Colloids and Surfaces B: Biointerfaces 116 (2014) 334–342

Contents lists available at ScienceDirect

Colloids and Surfaces B: Biointerfaces journal homepage: www.elsevier.com/locate/colsurfb

Mesoporous silica shell alleviates cytotoxicity and inflammation induced by colloidal silica particles Jie Wang a , Yuqing Shen a , Ling Bai b , Dan Lv a , Aifeng Zhang a,c , Fengqin Miao a , Meng Tang d,∗∗ , Jianqiong Zhang a,∗ a

Key Laboratory of Developmental Genes and Human Disease, Ministry of Education, Department of Microbiology and Immunology, Medical School, Southeast University, Nanjing 210009, China b State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210009, China c Department of Pathology, Medical School, Southeast University, Nanjing 210009, China d Key Laboratory of Environmental Medicine Engineering, Ministry of Education, School of Public Health, Southeast University, Nanjing 210009, China

a r t i c l e

i n f o

Article history: Received 27 August 2013 Received in revised form 10 December 2013 Accepted 17 December 2013 Available online 27 December 2013 Keywords: Core–shell mesoporous silica particle Colloidal silica particle Cytotoxicity Inflammation

a b s t r a c t Core–shell mesoporous silica (MPS) materials have been proven to perform multiple simultaneous functions in biological systems and they demonstrate a vast potential for applications in the medical arena. Exploring such extensive potential requires a meticulous evaluation of their interactions with cells. The aim of this study is to investigate the influence of MPS-shells on the viability and activation of human THP-1 macrophages by comparing core–shell MPS with colloidal silica particles. In the present study we find core–shell MPS particles with a solid colloidal silica core and a thin MPS-shell deliver significantly less cytotoxicity than their nonporous counterparts and induce lower expression and release of the pro-inflammatory cytokines in macrophages. Moreover, core–shell MPS particles show no effect on the activation of mitogen-activated protein kinases (MAPKs), while colloidal silica particles do activate MAPKs under identical conditions. The corona of core–shell MPS particles is composed of a greater amount and variety of proteins as compared with colloidal silica particles. The abundant protein composition of the corona may inhibit the cellular toxicity by masking surface silanol groups at the MPS-cellular interface. In conclusion, the MPS-shell significantly alleviates both cytotoxicity and immune responses induced by colloidal silica particles while greatly improving the biocompatibility of colloidal silica materials. © 2013 Elsevier B.V. All rights reserved.

1. Introduction The manufacture of silica materials has several advantages, including straightforward synthesis, economic affordability, ease of isolation, and ease of surface modification [1,2]. These extraordinary features have led to the wide use of silica materials in cosmetics, foods and in medical applications [3–5]. Among various silica particles, mesoporous silica (MPS) can be made into nanoconstructs with variations in nanopore size and geometry [6,7], thus making them appealing candidates as a biomedical platform for nanomedicine. This has led to increased academic and industrial

∗ Corresponding author at: Key Laboratory of Developmental Genes and Human Disease, Ministry of Education, Department of Microbiology and Immunology, Medical School, Southeast University, 87 Dingjiaqiao Road, Nanjing, Jiangsu Province 210009, China. Tel.: +86 025 83272510; fax: +86 025 83272510. ∗∗ Corresponding author at: Key Laboratory of Environmental Medicine Engineering, Ministry of Education, School of Public Health, Southeast University, 87 Dingjiaqiao Road, Nanjing, Jiangsu Province 210009, China. Tel.: +86 025 83272564. E-mail addresses: [email protected] (M. Tang), [email protected] (J. Zhang). 0927-7765/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.colsurfb.2013.12.036

interest in the creation of new MPS materials for therapeutic, diagnostic and combinatory applications. Core–shell MPS materials are composed of a functional inorganic nanoparticle core and a thin MPS-shell. They have proven valuable for the construction of complex nanodevices which may be applied to perform multiple simultaneous functions in biological systems [8]. For example, core–shell mesoporous structures have been used in dual applications such as simultaneous imaging and therapeutic applications [9,10]. The cores of MPS materials include superparamagnetic iron oxide nanocrystals, gold nanoparticles or quantum dots, which can be utilized in magnetic resonance, photonic or optical imaging [9–13]. Meanwhile, MPS particles have been shown as mechanically, thermally and chemically stable matrices to act as suitable carriers for a broad range of biologically active species [6–8]. Furthermore, they display several advantages, such as resistance to harsh physiological conditions in vivo and the potential to release cargoes upon trigger [14,15]. Owing to these properties, core–shell nanoconstructs display great potential for applications in medicine. Therefore, it is important to carefully evaluate their interactions with cells and to characterize the biological responses they induce. Although previous cytotoxicity studies have

J. Wang et al. / Colloids and Surfaces B: Biointerfaces 116 (2014) 334–342

suggested that core–shell MPS materials possess low toxicity, they focused mainly on cellular viability assays [10,13]. Immunotoxicological tests are urgently required before these materials can be deemed entirely innocuous. Macrophages, also known as phagocytes, are strategically located throughout the body tissues and are abundant in organs including liver, lungs, and spleen. They are the primary cells responding to external stimuli and are involved in detecting and fighting against foreign substances. Macrophages respond to foreign substances through a range of activities including the triggering inflammatory responses such as the secretion of cytokines to recruit additional cells [16,17]. Therefore, evaluation of the proinflammatory response of macrophages treated with core–shell MPS materials is of great importance in determining their immunotoxicological assessments. In this work, human THP-1 macrophages were used to explore toxicological responses to core–shell MPS particles. We constructed core–shell MPS particles with a solid colloidal silica core and a thin MPS-shell, and used these to examine effects on cell viability, integrity and apoptosis. Cytokines expression and release were monitored to assess the inflammatory responses of human macrophages when treated with slightly cytotoxic doses. Furthermore, we evaluated the effect of core–shell MPS particles on mitogen-activated protein kinase (MAPK) signal pathways which have been determined to be potentially important in nanomaterialinduced inflammation and in the proliferative response [18–20]. In addition we examined the effects of core–shell MPS as compared with corresponding colloidal silica particles on cytotoxicity and immune response in macrophages. We attributed their diverse effects to be a result of difference in their respective protein corona. 2. Materials and methods 2.1. Silica particles synthesis and physicochemical characterization Colloidal silica particles were prepared utilizing the previously reported modified Stöber methods [21,22]. The core–shell MPS particles with a solid colloidal silica core and a thin MPS-shell were synthesized as previously described [23]. The pore structure of the shell was constructed by using cetyltrimethylammonium chloride (C16 TACl) as surfactants in the starting solution during the growth process. The materials obtained were subjected to calcination to remove the surfactants. The size, shape, morphology and pore structure of core–shell MPS and colloidal silica particles were characterized using a transmission electron microscope (TEM) (JEM-2100, JEOL Ltd., Tokyo, Japan) at 120 kV. The ASAP 2020 Accelerated Surface Area and Porosimetry analyzer (Micromeritics, Norcross, GA, USA) was used to determine the surface area and the pore size distribution of two silica particles. The BET (Brunauer–Emmett–Teller) model was applied to evaluate the specific surface areas, and the BJH (Barret–Joyner–Halenda) method was used to calculate the pore size. Particles hydrodynamic size and zeta-potential were measured in deionized water or cell culture medium using a Zetasizer Nano (Malvern Instruments Ltd., Worcestershire, UK).

335

Differentiation into macrophages was triggered by incubation with 0.2 ␮M PMA (Sigma–Aldrich, St. Louis, MO, USA) at 37 ◦ C for 48 h. Differentiated cells were characterized by adhering to the plastic surface. The nonadherent monocytes were carefully removed by washing twice with phosphate buffered saline (PBS). 2.3. Transmission electron microscopy (TEM) analysis THP-1 macrophages were incubated with 100 ␮g/mL silica particles for 6 h. After incubation, they were washed three times with PBS, and then fixed in 2.5% glutaraldehyde followed by 1.5% osmium tetraoxide. The fixed cells were dehydrated and embedded in epoxy resin. Ultrathin sections were stained with lead citrate and observed by TEM (JEM-1010, JEOL Ltd., Tokyo, Japan). 2.4. Cell viability assay Cell viability was evaluated using the Cell Counting Kit8 (Dojindo, Kamimashiki-gun Kumamoto, Japan). THP-1 macrophages were treated with core–shell MPS particles or colloidal silica particles at five concentrations (25, 50, 100, 200 and 400 ␮g/mL) for 24 h. After incubation, the culture medium was replaced with an equal volume of fresh medium that contain 10% CCK-8. Plates were incubated at 37 ◦ C for 2.5 h and the cell viability was determined by measuring the absorbance at 450 nm using the Microplate Reader (Thermo Fisher, USA). For each concentration, three wells were treated in parallel in each experiment and the experiment was repeated five times. The averaged absorbance readings were normalized to the control cell group (without treatment). 2.5. Measurement of membrane integrity using lactate dehydrogenase (LDH) assay THP-1 macrophages were exposed to core–shell MPS particles or colloidal silica particles at five concentrations (25, 50, 100, 200 and 400 ␮g/mL) for 24 h. LDH activity was determined by using an LDH assay kit (Jiancheng Bioengineering, Nanjing, China) according to the manufacturer’s instructions. 2.6. Reverse transcription-quantitative PCR (RT-qPCR) analysis THP-1 macrophages were treated with core–shell MPS or colloidal silica particles at three concentrations (25, 50 and 100 ␮g/mL) for 24 h. After the treatment, total RNA was extracted using the Trizol protocol (Invitrogen, San Diego, CA, USA). One micrograms of total RNA was reverse transcribed using oligo(dT) primers and MMLV (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Quantitative PCR analysis was performed with an automated sequence detection system (StepOnePlusTM Real-Time PCR System, Applied Biosystems, CA, USA). Expression of human genes ␤-actin, IL-6, IL-23, IL-1␣ and TNF-␣ were analyzed using Power SYBR Green PCR Master Mix (Life technologies, CA, USA). ␤actin was employed as an internal control gene. The primers used in this study are shown in Table 1. The data were analyzed using the 2−CT relative quantitation method [24,25].

2.2. Cell culture and differentiation into macrophages 2.7. Enzyme-linked immunosorbent assay (ELISA) THP-1 (human acute monocytic leukemia cell line) cells were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). THP-1 cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 ␮g/mL streptomycin, and grown at 37 ◦ C in a humidified atmosphere with 5% CO2 and 95% air.

Culture supernatants from three separate wells of THP-1 macrophages were assayed after treatment with silica particles for 24 h. Secretion of human IL-6, IL-1␣ and TNF-␣ was assessed by ELISA (R&D systems, Minneapolis, USA) in accordance with the manufacturer’s instructions.

336

J. Wang et al. / Colloids and Surfaces B: Biointerfaces 116 (2014) 334–342

Table 1 Primer sequences of genes used in this study.

2.10. Identification of the most abundant corona proteins by LC–MS/MS

Genes

Primer sequence (5 –3 )

IL-23

Forward: TACTGGGCCTCAGCCAACT Reverse: TTTGAAGCGGAGAAGGAGAC

IL-6

Forward: TACCCCCAGGAGAAGATTCC Reverse: GCCATCTTTGGAAGGTTCAG

IL-1␣

Forward: ACAAAAGGCGAAGAAGACTGA Reverse: GGAACTTTGGCCATCTTGAC

TNF-␣

Forward: CAGCCTCTTCTCCTTCCTGAT Reverse: GCCAGAGGGCTGATTAGAGA

␤-actin

Forward: AAAGACCTGTACGCCAACAC Reverse: GTCATACTCCTGCTTGCTGAT

After separation by SDS-PAGE, gels were stained with Coomassie Blue. To identify the most abundant protein in the corona by mass spectrometry, the bands of interest were excised, de-stained and digested with proteomics grade trypsin (Sigma, St. Louis, MO, USA) at 37 ◦ C for 18 h. Peptides were desalted and analyzed by liquid chromatography–mass spectrometry (LC–MS/MS) using an MALDITOF/TOF analyzer. Spectra were analyzed using the Swiss-Prot database (www.expasy.org). The data have been searched against bovine protein database.

2.11. Statistical analysis 2.8. Western blot analysis THP-1 macrophages were incubated with silica particles for the indicated times: 1 h 30 min for detecting MAPKs and 24 h for cleaved caspase-3. In brief, whole-cell lysates were obtained by lysing the cells on ice in lysis buffer (50 mM Tris–HCl, 1 mM Na2 EDTA·2H2 O, 200 mM NaCl, 1% NP-40, 0.5% C24 H39 O4 Na, 0.1% SDS) with protease inhibitors (Roche, Mannheim, Germany). The concentration of solubilized protein was quantified by the BCA protein assay kit (Pierce, Rockford, IL, USA) using BSA as the standard. After centrifugation, 20 ␮g of total protein was denatured at 100 ◦ C for 5 min in a protein sample buffer, separated by 10–12% SDSPAGE and then electrophoretically transferred onto polyvinylidene fluoride membrane (Millipore, Bedford, MA, USA). Immunoblot analysis was carried out with primary antibodies against ERK, pERK, JNK, p-JNK, p38, p-p38, cleaved caspase-3 (Cell Signaling, MA, USA) or ␤-actin (Pierce, Rockford, IL, USA), and then with HRP-conjugated goat anti-rabbit or anti-mouse IgG secondary antibodies (Sigma–Aldrich, St. Louis, MO, USA). Signal was detected by enhanced chemiluminescence (Pierce, Rockford, IL, USA).

2.9. Isolation and characterization of the hard corona on the silica particles recovered from cell cultures The hard corona proteins recovered from the core–shell MPS particles or colloidal silica particles incubated with cells in RPMI 1640 medium supplemented with 10% FBS were compared by SDSPAGE gel electrophoresis. The THP-1 cells were primed as described above, washed twice with PBS, and incubated with the core–shell MPS particles or colloidal silica particles in complete medium for 1 h. The corona proteins of those particles were isolated according to the previously described methods [26]. The hard corona proteins were loaded into a 4% stacking gel with a 12% resolving gel and subjected to electrophoresis at 120 V for about 120 min. Total protein was detected using silver stained.

All experiments were repeated at least three times. Data were presented as the mean ± SEM (standard error of the mean). Student’s t-test was used for the determination of statistical significance with P < 0.05 being considered significant.

3. Results 3.1. Physicochemical characterization of materials The TEM images of core–shell MPS (Fig. 1A) and colloidal silica (Fig. 1B) confirmed that both silica particles were almost uniform spheres, with diameters of about 250 nm. The TEM image also revealed that core–shell MPS particles were composed of a nonporous solid colloidal silica core and a thin MPS-shell. The shell thickness of the MPS was about 20 nm, with mesopores running perpendicular to the solid cores. And the diameter of the solid core was about 210 nm (Fig. 1A). The core–shell MPS particles had a BET specific surface area of 83.2 m2 /g and pore volume of 0.24 cm3 /g, while the corresponding value of colloidal silica particles were 19.4 m2 /g and 0.04 cm3 /g (Fig. 1C). The hydrodynamic size and zeta potential of the two silica particles in deionized water, cell culture medium with or without serum were determined. Table 2 summarized the results and suggested a good control of the particle dispersion.

3.2. Macrophages uptake TEM images (Fig. 2) showed that core–shell MPS and colloidal silica particles were located within the cytoplasm of THP-1 macrophages. Both were enclosed in vesicles. With regard to the mechanism of uptake, whether internalization events are mediated by phagocytosis or endocytosis remains unclear. It has been demonstrated that internalization of particles smaller than 1 ␮m can be carried out by both endocytosis and phagocytosis [27,28].

Table 2 Physicochemical characterization of silica particles. Size (TEM)a

Hydrodynamic sizeb (nm)

Core–shell mesoporous silica particles

259.4 ± 4.9 nm

ddH2 O (−) (+)

251.9 ± 3.6 255.3 ± 2.3 288.8 ± 6.0

−28.4 ± 0.9 −19.1 ± 0.2 −11.0 ± 0.1

Colloidal silica particles

253.0 ± 4.4 nm

ddH2 O (−) (+)

275.0 ± 7.3 282.2 ± 0.6 271.6 ± 2.3

−36.1 ± 0.6 −23.7 ± 1.1 −11.9 ± 0.3

Materials

Zeta-potentialb (mV)

In the presence (+) or absence (−) of 10% fetal bovine serum (FBS). a Size distribution was determined by TEM. Approximately 50 particles were counted per sample for size estimation, and the software ImageJ was used for data analysis. b Data are the means ± SD (standard deviation) of three independent experiments.

J. Wang et al. / Colloids and Surfaces B: Biointerfaces 116 (2014) 334–342

337

Fig. 1. Transmission electron microscopy images of (A) core–shell MPS, (B) colloidal silica, and (C) N2 adsorption–desorption isotherms of core–shell MPS and colloidal silica particles. MPS, mesoporous silica.

3.3. Cytotoxicity induced by silica particles

3.4. Expression and production of pro-inflammatory cytokines

CCK-8 viability assay revealed that viability of THP-1 macrophages showed a concentration-dependent decrease after incubation with core–shell MPS or colloidal silica particles for 24 h (Fig. 3A). At a concentration of 200 ␮g/mL, both silica particles significantly inhibited the growth of cells compared to untreated controls. When the concentration was at 100 ␮g/mL, the colloidal silica particles significantly decreased cell number (P < 0.05) while the core–shell MPS particles had little effect on cell viability. Over all, the viability of THP-1 macrophages was lower (P < 0.05) when treated for the same amount of time and with the same concentration of colloidal silica particles versus core–shell MPS particles. The amount of lactate dehydrogenase (LDH) released was also evaluated after human THP-1 macrophages were exposed to silica particles for 24 h. When the concentration was greater than or equal to 200 ␮g/mL, both of the silica particles caused considerable membrane damage (Fig. 3B). As compared with core–shell MPS particles, colloidal silica particles produced trend toward greater LDH leakage, however this difference was not statistically significant. To further investigate potential cytotoxicity, we evaluated apoptosis of THP-1 macrophages induced by silica particles at two concentrations (100 ␮g/mL and 200 ␮g/mL) through the measurement of activated caspase-3. The results showed that both silica particles at the concentration of 200 ␮g/mL induced cleavage of pro-caspase to the active form of caspase-3 (Fig. 3C). At a concentration of 100 ␮g/mL, activation of caspase-3 by colloidal silica particles was higher than activation by core–shell MPS particles.

A major activity of macrophages is their participation in the inflammation response of the body’s immune mechanism. The innate immune mechanism is motivated by detection of non-self antigens including foreign particles, resulting in the stimulation of various pro-inflammatory and cell signaling molecules [29,30]. Pro-inflammatory cytokines released from macrophages, such as IL-6, IL-23, IL-1 and TNF-␣, play important roles in the inflammation process. Therefore, the evaluation of pro-inflammatory molecule responses by macrophages treated with silica particles is of great importance in nanotoxicological assessments. To examine the toxicity of silica particles, the expression of pro-inflammatory cytokines IL-6, IL-23, IL-1␣ and TNF-␣ was measured using RT-qPCR on macrophages following treatment with a slightly cytotoxic dose (viability is greater than 85%). When THP-1 macrophages were treated with 100 ␮g/mL of colloidal silica particles, the expression of IL-23 and IL-6 were significantly increased (P < 0.05) (Fig. 4A and B). Although IL-1␣ and TNF-␣ did not show a significantly increase at 100 ␮g/mL of colloidal silica particles, they exhibited a similar trend of upregulation upon treatment (Fig. 4C and D). On the contrary, core–shell MPS particles showed much less induction of all four pro-inflammatory cytokines expression as compared to the colloidal particles when delivered at the same concentration (P < 0.05) (Fig. 4). To further evaluate the release of these cytokines from THP-1 macrophages, we measured the concentration of IL-6, IL-1␣ and TNF-␣ in the culture medium by ELISA. Colloidal silica particles at 100 ␮g/mL induced significantly greater IL-6, IL-1␣ and TNF-␣ production than control (without treatment), whereas core–shell

338

J. Wang et al. / Colloids and Surfaces B: Biointerfaces 116 (2014) 334–342

Fig. 2. Representative TEM images of the uptake of silica particles by human THP-1 macrophages at 100 ␮g/mL and 6 h incubation. (A) Medium control; (B) core–shell MPS particles; (C) enlargement of the area depicted by a rectangle in panel B; (D) colloidal silica particles; (E) enlargement of the area depicted by a rectangle in panel D. The arrows indicate vesicles with particles encapsulated within them. MPS, mesoporous silica.

MPS particles did not increase the release of IL-6, IL-1␣ and TNF-␣ (Supplementary Fig. S1). Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.colsurfb.2013.12.036.

3.5. Activation of MAPK Mitogen-activated protein kinases (MAPKs) are key intercellular mediators involved in directing cellular response to a diverse array of stimuli, such as mitogens, stress, heat shock and

Fig. 3. Effects of core–shell MPS and colloidal silica particles on the cytotoxicity in human THP-1 macrophages. (A) CCK8 assay results in cells treated with the two different types of silica particles at 25–400 ␮g/mL concentrations for 24 h. (B) The concentration dependent membrane damage as determined by LDH leakage from THP-1 macrophages exposed to silica particles at 24 h. (C) The blot was examined with anti-cleaved caspase-3 antibody. Data were the mean ± SEM of at least three independent experiments. Statistical significance was indicated by: *P < 0.05 particles treated cells compared with untreated cells, # P < 0.05 core–shell MPS particles treated cells compared with colloidal silica treated cells. LDH, lactic dehydrogenase; MPS, mesoporous silica.

J. Wang et al. / Colloids and Surfaces B: Biointerfaces 116 (2014) 334–342

339

Fig. 4. Effects of core–shell MPS and colloidal silica particles on mRNA expression of pro-inflammatory cytokines. (A) IL-23, (B) IL-6, (C) IL-1␣ and (D) TNF-␣ in macrophages treated with either core–shell MPS particles or colloidal silica particles at 25–100 ␮g/mL concentrations for 24 h. Data were the mean ± SEM of three independent experiments. Statistical significance was indicated by: *P < 0.05 particles treated cells compared with untreated cells, # P < 0.05 colloidal silica treated cells compared with core–shell MPS particles treated cells. MPS, mesoporous silica.

pro-inflammatory cytokines [31]. MAPK pathways, key mechanisms of inflammatory signal transduction in eukaryotic cells, also play a crucial role in many aspects of immune mediated inflammatory responses [32]. To determine the effect of core–shell MPS and colloidal silica particles on this important signal pathway, we studied the phosphorylation of three types of MAPKs: ERK, JNK and p38. Treatment with core–shell MPS particles induced much less activation of MAPK at concentrations ≤ 100 ␮g/mL. However, colloidal silica particles induced phosphorylation of ERK, JNK and p38 at concentrations below 50 ␮g/mL (Fig. 5). These results showed that MAPK pathway activation was much more sensitive to colloidal silica particles than to core–shell MPS.

Fig. 5. Effects of core–shell MPS and colloidal silica particles on MAPKs activation. Macrophages were stimulated with either core–shell MPS particles or colloidal silica particles at 25–100 ␮g/mL concentrations for indicated times. The phosphorylation of ERK, JNK and p38 was analyzed by Western blot. MPS, mesoporous silica.

3.6. Protein corona on the silica particles recovered from cell cultures SDS-PAGE was used to detect proteins on both silica particles (100 ␮g/mL) recovered from 1 h incubation in cell culture medium (RPMI-1640 medium supplemented with 10% FBS). The gels were stained using silver nitrate to identify protein corona content. Both protein isolates from core–shell MPS particles and colloidal silica particles showed complex band patterns, indicating that the adsorbed protein layer consists of a number of different proteins spanning a range of densities (Fig. 6A). A protein with molecular weight around 70 kDa was the most abundant in the corona (Fig. 6A and B). We excised these two bands (Bands A and B in Fig. 6B) for further identification by liquid chromatography–mass spectrometry (LC–MS/MS). The results showed that the most abundant protein in the corona of both silica nanoparticles was bovine serum albumin (BSA) (Fig. 6C), which was observed in previous studies when silica materials were dispersed in complete cell culture medium or plasma [26,33]. Then we used BSA to study the silanol–protein interaction by Fourier transform infrared spectroscopy (FTIR). After BSA adsorption, the FTIR spectra of both silica particles exhibited the characteristic peaks of BSA besides their own peaks (Supplementary Fig. S2). The data further confirmed that silanol-groups on silica particles can interact with proteins. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.colsurfb.2013.12.036. Protein binding visualized by gel electrophoresis also demonstrated that the mesoporous shell caused an increase in the net lane quantity and intensity, indicating the pores of MPS could adsorb more proteins (Fig. 6A and B). Since lots of proteins can be adsorbed into the pores of the mesoporous shell, the core–shell MPS particles and cells can align perfectly, and the cellcontactable surface by these particles is minimal [34]. This could be one of the reasons why the MPS-shell alleviated cytotoxicity and inflammation induced by colloidal silica particles in this study.

340

J. Wang et al. / Colloids and Surfaces B: Biointerfaces 116 (2014) 334–342

Fig. 6. Protein corona on the silica particles in complete medium. (A) Silver stained gel used to detect eventual presence of proteins on particles. Isolation and characterization of protein corona on silica particles (100 ␮g/mL) recovered from cell cultures exposed for 1 h in RPMI-1640 medium supplemented with 10% FBS. (B) Coomassie Blue stained gel used to recover the corona proteins for identification by mass spectrometry. The bands of interest in rectangular boxes were excised from the gel and analyzed by LC–MS/MS. (C) The mass spectrometry data have been searched against a bovine database. The result showed the most abundant bovine protein in the corona formed on the particles in complete medium, with their Accession number in Uniprot database (Accession, RSp), their molecular weight (MW) and spectral counts. The numbers in brackets represents spectral counts of proteins on colloidal silica particles. Lane 1 – molecular marker; lane 2 – hard corona of core–shell MPS particles; lane 3 – hard corona of colloidal silica particles.

4. Discussion Core–shell MPS nanoconstructs hold promise as multifunctional diagnostic and therapeutic agents [9–13]. The unique MPS-shell is one of the attractive properties that have caused a broadening interest in their application to biotechnology. Their large internal volume allow for high adsorption of vehicles which could include drugs or genes [35–37]. However, the effective application of core–shell MPS particles remains hampered by a limited understanding of their interactions with cells and of the biological responses they induce. Further cytotoxicity study and immunotoxicological tests are urgently required to provide more information for the clinical application of these materials. Liu et al. [38] have reported that core–shell MPS nanoparticles mainly accumulated in mononuclear phagocytic cells in the liver and spleen after intravenous injection in mice. So the principal purpose of this research is to evaluate the cytotoxicity of core–shell MPS particles and their induced inflammatory response in human THP-1 macrophages in vitro. In addition, we investigated effects of the corresponding colloidal silica particles in macrophages, and made a comparison with core–shell MPS particles. Data obtained from in vitro CCK-8 and LDH assay revealed that both core–shell MPS and colloidal silica particles showed a concentration-dependent decrease of cell numbers when taken by the human THP-1 macrophages, which is consistent with past studies using other cell-types [19,39,40]. When the concentration was above 100 ␮g/mL, core–shell MPS particles showed significantly less cytotoxicity than colloidal silica particles when treated with

the same dose. However, no obvious cytotoxicity was detected for both particles when the concentration was below 50 ␮g/mL (Fig. 3A and B). The cell number decrease only by 14% when treated with 100 ␮g/mL of colloidal silica particles while it did not change with 100 ␮g/mL of core–shell particles. Therefore, silicaparticle-induced immune responses in human THP-1 macrophages were investigated at lower concentration (25, 50 and 100 ␮g/mL) at which cell viability was not obviously reduced in this study. Core–shell MPS particles showed significantly less induction of proinflammatory cytokines than colloidal silica particles at these low cytotoxic doses, suggesting that the MPS-shell not only alleviated cell cytotoxicity, but also reduced inflammation induced by conventional colloidal silica particles. To further expand this work and to gain a deeper understanding of cellular stress variation at the molecular level, we investigated the activation of MAPK signaling pathways upon treatment with silica particles. In mammalian macrophages, MAPKs are key intercellular mediators involved in directing cellular response to a diverse array of stimuli and play a crucial role in many aspects of immune mediated inflammatory responses [31,32]. Mohamed et al. [18] have reported that A549 cells showed a gene stress response when exposed to silica nanoparticles which significantly increased the level of phosphorylated JNK as well as p38. Liu et al. [19] have demonstrated that silica nanoparticles induced dysfunction of endothelial cells through oxidative stress via the JNK pathway. It also has been reported that the activation of MAPKs in mouse J774A.1 macrophages by silica nanoparticles was apparently responsible for the expression of pro-inflammatory factors

J. Wang et al. / Colloids and Surfaces B: Biointerfaces 116 (2014) 334–342

[20]. However, these effects may be easily overlooked using high amounts of nanoparticles [41]. In this study, colloidal silica particles activated MAPK signaling pathways in human THP-1 macrophages more robustly, as compared with core–shell MPS particles at nonlethal doses (25 ␮g/mL and 50 ␮g/mL). These results suggest that the reduced activation of MAPKs induced by core–shell MPS particles could be responsible for the decreased inflammatory response before cell viability was deteriorated. When a nanomaterial enters a physiological environment, such as blood, interstitial fluid, and complete medium, proteins rapidly adsorb to its surface and form what is known as the protein corona [42]. The protein corona alters the size and interfacial composition of a nanomaterial, giving it a biological identity that is distinct from its synthetic identity. The biological identity determines the physiological response including signaling, kinetics, transport, accumulation, and toxicity. The structure and composition of the protein corona depends on the synthetic identity of the nanomaterial [43,44]. The representative difference in synthetic identity between core–shell MPS and colloidal silica particles is the porous shell. Our results showed that hard corona recovered from core–shell MPS particles consisted of more types and greater quantities of proteins than that on colloidal silica particles (Fig. 6A and B). It has been suggested that while the mesoporous SiO2 has a drastically larger total surface area than its nonporous counterparts due to the pores, the cell-contactable surface area, which is decreased by adsorbing abundant proteins and molecules into the pores, is more important in deciding a nanoparticles’ cellular impact [34]. In this study, more abundant proteins adsorption into the pores of the MPS-shells might cover the silanol groups on the cell-contactable surface of the core–shell MPS particles, thus conferring less cytotoxicity than their nonporous counterparts. Similarly, some authors have reported that other types of MPS nanoparticles had less impact on mouse immune cells (macrophages or mastocytes) than the nonporous silica nanoparticles [20,34]. MPS nanoparticles also showed lower hemolytic activity than their nonporous counterparts of a similar size [45]. Future studies are needed to further elucidate the mechanism of their different biological effects.

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16] [17]

[18]

5. Conclusion [19]

Core–shell MPS and colloidal silica particles are able to interact with human THP-1 macrophages and induce different cytotoxic effects. Core–shell MPS particles show lower cytotoxicity and induce less inflammation than their nonporous counterparts, possibly due to fewer silanol groups on the cell-contactable surface of the MPS-shells by adsorbing a greater abundance of proteins. MPS-shells could improve colloidal silica particles’ biocompatibility in vitro, and would play a key role for future biomedical application. Acknowledgments

[20]

[21] [22]

[23]

[24] [25]

This study was supported by Grant from the National Basic Research Program of China [2011CB933404]. Thanks to Michael T. Maloney, Ph.D. for critical reading of the manuscript. Thanks to Professor Youji He and Jianfei Sun Ph.D. for their suggestions.

[26]

[27]

References [28] [1] K.S. Rao, K. El-Hami, T. Kodaki, K. Matsushige, K. Makino, A novel method for synthesis of silica nanoparticles, J. Colloid Interface Sci. 289 (2005) 125–131. [2] R.P. Bagwe, L.R. Hilliard, W. Tan, Surface modification of silica nanoparticles to reduce aggregation and nonspecific binding, Langmuir 22 (2006) 4357–4362. [3] C. Barbe, J. Bartlett, L. Kong, K. Finnie, H.Q. Lin, M. Larkin, S. Calleja, A. Bush, G. Calleja, Silica particles a novel drug-delivery system, Adv. Mater. 16 (2004) 1959–1966. [4] D.J. Bharali, I. Klejbor, E.K. Stachowiak, P. Dutta, I. Roy, N. Kaur, E.J. Bergey, P.N. Prasad, M.K. Stachowiak, Organically modified silica nanoparticles: a nonviral

[29]

[30]

341

vector for in vivo gene delivery and expression in the brain, Proc. Natl. Acad. Sci. U.S.A. 102 (2005) 11539–11544. R. Kumar, I. Roy, T.Y. Ohulchanskyy, L.N. Goswami, A.C. Bonoiu, E.J. Bergey, K.M. Tramposch, A. Maitra, P.N. Prasad, Covalently dye-linked, surface-controlled, and bioconjugated organically modified silica nanoparticles as targeted probes for optical imaging, ACS Nano 2 (2008) 449–456. I.I. Slowing, B.G. Trewyn, S. Giri, V.Y. Lin, Mesoporous silica nanoparticles for drug delivery and biosensing applications, Adv. Funct. Mater. 17 (2007) 1225–1236. M. Stromme, U. Brohede, R. Atluri, A.E. Garcia-Bennett, Mesoporous silicabased nanomaterials for drug delivery: evaluation of structural properties associated with release rate, Wiley Interdiscip. Rev. Nanomed. Nanobiotechnol. 1 (2009) 140–148. N. Knezevic, E. Ruiz-Hernández, W. Hennink, M. Vallet-Regi, Magnetic mesoporous silica-based core/shell nanoparticles for biomedical applications, RSC Adv. 3 (2013) 9584–9593. M. Liong, J. Lu, M. Kovochich, T. Xia, S.G. Ruehm, A.E. Nel, F. Tamanoi, J.I. Zink, Multifunctional inorganic nanoparticles for imaging, targeting, and drug delivery, ACS Nano 2 (2008) 889–896. Y. Chen, H. Chen, D. Zeng, Y. Tian, F. Chen, J. Feng, J. Shi, Core/shell structured hollow mesoporous nanocapsules: a potential platform for simultaneous cell imaging and anticancer drug delivery, ACS Nano 4 (2010) 6001–6013. J. Kim, J.E. Lee, J. Lee, J.H. Yu, B.C. Kim, K. An, Y. Hwang, C.-H. Shin, J.-G. Park, J. Kim, Magnetic fluorescent delivery vehicle using uniform mesoporous silica spheres embedded with monodisperse magnetic and semiconductor nanocrystals, J. Am. Chem. Soc. 128 (2006) 688–689. P. Yang, Z. Quan, Z. Hou, C. Li, X. Kang, Z. Cheng, J. Lin, A magnetic, luminescent and mesoporous core–shell structured composite material as drug carrier, Biomaterials 30 (2009) 4786–4795. X. Li, Y. Chen, M. Wang, Y. Ma, W. Xia, H. Gu, A mesoporous silica nanoparticle–PEI–fusogenic peptide system for siRNA delivery in cancer therapy, Biomaterials 34 (2013) 1391–1401. C.Y. Lai, B.G. Trewyn, D.M. Jeftinija, K. Jeftinija, S. Xu, S. Jeftinija, V.S. Lin, A mesoporous silica nanosphere-based carrier system with chemically removable CdS nanoparticle caps for stimuli-responsive controlled release of neurotransmitters and drug molecules, J. Am. Chem. Soc. 125 (2003) 4451–4459. H. Meng, M. Xue, T. Xia, Y.L. Zhao, F. Tamanoi, J.F. Stoddart, J.I. Zink, A.E. Nel, Autonomous in vitro anticancer drug release from mesoporous silica nanoparticles by pH-sensitive nanovalves, J. Am. Chem. Soc. 132 (2010) 12690–12697. P.J. Murray, T.A. Wynn, Protective and pathogenic functions of macrophage subsets, Nat. Rev. Immunol. 11 (2011) 723–737. N. Gao, Q. Zhang, Q. Mu, Y. Bai, L. Li, H. Zhou, E.R. Butch, T.B. Powell, S.E. Snyder, G. Jiang, B. Yan, Steering carbon nanotubes to scavenger receptor recognition by nanotube surface chemistry modification partially alleviates NFkappaB activation and reduces its immunotoxicity, ACS Nano 5 (2011) 4581–4591. B.M. Mohamed, N.K. Verma, A. Prina-Mello, Y. Williams, A.M. Davies, G. Bakos, L. Tormey, C. Edwards, J. Hanrahan, A. Salvati, Activation of stress-related signalling pathway in human cells upon SiO2 nanoparticles exposure as an early indicator of cytotoxicity, J. Nanobiotechnol. 9 (2011) 29. X. Liu, J. Sun, Endothelial cells dysfunction induced by silica nanoparticles through oxidative stress via JNK/P53 and NF-kappaB pathways, Biomaterials 31 (2010) 8198–8209. S. Lee, H.S. Yun, S.H. Kim, The comparative effects of mesoporous silica nanoparticles and colloidal silica on inflammation and apoptosis, Biomaterials 32 (2011) 9434–9443. W. Stöber, A. Fink, E. Bohn, Controlled growth of monodisperse silica spheres in the micron size range, J. Colloid Interface Sci. 26 (1968) 62–69. K.D. Hartlen, A.P. Athanasopoulos, V. Kitaev, Facile preparation of highly monodisperse small silica spheres (15 to >200 nm) suitable for colloidal templating and formation of ordered arrays, Langmuir 24 (2008) 1714–1720. T. Nakamura, M. Mizutani, H. Nozaki, N. Suzuki, K. Yano, Formation mechanism for monodispersed mesoporous silica spheres and its application to the synthesis of core/shell particles, J. Phys. Chem. C 111 (2007) 1093–1100. T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C(T) method, Nat. Protoc. 3 (2008) 1101–1108. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) method, Methods 25 (2001) 402–408. A. Lesniak, F. Fenaroli, M.P. Monopoli, C. Aberg, K.A. Dawson, A. Salvati, Effects of the presence or absence of a protein corona on silica nanoparticle uptake and impact on cells, ACS Nano 6 (2012) 5845–5857. M. Koval, K. Preiter, C. Adles, P.D. Stahl, T.H. Steinberg, Size of IgG-opsonized particles determines macrophage response during internalization, Exp. Cell Res. 242 (1998) 265–273. A.S. Zahr, C.A. Davis, M.V. Pishko, Macrophage uptake of core–shell nanoparticles surface modified with poly(ethylene glycol), Langmuir 22 (2006) 8178–8185. N.G. Bastus, E. Sanchez-Tillo, S. Pujals, C. Farrera, M.J. Kogan, E. Giralt, A. Celada, J. Lloberas, V. Puntes, Peptides conjugated to gold nanoparticles induce macrophage activation, Mol. Immunol. 46 (2009) 743–748. W.-K. Oh, S. Kim, M. Choi, C. Kim, Y.S. Jeong, B.-R. Cho, J.-S. Hahn, J. Jang, Cellular uptake, cytotoxicity, and innate immune response of silica–titania hollow nanoparticles based on size and surface functionality, ACS Nano 4 (2010) 5301–5313.

342

J. Wang et al. / Colloids and Surfaces B: Biointerfaces 116 (2014) 334–342

[31] G. Pearson, F. Robinson, T. Beers Gibson, B.E. Xu, M. Karandikar, K. Berman, M.H. Cobb, Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions, Endocr. Rev. 22 (2001) 153–183. [32] D.W. Hommes, M.P. Peppelenbosch, S.J. van Deventer, Mitogen activated protein (MAP) kinase signal transduction pathways and novel anti-inflammatory targets, Gut 52 (2003) 144–151. [33] S. Tenzer, D. Docter, J. Kuharev, A. Musyanovych, V. Fetz, R. Hecht, F. Schlenk, D. Fischer, K. Kiouptsi, C. Reinhardt, K. Landfester, H. Schild, M. Maskos, S.K. Knauer, R.H. Stauber, Rapid formation of plasma protein corona critically affects nanoparticle pathophysiology, Nat. Nanotechnol. 8 (2013) 772–781. [34] M.A. Maurer-Jones, Y.S. Lin, C.L. Haynes, Functional assessment of metal oxide nanoparticle toxicity in immune cells, ACS Nano 4 (2010) 3363–3373. [35] S.P. Hudson, R.F. Padera, R. Langer, D.S. Kohane, The biocompatibility of mesoporous silicates, Biomaterials 29 (2008) 4045–4055. [36] I.I. Slowing, J.L. Vivero-Escoto, C.-W. Wu, V.S.-Y. Lin, Mesoporous silica nanoparticles as controlled release drug delivery and gene transfection carriers, Adv. Drug Deliv. Rev. 60 (2008) 1278–1288. [37] J.L. Vivero-Escoto, I.I. Slowing, B.G. Trewyn, V.S. Lin, Mesoporous silica nanoparticles for intracellular controlled drug delivery, Small 6 (2010) 1952–1967. [38] T. Liu, L. Li, X. Teng, X. Huang, H. Liu, D. Chen, J. Ren, J. He, F. Tang, Single and repeated dose toxicity of mesoporous hollow silica nanoparticles in intravenously exposed mice, Biomaterials 32 (2011) 1657–1668.

[39] H.L. Herd, A. Malugin, H. Ghandehari, Silica nanoconstruct cellular toleration threshold in vitro, J. Control. Release 153 (2011) 40–48. [40] D. Napierska, L.C. Thomassen, V. Rabolli, D. Lison, L. Gonzalez, M. KirschVolders, J.A. Martens, P.H. Hoet, Size-dependent cytotoxicity of monodisperse silica nanoparticles in human endothelial cells, Small 5 (2009) 846–853. [41] S.J. Soenen, B. Manshian, J.M. Montenegro, F. Amin, B. Meermann, T. Thiron, M. Cornelissen, F. Vanhaecke, S. Doak, W.J. Parak, S. De Smedt, K. Braeckmans, Cytotoxic effects of gold nanoparticles: a multiparametric study, ACS Nano 6 (2012) 5767–5783. [42] T. Cedervall, I. Lynch, S. Lindman, T. Berggard, E. Thulin, H. Nilsson, K.A. Dawson, S. Linse, Understanding the nanoparticle-protein corona using methods to quantify exchange rates and affinities of proteins for nanoparticles, Proc. Natl. Acad. Sci. U.S.A. 104 (2007) 2050–2055. [43] C.D. Walkey, J.B. Olsen, H. Guo, A. Emili, W.C. Chan, Nanoparticle size and surface chemistry determine serum protein adsorption and macrophage uptake, J. Am. Chem. Soc. 134 (2012) 2139–2147. [44] C.D. Walkey, W.C. Chan, Understanding and controlling the interaction of nanomaterials with proteins in a physiological environment, Chem. Soc. Rev. 41 (2012) 2780–2799. [45] Y.S. Lin, C.L. Haynes, Impacts of mesoporous silica nanoparticle size, pore ordering, and pore integrity on hemolytic activity, J. Am. Chem. Soc. 132 (2010) 4834–4842.