Biomaterials xxx (2014) 1e12

Contents lists available at ScienceDirect

Biomaterials journal homepage: www.elsevier.com/locate/biomaterials

Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation Ming Lei a, b,1, Kun Li a, b,1, Bei Li b, Li-Na Gao a, c, Fa-Ming Chen a, c, *, Yan Jin b, c, ** a State Key Laboratory of Military Stomatology, Department of Periodontology & Biomaterials Unit, School of Stomatology, Fourth Military Medical University, Xi’an, PR China b State Key Laboratory of Military Stomatology, Research and Development Center for Tissue Engineering, Fourth Military Medical University, Xi’an, PR China c State Key Laboratory of Military Stomatology, Translational Research Team, School of Stomatology, Fourth Military Medical University, Xi’an, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 27 March 2014 Accepted 17 April 2014 Available online xxx

Mesenchymal stem cells (MSCs) isolated from human postnatal dental pulp and periodontal ligament (PDL) tissues can give rise to multilineage differentiation in vitro and generate related dental tissues in vivo. However, the cell properties of human dental pulp stem cells (DPSCs) and PDL stem cells (PDLSCs) after in vivo implantation remain largely unidentified. In this study, cells were re-isolated from in vivogenerated dental pulp-like and PDL-like tissues (termed re-DPCs and re-PDLCs, respectively) as a result of ectopic transplantation of human DPSC and PDLSC sheets. The cell characteristics in terms of colonyforming ability, cell surface antigens and multi-differentiation potentials were all evaluated before and after implantation. It was found that re-DPCs and re-PDLCs were of human and mesenchymal origin and positive for MSC markers such as STRO-1, CD146, CD29, CD90 and CD105; and, to some extent, re-DPCs could maintain their colony forming abilities. Moreover, both cell types were able to form mineral deposits and differentiate into adipocytes and chondrocytes; however, quantitative analysis and related gene expression determination showed that the osteo-/chondro-differentiation capabilities of re-DPCs and re-PDLCs were significantly reduced compared to those of DPSCs and PDLSCs, respectively (P < 0.05); re-PDLCs showed a greater reduction potential than re-DPCs. We conclude that DPSCs and PDLSCs may maintain their MSC characteristics after in vivo implantation and, compared to PDLSCs, DPSCs appear much more stable under in vivo conditions. These findings provide additional cellular and molecular evidence that supports expanding the use of dental tissue-derived stem cells in cell therapy and tissue engineering. Ó 2014 Elsevier Ltd. All rights reserved.

Keywords: Dental pulp stem cells Periodontal ligament stem cells Stem cell therapy Tissue engineering In vivo transplantation

1. Introduction In recent years, stem/progenitor cells have been characterized from a variety of dental-related tissues, such as gingiva [1],

* Corresponding author. State Key Laboratory of Military Stomatology, Department of Periodontology & Biomaterials Unit, School of Stomatology, Fourth Military Medical University, 145th West Chang-le Road, Xi’an 710032, PR China. Tel.: þ86 29 84776093; fax: þ86 29 84776096. ** Corresponding author. State Key Laboratory of Military Stomatology, Research and Development Center for Tissue Engineering, Fourth Military Medical University, 1st Kang-fu Road, Xi’an 710032, PR China. Tel.: þ86 29 84776472; fax: þ86 29 83218039. E-mail addresses: [email protected] (F.-M. Chen), [email protected] (Y. Jin). 1 These authors contributed equally to this manuscript.

periodontal ligament (PDL) [2], papilla [3], follicle [4] and, indeed, dental pulp of exfoliated deciduous (children’s) [5] and adult teeth [6], which represents a rich source of mesenchymal stem cells (MSCs) that are suitable for tissue engineering applications due to their accessibility and multilineage differentiation capacity [7e11]. In addition, dental stem cells display multifactorial advantages, such as a high proliferation rate, high viability and easy induction to distinct cell lineages [7,8]. Currently, dental stem cells are known to be of ectomesenchymal origin and are considered to share a common lineage of being derived from neural crest cells [9]. Most, if not all, dental stem cells identified thus far have generic MSC-like properties, including expression of marker genes and differentiation into mesenchymal cell lineages (osteoblasts, adipocytes and chondrocytes) in vitro and, to some extent, in vivo (reviewed in Refs. [8e11]). While extensive efforts have been and still are being made

http://dx.doi.org/10.1016/j.biomaterials.2014.04.071 0142-9612/Ó 2014 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

2

M. Lei et al. / Biomaterials xxx (2014) 1e12

to assess the potential of these cells in preclinical applications, two of them, PDL-derived stem cells [12] and dental pulp stem cells (DPSCs) [13], have already been tested as therapeutics in humans, although clinical trials have not been widely reported. The most striking feature of DPSCs and PDLSCs is their ability to regenerate dental pulp-like and PDL-like tissues in vivo, where the local microenvironment represents an important compartment for maintaining the stem cell status and regulating the balance between self-renewal and differentiation [9,10]. However, the capacity of dental stem cells to give rise to other cell lineages, such as osteogenic, chondrogenic, adipogenic, myogenic and neurogenic cells, suggests that they may have wider clinical applications [14]. It is, nevertheless, important to consider that, although the selfrenewal capability, multi-lineage differentiation capacity and clonogenic efficiency of DPSCs and PDLSCs have been welldemonstrated, their stem cell properties following in vivo transplantation remain largely unexplored. Interestingly, there is evidence implying that DPSCs and PDLSCs maintain self-renewal capability and multipotent potential and even undergo a long-term period of in vivo transplantation [15,16]. For instance, stromal-like cells were reestablished in culture from primary DPSC transplants and were able to generate dentin pulplike tissues when retransplanted into immunocompromised mice [15]. In a recent study, ovine PDLSCs were demonstrated to survive after 8 weeks of post-transplantation into immunodeficient mice. These cells exhibited an immunophenotype and multipotential capacity comparable to primary PDLSCs and displayed a capacity to form fibrous ligament structures and mineralized tissues associated with vasculature in vivo, albeit at diminished levels when compared with primary PDLSCs [16]. Although these findings indicate the stability of dental stem cells in an in vivo condition, at least to a certain degree, the stem cell properties of human DPSCs and PDLSCs before and following in vivo implantation have yet to be

contrastively evaluated. In the present study, we characterized cells obtained from in vivo-regenerated dental pulp-like tissues (reDPCs) and periodontal ligament (PDL)-like tissues (re-PDLCs) as a result of ectopic transplantation of human DPSC and PDLSC sheets, where originally obtained DPSCs and PDLSCs from human dental pulp or PDL tissue were used as matched controls for quantitative analysis at the cellular and molecular levels. 2. Materials and methods 2.1. Isolation of human DPSCs and PDLSCs Normal human third molars were collected from 3 adults (22e28 years of age) at the Dental and Alveolar Surgery Clinic, and the use of human tissue for research was approved by the Institutional Review Board (IRB) of the Fourth Military Medical University School of Stomatology. Dental pulp and PDL tissues were collected for patient-matched cell isolation and subsequent investigations; and human DPSCs and PDLSCs were cultured as previously described in the literature [17,18]. DPSCs and PDLSCs at passages P2eP5 were used for cell-pellet or cell-sheet production and subsequent transplantation. Meanwhile, portions of the original cell sources were stored in liquid nitrogen (170  C) for use as matched controls in subsequent, contrastive evaluations. 2.2. Transplantation and cell re-isolation The PDLSC cell sheets, DPSC cell pellets and human root canal fragments were obtained as previously reported [19]. The DPSC cell pellets were inserted into the root canal space of the fragments to observe pulp regeneration, while the PDLSC cell sheets were packaged around the outside of the root canal fragments to observe periodontal tissue regeneration. After culture in the minimal amount of cell culture medium for 24 h, DPSC and PDLSC transplants were transplanted subcutaneously into the dorsal surface of 6-week-old immunodeficient mice, respectively; and each mouse received two transplants (Fig. 1). The procedure was approved by the Animal Care Committee of Fourth Military Medical University and met the NIH guidelines for the care and use of laboratory animals. The transplants were harvested after 60 days for cell re-isolation. Meanwhile, hematoxylin and eosin (H&E) staining was used as evidence of new tissue regeneration. To obtain cells from in vivo-regenerated tissues, the newly formed tissues inside (dental pulp-like tissues) or outside (PDLlike tissues) the transplants were minced and digested in a solution of 3 mg/mL collagenase type I and 4 mg/mL dispase (Sigma, St Louis, MO, USA) for 1 h at 37  C.

Fig. 1. Schematic of the procedure for cell re-isolation from in vivo-regenerated dental tissues. Human dental pulp stem cells (DPSCs) and periodontal ligament stem cells (PDLSCs) were obtained and cultured to form cell pellets and cell sheets, respectively. Then, the DPSC pellets were inserted into the root canal space of the fragments, while the PDLSC sheets were packaged around the outside of the root canal fragments. After transplantation of the cell transplants into the dorsal surface of immunodeficient mice for 60 days, the transplants were harvested, and the regenerated dental pulp-like tissues and periodontal ligament-like tissues were harvested for cell re-isolation, termed re-DPCs and re-PDLCs, respectively.

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

M. Lei et al. / Biomaterials xxx (2014) 1e12 The procedure for cell re-isolation was similar to that for DPSC and PDLSC isolation [17,18]. Immunofluorescence assays were used to determine the origin of these cells. Briefly, the re-isolated cells from dental pulp-like tissues (termed re-DPCs) and PDLlike tissues (termed re-PDLCs) were seeded in 12-well plates at a density of 1  104 cells/well and cultured in complete medium. When the cells achieved 60%e 70% confluency, the medium was removed, and the cells were rinsed twice with phosphate buffered saline (PBS). Then, the cells were treated with 4% paraformaldehyde for 30 min at room temperature and washed again with PBS. Next, non-specific interactions were blocked with 10% normal goat serum. After 1 h, the cells were incubated with primary antibodies to the surface of intact mitochondria (Millipore, Billerica, MA, USA) or Vimentin (GeneTex, Taiwan) overnight at 4  C. The primary antibodies were detected with the corresponding, fluorescence-conjugated secondary antibodies. Nuclei were stained with Hoechst (Beyotime, Haimen, China). Cells were observed under an Olympus IX71 fluorescence microscope (Olympus, Japan), and all images were captured using a TH4-200 photo system (Olympus) at 200 magnification.

3

2.5. Real time-polymerase chain reaction (real time-PCR) analysis The re-DPCs (P4) and re-PDLCs (P4) were cultured separately in medium submitted to different conditions for Real time PCR analysis [21]; and matched DPSCs and PDLSCs were used as matched controls. For osteogenic differentiation, the primer sets for ALP, bone sialoprotein (BSP), collagen type I (COL-I), runt-related transcription factor 2 (RUNX2) and osteocalcin (OCN) were used following 7-day osteogenic induction. Meanwhile, the expression of peroxisome proliferatoractivated receptor g (PPARg) for adipogenic differentiation and aggrecan (ACAN) and collagen type II (COL-II) for chondrogenic differentiation was detected 7 days after adipogenic induction and at 10 days after chondrogenic induction [20]. Total RNA was extracted using TRIzol reagent (Invitrogen Life Technology, Carlsbad, CA, USA), and First-strand cDNA syntheses were performed according to the manufacturer’s protocol. The Quantitect SYBR Green Kit (Toyobo, Osaka, Japan) and the ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) were used for real-time PCR. The primer sequences used are shown in Table 1. GAPDH was used as an internal control. Amplification was performed using the following parameters for 40 cycles: 94 C for 3 min, 94 C for 15 s and 60 C for 30 s.

2.3. Characterization of re-DPCs and re-PDLCs 2.3.1. Single-cell cloning re-DPCs (P2) and re-PDLCs (P2) (1  103) were seeded into 75-cm2 cell culture dishes (Costar, Cambridge, MA, USA) and cultured in growth medium. Meanwhile, the stored DPSCs (P2) and PDLSCs (P2) were used as matched controls. The medium was changed every 2 days; and after incubation for 7 days, the cells were observed and photographed under a stereomicroscope. Aggregates of >50 cells were scored as a colony, and the experiment was repeated at least three times. 2.3.2. MTT assay To assess the proliferation ability of re-DPCs (P3) and re-PDLCs (P3), the cells were seeded at a density of 2  103 cells per well into 96-well plates. MTT [3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assays were carried out across an 8-day culture according to the cell proliferation kit protocol (Sigma). Absorbance values for each well were measured using a spectrophotometer at 490 nm, and the assay was repeated three times. Again, DPSCs (P3) and PDLSCs (P3) were used as matched controls. 2.3.3. Flow cytometric analysis The surface antigen expression of the re-DPCs and re-PDLCs was analyzed and compared to matched DPSCs and PDLSCs, respectively, using flow cytometric analysis. Briefly, 5  105 cells (P3) were harvested, washed with PBS containing 3% FBS and incubated with antibodies to human STRO-1, CD146, CD90, CD105, CD29, CD31 and CD45 (BD Bioscience, San Jose, CA, USA) at 4  C in the dark. Cell suspensions without antibodies served as matched controls. After 1 h, the cells were washed three times with PBS containing 3% FBS. Finally, 300 mL of PBS supplemented with 3% FBS was added to the tubes, and the samples were subjected to flow cytometric analysis using a Beckman Coulter Epics XL cytometer (Beckman Coulter, Fullerton, CA, USA).

2.6. Protein isolation and western blot analysis The expression of the cell-specific proteins of re-DPCs (P4) and re-PDLCs (P4) was analyzed by Western blot analysis [21]; and matched DPSCs and PDLSCs were used as matched controls. Briefly, total protein was lysed in RIPA buffer using a protease inhibitor cocktail (Sigma), and the protein concentration was measured using the BCA protein assay (Beyotime). Thirty micrograms of protein in each lane were separated on a Tris-glycine SDS-polyacrylamide gel (Invitrogen Life Technology, Carlsbad, CA, USA) and transferred onto a PVDF membrane (Millipore, Billerica, MA, USA), followed by blocking in 5% BSA for 2 h. The primary antibodies used in this work included COL-I, OCN (Millipore), RUNX2, BSP (Santa Cruz Biotechnology, CA. USA) and ALP (R&D Systems, MN, USA) for osteogenic differentiation; PPARg (Abcam, Cambridge, UK) for adipogenic differentiation; and ACAN and COL-II (Bioss, Beijing, China) for chondrogenic differentiation. Membranes were incubated with primary antibody overnight at 4  C and then with horseradish peroxidase (HRP)conjugated secondary antibodies to rabbit and mouse (Cowin Biotech Co., Ltd Beijing, China) at room temperature for 1 h. Immunodetection was performed using the Western-Light Chemiluminescent Detection System (Peiqing, Shanghai, China). 2.7. Statistical analysis All results are presented as the mean  standard deviation (SD) from at least three independent experiments for each cell line. Data were analyzed using Student’s t-test or two-way analysis of variance (ANOVA) with the SPSS software. P values less than 0.05 were considered statistically significant. For analysis of multiple groups, the P values were adjusted using the Bonferroni method.

3. Results 3.1. Origin of re-isolated cells

2.4. Pluripotent of re-DPCs and re-PDLCs The re-DPCs (P4) and re-PDLCs (P4) were seeded separately at a density of 3  104 cells per well in 12-well plates for the following testing; and matched DPSCs and PDLSCs were used as matched controls. To investigate the osteogenic potential, the cells were cultured in osteogenic induction medium supplemented with 100 nM dexamethasone, 0.2 mM ascorbic acid-2-phosphate and 10 mM bglycerophosphate (all from Sigma) when the cells achieved 60%e70% confluency. After 1-week culture, the cells were fixed with absolute alcohol for at least 0.5 h, and alkaline phosphatase (ALP) staining and ALP activity were carried out using an ALP kit according to the manufacturer’s protocol (Beyotime). In addition, after 4 weeks, the cultures were fixed with 4% paraformaldehyde for 30 min for Alizarin red staining, and the stained area of mineralized nodules per well was dissolved with hexadecylpyridinium chloride for quantitative analysis as previously described [20]. For cell adipogenic differentiation, the cells were cultured in adipo-inductive medium supplemented with 0.5 mM methylisobutylxanthine, 0.5 mM hydrocortisone and 60 mM indomethacin (all from Sigma) for 3 weeks. Then, the cultures were fixed with 4% polyoxymethylene for 30 min and stained with fresh Oil Red O solution (Sigma); lipid droplets were dissolved with isopropanol and absorbance was quantitatively measured at 560 nm for statistical analysis as previously described [20]. For cell chondrogenic differentiation, the cells were transferred into 15-mL polypropylene culture tubes and centrifuged at 800 rpm for 6 min to form a pellet at the bottom of the tube. After incubation in standard medium for 24 h, the pellets were incubated in chondro-inductive medium: high-glucose DMEM (Gibco BRL, Gaithersburg, MD, USA) containing 0.1 mM dexamethasone, 50 mg/mL L-ascorbic acid-2-phosphate (Sigma), 40 mg/mL of Lproline (Sigma), 1% insulin-transferring selenium (ITS þ premix; 100X) (Sigma), 15% FBS, 10 ng/mL transforming growth factor-b1 (CytoLab/PeproTech, Rehovot, Israel) and 2% Antibiotic-Antimycotic. Chondrogenesis was assayed by H&E staining after 8 weeks of chondrogenic induction [20].

Two months after transplantation into the mouse subcutaneous space, newly formed dentin pulp-like tissues and PDL-like tissues were harvested for cell re-isolation. Similar to DPSCs and PDLSCs, re-isolated cells from in vivo-regenerated tissues were capable of forming adherent, clonogenic cell clusters of firoblast-like cells with a typical fibroblastic spindle shape that positively interacted with the anti-human mitochondria antibody, indicating the obtained re-DPCs and re-PDLCs in the present study were of human origin. Meanwhile, the majority of the re-isolated cells positively interacted with the vimentin antibody, indicating their mesenchymal origin (Fig. 2). 3.2. Colony-forming ability and proliferation of re-DPCs and rePDLCs To identify the self-renewal potential of re-DPCs and re-PDLCs, the ability of colony-forming unit-fibroblast (CFU-F) formation and their proliferation profiles were determined. The main robust colony-forming ability of re-DPCs was shown, although there was a significant difference between that of DPSCs and re-DPCs (P < 0.05). However, in this particular study, re-PDLCs seemed to lose their ability to form colonies (Fig. 3A&B). All of the tested cells showed obvious proliferation activities, and the growth rates of re-isolated

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

4

M. Lei et al. / Biomaterials xxx (2014) 1e12

Table 1 Specific primer sequences used for real time-polymerase chain reaction analysis. Primes

Abbreviations

GenBank no.

Bone sialoprotein

BSP

NM_004967.3

Product size (bp) 96

Alkaline phosphatase

ALP

NM_000478.4

137

Runt-related transcription factor 2

RUNX2

NM_001024630.3

127

Osteocalcin

OCN

NM_199173.4

315

Collagen type I

COL1

NM_000088.3

95

Peroxisome proliferator

PPARg

NM_138712.3

134

Collagen type II

COL2

NM_001844.4

122

Aggrecan

ACAN

NM_001135.3

99

b-actin

N/A

NM_001101.3

188

Sequences Forward (50 e30 ): GGGCAGTAGTGACTCATCCGA Reverse (50 e30 ): TCTTCATTGTTTTCTCCTTCATTTG Forward (50 e30 ): CCTTGTAGCCAGGCCCATTG Reverse (50 e30 ): GGACCATTCCCACGTCTTCAC Forward (50 e30 ): CACTGGCGCTGCAACAAGA Reverse (50 e30 ): CATTCCGGAGCTCAGCAGAATAA Forward (50 e30 ): CATGAGAGCCCTCACA Reverse (50 e30 ): AGAGCGACACCCTAGAC Forward (50 e30 ): CCAGAAGAACTGGTACATCAGCAA Reverse (50 e30 ): CGCCATACTCGAACTGGAATC Forward (50 e30 ): CCACTTTGATTGCACTTTGGTACTCTTG Reverse (50 e30 ): CTTCACTACTGTTGACTTCTCCAGCATTTC Forward (50 e30 ): CCAGTTGGGAGTAATGCAAGGA Reverse (50 e30 ): ACACCAGGTTCACCAGGTTCA Forward (50 e30 ): AGCAGTCACACCTGAGCAGCA Reverse (50 e30 ): GTTCAGGCCGATCCACTGGTA Forward (50 e30 ): TGGCACCCAGCACAATGAA Reverse (50 e30 ): CTAAGTCATAGTCCGCCTAGAAGCA

3.4. Multipotentiality of re-DPCs and re-PDLCs

showed that re-DPCs and re-PDLCs had decreased ALP activity compared to that of DPSCs (P < 0.05) and PDLSCs (P < 0.01), respectively. After the cells were cultured in osteogenic medium for 4 weeks, Alizarin red staining revealed that all four testing groups formed mineralized nodules (Fig. 6A). Quantitation analysis showed that the ability of re-DPCs and re-PDLCs to form mineralized nodules decreased compared to that of DPSCs (no significant difference, P > 0.05) and PDLSCs (significant difference, P < 0.001), respectively (Fig. 6B). Real-time PCR and Western blot analysis further indicated decreased expression of ALP, COL-I and RUNX2 in the re-DPC and re-PDLC populations, compared to DPSCs and PDLSCs, respectively (P < 0.05 or P < 0.01). There was no significant change in the mRNA and protein levels of BSP and OCN in DPSCs and re-DPCs, but a significant decrease in PDLSCs to re-PDLCs was observed (P < 0.05 or P < 0.001) (Fig. 7).

3.4.1. Osteogenic potential After cells were cultured in osteogenic-inducing medium for 7 days, ALP staining (Fig. 5A) and ALP quantity (Fig. 5B) analysis

3.4.2. Adipogenic and chondrogenic potential Following 4-week adipogenic induction, intracellular lipid vacuoles appeared in all tested cells, as confirmed by Oil Red O staining

cells were significantly reduced compared to the originally isolated cells (Fig. 3C&D). 3.3. Cell-surface markers of the re-DPCs and re-PDLCs DPSCs and PDLSCs positively expressed MSC markers, such as STRO-1, CD146, CD29, CD105 and CD90, while negatively expressing hematopoietic cell markers, such as CD34 and CD45. Similar to DPSCs, re-DPCs also positively expressed MSC markers, but their expression of STRO-1 and CD146 was much lower than that of DPSCs (P < 0.05). The expression of all MSC markers, excluding CD90, in re-PDLCs was significantly lower compared with PDLSCs (P < 0.05) (Fig. 4).

Fig. 2. Primary cell growth from human dental pulp tissues and periodontal ligament (PDL) tissues, termed dental pulp stem cells (DPSCs) and PDL stem cells (PDLSCs), respectively, as well as from in vivo-regenerated dental pulp-like tissues (re-DPCs) and (PDL)-like tissues (re-PDLCs). All of these cells positively interacted with the anti-human mitochondria and vimentin antibodies; indicating those cells were all of human mesenchymal origin.

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

M. Lei et al. / Biomaterials xxx (2014) 1e12

5

Fig. 3. Colony-forming unit-fibroblast (CFU-F) assays and proliferation activity of cells from in vivo-regenerated dental pulp-like tissues (re-DPCs) and periodontal ligament (PDL)like tissues (re-PDLCs); human dental pulp stem cells (DPSCs) and PDL stem cells (PDLSCs) served as matched controls. (A) Representative images showing the colonies formed by DPSCs, re-DPCs, PDLSCs and re-PDLCs. (B) The graphs show a statistically significant difference in the total colony number among the indicated groups, where values are represented as the mean  standard deviation. (C) Representative images of a single colony-forming unit of DPSCs, re-DPCs, PDLSCs and re-PDLCs when observed using a stereomicroscope. (D) Cell proliferation profiles determined by MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assays. *P < 0.05, **P < 0.01 and ***P < 0.001 indicate significant differences between two matched groups.

(Fig. 8A). Quantitative analysis showed no significant difference between the adipogenic capabilities of re-isolated cells and their original stem cells before transplantation (P > 0.05) (Fig. 8B). This was further demonstrated by analyzing the mRNA and protein levels of PPARg, which is an adipocyte-specific transcript (P > 0.05) (Fig. 8C). The chondrogenesis of all tested cells was examined using H&E staining to detect the cartilage-like cells, and the results indicated that re-DPCs and re-PDLCs could differentiate into chondrocytes, similar to DPSCs and PDLSCs (Fig. 9A). Furthermore, real-time PCR

and Western blot analysis revealed that the expression of COL-II was lower in re-DPCs than in DPSCs (P < 0.01), while ACAN and COL-II were significantly reduced in re-PDLCs compared to PDLSCs (P < 0.01 or P < 0.001) (Fig. 9BeD). 4. Discussion Recent advances in stem cell biology together with bio-inspired materials design have offered new insights into the understanding of wound healing and expand opportunities for the therapeutic

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

6 M. Lei et al. / Biomaterials xxx (2014) 1e12

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

Fig. 4. Cell surface markers of cells obtained from in vivo-regenerated dental pulp-like tissues (re-DPCs) and periodontal ligament (PDL)-like tissues (re-PDLCs); human dental pulp stem cells (DPSCs) and PDL stem cells (PDLSCs) served as matched controls. (A) Representative figures of cytometric flow tests. (B) Percentage of positive expression (mean data).

M. Lei et al. / Biomaterials xxx (2014) 1e12

7

Fig. 5. The alkaline phosphatase (ALP) activity of cells from in vivo-regenerated dental pulp-like tissues (re-DPCs) and periodontal ligament (PDL)-like tissues (re-PDLCs); human dental pulp stem cells (DPSCs) and PDL stem cells (PDLSCs) served as matched controls. (A) Representative images of ALP staining. (B) Data analysis of ALP activity. *P < 0.05 and **P < 0.01 indicate significant differences between two matched groups.

application of tissue engineering [22e24]. Multipotent MSCs and MSC-like cells, first from bone marrow and subsequently from a variety of other human tissues, have now been discovered and characterized based on the general criteria established for bone marrow MSCs (BMMSCs) [14]. It is well recognized that MSCs from adipose tissues and umbilical cord blood are promising, multipotent MSC alternatives to BMMSCs [25,26]. Of note, all of these MSCs display multidifferentiation potential with the capacity to at least give rise to osteogenic, adipogenic and chondrogenic lineages. Under certain conditions, these MSC-like populations are also capable of giving rise to other lineages, such as ones that are myogenic, tenogenic and neurogenic. In pursuit of MSC-like populations that reside in specialized tissues in the body, dental tissuederived MSC-like cells, as well as many other stem cells that have been identified in the past decades (reviewed in Refs. [27e29]), have been isolated and characterized. The first type of dental tissue-derived stem cell was identified from human dental pulp tissue and was termed DPSCs [6]. Thereafter, several other types of dental stem cells were isolated and characterized in succession, such as stem cells from exfoliated deciduous teeth (SHED) [5], PDLSCs [2] and stem cells from apical papilla (SCAP) [3] and follicles [4]; the latter have generally been termed ‘dental follicle precursor cells’ (DFPCs). Dental stem cells can be obtained with ease from medical waste, such as teeth extracted for orthodontic or impaction reasons, and exfoliated deciduous teeth, making them an attractive source of autologous stem cells for use in tissue engineering and regenerative therapies [10]. However, the stem cell properties of and the precise relationship among these different dental tissuederived stem cell populations are either unexplored or partially explored. Similar to BMMSCs, dental stem cells, such as DPSCs and PDLSCs, can give rise to osteogenic, adipogenic and chondrogenic lineages. This multi-lineage capability of all cell types isolated from either original dental tissues (i.e., DPSCs and PDLSCs) or in vivo regenerated tissues (i.e., re-DPCs and re-PDLCs) has been demonstrated in the present study. It is, nevertheless, important to consider that,

although different types of dental tissue-derived MSCs share several common multidifferentiation potentials, differences have been noted between different stem cell types [30]. Interestingly, ex vivo-expanded SHED were found to have a high proliferative capacity and express vascular-related markers, in addition to their capability of generating robust amounts of bone in vivo [5,31,32]. Recently, highly pure subsets with mesenchymal properties have been harvested from deciduous or permanent PDL tissue, and both cell types present phenotypic dissimilarities, although cells from deciduous PDL possess a higher ability to differentiate into adipocyte-like cells, rather than osteoblast-like cells [33]. Upon application, DPSCs appear to be more committed to odontogenic rather than osteogenic development [14,34]; although, in recent years, DPSCs have also been introduced as a promising cell type for bone tissue engineering [13,35]. Moreover, it seems that PDLSCs are more likely able to generate a cementum/PDL-like structure following ectopic transplantation into immunocompromised mice [2,36]; and, in periodontal defect animal models, PDLSCs showed the best regenerating capacity of PDL, alveolar bone, and cementum when compared to other intraoral or extraoral stem cells [37,38]. However, the underlying mechanisms that determine the lineagespecific differentiation of dental MSCs and its regulation remain unknown. New insights into the biology of these dental stem cells, in particular within an in vivo milieu, is a prerequisite to developing effective, cell-based therapies and understanding the extent of their efficacy for tissue engineering and regenerative medicine. Of note, the ability of stem cells to maintain their self-renewal and multi-lineage differentiation potential in vivo is of great importance to ensure effective tissue regeneration [15,16]. Recent evidence suggests that a number of factors, including the ability of MSCs to undergo self-renewal, determine the cell capacity for longterm survival and participation in tissue formation following in vivo transplantation [14e16]. In this regard, DPSCs have been shown to exhibit a capacity to undergo self-renewal, as assessed by their capability for multi-lineage differentiation and the ability to regenerate dentin pulp-like complexes over serial transplantations

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

8

M. Lei et al. / Biomaterials xxx (2014) 1e12

Fig. 6. Osteogenic differentiation of cells from in vivo-regenerated dental pulp-like tissues (re-DPCs) and periodontal ligament (PDL)-like tissues (re-PDLCs); human dental pulp stem cells (DPSCs) and PDL stem cells (PDLSCs) served as matched controls. (A) Representative images of mineralized nodules formed after 4 weeks of osteogenic induction (stained with Alizarin Red). (B) The total areas of mineralized nodules in different groups were quantified using hexadecylpyridinium chloride. ***P < 0.001 indicates a significant difference between two matched groups.

in vivo [15]. In a recent similar study, PDLSCs were shown to exhibit self-renewal capacity in a serial xenogeneic transplantation model and contribute to long-term periodontal tissue regeneration following implantation of autologous PDLSCs into a periodontal defect model [16]. These two reports demonstrate the self-renewal capacity of DPSCs and PDLSCs, for the first time, using serial xenogeneic transplants. However, in both studies, the stem cell properties, in terms of their colony-forming ability, cell surface antigens and multi-differentiation potentials, were not contrastively evaluated before and after implantation. Normally, stem cells generate cell types of the tissue in which they reside. However, stem cells from one tissue could generate cell types of a completely different tissue under in vitro or in vivo induction. It is therefore believed that DPSCs and PDLSCs are capable of responding to specific environmental signals to generate new stem cells or select a particular differentiation program [15,16]. In the present study, we found that re-DPCs and re-PDLCs from regenerated tissue in immunocompromised mice were of human and mesenchymal origin, suggesting that these cells may belong to a population of more primitive reserve cells that are responsible for the maintenance of stem cell properties or are indeed daughter cells that are generated by the originally transplanted stem cells [14]. Both cells were positive for MSC markers such as STRO-1, CD146, CD29, CD90

and CD105, and, to some extent, re-DPCs maintained their colony forming abilities. In this particular study, we found that re-PDLCs lost their clonogenic efficiency, as determined by CFU-F formation (Fig. 3). However, there is currently no consensus regarding the effect of in vivo transplantation on this specific MSC function. An important finding is that we found that both cells were able to form mineral deposits and differentiate into adipocytes and chondrocytes, although quantitative analysis and the related gene expression determination showed that the osteo-/chondro-differentiation capabilities of re-DPCs and re-PDLCs were significantly reduced compared to those of DPSCs and PDLSCs, respectively (P < 0.05); re-PDLCs showed a greater reduction potential compared to re-DPCs. Our findings have provided additional evidence to that found in the literature [15,16] suggesting that transplanted DPSCs or PDLSCs can not only give rise to a specific lineage (odontoblasts or fibroblasts, respectively) but also reside in the regenerated pulp-like or PDL-like tissue as quiescent or daughter stem cells, even at 8 weeks post-transplantation. Comparative in vitro characterization of primary stem cells (i.e., DPSCs and PDLSCs) and cells isolated from ectopic transplants (i.e., re-DPCs and re-PDLCs) illustrated decreased cell capacities in terms of osteogenic and chondrogenic differentiation. Furthermore, realtime PCR and Western blot analysis indicated decreased expression

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

M. Lei et al. / Biomaterials xxx (2014) 1e12

9

Fig. 7. The osteogenic-relative markers alkaline phosphatase (ALP), bone sialoprotein (BSP), collagen type I (COL-I), runt-related transcription factor 2 (RUNX2) and osteocalcin (OCN) in cells from in vivo-regenerated, dental pulp-like tissues (re-DPCs) and periodontal ligament (PDL)-like tissues (re-PDLCs); human dental pulp stem cells (DPSCs) and PDL stem cells (PDLSCs) served as matched controls. (A) Western blot analysis and scanning densitometer images. (B) Analysis using real-time polymerase chain reaction (RT-PCR). *P < 0.05, **P < 0.01 and ***P < 0.001 indicate significant differences between two matched groups.

of ALP, COL-I, COL-II and RUNX2 in re-DPC and re-PDLC populations, compared to DPSCs and PDLSCs, respectively (P < 0.05 or P < 0.01). In addition, a significant decrease was found in the mRNA and protein levels of BSP, OCN and ACAN from PDLSCs to re-PDLCs (P < 0.05 or P < 0.001) (Figs. 5e7 and 9). These findings suggest that at least a small proportion of DPSCs and PDLSCs may retain their MSC properties following extensive expansion ex vivo and longterm transplantation in vivo, as they contributed to such multilineage differentiation. These results, combined with that of published data related to the contribution of re-isolated cells to tissue regrowth [15,16], imply that a subset of implanted DPSCs and PDLSCs remained in the undifferentiated progenitor state, maintained an immature MSC phenotype and committed to a population of MSC daughter cells, which is indicative of a hierarchical compartment of progenitor populations, while a subset of implanted DPSCs and PDLSCs terminally differentiated into functional cells of a specific lineage that were responsible for the resultant ectopic tissue formation post-stem-cell transplantation. Despite their remaining multipotency in vitro, a reduction in the number of STRO-1- and CD146-positive cells was evident in reDPCs, and excluding CD90, all of the tested MSC markers in rePDLCs was significantly lower when compared to those of PDLSCs (Fig. 4). Moreover, re-PDLCs are incapable of forming colonies, as was observed in the present study (Fig. 3), but the clonogenic efficiency of re-isolated cells must be re-evaluated in a large number of dental tissue-derived cell sources. Nevertheless, our findings suggest that long-term, ex vivo expansion of DPSCs and PDLSCs had a negative impact on their survival and self-renewal capacities, which subsequently altered the developmental potential of the

remaining progeny. The regenerative potential of DPSCs and PDLSCs (autogenic or allogeneic) has previously been shown in preclinical large-animal studies and, recently, in human clinical pilot trials for bone and periodontal regeneration [12,13,37e44]. However, most studies have failed to identify the cell populations post-transplantation and their direct contribution to tissue regeneration. To further characterize the long-term survival and differentiation potential of DPSCs and PDLSCs, we transplanted ex vivoexpanded human DPSCs and PDLSCs into immunocompromised mice to regenerate dental pulp- or PDL-like tissue. Then, the regenerated tissues were harvested for cell re-isolation, and the cell properties in terms of colony-forming ability, cell surface antigens and differentiation potentials were all evaluated. Our results showed that DPSCs and PDLSCs may maintain their MSC properties following in vivo implantation, and, compared to PDLSCs, that DPSCs appear much more stable under in vivo conditions. However, the underlying mechanisms that determine the reduction of lineage-specific differentiation of PDLSCs are still unclear.

5. Conclusions Our data provide evidence that DPSCs and PDLSCs are both highly potent cell populations that have the ability to differentiate into specialized lineages toward functional tissue regeneration. Importantly, these cells show the potential to retain their stem celllike properties after long-term in vivo transplantation. These findings provide new insights into the characteristics of DPSCs and PDLSCs and illustrate additional cellular and molecular evidence

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

10 M. Lei et al. / Biomaterials xxx (2014) 1e12

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

Fig. 8. Adipogenic differentiation of cells from in vivo-regenerated dental pulp-like tissues (re-DPCs) and periodontal ligament (PDL)-like tissues (re-PDLCs); human dental pulp stem cells (DPSCs) and PDL stem cells (PDLSCs) served as matched controls. (A) Representative images of intracellular lipid vacuoles that appeared in all tested cells, as confirmed by Oil Red O staining. (B) The total areas of lipid vacuole formation were quantitatively measured using isopropanol and subsequently subjected to statistical analysis. (C) The peroxisome proliferator-activated receptor g (PPARg) level examined by Western blot analysis and scanning densitometer (b-actin was used as the internal control). (D) The expression of an adipogenesis-related gene (PPARg) detected by real-time polymerase chain reaction (RT-PCR).

M. Lei et al. / Biomaterials xxx (2014) 1e12

11

Fig. 9. Chondrogenic differentiation of cells from in vivo-regenerated dental pulp-like tissues (re-DPCs) and periodontal ligament (PDL)-like tissues (re-PDLCs); human dental pulp stem cells (DPSCs) and PDL stem cells (PDLSCs) served as matched controls. (A) Representative images of all tested cells after chondrogenic induction for 8 weeks, as observed by Hematoxylin and eosin (H&E) staining. (B) The aggrecan (ACAN) level examined by Western blot analysis and a scanning densitometer (b-actin was used as the internal control). (C) and (D) Chondrogenic differentiation-related genes, i.e., Aggrecan (ACAN) and Collagen type II (COL2), analyzed by real-time polymerase chain reaction (RT-PCR). **P < 0.01 and ***P < 0.001 indicate significant differences between the two matched groups.

that supports expanding the use of dental tissue-derived stem cells in stem cell therapy and tissue engineering. Acknowledgments This research is partially supported by the Program for New Century Excellent Talents in University (NCET-12-1005) for Dr. F.-M. Chen as well as by the National Natural Science Foundation of China (31170912) and Program for Changjiang Scholars and Innovative Research Team in University (IRT13051). References [1] Zhang Q, Shi S, Liu Y, Uyanne J, Shi Y, Shi S, et al. Mesenchymal stem cells derived from human gingiva are capable of immunomodulatory functions and ameliorate inflammation-related tissue destruction in experimental colitis. J Immunol 2009;183(12):7787e98. [2] Seo BM, Miura M, Gronthos S, Bartold PM, Batouli S, Brahim J, et al. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet 2004;364(9429):149e55. [3] Ikeda E, Hirose M, Kotobuki N, Shimaoka H, Tadokoro M, Maeda M, et al. Osteogenic differentiation of human dental papilla mesenchymal cells. Biochem Biophys Res Commun 2006;342(4):1257e62. [4] Morsczeck C, Götz W, Schierholz J, Zeilhofer F, Kühn U, Möhl C, et al. Isolation of precursor cells (PCs) from human dental follicle of wisdom teeth. Matrix Biol 2005;24(2):155e65.

[5] Miura M, Gronthos S, Zhao M, Lu B, Fisher LW, Robey PG, et al. SHED: stem cells from human exfoliated deciduous teeth. Proc Natl Acad Sci U S A 2003;100(10):5807e12. [6] Gronthos S, Mankani M, Brahim J, Robey PG, Shi S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 2000;97(25):13625e30. [7] Kim BC, Bae H, Kwon IK, Lee EJ, Park JH, Khademhosseini A, et al. Osteoblastic/ cementoblastic and neural differentiation of dental stem cells and their applications to tissue engineering and regenerative medicine. Tissue Eng Part B Rev 2012;18(3):235e44. [8] Volponi AA, Pang Y, Sharpe PT. Stem cell-based biological tooth repair and regeneration. Trends Cell Biol 2010;20(12):715e22. [9] Mantesso A, Sharpe P. Dental stem cells for tooth regeneration and repair. Expert Opin Biol Ther 2009;9(9):1143e54. [10] Chen FM, Sun HH, Lu H, Yu Q. Stem cell-delivery therapeutics for periodontal tissue regeneration. Biomaterials 2012;33(27):6320e44. [11] Lu H, Xie C, Zhao YM, Chen FM. Translational research and therapeutic applications of stem cell transplantation in periodontal regenerative medicine. Cell Transplant 2013;22(2):205e29. [12] Feng F, Akiyama K, Liu Y, Yamaza T, Wang TM, Chen JH, et al. Utility of PDL progenitors for in vivo tissue regeneration: a report of 3 cases. Oral Dis 2010;16(1):20e8. [13] d’Aquino R, De Rosa A, Lanza V, Tirino V, Laino L, Graziano A, et al. Human mandible bone defect repair by the grafting of dental pulp stem/progenitor cells and collagen sponge biocomplexes. Eur Cell Mater 2009;18:75e83. [14] Huang GT, Gronthos S, Shi S. Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine. J Dent Res 2009;88(9):792e806. [15] Gronthos S, Brahim J, Li W, Fisher LW, Cherman N, Boyde A, et al. Stem cell properties of human dental pulp stem cells. J Dent Res 2002;81(8):531e5.

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

12

M. Lei et al. / Biomaterials xxx (2014) 1e12

[16] Menicanin D, Mrozik KM, Wada N, Marino V, Shi S, Bartold PM, et al. Periodontal-ligament-derived stem cells exhibit the capacity for long-term survival, self-renewal, and regeneration of multiple tissue types in vivo. Stem Cells Dev 2014;23(9):1001e11. [17] Chen B, Sun HH, Wang HG, Kong H, Chen FM, Yu Q. The effects of human platelet lysate on dental pulp stem cells derived from impacted human third molars. Biomaterials 2012;33(20):5023e35. [18] Zhang J, An Y, Gao LN, Zhang YJ, Jin Y, Chen FM. The effect of aging on the pluripotential capacity and regenerative potential of human periodontal ligament stem cells. Biomaterials 2012;33(29):6974e86. [19] Na S, Zhang H, Huang F, Wang W, Ding Y, Li D, et al. Regeneration of dental pulp/dentine complex with a three-dimensional and scaffold-free stem-cell sheet-derived pellet. J Tissue Eng Regen Med; 2013. http://dx.doi.org/ 10.1002/term.1686. [20] Yang H, Gao LN, An Y, Hu CH, Jin F, Zhou J, et al. Comparison of mesenchymal stem cells derived from gingival tissue and periodontal ligament in different incubation conditions. Biomaterials 2013;34(29):7033e47. [21] Gao LN, An Y, Lei M, Li B, Yang H, Lu H, et al. The effect of the coumarin-like derivative osthole on the osteogenic properties of human periodontal ligament and jaw bone marrow mesenchymal stem cell sheets. Biomaterials 2013;34(38):9937e51. [22] Chen FM, Zhang M, Wu ZF. Toward delivery of multiple growth factors in tissue engineering. Biomaterials 2010;31(24):6279e308. [23] Chen FM, Wu LA, Zhang M, Zhang R, Sun HH. Homing of endogenous stem/ progenitor cells for in situ tissue regeneration: promises, strategies, and translational perspectives. Biomaterials 2011;32(12):3189e209. [24] Chen FM, Zhao YM, Jin Y, Shi S. Prospects for translational regenerative medicine. Biotechnol Adv 2012;30(3):658e72. [25] Mareschi K, Biasin E, Piacibello W, Aglietta M, Madon E, Fagioli F. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica 2001;86(10):1099e100. [26] Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, et al. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 2001;7(2):211e28. [27] Baksh D, Song L, Tuan RS. Adult mesenchymal stem cells: characterization, differentiation, and application in cell and gene therapy. J Cell Mol Med 2004;8(3):301e16. [28] Porada CD, Zanjani ED, Almeida-Porad G. Adult mesenchymal stem cells: a pluripotent population with multiple applications. Curr Stem Cell Res Ther 2006;1(3):365e9. [29] Kolf C, Cho E, Tuan R. Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation. Arthritis Res Ther 2007;9(1):204. [30] Mrozik KM, Zilm PS, Bagley CJ, Hack S, Hoffmann P, Gronthos S, et al. Proteomic characterization of mesenchymal stem cell-like populations derived from ovine periodontal ligament, dental pulp, and bone marrow: analysis of differentially expressed proteins. Stem Cells Dev 2010;19(10):1485e99.

[31] Seo BM, Sonoyama W, Yamaza T, Coppe C, Kikuiri T, Akiyama K, et al. SHED repair critical-size calvarial defects in mice. Oral Dis 2008;14(5):428e34. [32] Zheng Y, Liu Y, Zhang CM, Zhang HY, Li WH, Shi S, et al. Stem cells from deciduous tooth repair mandibular defect in swine. J Dent Res 2009;88(3): 249e54. [33] Silvério KG, Rodrigues TL, Coletta RD, Benevides L, Da Silva JS, Casati MZ, et al. Mesenchymal stem cell properties of periodontal ligament cells from deciduous and permanent teeth. J Periodontol 2010;81(8):1207e15. [34] Ravindran S, Huang CC, George A. Extracellular matrix of dental pulp stem cells: applications in pulp tissue engineering using somatic MSCs. Front Physiol 2014;4:395. [35] d’Aquino R, Graziano A, Sampaolesi M, Laino G, Pirozzi G, De Rosa A, et al. Human postnatal dental pulp cells co-differentiate into osteoblasts and endotheliocytes: a pivotal synergy leading to adult bone tissue formation. Cell Death Differ 2007;14(6):1162e71. [36] Yang ZH, Zhang XJ, Dang NN, Ma ZF, Xu L, Wu JJ, et al. Apical tooth germ cellconditioned medium enhances the differentiation of periodontal ligament stem cells into cementum/periodontal ligament-like tissues. J Periodontal Res 2009;44(2):199e210. [37] Park JY, Jeon SH, Choung PH. Efficacy of periodontal stem cell transplantation in the treatment of advanced periodontitis. Cell Transplant 2011;20(2):271e 85. [38] Tsumanuma Y, Iwata T, Washio K, Yoshida T, Yamada A, Takagi R, et al. Comparison of different tissue-derived stem cell sheets for periodontal regeneration in a canine 1-wall defect model. Biomaterials 2011;32(25): 5819e25. [39] Liu Y, Zheng Y, Ding G, Fang D, Zhang C, Bartold PM, et al. Periodontal ligament stem cell-mediated treatment for periodontitis in miniature swine. Stem Cells 2008;26(4):1065e73. [40] Ding G, Liu Y, Wang W, Wei F, Liu D, Fan Z, et al. Allogeneic periodontal ligament stem cell therapy for periodontitis in swine. Stem Cells 2010;28(10): 1829e38. [41] Mrozik KM, Wada N, Marino V, Richter W, Shi S, Wheeler DL, et al. Regeneration of periodontal tissues using allogeneic periodontal ligament stem cells in an ovine model. Regen Med 2013;8(6):711e23. [42] Khorsand A, Eslaminejad MB, Arabsolghar M, Paknejad M, Ghaedi B, Rokn AR, et al. Autologous dental pulp stem cells in regeneration of defect created in canine periodontal tissue. J Oral Implantol 2013;39(4):433e43. [43] Moshaverinia A, Chen C, Xu X, Akiyama K, Ansari S, Zadeh HH, et al. Bone regeneration potential of stem cells derived from periodontal ligament or gingival tissue sources encapsulated in RGD-modified alginate scaffold. Tissue Eng Part A 2014;20(3e4):611e21. [44] Iwasaki K, Komaki M, Yokoyama N, Tanaka Y, Taki A, Honda I, et al. Periodontal regeneration using periodontal ligament stem cell-transferred amnion. Tissue Eng Part A 2014;20(3e4):693e704.

Please cite this article in press as: Lei M, et al., Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation, Biomaterials (2014), http://dx.doi.org/10.1016/j.biomaterials.2014.04.071

Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation.

Mesenchymal stem cells (MSCs) isolated from human postnatal dental pulp and periodontal ligament (PDL) tissues can give rise to multilineage different...
6MB Sizes 0 Downloads 6 Views