568373
research-article2015
IJLXXX10.1177/1534734614568373The International Journal of Lower Extremity WoundsWu et al
Basic and Experimental Research
Mesenchymal Stem Cells Suppress Fibroblast Proliferation and Reduce Skin Fibrosis Through a TGF-β3-Dependent Activation
The International Journal of Lower Extremity Wounds 2015, Vol. 14(1) 50–62 © The Author(s) 2015 Reprints and permissions: sagepub.com/journalsPermissions.nav DOI: 10.1177/1534734614568373 ijl.sagepub.com
Yan Wu, PhD1,2,3, Yan Peng, MD4, Dongyun Gao, MM5, Changjiang Feng, MD6, Xiaohuan Yuan, PhD1, Houzhong Li, MM1, Ying Wang, MD1, Lan Yang, MM1, Sha Huang, PhD2,3, and Xiaobing Fu, PhD2,3
Abstract Recent studies showed that transplantation of mesenchymal stem cells (MSCs) significantly decreased tissue fibrosis; however, little attention has been paid to its efficacy on attenuating skin fibrosis, and the mechanism involved in its effect is poorly understood. In this work, we investigated the effects of MSCs on keloid fibroblasts and extracellular matrix deposition through paracrine actions and whether the antifibrotic properties of MSCs involved transforming growth factorβ (TGF-β)-dependent activation. In vitro experiments showed that conditioned media (CM) from MSCs decreased viability, a-smooth muscle actin expression, and collagen secretion of human keloid fibroblasts. In addition, TGF-β3 secreted by MSCs was expressed at high level under inflammatory environment, and blocking the activity of TGF-β3 apparently antagonized the suppressive activity of MSC CM, which demonstrated that TGF-β3 played a preponderant role in preventing collagen accumulation. In vivo studies showed that MSC CM infusion in a mouse dermal fibrosis model induced a significant decrease in skin fibrosis. Histological examination of tissue sections and immunohistochemical analysis for α-smooth muscle actin revealed that TGF-β3 of CM-mediated therapeutic effects could obviously attenuate matrix production and myofibroblast proliferation and differentiation. These findings suggest that TGF-β3 mediates the attenuating effect of MSCs on both the proliferation and extracellular matrix production of human keloid fibroblasts and decreases skin fibrosis of mouse model, thus providing new understanding and MSC-based therapeutic strategy for cutaneous scar treatment. Keywords mesenchymal stem cells, paracrine, transforming growth factor-beta, skin fibrosis When skin is severely damaged through both surgical and nonsurgical injuries, the injured tissue seems to be limited in its ability to repair itself. The cutaneous wound healing process may give rise to tissue repair that is severely dysregulated and contribute to scar or fibrosis that is composed of excess extracellular matrix (ECM) in the place of the normal dermal tissue,1,2 which remains a challenging issue in clinic. Termination of the fibrotic response to the injury and pathological condition seems to be associated with myofibroblast apoptosis3; however, in most cases, fibroblasts maintain their profibrotic properties as well as actively participate in the progressive accumulation of ECM proteins in the dermis and subcutaneous tissues and pathological skin remodeling.4,5 Therapeutic strategies that regulate fibroblast activity could be a promising method to prevent fibrosis progressing toward skin damage. For this purpose, cell-mediated therapy has been proposed as an attractive alternative to currently available pharmacological approaches. In all of cell types attainable for cell therapy, bone marrow–derived mesenchymal stem cells (BM-MSCs)
appear to be especially interesting due to some of its features. The beneficial effects of MSC administration can be ascribed in part to their paracrine activity.6-8 Several recent 1
Mudanjiang Medical College, Mudanjiang, People’s Republic of China The First Affiliated Hospital, General Hospital of PLA, Beijing, People’s Republic of China 3 General Hospital of PLA, Beijing, People’s Republic of China 4 The University of Hong Kong, Hong Kong SAR, People’s Republic of China 5 Dongtai People’s Hospital, Dongtai, People’s Republic of China 6 Peking University People’s Hospital, Beijing, People’s Republic of China 2
Corresponding Authors: Sha Huang, Key laboratory of wound repair and regeneration of PLA, the First Affiliated Hospital, General Hospital of PLA 51 Fu Cheng Road, Beijing 100048 P. R. China. Email: [email protected] Yan Wu, Heilongjiang Key Laboratory of Anti-fibrosis Biotherapy, Mudanjiang Medical College, 3 Tong Xiang Street, Ai Min District, Mudanjiang 157000 P. R. China. Email: [email protected]
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
51
Wu et al Table 1. Human Gene Primers for Real-Time Polymerase Chain Reaction in This Study. Primer Sequence Target TGF-β1 TGF-β2 TGF-β3 Type I collagen α-SMA GAPDH
Forward
Reverse
Product Size (bp)
GCCAGAGTGGTTATCTTTTGATG CGGAGGTGATTTCCATCTACA TGAGTGGCTGTTGAGAAGAGAG CCTGGAAAGAATGGAGATGATG GCTGTTTTCCCATCCATTGT GGTGAAGGTCGGTGTGAACG
AGTGTGTTATCCCTGCTGTCAC GGCGGCATGTCTATTTTGTAA GAGGATTAGATGAGGGTTGTGG ATCCAAACCACTGAAACCTCTG CTCTTTTGCTCTGTGCTTCGT CTCGCTCCTGGAAGATGGTG
120 136 214 147 103 233
Abbreviations: α-SMA, α-smooth muscle actin; GAPDH, glyceraldehyde-3-phosphate-dehydrogenase; TGF-β, transforming growth factor-β.
studies have shown that MSC graft can significantly decrease fibrosis in the heart,9,10 lung,11,12 liver,13,14 kidney,15,16 and cornea.17 However, for skin fibrosis, there is yet no related evidence, and it is not known whether the efficacy may involve decrease of proliferation and collagen expression of skin fibroblasts mediated by MSC paracrine factors. Furthermore, although the molecular mechanisms reducing tissue fibrosis are still poorly understood, the transforming growth factor-β (TGF-β) family may be involved. Particularly, TGF-β3 plays a crucial role in reducing scar of adult wounds, while TGF-β1 and TGF-β2 have been proved to be one of the profibrotic factors.18 Here, we observed the effect of MSC conditioned media (CM) on human keloid fibroblasts in vitro and used daily treatments of MSC CM to attenuate fibrosis in a mouse model of dermal fibrosis. We paid special attention to investigate whether antifibrotic paracrine effects of MSCs may modulate fibroblasts proliferation and prevent collagen accumulation by mediating TGF-β3-dependent activation.
Materials and Methods Isolation and Expansion of Primary Human Bone Marrow–Derived Mesenchymal Stem Cells After informed consent was obtained, human adult bone marrow mononuclear cells were freshly collected from the iliac bone of normal donor (35-year-old male) as described previously.19 The samples were seeded in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% human serum, 100 units/mL penicillin, and 100 µg/mL streptomycin (Sigma-Aldrich, St Louis, MO), and cultured at 37°C in a humidified atmosphere with 5% CO2. The medium containing nonadherent cells were removed after 3 days of seeding, and medium was changed every 2 or 3 days. When well-developed colonies of fibroblast-like cells appeared and reached 90% confluence, the cells were trypsinized and passed into new 75-cm2 flasks (BD Falcon, BD Biosciences, San Jose, CA) at a density of 0.6 × 106 cells. In addition, cultured cells were incubated with antibodies for CD14, CD34, CD45, CD44, and CD73 (Becton Dickinson,
Franklin Lakes, NJ) and analyzed by flow cytometry (FACS Calibur; BD Biosciences), which is consistent with previous reports.20 The cells of 5 to 10 passage were used in the study.
Pretreatment of BM-MSCs With Inflammatory Factors When BM-MSCs were 80% confluent, BM-MSCs were starved overnight for serum to eliminate the effect of TGF-β isoforms (TGF-β1, -β2, and -β3) in serum before preconditioning. Then the cells were harvested and plated in 12-well plates in a concentration of 0.1 × 106/cells per plate. Cells were divided into 3 groups: (a) control (without intervention); (b) with stimulant alone, tumor necrosis factor-α (TNF-α; 50 ng/mL); (c) with stimulant alone, endotoxin (LPS; 200 ng/mL).21 In each case, mRNA or supernatants centrifuged of cells were harvested after 0-, 12-, 24-, and 48-hour incubation and stored at −80°C until use.
RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction For quantitative real-time polymerase chain reaction (qRTPCR), total RNA was isolated from BM-MSCs and cDNA was synthesized using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). The primers used for TGF-β isoforms are shown in Table 1. Reactions were performed using SYBR-Green PCR master mix (Applied Biosystems, Foster City, CA) and the Roche LightCycler instrument and software (Roche, Alameda, CA). Glyceraldehyde-3phosphate-dehydrogenase (GAPDH) was used for an internal control.
Immunocytofluorescence The cells were subcultured into 24-well plates (2 × 104 cells per well). The cells were fixed with 4% paraformaldehyde for 15 minutes and washed 3 times in phosphate-buffer solution (PBS). They were then permeabilized in 1%
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
52
The International Journal of Lower Extremity Wounds 14(1)
Triton-X100 for 30 minutes and washed 3 times in PBS buffer. Nonspecific binding was blocked with 10% goat serum for 1 to 2 hours at room temperature. In addition, the cells were, respectively, incubated overnight at 4°C with the primary monoclonal antibodies, including anti-TGF-β1 antibody (8-25 µg/mL; Abcam, Cambridge, MA), anti-TGF-β2 antibody (1 µg/mL; Abcam), and anti-TGF-β3 antibody (5 µg/mL; Abcam). Then, the samples were washed with PBS 3 times and incubated with a Cy3-conjugated secondary antibody for 1 to 2 hours followed by counterstaining with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Roche Molecular Biochemicals). The numbers were examined at at least 5 high power fields per well.
Quantification of Quantifying TGF-β Protein in Culture Supernatants BM-MSCs were pretreated and incubated for 6, 12, 24, and 48 hours in serum-free (SF) fresh medium in the presence or absence of different cytokines as described above. Supernatants were then collected by centrifugation. The level of TGF-β isoforms in CM supernatant was tested by enzyme-linked immunosorbent assay (ELISA) following the manufacturer-recommended protocol (BlueGene; http:// www.bluegene.cc/).
Preparation of Human BM-MSC Conditioned Media The passage 5 to 10 human BM-MSCs were grown in DMEM with 10% human serum in 6-cm tissue culture dishes. When BM-MSCs were 80% confluent, the cells were starved overnight for serum. Then the cells were harvested and replanted in 12-well plates in a concentration of 1 × 105 cells per plate and incubated with 1 mL SF DMEM per dish for 24 hours. From this preparation, CM was collected by pretreatment of human BM-MSCs with TNF-α or LPS (TNF-α, 50 ng/mL; LPS, 200 ng/mL), centrifuged at 5000 rpm for 10 minutes, and stored at −80°C until use. The preferred duration of incubation was determined by ELISA data of TGF-β isoforms in CM. In addition, to assess the effect of TGF-β3 of human keloid fibroblasts, CM was processed by human TGF-β and TGF-β3 antibody (R&D Systems, Minneapolis, MN), through which TGF-β and TGF-β3 of CM was neutralized. The concentrations of TGF-β and TGF-β3 antibody were consistent with that of TGF-β and TGF-β3 of CM in every assay.
Human Keloid Fibroblast Culture The study was approved by the Medical and Ethics Committees of Chinese People’s Liberation Army (PLA) General Hospital (Beijing, China), and each patient and donor signed an informed consent form before enrolling in
the study. Six patients (3 males and 3 females, age from 20 to 38 years) had not received previous treatment for keloids. The location of keloid lesions were on the shoulder, chest, and dorsum. Fibroblast cultures were established as described.22,23 Samples were repeatedly rinsed in sterile DMEM containing with an antibiotic/antimycotic preparation. Subsequently, the tissues were cut into 5 mm × 5 mm small pieces, and then the pieces were incubated in DMEM with 0.5% dispase overnight at 4°C. After the epidermis was removed, the dermis was digested in DEME with 0.1% collagenase type I for 4 hours at 37°C. Digestion action was quenched by DMEM. Then, the tissues were cultured in DMEM with 1% penicillin–streptomycin (Sigma) and 10% human serum in a humidified incubator (Sanyo, Sakata, Japan) with 5% CO2 and at 37°C. The cells were used in the experiments for 3 to 5 passages.
Human Keloid Fibroblast Proliferation Assay To determine soluble factors released by BM-MSCs influencing human keloid fibroblasts, the metabolic activity of cells was tested by Cell Counting Kit-8 assay kit (CCK-8). The cells were plated in 96-well culture plates (Corning, NY) at a concentration of 2 × 103 cells/well in a total volume of 0.2 mL growth medium. Cells were quiesced in SF media for 24 hours before experimentation, and then the cells were, respectively, incubated with control (DMEM serum-free), CM, BM-MSC CM neutralized with TGF-β3 (TGF-β3 blocked), and BM-MSC CM neutralized with TGF-β (TGF-β blocked). TGF-β or TGF-β3 neutralizing antibody was added in BM-MSC CM about 5 minutes before the experiment starting. Plates were incubated for 24 hours at 37°C in a humidified atmosphere with 5% CO2. After the treatment period, the quantity of water-soluble formazan product present was determined on a microplate reader (Beckman) atλ = 490 nm for each well. All assays were carried out in at least 3 parallels and repeated 3 times.
Fibroblast Coculture Experiments Target human keloid fibroblasts were seeded at 5 × 105 cells/well on the bottom surface of 6-well plates and were cultured in SF media for 24 hours. Subsequently, SF media (control), CM, BM-MSC CM neutralized with TGF-β3, or BM-MSC CM neutralized with TGF-β were added. After 24 hours, the media of all wells were aspirated. The human keloid fibroblasts were trypsinized for the next experiments. Total RNA and protein was isolated from fibroblasts and the expression of α-SMA and type I collagen was measured by qRT-PCR as described above and Western blot. The primers are shown in Table 1. In addition, the cells were resuspended in trypan blue and calculated using a hemocytometer. Nonviable cells were stained blue. The cell number was
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
53
Wu et al counted using the following formula: C = (Av − Av1) × n × 104 cells/mL, where C is the cell concentration, Av is the total average number of cells in 4 corners of hemocytometer counted, Av1 is the average number of trypan blue stained cells in 4 corners of hemocytometer counted, and n (number) is the dilution factor.
Protein Isolation and Western Blot For the detection of protein expression, human keloid fibroblasts were harvested and lysed in cold cell lysis buffer for 30 minutes on ice as described previously.24 The amount of protein was determined using the Bio-Rad protein assay kit (Bio-Rad, Hercules, CA). Then, samples containing equal amounts of proteins (20-25 µg) were subjected to 10% sodium dodecylsulfate-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore, Eschborn, Germany). Subsequently, the proteins were blocked with 5% fat-free milk at room temperature, and then were incubated with antibodies against α-SMA (1:500 dilution; Sigma, St Louis, MO), type I collagen (1:250 dilution; Santa Cruz Biotechnology, Santa Cruz, CA), or β-actin (1:200 dilution; Santa Cruz Biotechnology) overnight at 4°C. The membranes were then incubated with appropriate secondary antibodies for 1 hour at room temperature. Signals were visualized using an enhanced chemiluminescence detection system (ECL; Amersham Biosciences, Piscataway, NJ). Protein levels were normalized against the intensity of the β-actin signal. Relative optical density of protein bands was measured after subtracting the film background.
Isolation, Expansion, and Characterization of Murine BM-MSCs In Vitro All animal procedures were approved under the guidelines of the Institutional Animal Care and Use Committee of Chinese PLA General Hospital (Beijing, China). Bone marrow was harvested from the femurs and tibias of 3- to 4-week-old male C57BL/6 mice (Beijing HFK Bioscience Co). The mononuclear cells of bone marrow were isolated by Ficoll-Paque density gradient. The nucleated cells were plated in plastic tissue culture dishes and incubated in complete minimum essential medium (D-MEM/F-12; Gibco) supplemented with 10% heatinactivated fetal bovine serum (FBS), 1% penicillin/streptomycin, and 1% glutamine, and cultured at 37°C in a humidified atmosphere with 5% CO2. The medium containing nonadherent cells was replaced after 3 days of culture. Then the medium was changed every 2 or 3 days. When reaching 80% confluence, the cells were harvested with 0.05% trypsin-EDTA (Sigma), and the adherent spindle-shaped cells were used for the experiments between the third and fifth passages. As in previous assays, cells expressing typical
BM-MSC-specific cell surface markers such as CD29, CD44, CD90, CD106 while being negative for reactivity to antigens CD34 and CD45 as well as having osteogeneic and adipogeneic differentiation potential25,26 were used in this experiment.
Collection of Murine BM-MSC CM The preparation of murine BM-MSC CM obtained resembled the preparation of human BM-MSC CM described above. Passages 3 to 5 BM-MSCs were seeded in 6-cm tissue culture dishes at a concentration of 1 × 106 cells in a total volume of 1 mL, and then the cells was pretreated with TNF-α or LPS. CM was collected and the level of TGF-β3 was tested by ELISA. Moreover, to assess the effect of TGF-β3 of CM in animal experiments, the protein was neutralized by mouse TGF-β3 antibody (R&D Systems, Minneapolis, MN) and the optimal time of incubation and concentration was chosen on the basis of results by ELISA. Furthermore, for in vivo experiments, CM was further concentrated (50 times) by ultrafiltration using centrifugal filter units with 5 kDa cutoff (Millipore) following the manufacturer’s instructions.
Skin Fibrosis Model and BM-MSC Administration Experiments were performed in sodium pentobarbital anesthetized C57BL/6 mice (7-8 weeks old, female, body weight 20-25 g). The concentration of bleomycin (Nippon Kayaku Company, Tokyo, Japan) was 1 mg/mL in PBS27 and was sterilized by filtration. After hair removal from the dorsal surface and anesthesia, the back skin of mice was treated with subcutaneous injections of bleomycin for 3 weeks, and bleomycin was dosed at 100 µL once a day. Next, wild C57BL/6 mice skin fibrosis models were randomly divided into 4 groups (n = 5 per group): untreated control group, the lesional skin was left untreated; placebo group, 100 µL PBS (0.01 M) was injected into the lesion skin by subcutaneous injection every day for 3 weeks; BM-MSC CM group, 100 µL concentrated (50 times) MSC CM were injected into the lesion skin by subcutaneous injection every day for 3 weeks; BM-MSC CM neutralized with TGF-β3-treated group (TGF-β3 blocked), 100 µL concentrated (50 times) MSC CM neutralized with TGF-β3 were injected into the lesion skin by subcutaneous injection every day for 3 weeks.
Histological Examination (Hematoxylin–Eosin Staining and Masson’s Trichome) At 3 weeks after treatment, skin specimens were harvested after euthanasia and fixed with 10% buffered formalin for paraffin embedding. Five-micrometer-thick paraffin-embedded sections were routinely stained with hematoxylin and eosin and Masson’s trichome for conventional morphological
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
54
The International Journal of Lower Extremity Wounds 14(1)
evaluation. All slides were evaluated in a blinded fashion by 2 independent observers without knowledge of our study design. The skin dermal thickness in each group was determined by image analysis (digital photography and Adobe Photoshop software) from the average of 5 random fields between the epidermal–dermal junction and the dermal–fat junction per skin section.
Immunohistochemical Assay The relative levels of α-SMA-positive cells in bleomycininjected sites were detected in each group. Five-micrometer tissue sections of paraffin-embedded skin tissue were deparaffinized and rehydrated in PBS for 3 minutes. Subsequently, endogenous peroxidase was quenched using 10% H2O2 for 10 minutes at room temperature. To block endogenous mouse immunoglobulins, the sections were blocked with 5% serum for 1 to 2 hours. And then slides were stained with the primary antibody for α-SMA (Abcam) overnight. Then, sections were washed with PBS, incubated with biotinylated secondary antibody (Zhong Shan Golden Bridge Biotechnology, Beijing, China) for 30 minutes, and stained with diaminobenzadine (DAB) for 1 minute. Appropriate control IgG was used. Sections were counterstained with hematoxylin (Sigma), mounted. The slides were examined at at least 5 high power fields per section.
Immunofluorescent Assay Six-micrometer frozen sections were fixed with methanol for 10 minutes and washed for 10 minutes in PBS. For immunofluorescence, following permeabilization in 0.5% Triton-X 100 for 60 minutes, the slides were blocked with 10% goat serum for an hour and incubated with Ki-67 antibody (1:500, Abcam) overnight at 4°C. And then, sections were washed with PBS 3 times and incubated with Cy3-conjugated fluorescent secondary antibodies. Next, counterstaining was performed with DAPI. The percentage of Ki67-positive cells was accomplished by performing counts using digital photography and Adobe Photoshop software for Ki67 and DAPI. Two pathologists who were blinded to the group identity of the slides evaluated the cell proliferation. The average numbers were determined at at least 5 high power fields per group (magnification 200×).
Statistical Analysis Statistical analysis of the data involved using t test for comparison between 2 groups or 1-way ANOVA for comparison of more than 2 groups. The data are presented as the mean ± SEM. A value of P < .05 was considered to be statistically significant.
Results TGF-β Isoforms Released by Human BM-MSCs The expression levels of TGF-β isoforms were analyzed from primary adult human BM-MSCs. After the cells were preprocessed (see Materials and Methods), the mRNA expression levels were measured by qRT-PCR. BM-MSCs expressed significantly greater amounts of TGF-β1 and TGF-β3, but lower amounts of TGF-β2 (Figure 1A). The levels of TGF-β isoforms were significantly greater with stimulant alone (TNF-α or LPS) compared with those without intervention group, and particularly the gene expression of TGF-β1 and TGF-β3 isoforms was almost 3-fold higher at 24 hours after inflammatory factor functioning than the control group. In addition, there were no significant differences for TGF-β levels between TNF-α and LPS. Subsequently, the protein expression of TGF-β isoforms was detected using immunocytofluorescence. As Figure 1B shows, the fluorescence was highest at 24 hours compared with other times (data not shown). Moreover, the expression of protein was similar between TGF-β1 and TGF-β3, and the expression of TGF-β2 was weaker. To determine the protein level of TGF-β isoforms released by BM-MSCs, we performed ELISA analysis in CM under normal conditions and inflammatory environment. The studies showed that TGF-β secreted by BM-MSCs stimulated significantly increase over a 24-hour period under TNF-α or LPS exposure compared with other time points (Figure 1C). TGF-β1 and TGF-β3 concentrations were approximately 2-fold higher compared to those without intervention groups (TGF-β1: 887 ± 41 pg/mL [TNF-α] or 853 ± 25 pg/mL [LPS] vs 421 ± 21 pg/mL, P < .01; TGFβ3: 802 ± 23 pg/mL [TNF-α] or 790 ± 36 pg/mL [LPS] vs 358 ± 16 pg/mL, P < .01), whereas the concentrations of TGF-β2 were obviously lower (119 ± 17 pg/mL [TNF-α] or 112 ± 12 pg/mL [LPS] vs 93 ± 9 pg/mL, P < .05; Figure 2C). In all the cytokines examined, the data demonstrated that similar expression patterns were found at mRNA and protein levels of TGF-β isoforms.
Effects of MSC-Conditioned Media on Human Keloid Fibroblasts In Vitro To investigate the effects of MSCs on human keloid fibroblasts, the cells were respectively maintained with DMEM serum-free (control), CM, BM-MSC CM neutralized with (TGF-β3 blocked), or BM-MSC CM neutralized with TGFβ (TGF-β blocked) for 24 hours. As anticipated, CM from BM-MSCs resulted in a significant reduction in cell metabolic activity compared with control, whereas incubation with anti-TGF-β3 neutralizing antibodies partially inhibited CM activity (Figure 2A). From the assay of cell count, human keloid fibroblasts were enumerated using a hemocytometer.
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
55
Wu et al
Figure 1. TGF-β isoform expression of human BM-MSCs were unregulated in the presence of TNF-α or LPS.
(A) Levels of TGF-β isoform mRNAs (0, 12, 24, and 48 hours) were determined by quantitative real time (*P < .05, #P < .01 vs 0 hours, 12 hours). (B) The protein levels of TGF-β isoforms were examined by immunocytofluorescence at 24 hours. TGF-β isoforms presented as red and the nuclei were counterstained as blue. Magnification 200×. Bar = 100 µm. (C) The protein content of TGF-β isoforms secreted by BM-MSCs was analyzed by ELISA in condition media (6, 12, 24, and 48 hours). Compared with control, TNF-α and LPS significantly increased secretion of TGF-β isoforms in every group, and the TGF-β proteins level is highest at 24 hours. No differences for the protein content were seen between 24 and 48 hours. Data are expressed as mean ± SEM; n = 5.
The counts showed that increased CCK-8 correlates with an increased number of cells (Figure 2B). In addition, the effect was concomitant with a decrease in α-SMA expression, a marker of myofibroblast differentiation, and type I collagen. The data showed that CM inhibited the α-SMA and COL1A1 gene expression (Figure 3A), which implied that it could decrease the activeness of keloid fibroblasts and reduced collagen production. Additionally,
to define the role of TGF-β3 in the antifibrotic effects of MSC CM, we performed experiments in fibroblasts cultured with BM-MSC CM neutralized with TGF-β3. Specific blocking of TGF-β3 enhanced the expression of α-SMA and COL1A1 gene in human keloid fibroblasts and partially abolished the effect of CM. Similarly, blocking of total TGF-β can also promote their expression in human keloid fibroblasts and abrogated the effect of CM in part, while the
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
56
The International Journal of Lower Extremity Wounds 14(1)
Figure 2. Comparison of the effect of TGF-β3 on human keloid fibroblast cultured in different media.
(A) Cell viability as determined by CCK-8 assay (*P < .05 vs control, **P < .01 and #P < .05 vs CM). (B) Cell numbers were enumerated using a hemocytometer (*P < .05 vs control, **P < .01 and #P < .05 vs CM). The data are expressed as mean ± SEM from independent experiments.
Figure 3. The expression of α-smooth muscle actin (α-SMA) and type I collagen was detected in human keloid fibroblasts.
The fibroblasts were treated for 24 hours with serum-free media, CM, BM-MSC CM neutralized with TGF-β3, or BM-MSC CM neutralized with TGFβ, respectively. (A) mRNA levels of α-SMA and type I collagen were significantly reduced in test groups compared with control group by quantitative real-time polymerase chain reaction (*P < .05 and **P < .01 vs control; #P < .05 vs CM group). (B) Protein levels of α-SMA and type I collagen were reduced in test groups compared with control group by western blot (*P < .05 and **P < .01 vs control; #P < .05 vs CM group). The difference is statistically significant (*P < .05). Data are presented as mean ± SEM.
attenuating effects were lower than that of TGF-β3 blocking CM, which showed that other proteins secreted from
BM-MSCs except for TGF-β protein also have the inhibitory effect on keloid fibroblasts. As shown in Figure 3B,
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
57
Wu et al human keloid fibroblasts produced high levels of α-SMA and type I collagen in the control group; while 2 protein expressions appeared, an apparently decrease in CM-treated group and BM-MSC CM neutralized with TGF-β3 highlighted their expression level. Therefore, it is conceivable that MSC CM contribute to both the decrease of the fibroblast viability and the reduction of ECM deposits, and TGFβ3 is responsible for most parts of the antifibrotic effect of MSC secretome.
The dermal thickness was measured to provide a quantitative assessment of elements of fibrosis and scar formation (Figure 5B). The dermal thickness in the placebo group showed almost no change compared with that of untreated control group. In contrast, skin dermal thickness in CM group and BM-MSC CM neutralized with TGF-β3-treated group showed significant decrease in tissue sections compared with that of untreated control skin (307.4 µm and 378.9 µm vs 439.1 µm, P < .05).
Homeostasis Assessment of an Adult Model of Dermal Fibrosis Induced by Bleomycin
Detection of Myofibroblasts
Cutaneous fibrosis formation was consistently and reproducibly produced in adult murine model of skin fibrosis similar to human scleroderma by intradermal injection of bleomycin into the dorsal skin of C57BL/6 mice. After the dorsal skin of murine was treated daily with PBS or bleomycin for 3 weeks, homeostasis model assessment was carried out including abnormal collagen deposition and the measurement of dermal mean thickness. After 3 weeks, lesional skin with bleomycin treatment histologically showed thickening of collagen bundles, an increase in dermal thickness, and subcutaneous fat replaced by connective tissue (Figure 4A). In addition, the dermal mean thickness was measured to provide a quantitative assessment of skin fibrosis at 5 randomly selected fields (Figure 4B) after 3 weeks. The dermal mean thickness with bleomycin treatment showed almost 2-fold greater thickness than with PBS treatment. Therefore, the model of skin fibrosis induced by bleomycin can be used as our experimental model.
Histological Comparison To access the effect of treatment for all the groups, the accumulation, organization of dermal collagen, and the degree of fibrosis were examined after 3 weeks. Representative tissues sections were subjected to hematoxylin–eosin staining and Masson’s trichrome stain, which can detect the areas of mature collagen deposition (Figure 5A). Placebo group consistently displayed abnormal collagen deposition and a lack of normal dermal architecture. Their histological appearance was similar to untreated control lesional skin that had not been injected with any substance. In contrast, BM-MSC CM group and BM-MSC CM neutralized with TGF-β3-treated group failed to display histologic elements of scar formation. Especially, BM-MSC CM group demonstrated restoration of normal dermal architecture and closely resembled, although not identical, the basket-weave pattern of the original tissue. Moreover, the subcutaneous fat was almost replaced by connective tissue in untreated control group and placebo group and was partially preserved in BM-MSC CM group and BM-MSC CM neutralized with TGF-β3-treated group.
To compare the accumulation of myofibroblasts of all groups, the expression of α-SMA was analyzed by immunohistochemistry (Figure 6). In normal skin, quiescent myofibroblasts express little α-SMA and the protein can be observed exclusively in vessels and erector pili muscles. And as shown in Figure 6, the fibrotic skin of untreated control group and placebo group consistently exhibited SMApositive cells and were observed to be distributed throughout the dermis. By comparison, α-SMA-positive myofibroblasts were few in CM group, while the quantity of positive cells expressing α-SMA was more in the area of BM-MSC CM neutralized with TGF-β3 treated.
BM-MSCs Inhibit Proliferation in the Lesion Skin Ki-67, a marker of cellular proliferation, was used to quantify the number of proliferating cells. And as shown in Figure 7, the proliferating cells were significantly higher in the lesion skin of control and placebo groups. In addition, compared to BM-MSC CM neutralized with TGF-β3treated group, MSC CM-treated group exhibited significantly fewer proliferating cells.
Discussion Skin scar caused by mechanical injury or pathological wound is an undesirable consequence of cutaneous wound healing; however, related treatment remains limited and largely ineffective. MSCs have been known to contribute to wound healing and cutaneous homeostasis due to their inherent capacity to secrete growth factors, chemokines, and cytokines, which makes them potential cell therapeutics.28-30 However, much less is known about the MSC cytokines involved in alleviating skin fibrosis or scar. In the present study, we have reported for the first time that human BM-MSC CM significantly reduced the viability of human keloid fibroblasts and decreased expression of α-SMA, suggesting that paracrine factors of BM-MSCs act on proliferation and differentiation of fibroblasts. These effects were also corresponding to a decrease in collagen expression of fibroblasts cocultured with BM-MSC CM.
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
58
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
(A) Histological assessment of lesional skin (HE and Masson’s trichome, original magnification 200×). Scale bars = 50 µm. (B) The dermal thickness was measured by comparing the mean thickness with PBS and bleomycin treatment for 3 weeks. Results are expressed as mean ± SEM. **P < .01 versus PBS group.
Figure 4. Model of skin fibrosis formation induced by PBS or bleomycin in adult mice.
59
Wu et al
Figure 5. Histological assessment of lesional skin after treatment.
(A) Lesional skin was treated without any substance (a-b), and injected with PBS (c-d), BM-MSC CM group (e-f), or BM-MSC CM neutralized with TGFβ3 (g-h). Skin samples were harvested at 3 weeks after treatment, analyzing collagen deposition, and organized by either hematoxylin and eosin (left column) or trichrome staining (right panel). Original magnification 100×. Bar = 100 µm. (B) In addition, dermal thickness was measured for all of groups (mean ± SEM, n = 5, *P < .05 and **P < .01 vs untreated control).
Recent studies have reported that 3 members (TGF-β1, TGF-β2, and TGF-β3) of the TGF-β family were closely related to tissue fibrosis. TGF-β1 and TGF-β2 are widely considered to be potent driver of tissue fibrosis, and TGFβis one of the factors that reduce fibrosis in different organs.31,32 In some related findings, skin scar could be effectively reduced via treatment with antibodies neutralizing endogenous TGF-β1 and TGF-β2, and administration of exogenous TGF-β3 was found to contribute to significantly prompt alleviations in scarring of adult wounds.18,33 Ferguson et al also have demonstrated that prophylactic administration of avotermin (recombinant, active, human TGF-β3) was significantly at work on improving total scar scores at all concentrations versus placebo.34 Our results also provide important potentially valuable insights into the underlying mechanisms of TGF-β signaling in response to BM-MSCs. Our data showed that BM-MSCs can release TGF-β family, in vitro, especially under stimulation of inflammatory factors, which hinted the cells can significantly increase TGF-β family releasing in response to injury and pathological condition. Unraveling the related signaling pathway will hopefully lead to new therapeutic strategies to promote adult scarless wound healing. In addition, to determine whether TGF-β3 was involved in the contribution of BM-MSC CM to human keloid fibroblasts,
we incubated BM-MSC CM with TGF-β3 antibody, and blocking TGF-β3 partly weakened the efficacy of BM-MSC CM. These results supported the fact that TGF-β3 was one of the MSC paracrine factors that mediated fibroblast viability and contributed to the reduction of ECM deposits, and also was one factor alleviating fibrosis. Furthermore, TGFβantibody neutralized BM-MSC CM exhibited an apparently weakened antifibrotic effect, which implied that other proteins secreted from BM-MSCs except for TGF-β protein also had the antifibrosis effect. Hence, we thought that BM-MSC CM can modulate keloid fibroblasts proliferation and prevent collagen accumulation in an environment favorable to fibrosis, and TGF-β3 secreted by BM-MSCs played the critical role in skin scar healing. Many reports have already shown that collagen type I expression, as the major fibrous collagen synthesized by wound fibroblasts, was remarkably upregulated in repair processes. To define the relevance of in vivo collagen production and ECM regulation by BM-MSCs, we used a murine model of dermal fibrosis. Results showed that an apparent fibrotic scar was evident in the murine dorsal skin treated by bleomycin for 3 weeks. After lesional skin of model untreated with any substance or treated with PBS, BM-MSC CM, or BM-MSC CM neutralized with TGF-β3, respectively, for 3 weeks, we observed matrix organization
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
60
The International Journal of Lower Extremity Wounds 14(1)
Figure 6. Immunohistochemical analysis detecting myofibroblasts in skin lesion.
(A) α-SMA staining of tissue sections was examined in untreated control group (a-b), placebo group (c-d), BM-MSC CM group (e-f), and BM-MSC CM neutralized with TGF-β3 (g-h). A light hematoxylin counterstain was used to visualize nuclei. α-SMA-positive cells are indicated by arrowheads. (B) In untreated control group and placebo group, untreated and PBS-treated lesional skin sites exhibited plentiful the positive cells of α-SMA. In contrast, few α-SMA-positive cells appeared in the skin lesion of BM-MSC CM group, and more protein was expressed in BM-MSC CM neutralized with TGFβ3-treated group compared with BM-MSC CM group. Original magnification 100× (a, c, e, g); 200× (b, d, f, h). Bar = 100 µm (a, c, e, g); 50 µm (b, d, f, h). The difference is statistically significant (*P < .05). Data are presented as mean ± SEM. *P < .01 and **P < .001 versus untreated control.
Figure 7. Immunofluorescent staining analysis detecting the proliferating cells in lesion skin.
Quantification of the proliferating cells showed an approximate decrease of 9% on average as a result of CM treated using high-power magnification, and an approximate decrease of 4% in TGF-β3 blocked group, compared with untreated control group and placebo group. Data are presented as mean ± SEM. *P < .01 and **P < .001 versus untreated control.
and collagen arrangement in all the groups. Engraftment of BM-MSC CM was associated with a significant decrease in fibrosis, which showed that the dermis exhibited a unanimous basket-weave organization of collagen arrangement
similar to that in normal skin, whereas in untreated control and placebo group, collagen presented an abnormal parallel organization in the dermis that resembled the hypertrophic scar. Moreover, this antifibrotic effect afforded by BM-MSC CM was apparently weakened by addition of TGF-β3 inhibitors. Meanwhile, in our in vivo setting, we also examined the expression of α-SMA that is the most reliable marker of myofibroblasts. Myofibroblast accumulation is a key finding in the dermis of fibrotic skin, wherein it is thought that the presence of myofibroblasts is consistent with the pathology of fibrotic diseases35 and is capable of synthesizing ECM components, namely, collagen, as well as fibrogenic cytokines and chemokines. Our data demonstrated that α-SMA-positive cells were few in the CM-treated group; however, this effect was abolished partly when experiments were performed with antibody neutralization of TGF-β3. By comparison, a noticeably increased presence was noted of α-SMA distributed throughout the dermis of the lesional skin in untreated control group and placebo group. The data implied that the application of BM-MSC CM may help in regulating ECM balance as well as myofibroblast proliferation and differentiation in fibrotic disease. These results were in accordance with in vitro studies, showing that the
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
61
Wu et al antifibrotic effect of MSCs observed was related to mediation of TGF-β3 acting on fibroblasts proliferation, collagen accumulation, and ECM regulation. Increased myofibroblast accumulation is thought to contribute to the pathogenesis of fibrotic diseases. Myofibroblasts are capable of synthesizing ECM protein, mainly collagen. Using our model of bleomycin-induced fibrosis, we observed that the α-SMA-positive cells were fewer in CM group and TGF-β3 blocked group, when compared with control and placebo group, especially CM group. The findings implied that the application of BM-MSCs could decrease presence of myofibroblasts, regulate the accumulation of collagen, and alleviate matrix production in fibrotic disease. Furthermore, immunofluorescence assay for the proliferation marker Ki-67 has also come to similar conclusions, which showed that a significant decrease of proliferative cells in the CM group. Our study provides the information to indicate BM-MSC CM contains components with antifibrotic potential that could mediate a sequence of events including myofibroblasts proliferation and differentiation as well as collagen deposition and ECM homeostasis in the fibrotic changes in vivo. As well, our study also underlined that the application of BM-MSC CM in vivo significantly improved the morphological and functional parameters of dermal healing 3 weeks after injection. These properties of BM-MSCs add a new dimension to our understanding the mechanisms of action of stem cells in fibrosis. Also, BM-MSC CM exhibited an apparently weakened antifibrotic effect through the inhibition of TGF-β3 activation. Thus, we speculate that BM-MSC CM may modulate the development of skin fibrosis in virtue of TGF-β3 effects, at least in part. Of note, although TGF-β3 secreted by BM-MSCs indeed may account for most of the antifibrotic effect, it seems unlikely that it could be only relevant efficient ingredient in terms of reducing skin fibrosis and improving dermal wound healing. The beneficial effects from the paracrine factors of BM-MSCs remain partly unidentified and multiple factors might function synergistically. However, it is possible that TGF-β3-engineered MSCs might exert more powerful antifibrotic effect compared with common MSCs. In conclusion, we have shown that antifibrotic paracrine effects of BM-MSC CM may modulate fibroblasts proliferation and prevent collagen accumulation by mediating TGF-β3dependent activation. These findings open new perspectives regarding the mechanisms of action of MSCs in alleviating skin fibrosis and provide a potential therapeutic strategy for cutaneous scar treatment. Declaration of Conflicting Interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding This study was supported in part by the National Nature Science Foundation of China (81401599, 81121004, 81230041 and 81372066), Youth Leading Scholar Supporting Program in General Colleges and Universities of Heilongjiang Province (1254G064).
References 1. Gurtner GC, Werner S, Barrandon Y, Longaker MT. Wound repair and regeneration. Nature. 2008;453:314-321. 2. Larson BJ, Longaker MT, Lorenz HP. Scarless fetal wound healing: a basic science review. Plast Reconstr Surg. 2010;126:1172-1180. 3. Mias C, Lairez O, Trouche E, et al. Mesenchymal stem cells promote matrix metalloproteinase secretion by cardiac fibroblasts and reduce cardiac ventricular fibrosis after myocardial infarction. Stem Cells. 2009;27:2734-2743. 4. Gabbiani G. The myofibroblast in wound healing and fibrocontractive diseases. J Pathol. 2003;200:500-503. 5. Brown RD, Ambler SK, Mitchell MD, Long CS. The cardiac fibroblast: therapeutic target in myocardial remodeling and failure. Annu Rev Pharmacol Toxicol. 2005;45:657-687. 6. Al-Nbaheen M, Vishnubalaji R, Ali D. Human stromal (mesenchymal) stem cells from bone marrow, adipose tissue and skin exhibit differences in molecular phenotype and differentiation potential. Stem Cell Rev. 2013;9:32-43. 7. Parekkadan B, Milwid JM. Mesenchymal stem cells as therapeutics. Annu Rev Biomed Eng. 2010;12:87-117. 8. Baraniak PR, McDevitt TC. Stem cell paracrine actions and tissue regeneration. Regen Med. 2010;5:121-143. 9. Timmers L, Lim SK, Arslan F, et al. Reduction of myocardial infarct size by human mesenchymal stem cell conditioned medium. Stem Cell Res. 2007;1:129-137. 10. Li L, Zhang Y, Li Y, et al. Mesenchymal stem cell transplantation attenuates cardiac fibrosis associated with isoproterenolinduced global heart failure. Transpl Int. 2008;21:1181-1189. 11. Ortiz LA, Gambelli F, McBride C, et al. Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci U S A. 2003;100:8407-8411. 12. Kim SY, Lee JH, Kim HJ, et al. Mesenchymal stem cellconditioned media recovers lung fibroblasts from cigarette smoke-induced damage. Am J Physiol Lung Cell Mol Physiol. 2012;302:L891-L908. 13. Oyagi S, Hirose M, Kojima M, et al. Therapeutic effect of transplanting HGF-treated bone marrow mesenchymal cells into CCl4-injured rats. J Hepatol. 2006;44:742-748. 14. Abdel Aziz MT, Atta HM, Mahfouz S, et al. Therapeutic potential of bone marrow-derived mesenchymal stem cells on experimental liver fibrosis. Clin Biochem. 2007;40:893-899. 15. Ninichuk V, Gross O, Segerer S, et al. Multipotent mesenchymal stem cells reduce interstitial fibrosis but do not delay progression of chronic kidney disease in collagen4A3-deficient mice. Kidney Int. 2006;70:121-129. 16. Semedo P, Correa-Costa M, Cenedeze MA, et al. Mesenchymal stem cells attenuate renal fibrosis through immune modulation and remodeling properties in a rat remnant kidney model. Stem Cells. 2009;27:3063-3073.
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
62
The International Journal of Lower Extremity Wounds 14(1)
17. Watson SL, Marcal H, Sarris M, Girolamo ND, M Coroneo TC, Wakefield D. The effect of mesenchymal stem cell conditioned media on corneal stromal fibroblast wound healing activities. Br J Ophthalmol. 2010;94:1067-1073. 18. Shah M, Foreman DM, Ferguson MW. Neutralisation of TGF-beta 1 and TGF-beta 2 or exogenous addition of TGFbeta 3 to cutaneous rat wounds reduces scarring. J Cell Sci.1995;108:985-1002. 19. Takeda Y, Mori T, Imabayashi H, et al. Can the life span of human marrow stromal cells be prolonged by bmi-1, E6, E7, and/or telomerase without affecting cardiomyogenic differentiation? J Gene Med. 2004;6:833-845. 20. Bocelli-Tyndall C, Bracci L, Spagnoli G, et al. Bone marrow mesenchymal stromal cells (BM-MSCs) from healthy donors and auto-immune disease patients reduce the proliferation of autologous- and allogeneic-stimulated lymphocytes in vitro. Rheumatology. 2007;46:403-408. 21. Crisostomo PR, Wang Y, Markel TA, Wang M, Lahm T, Meldrum DR. Human mesenchymal stem cells stimulated by TNF-α, LPS, or hypoxia produce growth factors by an NF κB- but not JNK-dependent mechanism. Am J Physiol Cell Physiol. 2008;294:C675-C682. 22. Dienus K, Bayat A, Gilmore BF, Seifert O. Increased expression of fibroblast activation protein-alpha in keloid fibroblasts: implications for development of a novel treatment option. Arch Dermatol Res. 2010;302:725-731. 23. Tang B, Zhu B, Liang Y, et al. Asiaticoside suppresses collagen expression and TGF-b/Smad signaling through inducing Smad7 and inhibiting TGF-bRI and TGF-bRII in keloid fibroblasts. Arch Dermatol Res. 2011;303:563-572. 24. Wang S, Wu H, Liu Y, et al. Expression of USP2-69 in mesangial cells in vivo and in vitro. Pathol Int. 2010;60:184-192. 25. Pittenger MF, Mackay AM, Beck SC, et al. Multilineage potential of adult human mesenchymal stem cells. Science. 1999;284:143-147.
26. Colter DC, Class R, DiGirolamo CM, Prockop DJ. Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow. Proc Natl Acad Sci U S A. 2000;97:3213-3218. 27. Yamamoto T, Kuroda M, Nishioka K. Animal model of sclerotic skin. III: histopathological comparison of bleomycininduced scleroderma in various mice strains. Arch Dermatol Res. 2000;292:535-541. 28. Hsiao ST, Asgari A, Lokmic Z, et al. Comparative analysis of paracrine factor expression in human adult mesenchymal stem cells derived from bone marrow, adipose, and dermal tissue. Stem Cells Dev. 2012;21:2189-2203. 29. Baraniak PR, McDevitt TC. Stem cell paracrine actions and tissue regeneration. Regen Med. 2010;5:121-143. 30. Leclerc T, Thepenier C, Jault P, et al. Cell therapy of burns. Cell Prolif. 2011;44(suppl 1):48-54. 31. Liu W, Wang DR, Cao YL. TGF-β: a fibrotic factor in wound scarring and a potential target for anti-scarring gene therapy. Curr Gene Ther. 2004;4:123-136. 32. Seong J, Kim SH, Chung EJ, Lee WJ, Suh CO. Early alteration in TGF-β mRNA expression in irradiated rat liver. Int J Radiat Oncol. 2000;46:639-643. 33. Rhett JM, Ghatnekar GS, Palatinus JA, O’Quinn M, Yost MJ, Gourdie RG. Novel therapies for scar reduction and regenerative healing of skin wounds. Cell. 2008;26:173180. 34. Ferguson MWJ, Duncan J, Bond J, et al. Prophylactic administration of avotermin for improvement of skin scarring: three double-blind, placebo-controlled, phase I/II studies. Lancet. 2009;373:1264-1274. 35. Ludwicka A, Trojanowska M, Smith EA, et al. Growth and characterization of fibroblasts obtained from bronchoalveolar lavage of patients with scleroderma. J Rheumatol. 1992;19:1716-1723.
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
research-article2015
IJLXXX10.1177/1534734614568373The International Journal of Lower Extremity WoundsWu et al
Basic and Experimental Research
Mesenchymal Stem Cells Suppress Fibroblast Proliferation and Reduce Skin Fibrosis Through a TGF-β3-Dependent Activation
The International Journal of Lower Extremity Wounds 2015, Vol. 14(1) 50–62 © The Author(s) 2015 Reprints and permissions: sagepub.com/journalsPermissions.nav DOI: 10.1177/1534734614568373 ijl.sagepub.com
Yan Wu, PhD1,2,3, Yan Peng, MD4, Dongyun Gao, MM5, Changjiang Feng, MD6, Xiaohuan Yuan, PhD1, Houzhong Li, MM1, Ying Wang, MD1, Lan Yang, MM1, Sha Huang, PhD2,3, and Xiaobing Fu, PhD2,3
Abstract Recent studies showed that transplantation of mesenchymal stem cells (MSCs) significantly decreased tissue fibrosis; however, little attention has been paid to its efficacy on attenuating skin fibrosis, and the mechanism involved in its effect is poorly understood. In this work, we investigated the effects of MSCs on keloid fibroblasts and extracellular matrix deposition through paracrine actions and whether the antifibrotic properties of MSCs involved transforming growth factorβ (TGF-β)-dependent activation. In vitro experiments showed that conditioned media (CM) from MSCs decreased viability, a-smooth muscle actin expression, and collagen secretion of human keloid fibroblasts. In addition, TGF-β3 secreted by MSCs was expressed at high level under inflammatory environment, and blocking the activity of TGF-β3 apparently antagonized the suppressive activity of MSC CM, which demonstrated that TGF-β3 played a preponderant role in preventing collagen accumulation. In vivo studies showed that MSC CM infusion in a mouse dermal fibrosis model induced a significant decrease in skin fibrosis. Histological examination of tissue sections and immunohistochemical analysis for α-smooth muscle actin revealed that TGF-β3 of CM-mediated therapeutic effects could obviously attenuate matrix production and myofibroblast proliferation and differentiation. These findings suggest that TGF-β3 mediates the attenuating effect of MSCs on both the proliferation and extracellular matrix production of human keloid fibroblasts and decreases skin fibrosis of mouse model, thus providing new understanding and MSC-based therapeutic strategy for cutaneous scar treatment. Keywords mesenchymal stem cells, paracrine, transforming growth factor-beta, skin fibrosis When skin is severely damaged through both surgical and nonsurgical injuries, the injured tissue seems to be limited in its ability to repair itself. The cutaneous wound healing process may give rise to tissue repair that is severely dysregulated and contribute to scar or fibrosis that is composed of excess extracellular matrix (ECM) in the place of the normal dermal tissue,1,2 which remains a challenging issue in clinic. Termination of the fibrotic response to the injury and pathological condition seems to be associated with myofibroblast apoptosis3; however, in most cases, fibroblasts maintain their profibrotic properties as well as actively participate in the progressive accumulation of ECM proteins in the dermis and subcutaneous tissues and pathological skin remodeling.4,5 Therapeutic strategies that regulate fibroblast activity could be a promising method to prevent fibrosis progressing toward skin damage. For this purpose, cell-mediated therapy has been proposed as an attractive alternative to currently available pharmacological approaches. In all of cell types attainable for cell therapy, bone marrow–derived mesenchymal stem cells (BM-MSCs)
appear to be especially interesting due to some of its features. The beneficial effects of MSC administration can be ascribed in part to their paracrine activity.6-8 Several recent 1
Mudanjiang Medical College, Mudanjiang, People’s Republic of China The First Affiliated Hospital, General Hospital of PLA, Beijing, People’s Republic of China 3 General Hospital of PLA, Beijing, People’s Republic of China 4 The University of Hong Kong, Hong Kong SAR, People’s Republic of China 5 Dongtai People’s Hospital, Dongtai, People’s Republic of China 6 Peking University People’s Hospital, Beijing, People’s Republic of China 2
Corresponding Authors: Sha Huang, Key laboratory of wound repair and regeneration of PLA, the First Affiliated Hospital, General Hospital of PLA 51 Fu Cheng Road, Beijing 100048 P. R. China. Email: [email protected] Yan Wu, Heilongjiang Key Laboratory of Anti-fibrosis Biotherapy, Mudanjiang Medical College, 3 Tong Xiang Street, Ai Min District, Mudanjiang 157000 P. R. China. Email: [email protected]
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
51
Wu et al Table 1. Human Gene Primers for Real-Time Polymerase Chain Reaction in This Study. Primer Sequence Target TGF-β1 TGF-β2 TGF-β3 Type I collagen α-SMA GAPDH
Forward
Reverse
Product Size (bp)
GCCAGAGTGGTTATCTTTTGATG CGGAGGTGATTTCCATCTACA TGAGTGGCTGTTGAGAAGAGAG CCTGGAAAGAATGGAGATGATG GCTGTTTTCCCATCCATTGT GGTGAAGGTCGGTGTGAACG
AGTGTGTTATCCCTGCTGTCAC GGCGGCATGTCTATTTTGTAA GAGGATTAGATGAGGGTTGTGG ATCCAAACCACTGAAACCTCTG CTCTTTTGCTCTGTGCTTCGT CTCGCTCCTGGAAGATGGTG
120 136 214 147 103 233
Abbreviations: α-SMA, α-smooth muscle actin; GAPDH, glyceraldehyde-3-phosphate-dehydrogenase; TGF-β, transforming growth factor-β.
studies have shown that MSC graft can significantly decrease fibrosis in the heart,9,10 lung,11,12 liver,13,14 kidney,15,16 and cornea.17 However, for skin fibrosis, there is yet no related evidence, and it is not known whether the efficacy may involve decrease of proliferation and collagen expression of skin fibroblasts mediated by MSC paracrine factors. Furthermore, although the molecular mechanisms reducing tissue fibrosis are still poorly understood, the transforming growth factor-β (TGF-β) family may be involved. Particularly, TGF-β3 plays a crucial role in reducing scar of adult wounds, while TGF-β1 and TGF-β2 have been proved to be one of the profibrotic factors.18 Here, we observed the effect of MSC conditioned media (CM) on human keloid fibroblasts in vitro and used daily treatments of MSC CM to attenuate fibrosis in a mouse model of dermal fibrosis. We paid special attention to investigate whether antifibrotic paracrine effects of MSCs may modulate fibroblasts proliferation and prevent collagen accumulation by mediating TGF-β3-dependent activation.
Materials and Methods Isolation and Expansion of Primary Human Bone Marrow–Derived Mesenchymal Stem Cells After informed consent was obtained, human adult bone marrow mononuclear cells were freshly collected from the iliac bone of normal donor (35-year-old male) as described previously.19 The samples were seeded in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% human serum, 100 units/mL penicillin, and 100 µg/mL streptomycin (Sigma-Aldrich, St Louis, MO), and cultured at 37°C in a humidified atmosphere with 5% CO2. The medium containing nonadherent cells were removed after 3 days of seeding, and medium was changed every 2 or 3 days. When well-developed colonies of fibroblast-like cells appeared and reached 90% confluence, the cells were trypsinized and passed into new 75-cm2 flasks (BD Falcon, BD Biosciences, San Jose, CA) at a density of 0.6 × 106 cells. In addition, cultured cells were incubated with antibodies for CD14, CD34, CD45, CD44, and CD73 (Becton Dickinson,
Franklin Lakes, NJ) and analyzed by flow cytometry (FACS Calibur; BD Biosciences), which is consistent with previous reports.20 The cells of 5 to 10 passage were used in the study.
Pretreatment of BM-MSCs With Inflammatory Factors When BM-MSCs were 80% confluent, BM-MSCs were starved overnight for serum to eliminate the effect of TGF-β isoforms (TGF-β1, -β2, and -β3) in serum before preconditioning. Then the cells were harvested and plated in 12-well plates in a concentration of 0.1 × 106/cells per plate. Cells were divided into 3 groups: (a) control (without intervention); (b) with stimulant alone, tumor necrosis factor-α (TNF-α; 50 ng/mL); (c) with stimulant alone, endotoxin (LPS; 200 ng/mL).21 In each case, mRNA or supernatants centrifuged of cells were harvested after 0-, 12-, 24-, and 48-hour incubation and stored at −80°C until use.
RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction For quantitative real-time polymerase chain reaction (qRTPCR), total RNA was isolated from BM-MSCs and cDNA was synthesized using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). The primers used for TGF-β isoforms are shown in Table 1. Reactions were performed using SYBR-Green PCR master mix (Applied Biosystems, Foster City, CA) and the Roche LightCycler instrument and software (Roche, Alameda, CA). Glyceraldehyde-3phosphate-dehydrogenase (GAPDH) was used for an internal control.
Immunocytofluorescence The cells were subcultured into 24-well plates (2 × 104 cells per well). The cells were fixed with 4% paraformaldehyde for 15 minutes and washed 3 times in phosphate-buffer solution (PBS). They were then permeabilized in 1%
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
52
The International Journal of Lower Extremity Wounds 14(1)
Triton-X100 for 30 minutes and washed 3 times in PBS buffer. Nonspecific binding was blocked with 10% goat serum for 1 to 2 hours at room temperature. In addition, the cells were, respectively, incubated overnight at 4°C with the primary monoclonal antibodies, including anti-TGF-β1 antibody (8-25 µg/mL; Abcam, Cambridge, MA), anti-TGF-β2 antibody (1 µg/mL; Abcam), and anti-TGF-β3 antibody (5 µg/mL; Abcam). Then, the samples were washed with PBS 3 times and incubated with a Cy3-conjugated secondary antibody for 1 to 2 hours followed by counterstaining with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Roche Molecular Biochemicals). The numbers were examined at at least 5 high power fields per well.
Quantification of Quantifying TGF-β Protein in Culture Supernatants BM-MSCs were pretreated and incubated for 6, 12, 24, and 48 hours in serum-free (SF) fresh medium in the presence or absence of different cytokines as described above. Supernatants were then collected by centrifugation. The level of TGF-β isoforms in CM supernatant was tested by enzyme-linked immunosorbent assay (ELISA) following the manufacturer-recommended protocol (BlueGene; http:// www.bluegene.cc/).
Preparation of Human BM-MSC Conditioned Media The passage 5 to 10 human BM-MSCs were grown in DMEM with 10% human serum in 6-cm tissue culture dishes. When BM-MSCs were 80% confluent, the cells were starved overnight for serum. Then the cells were harvested and replanted in 12-well plates in a concentration of 1 × 105 cells per plate and incubated with 1 mL SF DMEM per dish for 24 hours. From this preparation, CM was collected by pretreatment of human BM-MSCs with TNF-α or LPS (TNF-α, 50 ng/mL; LPS, 200 ng/mL), centrifuged at 5000 rpm for 10 minutes, and stored at −80°C until use. The preferred duration of incubation was determined by ELISA data of TGF-β isoforms in CM. In addition, to assess the effect of TGF-β3 of human keloid fibroblasts, CM was processed by human TGF-β and TGF-β3 antibody (R&D Systems, Minneapolis, MN), through which TGF-β and TGF-β3 of CM was neutralized. The concentrations of TGF-β and TGF-β3 antibody were consistent with that of TGF-β and TGF-β3 of CM in every assay.
Human Keloid Fibroblast Culture The study was approved by the Medical and Ethics Committees of Chinese People’s Liberation Army (PLA) General Hospital (Beijing, China), and each patient and donor signed an informed consent form before enrolling in
the study. Six patients (3 males and 3 females, age from 20 to 38 years) had not received previous treatment for keloids. The location of keloid lesions were on the shoulder, chest, and dorsum. Fibroblast cultures were established as described.22,23 Samples were repeatedly rinsed in sterile DMEM containing with an antibiotic/antimycotic preparation. Subsequently, the tissues were cut into 5 mm × 5 mm small pieces, and then the pieces were incubated in DMEM with 0.5% dispase overnight at 4°C. After the epidermis was removed, the dermis was digested in DEME with 0.1% collagenase type I for 4 hours at 37°C. Digestion action was quenched by DMEM. Then, the tissues were cultured in DMEM with 1% penicillin–streptomycin (Sigma) and 10% human serum in a humidified incubator (Sanyo, Sakata, Japan) with 5% CO2 and at 37°C. The cells were used in the experiments for 3 to 5 passages.
Human Keloid Fibroblast Proliferation Assay To determine soluble factors released by BM-MSCs influencing human keloid fibroblasts, the metabolic activity of cells was tested by Cell Counting Kit-8 assay kit (CCK-8). The cells were plated in 96-well culture plates (Corning, NY) at a concentration of 2 × 103 cells/well in a total volume of 0.2 mL growth medium. Cells were quiesced in SF media for 24 hours before experimentation, and then the cells were, respectively, incubated with control (DMEM serum-free), CM, BM-MSC CM neutralized with TGF-β3 (TGF-β3 blocked), and BM-MSC CM neutralized with TGF-β (TGF-β blocked). TGF-β or TGF-β3 neutralizing antibody was added in BM-MSC CM about 5 minutes before the experiment starting. Plates were incubated for 24 hours at 37°C in a humidified atmosphere with 5% CO2. After the treatment period, the quantity of water-soluble formazan product present was determined on a microplate reader (Beckman) atλ = 490 nm for each well. All assays were carried out in at least 3 parallels and repeated 3 times.
Fibroblast Coculture Experiments Target human keloid fibroblasts were seeded at 5 × 105 cells/well on the bottom surface of 6-well plates and were cultured in SF media for 24 hours. Subsequently, SF media (control), CM, BM-MSC CM neutralized with TGF-β3, or BM-MSC CM neutralized with TGF-β were added. After 24 hours, the media of all wells were aspirated. The human keloid fibroblasts were trypsinized for the next experiments. Total RNA and protein was isolated from fibroblasts and the expression of α-SMA and type I collagen was measured by qRT-PCR as described above and Western blot. The primers are shown in Table 1. In addition, the cells were resuspended in trypan blue and calculated using a hemocytometer. Nonviable cells were stained blue. The cell number was
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
53
Wu et al counted using the following formula: C = (Av − Av1) × n × 104 cells/mL, where C is the cell concentration, Av is the total average number of cells in 4 corners of hemocytometer counted, Av1 is the average number of trypan blue stained cells in 4 corners of hemocytometer counted, and n (number) is the dilution factor.
Protein Isolation and Western Blot For the detection of protein expression, human keloid fibroblasts were harvested and lysed in cold cell lysis buffer for 30 minutes on ice as described previously.24 The amount of protein was determined using the Bio-Rad protein assay kit (Bio-Rad, Hercules, CA). Then, samples containing equal amounts of proteins (20-25 µg) were subjected to 10% sodium dodecylsulfate-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore, Eschborn, Germany). Subsequently, the proteins were blocked with 5% fat-free milk at room temperature, and then were incubated with antibodies against α-SMA (1:500 dilution; Sigma, St Louis, MO), type I collagen (1:250 dilution; Santa Cruz Biotechnology, Santa Cruz, CA), or β-actin (1:200 dilution; Santa Cruz Biotechnology) overnight at 4°C. The membranes were then incubated with appropriate secondary antibodies for 1 hour at room temperature. Signals were visualized using an enhanced chemiluminescence detection system (ECL; Amersham Biosciences, Piscataway, NJ). Protein levels were normalized against the intensity of the β-actin signal. Relative optical density of protein bands was measured after subtracting the film background.
Isolation, Expansion, and Characterization of Murine BM-MSCs In Vitro All animal procedures were approved under the guidelines of the Institutional Animal Care and Use Committee of Chinese PLA General Hospital (Beijing, China). Bone marrow was harvested from the femurs and tibias of 3- to 4-week-old male C57BL/6 mice (Beijing HFK Bioscience Co). The mononuclear cells of bone marrow were isolated by Ficoll-Paque density gradient. The nucleated cells were plated in plastic tissue culture dishes and incubated in complete minimum essential medium (D-MEM/F-12; Gibco) supplemented with 10% heatinactivated fetal bovine serum (FBS), 1% penicillin/streptomycin, and 1% glutamine, and cultured at 37°C in a humidified atmosphere with 5% CO2. The medium containing nonadherent cells was replaced after 3 days of culture. Then the medium was changed every 2 or 3 days. When reaching 80% confluence, the cells were harvested with 0.05% trypsin-EDTA (Sigma), and the adherent spindle-shaped cells were used for the experiments between the third and fifth passages. As in previous assays, cells expressing typical
BM-MSC-specific cell surface markers such as CD29, CD44, CD90, CD106 while being negative for reactivity to antigens CD34 and CD45 as well as having osteogeneic and adipogeneic differentiation potential25,26 were used in this experiment.
Collection of Murine BM-MSC CM The preparation of murine BM-MSC CM obtained resembled the preparation of human BM-MSC CM described above. Passages 3 to 5 BM-MSCs were seeded in 6-cm tissue culture dishes at a concentration of 1 × 106 cells in a total volume of 1 mL, and then the cells was pretreated with TNF-α or LPS. CM was collected and the level of TGF-β3 was tested by ELISA. Moreover, to assess the effect of TGF-β3 of CM in animal experiments, the protein was neutralized by mouse TGF-β3 antibody (R&D Systems, Minneapolis, MN) and the optimal time of incubation and concentration was chosen on the basis of results by ELISA. Furthermore, for in vivo experiments, CM was further concentrated (50 times) by ultrafiltration using centrifugal filter units with 5 kDa cutoff (Millipore) following the manufacturer’s instructions.
Skin Fibrosis Model and BM-MSC Administration Experiments were performed in sodium pentobarbital anesthetized C57BL/6 mice (7-8 weeks old, female, body weight 20-25 g). The concentration of bleomycin (Nippon Kayaku Company, Tokyo, Japan) was 1 mg/mL in PBS27 and was sterilized by filtration. After hair removal from the dorsal surface and anesthesia, the back skin of mice was treated with subcutaneous injections of bleomycin for 3 weeks, and bleomycin was dosed at 100 µL once a day. Next, wild C57BL/6 mice skin fibrosis models were randomly divided into 4 groups (n = 5 per group): untreated control group, the lesional skin was left untreated; placebo group, 100 µL PBS (0.01 M) was injected into the lesion skin by subcutaneous injection every day for 3 weeks; BM-MSC CM group, 100 µL concentrated (50 times) MSC CM were injected into the lesion skin by subcutaneous injection every day for 3 weeks; BM-MSC CM neutralized with TGF-β3-treated group (TGF-β3 blocked), 100 µL concentrated (50 times) MSC CM neutralized with TGF-β3 were injected into the lesion skin by subcutaneous injection every day for 3 weeks.
Histological Examination (Hematoxylin–Eosin Staining and Masson’s Trichome) At 3 weeks after treatment, skin specimens were harvested after euthanasia and fixed with 10% buffered formalin for paraffin embedding. Five-micrometer-thick paraffin-embedded sections were routinely stained with hematoxylin and eosin and Masson’s trichome for conventional morphological
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
54
The International Journal of Lower Extremity Wounds 14(1)
evaluation. All slides were evaluated in a blinded fashion by 2 independent observers without knowledge of our study design. The skin dermal thickness in each group was determined by image analysis (digital photography and Adobe Photoshop software) from the average of 5 random fields between the epidermal–dermal junction and the dermal–fat junction per skin section.
Immunohistochemical Assay The relative levels of α-SMA-positive cells in bleomycininjected sites were detected in each group. Five-micrometer tissue sections of paraffin-embedded skin tissue were deparaffinized and rehydrated in PBS for 3 minutes. Subsequently, endogenous peroxidase was quenched using 10% H2O2 for 10 minutes at room temperature. To block endogenous mouse immunoglobulins, the sections were blocked with 5% serum for 1 to 2 hours. And then slides were stained with the primary antibody for α-SMA (Abcam) overnight. Then, sections were washed with PBS, incubated with biotinylated secondary antibody (Zhong Shan Golden Bridge Biotechnology, Beijing, China) for 30 minutes, and stained with diaminobenzadine (DAB) for 1 minute. Appropriate control IgG was used. Sections were counterstained with hematoxylin (Sigma), mounted. The slides were examined at at least 5 high power fields per section.
Immunofluorescent Assay Six-micrometer frozen sections were fixed with methanol for 10 minutes and washed for 10 minutes in PBS. For immunofluorescence, following permeabilization in 0.5% Triton-X 100 for 60 minutes, the slides were blocked with 10% goat serum for an hour and incubated with Ki-67 antibody (1:500, Abcam) overnight at 4°C. And then, sections were washed with PBS 3 times and incubated with Cy3-conjugated fluorescent secondary antibodies. Next, counterstaining was performed with DAPI. The percentage of Ki67-positive cells was accomplished by performing counts using digital photography and Adobe Photoshop software for Ki67 and DAPI. Two pathologists who were blinded to the group identity of the slides evaluated the cell proliferation. The average numbers were determined at at least 5 high power fields per group (magnification 200×).
Statistical Analysis Statistical analysis of the data involved using t test for comparison between 2 groups or 1-way ANOVA for comparison of more than 2 groups. The data are presented as the mean ± SEM. A value of P < .05 was considered to be statistically significant.
Results TGF-β Isoforms Released by Human BM-MSCs The expression levels of TGF-β isoforms were analyzed from primary adult human BM-MSCs. After the cells were preprocessed (see Materials and Methods), the mRNA expression levels were measured by qRT-PCR. BM-MSCs expressed significantly greater amounts of TGF-β1 and TGF-β3, but lower amounts of TGF-β2 (Figure 1A). The levels of TGF-β isoforms were significantly greater with stimulant alone (TNF-α or LPS) compared with those without intervention group, and particularly the gene expression of TGF-β1 and TGF-β3 isoforms was almost 3-fold higher at 24 hours after inflammatory factor functioning than the control group. In addition, there were no significant differences for TGF-β levels between TNF-α and LPS. Subsequently, the protein expression of TGF-β isoforms was detected using immunocytofluorescence. As Figure 1B shows, the fluorescence was highest at 24 hours compared with other times (data not shown). Moreover, the expression of protein was similar between TGF-β1 and TGF-β3, and the expression of TGF-β2 was weaker. To determine the protein level of TGF-β isoforms released by BM-MSCs, we performed ELISA analysis in CM under normal conditions and inflammatory environment. The studies showed that TGF-β secreted by BM-MSCs stimulated significantly increase over a 24-hour period under TNF-α or LPS exposure compared with other time points (Figure 1C). TGF-β1 and TGF-β3 concentrations were approximately 2-fold higher compared to those without intervention groups (TGF-β1: 887 ± 41 pg/mL [TNF-α] or 853 ± 25 pg/mL [LPS] vs 421 ± 21 pg/mL, P < .01; TGFβ3: 802 ± 23 pg/mL [TNF-α] or 790 ± 36 pg/mL [LPS] vs 358 ± 16 pg/mL, P < .01), whereas the concentrations of TGF-β2 were obviously lower (119 ± 17 pg/mL [TNF-α] or 112 ± 12 pg/mL [LPS] vs 93 ± 9 pg/mL, P < .05; Figure 2C). In all the cytokines examined, the data demonstrated that similar expression patterns were found at mRNA and protein levels of TGF-β isoforms.
Effects of MSC-Conditioned Media on Human Keloid Fibroblasts In Vitro To investigate the effects of MSCs on human keloid fibroblasts, the cells were respectively maintained with DMEM serum-free (control), CM, BM-MSC CM neutralized with (TGF-β3 blocked), or BM-MSC CM neutralized with TGFβ (TGF-β blocked) for 24 hours. As anticipated, CM from BM-MSCs resulted in a significant reduction in cell metabolic activity compared with control, whereas incubation with anti-TGF-β3 neutralizing antibodies partially inhibited CM activity (Figure 2A). From the assay of cell count, human keloid fibroblasts were enumerated using a hemocytometer.
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
55
Wu et al
Figure 1. TGF-β isoform expression of human BM-MSCs were unregulated in the presence of TNF-α or LPS.
(A) Levels of TGF-β isoform mRNAs (0, 12, 24, and 48 hours) were determined by quantitative real time (*P < .05, #P < .01 vs 0 hours, 12 hours). (B) The protein levels of TGF-β isoforms were examined by immunocytofluorescence at 24 hours. TGF-β isoforms presented as red and the nuclei were counterstained as blue. Magnification 200×. Bar = 100 µm. (C) The protein content of TGF-β isoforms secreted by BM-MSCs was analyzed by ELISA in condition media (6, 12, 24, and 48 hours). Compared with control, TNF-α and LPS significantly increased secretion of TGF-β isoforms in every group, and the TGF-β proteins level is highest at 24 hours. No differences for the protein content were seen between 24 and 48 hours. Data are expressed as mean ± SEM; n = 5.
The counts showed that increased CCK-8 correlates with an increased number of cells (Figure 2B). In addition, the effect was concomitant with a decrease in α-SMA expression, a marker of myofibroblast differentiation, and type I collagen. The data showed that CM inhibited the α-SMA and COL1A1 gene expression (Figure 3A), which implied that it could decrease the activeness of keloid fibroblasts and reduced collagen production. Additionally,
to define the role of TGF-β3 in the antifibrotic effects of MSC CM, we performed experiments in fibroblasts cultured with BM-MSC CM neutralized with TGF-β3. Specific blocking of TGF-β3 enhanced the expression of α-SMA and COL1A1 gene in human keloid fibroblasts and partially abolished the effect of CM. Similarly, blocking of total TGF-β can also promote their expression in human keloid fibroblasts and abrogated the effect of CM in part, while the
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
56
The International Journal of Lower Extremity Wounds 14(1)
Figure 2. Comparison of the effect of TGF-β3 on human keloid fibroblast cultured in different media.
(A) Cell viability as determined by CCK-8 assay (*P < .05 vs control, **P < .01 and #P < .05 vs CM). (B) Cell numbers were enumerated using a hemocytometer (*P < .05 vs control, **P < .01 and #P < .05 vs CM). The data are expressed as mean ± SEM from independent experiments.
Figure 3. The expression of α-smooth muscle actin (α-SMA) and type I collagen was detected in human keloid fibroblasts.
The fibroblasts were treated for 24 hours with serum-free media, CM, BM-MSC CM neutralized with TGF-β3, or BM-MSC CM neutralized with TGFβ, respectively. (A) mRNA levels of α-SMA and type I collagen were significantly reduced in test groups compared with control group by quantitative real-time polymerase chain reaction (*P < .05 and **P < .01 vs control; #P < .05 vs CM group). (B) Protein levels of α-SMA and type I collagen were reduced in test groups compared with control group by western blot (*P < .05 and **P < .01 vs control; #P < .05 vs CM group). The difference is statistically significant (*P < .05). Data are presented as mean ± SEM.
attenuating effects were lower than that of TGF-β3 blocking CM, which showed that other proteins secreted from
BM-MSCs except for TGF-β protein also have the inhibitory effect on keloid fibroblasts. As shown in Figure 3B,
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
57
Wu et al human keloid fibroblasts produced high levels of α-SMA and type I collagen in the control group; while 2 protein expressions appeared, an apparently decrease in CM-treated group and BM-MSC CM neutralized with TGF-β3 highlighted their expression level. Therefore, it is conceivable that MSC CM contribute to both the decrease of the fibroblast viability and the reduction of ECM deposits, and TGFβ3 is responsible for most parts of the antifibrotic effect of MSC secretome.
The dermal thickness was measured to provide a quantitative assessment of elements of fibrosis and scar formation (Figure 5B). The dermal thickness in the placebo group showed almost no change compared with that of untreated control group. In contrast, skin dermal thickness in CM group and BM-MSC CM neutralized with TGF-β3-treated group showed significant decrease in tissue sections compared with that of untreated control skin (307.4 µm and 378.9 µm vs 439.1 µm, P < .05).
Homeostasis Assessment of an Adult Model of Dermal Fibrosis Induced by Bleomycin
Detection of Myofibroblasts
Cutaneous fibrosis formation was consistently and reproducibly produced in adult murine model of skin fibrosis similar to human scleroderma by intradermal injection of bleomycin into the dorsal skin of C57BL/6 mice. After the dorsal skin of murine was treated daily with PBS or bleomycin for 3 weeks, homeostasis model assessment was carried out including abnormal collagen deposition and the measurement of dermal mean thickness. After 3 weeks, lesional skin with bleomycin treatment histologically showed thickening of collagen bundles, an increase in dermal thickness, and subcutaneous fat replaced by connective tissue (Figure 4A). In addition, the dermal mean thickness was measured to provide a quantitative assessment of skin fibrosis at 5 randomly selected fields (Figure 4B) after 3 weeks. The dermal mean thickness with bleomycin treatment showed almost 2-fold greater thickness than with PBS treatment. Therefore, the model of skin fibrosis induced by bleomycin can be used as our experimental model.
Histological Comparison To access the effect of treatment for all the groups, the accumulation, organization of dermal collagen, and the degree of fibrosis were examined after 3 weeks. Representative tissues sections were subjected to hematoxylin–eosin staining and Masson’s trichrome stain, which can detect the areas of mature collagen deposition (Figure 5A). Placebo group consistently displayed abnormal collagen deposition and a lack of normal dermal architecture. Their histological appearance was similar to untreated control lesional skin that had not been injected with any substance. In contrast, BM-MSC CM group and BM-MSC CM neutralized with TGF-β3-treated group failed to display histologic elements of scar formation. Especially, BM-MSC CM group demonstrated restoration of normal dermal architecture and closely resembled, although not identical, the basket-weave pattern of the original tissue. Moreover, the subcutaneous fat was almost replaced by connective tissue in untreated control group and placebo group and was partially preserved in BM-MSC CM group and BM-MSC CM neutralized with TGF-β3-treated group.
To compare the accumulation of myofibroblasts of all groups, the expression of α-SMA was analyzed by immunohistochemistry (Figure 6). In normal skin, quiescent myofibroblasts express little α-SMA and the protein can be observed exclusively in vessels and erector pili muscles. And as shown in Figure 6, the fibrotic skin of untreated control group and placebo group consistently exhibited SMApositive cells and were observed to be distributed throughout the dermis. By comparison, α-SMA-positive myofibroblasts were few in CM group, while the quantity of positive cells expressing α-SMA was more in the area of BM-MSC CM neutralized with TGF-β3 treated.
BM-MSCs Inhibit Proliferation in the Lesion Skin Ki-67, a marker of cellular proliferation, was used to quantify the number of proliferating cells. And as shown in Figure 7, the proliferating cells were significantly higher in the lesion skin of control and placebo groups. In addition, compared to BM-MSC CM neutralized with TGF-β3treated group, MSC CM-treated group exhibited significantly fewer proliferating cells.
Discussion Skin scar caused by mechanical injury or pathological wound is an undesirable consequence of cutaneous wound healing; however, related treatment remains limited and largely ineffective. MSCs have been known to contribute to wound healing and cutaneous homeostasis due to their inherent capacity to secrete growth factors, chemokines, and cytokines, which makes them potential cell therapeutics.28-30 However, much less is known about the MSC cytokines involved in alleviating skin fibrosis or scar. In the present study, we have reported for the first time that human BM-MSC CM significantly reduced the viability of human keloid fibroblasts and decreased expression of α-SMA, suggesting that paracrine factors of BM-MSCs act on proliferation and differentiation of fibroblasts. These effects were also corresponding to a decrease in collagen expression of fibroblasts cocultured with BM-MSC CM.
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
58
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
(A) Histological assessment of lesional skin (HE and Masson’s trichome, original magnification 200×). Scale bars = 50 µm. (B) The dermal thickness was measured by comparing the mean thickness with PBS and bleomycin treatment for 3 weeks. Results are expressed as mean ± SEM. **P < .01 versus PBS group.
Figure 4. Model of skin fibrosis formation induced by PBS or bleomycin in adult mice.
59
Wu et al
Figure 5. Histological assessment of lesional skin after treatment.
(A) Lesional skin was treated without any substance (a-b), and injected with PBS (c-d), BM-MSC CM group (e-f), or BM-MSC CM neutralized with TGFβ3 (g-h). Skin samples were harvested at 3 weeks after treatment, analyzing collagen deposition, and organized by either hematoxylin and eosin (left column) or trichrome staining (right panel). Original magnification 100×. Bar = 100 µm. (B) In addition, dermal thickness was measured for all of groups (mean ± SEM, n = 5, *P < .05 and **P < .01 vs untreated control).
Recent studies have reported that 3 members (TGF-β1, TGF-β2, and TGF-β3) of the TGF-β family were closely related to tissue fibrosis. TGF-β1 and TGF-β2 are widely considered to be potent driver of tissue fibrosis, and TGFβis one of the factors that reduce fibrosis in different organs.31,32 In some related findings, skin scar could be effectively reduced via treatment with antibodies neutralizing endogenous TGF-β1 and TGF-β2, and administration of exogenous TGF-β3 was found to contribute to significantly prompt alleviations in scarring of adult wounds.18,33 Ferguson et al also have demonstrated that prophylactic administration of avotermin (recombinant, active, human TGF-β3) was significantly at work on improving total scar scores at all concentrations versus placebo.34 Our results also provide important potentially valuable insights into the underlying mechanisms of TGF-β signaling in response to BM-MSCs. Our data showed that BM-MSCs can release TGF-β family, in vitro, especially under stimulation of inflammatory factors, which hinted the cells can significantly increase TGF-β family releasing in response to injury and pathological condition. Unraveling the related signaling pathway will hopefully lead to new therapeutic strategies to promote adult scarless wound healing. In addition, to determine whether TGF-β3 was involved in the contribution of BM-MSC CM to human keloid fibroblasts,
we incubated BM-MSC CM with TGF-β3 antibody, and blocking TGF-β3 partly weakened the efficacy of BM-MSC CM. These results supported the fact that TGF-β3 was one of the MSC paracrine factors that mediated fibroblast viability and contributed to the reduction of ECM deposits, and also was one factor alleviating fibrosis. Furthermore, TGFβantibody neutralized BM-MSC CM exhibited an apparently weakened antifibrotic effect, which implied that other proteins secreted from BM-MSCs except for TGF-β protein also had the antifibrosis effect. Hence, we thought that BM-MSC CM can modulate keloid fibroblasts proliferation and prevent collagen accumulation in an environment favorable to fibrosis, and TGF-β3 secreted by BM-MSCs played the critical role in skin scar healing. Many reports have already shown that collagen type I expression, as the major fibrous collagen synthesized by wound fibroblasts, was remarkably upregulated in repair processes. To define the relevance of in vivo collagen production and ECM regulation by BM-MSCs, we used a murine model of dermal fibrosis. Results showed that an apparent fibrotic scar was evident in the murine dorsal skin treated by bleomycin for 3 weeks. After lesional skin of model untreated with any substance or treated with PBS, BM-MSC CM, or BM-MSC CM neutralized with TGF-β3, respectively, for 3 weeks, we observed matrix organization
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
60
The International Journal of Lower Extremity Wounds 14(1)
Figure 6. Immunohistochemical analysis detecting myofibroblasts in skin lesion.
(A) α-SMA staining of tissue sections was examined in untreated control group (a-b), placebo group (c-d), BM-MSC CM group (e-f), and BM-MSC CM neutralized with TGF-β3 (g-h). A light hematoxylin counterstain was used to visualize nuclei. α-SMA-positive cells are indicated by arrowheads. (B) In untreated control group and placebo group, untreated and PBS-treated lesional skin sites exhibited plentiful the positive cells of α-SMA. In contrast, few α-SMA-positive cells appeared in the skin lesion of BM-MSC CM group, and more protein was expressed in BM-MSC CM neutralized with TGFβ3-treated group compared with BM-MSC CM group. Original magnification 100× (a, c, e, g); 200× (b, d, f, h). Bar = 100 µm (a, c, e, g); 50 µm (b, d, f, h). The difference is statistically significant (*P < .05). Data are presented as mean ± SEM. *P < .01 and **P < .001 versus untreated control.
Figure 7. Immunofluorescent staining analysis detecting the proliferating cells in lesion skin.
Quantification of the proliferating cells showed an approximate decrease of 9% on average as a result of CM treated using high-power magnification, and an approximate decrease of 4% in TGF-β3 blocked group, compared with untreated control group and placebo group. Data are presented as mean ± SEM. *P < .01 and **P < .001 versus untreated control.
and collagen arrangement in all the groups. Engraftment of BM-MSC CM was associated with a significant decrease in fibrosis, which showed that the dermis exhibited a unanimous basket-weave organization of collagen arrangement
similar to that in normal skin, whereas in untreated control and placebo group, collagen presented an abnormal parallel organization in the dermis that resembled the hypertrophic scar. Moreover, this antifibrotic effect afforded by BM-MSC CM was apparently weakened by addition of TGF-β3 inhibitors. Meanwhile, in our in vivo setting, we also examined the expression of α-SMA that is the most reliable marker of myofibroblasts. Myofibroblast accumulation is a key finding in the dermis of fibrotic skin, wherein it is thought that the presence of myofibroblasts is consistent with the pathology of fibrotic diseases35 and is capable of synthesizing ECM components, namely, collagen, as well as fibrogenic cytokines and chemokines. Our data demonstrated that α-SMA-positive cells were few in the CM-treated group; however, this effect was abolished partly when experiments were performed with antibody neutralization of TGF-β3. By comparison, a noticeably increased presence was noted of α-SMA distributed throughout the dermis of the lesional skin in untreated control group and placebo group. The data implied that the application of BM-MSC CM may help in regulating ECM balance as well as myofibroblast proliferation and differentiation in fibrotic disease. These results were in accordance with in vitro studies, showing that the
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
61
Wu et al antifibrotic effect of MSCs observed was related to mediation of TGF-β3 acting on fibroblasts proliferation, collagen accumulation, and ECM regulation. Increased myofibroblast accumulation is thought to contribute to the pathogenesis of fibrotic diseases. Myofibroblasts are capable of synthesizing ECM protein, mainly collagen. Using our model of bleomycin-induced fibrosis, we observed that the α-SMA-positive cells were fewer in CM group and TGF-β3 blocked group, when compared with control and placebo group, especially CM group. The findings implied that the application of BM-MSCs could decrease presence of myofibroblasts, regulate the accumulation of collagen, and alleviate matrix production in fibrotic disease. Furthermore, immunofluorescence assay for the proliferation marker Ki-67 has also come to similar conclusions, which showed that a significant decrease of proliferative cells in the CM group. Our study provides the information to indicate BM-MSC CM contains components with antifibrotic potential that could mediate a sequence of events including myofibroblasts proliferation and differentiation as well as collagen deposition and ECM homeostasis in the fibrotic changes in vivo. As well, our study also underlined that the application of BM-MSC CM in vivo significantly improved the morphological and functional parameters of dermal healing 3 weeks after injection. These properties of BM-MSCs add a new dimension to our understanding the mechanisms of action of stem cells in fibrosis. Also, BM-MSC CM exhibited an apparently weakened antifibrotic effect through the inhibition of TGF-β3 activation. Thus, we speculate that BM-MSC CM may modulate the development of skin fibrosis in virtue of TGF-β3 effects, at least in part. Of note, although TGF-β3 secreted by BM-MSCs indeed may account for most of the antifibrotic effect, it seems unlikely that it could be only relevant efficient ingredient in terms of reducing skin fibrosis and improving dermal wound healing. The beneficial effects from the paracrine factors of BM-MSCs remain partly unidentified and multiple factors might function synergistically. However, it is possible that TGF-β3-engineered MSCs might exert more powerful antifibrotic effect compared with common MSCs. In conclusion, we have shown that antifibrotic paracrine effects of BM-MSC CM may modulate fibroblasts proliferation and prevent collagen accumulation by mediating TGF-β3dependent activation. These findings open new perspectives regarding the mechanisms of action of MSCs in alleviating skin fibrosis and provide a potential therapeutic strategy for cutaneous scar treatment. Declaration of Conflicting Interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding This study was supported in part by the National Nature Science Foundation of China (81401599, 81121004, 81230041 and 81372066), Youth Leading Scholar Supporting Program in General Colleges and Universities of Heilongjiang Province (1254G064).
References 1. Gurtner GC, Werner S, Barrandon Y, Longaker MT. Wound repair and regeneration. Nature. 2008;453:314-321. 2. Larson BJ, Longaker MT, Lorenz HP. Scarless fetal wound healing: a basic science review. Plast Reconstr Surg. 2010;126:1172-1180. 3. Mias C, Lairez O, Trouche E, et al. Mesenchymal stem cells promote matrix metalloproteinase secretion by cardiac fibroblasts and reduce cardiac ventricular fibrosis after myocardial infarction. Stem Cells. 2009;27:2734-2743. 4. Gabbiani G. The myofibroblast in wound healing and fibrocontractive diseases. J Pathol. 2003;200:500-503. 5. Brown RD, Ambler SK, Mitchell MD, Long CS. The cardiac fibroblast: therapeutic target in myocardial remodeling and failure. Annu Rev Pharmacol Toxicol. 2005;45:657-687. 6. Al-Nbaheen M, Vishnubalaji R, Ali D. Human stromal (mesenchymal) stem cells from bone marrow, adipose tissue and skin exhibit differences in molecular phenotype and differentiation potential. Stem Cell Rev. 2013;9:32-43. 7. Parekkadan B, Milwid JM. Mesenchymal stem cells as therapeutics. Annu Rev Biomed Eng. 2010;12:87-117. 8. Baraniak PR, McDevitt TC. Stem cell paracrine actions and tissue regeneration. Regen Med. 2010;5:121-143. 9. Timmers L, Lim SK, Arslan F, et al. Reduction of myocardial infarct size by human mesenchymal stem cell conditioned medium. Stem Cell Res. 2007;1:129-137. 10. Li L, Zhang Y, Li Y, et al. Mesenchymal stem cell transplantation attenuates cardiac fibrosis associated with isoproterenolinduced global heart failure. Transpl Int. 2008;21:1181-1189. 11. Ortiz LA, Gambelli F, McBride C, et al. Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci U S A. 2003;100:8407-8411. 12. Kim SY, Lee JH, Kim HJ, et al. Mesenchymal stem cellconditioned media recovers lung fibroblasts from cigarette smoke-induced damage. Am J Physiol Lung Cell Mol Physiol. 2012;302:L891-L908. 13. Oyagi S, Hirose M, Kojima M, et al. Therapeutic effect of transplanting HGF-treated bone marrow mesenchymal cells into CCl4-injured rats. J Hepatol. 2006;44:742-748. 14. Abdel Aziz MT, Atta HM, Mahfouz S, et al. Therapeutic potential of bone marrow-derived mesenchymal stem cells on experimental liver fibrosis. Clin Biochem. 2007;40:893-899. 15. Ninichuk V, Gross O, Segerer S, et al. Multipotent mesenchymal stem cells reduce interstitial fibrosis but do not delay progression of chronic kidney disease in collagen4A3-deficient mice. Kidney Int. 2006;70:121-129. 16. Semedo P, Correa-Costa M, Cenedeze MA, et al. Mesenchymal stem cells attenuate renal fibrosis through immune modulation and remodeling properties in a rat remnant kidney model. Stem Cells. 2009;27:3063-3073.
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
62
The International Journal of Lower Extremity Wounds 14(1)
17. Watson SL, Marcal H, Sarris M, Girolamo ND, M Coroneo TC, Wakefield D. The effect of mesenchymal stem cell conditioned media on corneal stromal fibroblast wound healing activities. Br J Ophthalmol. 2010;94:1067-1073. 18. Shah M, Foreman DM, Ferguson MW. Neutralisation of TGF-beta 1 and TGF-beta 2 or exogenous addition of TGFbeta 3 to cutaneous rat wounds reduces scarring. J Cell Sci.1995;108:985-1002. 19. Takeda Y, Mori T, Imabayashi H, et al. Can the life span of human marrow stromal cells be prolonged by bmi-1, E6, E7, and/or telomerase without affecting cardiomyogenic differentiation? J Gene Med. 2004;6:833-845. 20. Bocelli-Tyndall C, Bracci L, Spagnoli G, et al. Bone marrow mesenchymal stromal cells (BM-MSCs) from healthy donors and auto-immune disease patients reduce the proliferation of autologous- and allogeneic-stimulated lymphocytes in vitro. Rheumatology. 2007;46:403-408. 21. Crisostomo PR, Wang Y, Markel TA, Wang M, Lahm T, Meldrum DR. Human mesenchymal stem cells stimulated by TNF-α, LPS, or hypoxia produce growth factors by an NF κB- but not JNK-dependent mechanism. Am J Physiol Cell Physiol. 2008;294:C675-C682. 22. Dienus K, Bayat A, Gilmore BF, Seifert O. Increased expression of fibroblast activation protein-alpha in keloid fibroblasts: implications for development of a novel treatment option. Arch Dermatol Res. 2010;302:725-731. 23. Tang B, Zhu B, Liang Y, et al. Asiaticoside suppresses collagen expression and TGF-b/Smad signaling through inducing Smad7 and inhibiting TGF-bRI and TGF-bRII in keloid fibroblasts. Arch Dermatol Res. 2011;303:563-572. 24. Wang S, Wu H, Liu Y, et al. Expression of USP2-69 in mesangial cells in vivo and in vitro. Pathol Int. 2010;60:184-192. 25. Pittenger MF, Mackay AM, Beck SC, et al. Multilineage potential of adult human mesenchymal stem cells. Science. 1999;284:143-147.
26. Colter DC, Class R, DiGirolamo CM, Prockop DJ. Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow. Proc Natl Acad Sci U S A. 2000;97:3213-3218. 27. Yamamoto T, Kuroda M, Nishioka K. Animal model of sclerotic skin. III: histopathological comparison of bleomycininduced scleroderma in various mice strains. Arch Dermatol Res. 2000;292:535-541. 28. Hsiao ST, Asgari A, Lokmic Z, et al. Comparative analysis of paracrine factor expression in human adult mesenchymal stem cells derived from bone marrow, adipose, and dermal tissue. Stem Cells Dev. 2012;21:2189-2203. 29. Baraniak PR, McDevitt TC. Stem cell paracrine actions and tissue regeneration. Regen Med. 2010;5:121-143. 30. Leclerc T, Thepenier C, Jault P, et al. Cell therapy of burns. Cell Prolif. 2011;44(suppl 1):48-54. 31. Liu W, Wang DR, Cao YL. TGF-β: a fibrotic factor in wound scarring and a potential target for anti-scarring gene therapy. Curr Gene Ther. 2004;4:123-136. 32. Seong J, Kim SH, Chung EJ, Lee WJ, Suh CO. Early alteration in TGF-β mRNA expression in irradiated rat liver. Int J Radiat Oncol. 2000;46:639-643. 33. Rhett JM, Ghatnekar GS, Palatinus JA, O’Quinn M, Yost MJ, Gourdie RG. Novel therapies for scar reduction and regenerative healing of skin wounds. Cell. 2008;26:173180. 34. Ferguson MWJ, Duncan J, Bond J, et al. Prophylactic administration of avotermin for improvement of skin scarring: three double-blind, placebo-controlled, phase I/II studies. Lancet. 2009;373:1264-1274. 35. Ludwicka A, Trojanowska M, Smith EA, et al. Growth and characterization of fibroblasts obtained from bronchoalveolar lavage of patients with scleroderma. J Rheumatol. 1992;19:1716-1723.
Downloaded from ijl.sagepub.com at Freie Universitaet Berlin on May 11, 2015
