Appl Biochem Biotechnol (2014) 172:2012–2021 DOI 10.1007/s12010-013-0659-3
Metabolic Engineering of Escherichia coli for Production of 2-phenylethanol from Renewable Glucose Zhen Kang & Chuanzhi Zhang & Guocheng Du & Jian Chen
Received: 7 October 2013 / Accepted: 27 November 2013 / Published online: 8 December 2013 # Springer Science+Business Media New York 2013
Abstract 2-Phenylethanol (2-PE) is an important aromatic alcohol with a rose-like odor and has wide applications. The present work aims to construct a synthetic pathway for 2-PE synthesis from glucose in Escherichia coli. First, the genes adh1 (encoding alcohol dehydrogenase) and kdc (encoding phenylpyruvate decarboxylase) from Saccharomyces cerevisiae S288c and Pichia pastoris GS115 were investigated in E. coli, respectively, and single overexpression of adh1 or kdc significantly increased 2-PE accumulation. When co-overexpressing adh1 and kdc, 2-PE was increased up to 130 from 57 mg/L. Furthermore, by optimizing coordinated expression of the four committed genes aroF, pheA, adh1 and kdc, 2-PE was improved to 285 mg/L which was the highest production of 2-PE by the recombinant E. coli system. In addition, our results also demonstrated that the tyrB gene, which encodes aromatic-amino-acid transaminase, plays an important role on 2-PE synthesis. Keywords Metabolic engineering . 2-Phenylethanol . Gene expression control . Escherichia coli . L-phenylalanine Z. Kang (*) : G. Du : J. Chen Synergetic Innovation Center of Food Safety and Nutrition, Wuxi 214122, China e-mail: [email protected] Z. Kang : C. Zhang The Key Laboratory of Industrial Biotechnology, Ministry of Education, Jiangnan University, Wuxi 214122, China Z. Kang : C. Zhang : G. Du : J. Chen School of Biotechnology, Jiangnan University, Wuxi 214122, China J. Chen National Engineering Laboratory for Cereal Fermentation Technology, Jiangnan University, Wuxi 214122, China G. Du The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi 214122, China
Appl Biochem Biotechnol (2014) 172:2012–2021
2013
Introduction 2-Phenylethanol (2-PE), an aroma compound with a rose-like odor, has been widely used in perfumery, cosmetics and food industries [1]. In addition, 2-phenylethanol is also considered to be an alternative biofuel because of its advantage of a higher energy density [2]. To date, the majority of the 2-PE currently in use is primarily produced by chemical synthesis. However, chemical synthesis processes are often environmentally unfriendly (high temperature, high pressure and strong acid or alkali) and many unwanted byproducts increase the purify cost. Moreover, according to US and European legislations, chemically synthesized flavor compounds are restricted from being used in beverages, food and cosmetics [3]. Therefore, for these applications, natural 2-PE is always preferred. Naturally, in most cases, concentrations of 2-PE are too low to justify extraction (except for rose oil), resulting in a high price [4]. As a result, microbial production of 2-PE would be much more attractive. In the past, several microbial species have been described as possessing the ability to synthesize 2-PE [1, 5]. In 1992, Jollivet et al. reported that Microbacterium sp. and Brebibacteriumlinens have the ability to synthesize 2-PE [6]. Among the fungi, a multitude of species are known as producers of aroma compounds. Phellinus ignarius, P. laevigatus, P. tremulae, Ischnoderma benzoinum and Geotrichum penicillatum were demonstrated to accumulate 2-PE under specific conditions. However, cultivation process is long and the titer is low [1]. In 2001, Lomascolo et al. discovered that by addition of a precursor L-Phe, Aspergillus niger CIMICC 298302 could accumulate 2-PE to 1,375 mg in 9 days [7]. Subsequently, yeast as a good candidate was extensively investigated for 2-PE transformation from L-Phe [1] and considerable progresses have been achieved by applying many strategies, such as optimization of transformation process, screening of stress-tolerant strain and metabolic engineering of related pathways [8–13]. In addition, Yarrowia lipolytica was also considered to be a novel and promising natural 2-phenylethanol producer [14]. E. coli as the most well known microorganism has been widely applied in industrial biotechnology for production of proteins and biochemicals such as biofuels, organic acid, amino acids, sugar alcohols and biopolymers because of its numerous advantages [15–17]. Applying strategies of metabolic engineering and adaptive evolution, many robust E. coli strains have been developed for many unnatural higher alcohol and compounds [18–20]. Recently, E. coli has been also proposed as a potential candidate for production of aromatic compounds, especially for 2-PE [21, 22]. In this study, we constructed a heterologous pathway (Fig. 1) to produce 2-PE directly from glucose in E. coli. To improve 2-PE production, the involved shikimic acid and branch acid pathways were first optimized by overexpression of the committed enzymes 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase and bifunctional enzyme chorismate mutase (CM)-prephenate dehydratase (PD). Subsequently, two enzymes phenylpyruvate decarboxylase (Kdc) from Pichia pastoris GS115 and alcohol dehydrogenase (Adh1) from Saccharomyces cerevisiae S288c were introduced and investigated. After optimization of the involved key enzymes, a titer of 285 mg/L 2-PE was accumulated from the renewable resource glucose. To our knowledge, it was the highest report in E. coli.
Materials and Methods Bacterial Strains and Plasmids Bacterial strains, plasmids and oligonucleotides used in this study are listed in Tables 1 and 2. E. coli JM109 was applied for molecular cloning and manipulation of plasmids. E. coli BP-42
2014
Appl Biochem Biotechnol (2014) 172:2012–2021
Fig. 1 Schematic representation of 2-PE synthetic pathway from glucose in engineered E. coli. PEP, phosphoenopyruvate; Ery-4P, erythrose-4-phosphate; DAHP, 3-deoxy-D-arabino-hept-2-ulosonate 7-phosphate; CHA, Chorismate; PA, Prephenate; PPA, Phenylpyruvate; PAD, phenylacetaldehyde; 2-PE, 2-phenylethanol; L-Phe, L-phenylalanine; DS, 3-deoxy-7-phosphoheptulonate synthase; CM-PT, Chorismate mutase/prephenate dehydratase; KDC, Phenylpyruvate decarboxylase from Pichia pastoris GS115; ADH, Alcohol dehydrogenase from Saccharomyces cerevisiae S288c
as the parent strain was engineered for producing 2-PE. Gene pheAfbr and aroFwt was amplified from plasmid pAP-B03, genes kdc, and adh1 and adh2 were amplified from genomic DNA of Pichia pastoris GS115 and Saccharomyces cerevisiae S288c, respectively. After digestion, the fragments were subcloned into related plasmid-constructed recombinant plasmids in Table 1. To increase the translation efficiency, the Shine-Dalgarno sequence (AGGAGGA) was artificially added in the upstream of starting codon ATG (Table 2). Media and Culture Conditions E. coli cells were routinely grown in LB medium for 12 h at 37 °C and 200 rpm on rotary shakers. Antibiotic was used at related concentration as required (AmpR 100 μg/L, SpcR 80 μg/L). The seed LB medium contains (g/L) 5 yeast extract, 10 peptone and 10 NaCl. The fermentation medium contains (g/L) 20 glucose, 5 (NH4)2SO4, 3 KH2PO4, 3 MgSO4 ·7H2O, 1 NaCl, 1.5 Na-Citrate, 0.015 CaCl2 ·2H2O, 0.1125 FeSO4 ·7H2O, 0.075 Thiamine-HCl, 0.4 L-Tyr, 3 yeast extract and 1.5 mL/L trace elements solution (TES). TES contained (g/L) 2.0 Al2(SO4)3 · 18H2O, 0.75 CoSO4 ·7H2O, 2.5 CuSO4 ·5H2O, 0.5 H3BO3, 24 MnSO4 ·7H2O, 3.0 Na2MoO4 · 2H2O, 2.5 NiSO4 ·6H2O and 15 ZnSO4 ·7H2O. Shake flask fermentations were carried out in 500 mL Erlenmeyer flask supplied with 50 mL fermentation medium at an agitation of 200 rpm. Calcium carbonate (12 g/L) was added to adjust the pH of the medium. A 10 % (v/v) inoculum from an overnight culture for 12 h was used. For temperature-induced systems, the temperature was initially maintained at 33 °C and elevated to 38 °C when the value of OD600 reached 1.5–2.0. In contrast, the chemical-induced systems were constantly operated at 37 °C with addition of 1 mM IPTG at initial. Samples were taken and measured with an interval of 6 h. Analysis of Fermentation Parameters Optical density (OD) was measured at 600 nm with a spectrophotometer-722 (Third Analytical Instrument Factory, Shanghai, China) after an appropriate dilution. For analyzing 2-PE and phenylacetaldehyde, 5 mL of cell culture was centrifuged (10,000×g for 10 min at 4 °C) and
Appl Biochem Biotechnol (2014) 172:2012–2021
2015
Table 1 Strains and plasmids used in this study Strains and plasmids
Relevant properties or genotype
Source or reference
E. coli JM109
F′traD36 proA+B+ lacIq Δ(lacZ)M15/Δ(lac-proAB) glnV44e14- gyrA96 recA1 relA1 endA1 thi hsdR17
Lab stock
E. coli DH5α
Δ(lacZYA-argF)U169 deoR gyrA96 thi-I hsdR17 supE44 relAI
Lab stock
S. cerevisiae S288c P. pastoris GS115
MATα SUC2 gal2 mal mel flo1 flo8-1 hap1 ho bio1 bio6 his4 Mut+ His- (aox1+, aox2+)
Lab stock Lab stock
Strains
E. coli DHP1
E. coli DH5α harboring pAP-B03
This work
E. coli DHP2
E. coli DH5α harboring pAP-B03 and pCL1920-adh1
This work
E. coli DHP3
E. coli DH5α harboring pAP-B03 and pCL1920-adh2
This work
E. coli DHP4
E. coli DH5α harboring pAP-B03 and pCL1920-kdc
This work
E. coli DHP5
E. coli DH5α harboring pAP-B03 and pCL1920-adh1-kdc
This work
E. coli DCU1
E. coli DH5α harboring pCL1920-pheAfbr-aroFwt
This work
E. coli DCU2 E. coli DCU3
E. coli DH5α harboring pCL1920-pheAfbr-aroFwt and pUC19-adh1 E. coli DH5α harboring pCL1920-pheAfbr-aroFwt and pUC19-kdc
This work This work
E. coli DCU4
E. coli DH5α harboring pCL1920-pheAfbr-aroFwt and pUC19-adh1-kdc
This work
E. coli DCB
E. coli DH5α with deletion of tyrB gene
This work
E. coli DCB1
E. coli DCB harboring pCL1920-pheAfbr-aroFwt
This work
E. coli DCB2 E. coli DCB3
E. coli DCB harboring pCL1920-pheAfbr-aroFwt and pUC19-adh1 E. coli DCB harboring pCL1920-pheAfbr-aroFwt and pUC19-kdc
This work This work
E. coli DCB4
E. coli DCB harboring pCL1920-pheAfbr-aroFwt and pUC19-adh1-kdc
This work
pMD-19 pCL1920
Cloning vector, AmpR SpcR, Plac
Takara Lab stock
pUC19
AmpR, Plac
Lab stock
pAP-B03
pPL450 derivative, containing pheAfbr gene and aroFwt gene
[41]
pCL1920-adh1
pCL1920 containing adh1 gene
This work
Plasmids
pCL1920-adh2
pCL1920 containing adh2 gene
This work
pCL1920-kdc
pCL1920 containing kdc gene
This work
pCL1920-adh1-kdc
pCL1920 containing adh1 gene and kdc gene
This work
pCL1920-pheAfbr-aroFwt pUC19-adh1
pCL1920 containing pheAfbr gene and aroFwt gene pUC19 containing adh1 gene
This work This work
pUC19-kdc
pUC19 containing kdc gene
This work
pUC19-adh1-kdc
pUC19 containing adh1 gene and kdc gene
This work
the supernatant was then filtered with a 0.22 μm syringe filter for analysis. The Agilent 1200 HPLC (Agilent, Santa Clara, USA) system was equipped with a 250×4.6 mm ZORBAX SBAq column (Agilent, Santa Clara, USA), a standard G 1329A autosampler (Agilent, Santa Clara, USA) and a G13158 diode array detector (DAD) (Agilent, Santa Clara, USA). Na2HPO4 (0.138 mol/L). One percent acetonitrile (v/v) adjusted to pH 2.0 with phosphoric acid was used as the mobile phase at a flow rate of 1.0 mL/min. The detection wavelength was 210 nm and the column temperature was maintained at 35 °C. For analyzing amino acids,
2016
Appl Biochem Biotechnol (2014) 172:2012–2021
Table 2 Primers used in this study. The base underlined means the restriction enzyme sites, the base in bold means the Shine-Dalgarno sequence added artificially Primers
Sequence (5′-3′)
adh1-F
AAAACTGCAGGTAAAAGGAGGATATACATATGTCTATCCCAGAAACTCAAAAAGGTGT
adh1-R
CGCGGATCCGAATTTTCGTTTTAAAACCTAAGAGTCACTTTA
adh2-F
CGCGGATCCAAGGAGGATATACATATGTCTATTCCAGAAACTCAAAAAGCC
adh2-R
CGAGCTCGGTACCCGGGTTATTTAGAAGTGTCAACAACGTATCTACCA
kdc-F
TCCCCCGGGAAGGAGGATATACATATGGCCCCAGTTCCAGATATAGCA
kdc-R
CGAGCTCTTAACCTACGATTTTGGCTTTGTTCTTG
aroFwt-F
TCCCCGCGG AAAGGAGGACACGCATGCAAAAAGACGCGCTGAATAACG
aroFwt-R pheAfbr-F
CGCGGATCCCCGCTCGAGTTAAGCCACGCGAGCCGTCA CCCAAGCTTAAAGGAGGACACGCATGACATCGGAAAACCCGTTACT
pheAfbr-R
TGCACTCCAGTCCCCGCGGTCAGGTTGGATCAACAGGCACTA
5 mL of cell culture was centrifuged (10,000×g for 10 min at 4 °C). The supernatant was diluted with trichloroacetic acid (5 g/L) and filtered with a 0.22 μm syringe filter for analysis. Subsequently, amino acids were precolumn derivatized by o-phthaldialdehyde (OPA) and analyzed with the Agilent 1100 HPLC (Agilent, Palo Alto, USA) system equipped with a reverse-phase column (Zorbax Eclipse-AAA) and UV detector (338 nm).
Results and Discussion Tolerance Analysis of 2-PE to E. coli It has been demonstrated 2-PE has inhibitory effects on cell growth of S. cerevisiae, which involved in nutrients uptake, cell membrane damage and reduction in respiratory capacity [13]. As a result, the tolerance investigation of 2-PE to E. coli was firstly carried out. As shown in Fig. 2, an OD600 of to 9.2 was accumulated without addition of 2-PE. When the concentration of 2-PE was below 1.0 g/L, no significant inhibition was observed. However, when 2-PE was increased above 1.0 g/L, remarkable inhibitory effect to cell growth was detected, which was similar with other higher alcohols [23–25]. Correspondingly, many strategies such as genome engineering [18, 20], global factor engineering [26, 27], pump proteins [28], random mutation [29] and adaptive evolution [30, 31] have been developed and intensively utilized for construction of robust E. coli factories to produce alcohols. Therefore, these approaches could also be conducted to engineer E. coli to increase its tolerance capacity. In addition, it was interesting that although a small biomass was accumulated, shorter lag phase occurred when high concentration of 2-PE was added, indicating that low concentration of 2-PE at initial phase might have greater inhibition to cell growth. Construction of 2-PE Synthetic Pathway in L-Phe Producing E. coli To construct 2-PE synthetic pathway, the genes kdc and adh1 which encode phenylpyruvate decarboxylase (Kdc) and alcohol dehydrogenase were amplified from Pichia pastoris GS115 and Saccharomyces cerevisiae S288c and introduced to E. coli. As a consequence, the recombinants E. coli DHP2 (pCL1920-adh1), E. coli DHP3 (pCL1920-kdc), E. coli DHP4
Appl Biochem Biotechnol (2014) 172:2012–2021
2017
Fig. 2 Effect of exogenous 2-PE on E. coli cell growth. Cultures were carried out in LB medium
(pCL1920-adh1-kdc) constructed were comparatively cultured and investigated with the L-Phe producing E. coli DHP1 (pAP-B03) (Fig. 3). As expected, no 2-PE was detected in the parent E. coli BP-43 although high concentration of L-Phe was accumulated (6.06 g/L) (Fig. 3). Interestingly, single overexpression of kdc and adh1 resulted in significant increase of 2-PE which was 32 and 57 mg/L, respectively (Fig. 3). Recently, novel PPA synthetic pathway involved in amino acid aminotransferase was proposed in rose protoplasts [32]. Hence, the results suggested that some natural amino acid aminotransferases and alcohol dehydrogenases might drive the flux from phenylpyruvate to 2-PE in E. coli. In fact, three candidate genes yqhD, yjgB, and yahK have been identified and yqhD has been experimentally confirmed as a broad-substrate alcohol dehydrogenase [33]. Furthermore, the results also confirmed that both kdc and adh1 were essential for 2-PE synthesis. To our anticipation, co-overexpression of kdc and adh1 increased 2-PE up to 130 mg/L (Fig. 3). In comparison, overexpression of the adh2 gene from S. cerevisiae generated no 2-PE accumulation (Fig. 3), which further demonstrated that the alcohol dehydrogenase encoded by adh2 preferentially catalyzes the conversion of ethanol to acetaldehyde but not acetaldehyde to ethanol [34]. Optimization of the 2-PE Synthetic Pathway by Reassembling the Committed Genes To improve microbial productivity of aimed products, many critical genes of the targeted pathway generally require modifications with variety of approaches such as plasmid copy numbers, promoter strength and placement of genes in operons [35–37]. As a consequence, the rate-limiting enzymes pheA, aroF, kdc and adh1 were rationally reassembled with plasmids pCL1920 [38] and pUC19 whose replicons were pSC101 (low copy number) and pMB1 (high copy number). Meanwhile, the orders of the genes were also optimized for genes aligned in operons appear in the same order as they are needed in metabolism [39] and the transcriptional level of the first gene is higher than that of subsequent genes [40]. As shown in Fig. 4, E. coli DCU1 (pCL1920-pheAfbr-aroFwt) accumulated a large amount of L-Phe while no 2-PE was detected throughout the whole cultivation process. In contrast, E. coli DCU2 (pCL1920-pheAfbr-aroFwt, pUC19-adh1) and E. coli DCU3 (pCL1920-pheAfbr-aroFwt, pUC1920-kdc) accumulated 2-PE to 27 and 220 mg/L, respectively (Fig. 4). Impressively, the highest level of 2-PE (285 mg/L) was produced by the recombinant E. coli DCU4 (pCL1920-pheAfbr-aroFwt, pUC19-adh1-kdc), which was 2.2-fold of that of E. coli DHP5 (pAP-B03, pCL1920-adh1-kdc).
2018
Appl Biochem Biotechnol (2014) 172:2012–2021
Fig. 3 Characterization of different recombinant strains with respect to 2-PE. Data are presented as the mean±standard deviation (SD) (n=3)
Moreover, the intermediate phenylacetaldehyde was also comparatively investigated. As shown in Fig. 4, without introduction of the kdc gene, nearly no phenylacetaldehyde was detected. Nevertheless, single overexpression of the kdc gene gave rise to a significantly
Fig. 4 Accumulation of 2-PE by recombinants with modulated overexpression of key enzymes. Data are presented as the mean±SD (n=3)
Appl Biochem Biotechnol (2014) 172:2012–2021
2019
Fig. 5 Accumulation of 2-PE by recombinants with inactivation of the tyrB gene. Data are presented as the mean±SD (n=3)
increased phenylacetaldehyde (96 mg/L), indicating an unbalanced flux arose. When introducing the adh1 gene, phenylacetaldehyde was decreased to 34 mg/L, coupled with an increased 2-PE (Fig. 4). Taken together, the results demonstrated that optimization of the key genes with respect to copy numbers, position in operon and transcriptional strength is of great importance for high-level accumulation of the targeted product. Inactivation of the tyrB Gene Resulted in an Unbalanced Flux To drive more carbon flux to 2-PE, the tyrB gene which encodes aromatic-amino-acid transaminase was inactivated. As anticipated, deletion of the tyrB gene resulted in substantial decrease of L-Phe (0.76 g/L). However, when overexpressing the kdc gene, 2-PE was not increased but dramatically decreased to a low level (Fig. 5). At the same time, the intermediate phenylacetaldehyde was sharply increased to 156 mg/L (Fig. 5) with inhibited cell growth (data not shown). The results suggested that although E. coli equips three genes aspC, hisC and tyrB in charge of conversion of phenylpyruvate and 4-hydroxy-phenylpyruvate to L-Phe and L-Tyr, respectively, tyrB should be the largest contributor. Furthermore, the aromaticamino-acid transaminase encoded by tyrB might play an important role on 2-PE synthesis. Inactivation of the tyrB gene blocked the metabolic flux from phenylpyruvate to L-Phe which leads to high concentration of phenylacetaldehyde and eventually caused poor cell growth [1].
Conclusion In the present work, we cloned the phenylpyruvate decarboxylase (Kdc) from Pichia pastoris GS115 and alcohol dehydrogenase (Adh1) from Saccharomyces cerevisiae S288c and
2020
Appl Biochem Biotechnol (2014) 172:2012–2021
introduced into the L-Phe producing E. coli to construct a synthetic pathway for 2-PE synthesis. Single overexpression of kdc or adh1 could endow E. coli the ability to produce 2-PE and co-overexpression kdc and adh1 improved 2-PE to a titer of 130 mg/L. Furthermore, by optimizing coordinated expression of the four key enzymes aroFfbr, pheAfbr, kdc and adh1, the high titer of 285 mg/L 2-PE was achieved. Moreover, deletion of the tyrB gene resulted in unbalanced flux, large amounts of accumulated phenylacetaldehyde and repressed cell growth, suggesting a critical role of aromatic-amino-acid transaminase encoded by tyrB on aromatic amino acids and 2-PE synthesis. Acknowledgments This work was financially supported by the Major State Basic Research Development Program of China (973 Program, 2014CB745103, 2013CB733602), the National Natural Science Foundation of China (31200020), the National High Technology Research and Development Program of China (2012AA021201), the National Science Foundation for Post-doctoral Scientists of China (2013 M540414), the Jiangsu Planned Projects for Postdoctoral Research Funds (1301010B), the 111 Project and the Priority Academic Program Development of Jiangsu Higher Education Institutions.
References 1. Etschmann, M. M., Bluemke, W., Sell, D., & Schrader, J. (2002). Biotechnological production of 2-phenylethanol. Applied Microbiology and Biotechnology, 59, 1–8. 2. Atsumi, S., Hanai, T., & Liao, J. C. (2008). Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature, 451, 86–89. 3. Xu, P., Hua, D., & Ma, C. (2007). Microbial transformation of propenylbenzenes for natural flavour production. Trends in Biotechnology, 25, 571–576. 4. Hua, D., & Xu, P. (2011). Recent advances in biotechnological production of 2-phenylethanol. Biotechnology Advances, 29, 654–660. 5. Jin, J. Z., Li, H., & Zhang, J. (2010). Improved synthesis of (S)-1-phenyl-2-propanol in high concentration with coupled whole cells of Rhodococcus erythropolis and Bacillus subtilis on preparative scale. Applied Biochemistry and Biotechnology, 162, 2075–2086. 6. Jollivet, N., Bézenger, M. C., Vayssier, Y., & Belin, J. M. (1992). Production of volatile compounds in liquid cultures by six strains of coryneform bacteria. Applied Microbiology and Biotechnology, 36, 790–794. 7. Lomascolo, A., Lesage-Meessen, L., Haon, M., Navarro, D., Antona, C., Faulds, C., & Marcel, A. (2001). Evaluation of the potential of Aspergillus niger species for the bioconversion of L-phenylalanine into 2-phenylethanol. World Journal of Microbiology and Biotechnology, 17, 99–102. 8. Stark, D., Zala, D., Münch, T., Sonnleitner, B., Marison, I., & Von Stockar, U. (2003). Inhibition aspects of the bioconversion of l-phenylalanine to 2-phenylethanol by Saccharomyces cerevisiae. Enzyme and Microbial Technology, 32, 212–223. 9. Eshkol, N., Sendovski, M., Bahalul, M., Katz-Ezov, T., Kashi, Y., & Fishman, A. (2009). Production of 2phenylethanol from L-phenylalanine by a stress tolerant Saccharomyces cerevisiae strain. Journal of Applied Microbiology, 106, 534–542. 10. Seo, W. T., & Ahn, K. C. (2003). Production of phenylethanol from L-phenylalanine by Candida sp S-8. Food Science and Biotechnology, 12, 644–648. 11. Serp, D., von Stockar, U., & Marison, I. W. (2003). Enhancement of 2-phenylethanol productivity by Saccharomyces cerevisiae in two-phase fed-batch fermentations using solvent immobilization. Biotechnology and Bioengineering, 82, 103–110. 12. Wang, H., Dong, Q. F., Meng, C., Shi, X. A., & Guo, Y. H. (2011). A continuous and adsorptive bioprocess for efficient production of the natural aroma chemical 2-phenylethanol with yeast. Enzyme and Microbial Technology, 48, 404–407. 13. Stark, D., Munch, T., Sonnleitner, B., Marison, I. W., & von Stockar, U. (2002). Extractive bioconversion of 2-phenylethanol from L-phenylalanine by Saccharomyces cerevisiae. Biotechnology Progress, 18, 514–523. 14. Celinska, E., Kubiak, P., Bialas, W., Dziadas, M., & Grajek, W. (2013). Yarrowia lipolytica: the novel and promising 2-phenylethanol producer. Journal of Industrial Microbiology & Biotechnology, 40, 389–392. 15. Chen, X., Zhou, L., Kangming, T., Kumar, A., Singh, S., Prior, B. A., Wang, Z. (2013). Metabolic engineering of Escherichia coli: a sustainable industrial platform for bio-based chemical production. Biotechnology Advances.
Appl Biochem Biotechnol (2014) 172:2012–2021
2021
16. Keasling, J. D. (2008). Synthetic biology for synthetic chemistry. ACS Chemical Biology, 3, 64–76. 17. Goss, R. J., Shankar, S., & Fayad, A. A. (2012). The generation of “unnatural” products: synthetic biology meets synthetic chemistry. Natural Product Reports, 29, 870–889. 18. Atsumi, S., Wu, T. Y., Machado, I. M., Huang, W. C., Chen, P. Y., Pellegrini, M., & Liao, J. C. (2010). Evolution, genomic analysis, and reconstruction of isobutanol tolerance in Escherichia coli. Molecular Systems Biology, 6, 449. 19. Smith, K. M., & Liao, J. C. (2011). An evolutionary strategy for isobutanol production strain development in Escherichia coli. Metabolic Engineering, 13, 674–681. 20. Woodruff, L. B., Boyle, N. R., & Gill, R. T. (2013). Engineering improved ethanol production in Escherichia coli with a genome-wide approach. Metabolic Engineering, 17, 1–11. 21. Koma, D., Yamanaka, H., Moriyoshi, K., Ohmoto, T., & Sakai, K. (2012). Production of aromatic compounds by metabolically engineered Escherichia coli with an expanded shikimate pathway. Applied and Environmental Microbiology, 78, 6203–6216. 22. Gosset, G. (2009). Production of aromatic compounds in bacteria. Current Opinion in Biotechnology, 20, 651–658. 23. Brynildsen, M. P., & Liao, J. C. (2009). An integrated network approach identifies the isobutanol response network of Escherichia coli. Molecular Systems Biology, 5, 277. 24. Zheng, Y. N., Li, L. Z., Xian, M., Ma, Y. J., Yang, J. M., Xu, X., & He, D. Z. (2009). Problems with the microbial production of butanol. Journal of Industrial Microbiology & Biotechnology, 36, 1127–1138. 25. Woodruff, L. B., Pandhal, J., Ow, S. Y., Karimpour-Fard, A., Weiss, S. J., Wright, P. C., & Gill, R. T. (2013). Genome-scale identification and characterization of ethanol tolerance genes in Escherichia coli. Metabolic Engineering, 15, 124–133. 26. Zhang, H. F., Chong, H. Q., Ching, C. B., Song, H., & Jiang. R. R. (2012). Engineering global transcription factor cyclic AMP receptor protein of Escherichia coli for improved 1-butanol tolerance. Applied Microbiology and Biotechnology, 94, 1107–1117. 27. Liu, H., Liu, K., Yan, M., Xu, L., & Ouyang, P. (2011). gTME for improved adaptation of Saccharomyces cerevisiae to corn cob acid hydrolysate. Applied Biochemistry and Biotechnology, 164, 1150–1159. 28. Dunlop, M. J., Dossani, Z. Y., Szmidt, H. L., Chu, H. C., Lee, T. S., Keasling, J. D., Hadi, M. Z., & Mukhopadhyay, A. (2011). Engineering microbial biofuel tolerance and export using efflux pumps. Molecular Systems Biology, 7, 487. 29. Reyes, L. H., Almario, M. P., & Kao, K. C. (2011). Genomic library screens for genes involved in n-butanol tolerance in Escherichia coli. Plos One, 6. 30. Minty, J. J., Lesnefsky, A. A., Lin, F., Chen, Y., Zaroff, T. A., Veloso, A. B., Xie, B., McConnell, C. A., Ward, R. J., Schwartz, D. R., Rouillard, J. M., Gao, Y., Gulari, E., & Lin, X. N. (2011). Evolution combined with genomic study elucidates genetic bases of isobutanol tolerance in Escherichia coli. Microbial Cell Factories, 10, 18. 31. Ting, C. N., Wu, J., Takahashi, K., Endo, A., & Zhao, H. (2012). Screened butanol-tolerant Enterococcus faecium capable of butanol production. Applied Biochemistry and Biotechnology, 168, 1672–1680. 32. Hirata, H., Ohnishi, T., Ishida, H., Tomida, K., Sakai, M., Hara, M., & Watanabe, N. (2012). Functional characterization of aromatic amino acid aminotransferase involved in 2-phenylethanol biosynthesis in isolated rose petal protoplasts. Journal of Plant Physiology, 169, 444–451. 33. Jarboe, L. R. (2011). YqhD: a broad-substrate range aldehyde reductase with various applications in production of biorenewable fuels and chemicals. Applied Microbiology and Biotechnology, 89, 249–257. 34. Russell, D. W., Smith, M., Williamson, V. M., & Young, E. T. (1983). Nucleotide sequence of the yeast alcohol dehydrogenase II gene. The Journal of Biological Chemistry, 258, 2674–2682. 35. Juminaga, D., Baidoo, E. E., Redding-Johanson, A. M., Batth, T. S., Burd, H., Mukhopadhyay, A., Petzold, C. J., & Keasling, J. D. (2012). Modular engineering of L-tyrosine production in Escherichia coli. Applied and Environmental Microbiology, 78, 89–98. 36. Kang, Z., Wang, Y., Gu, P., Wang, Q., & Qi, Q. (2011). Engineering Escherichia coli for efficient production of 5-aminolevulinic acid from glucose. Metabolic Engineering, 13, 492–498. 37. Wu, J., Du, G., Zhou, J., & Chen, J. (2013). Metabolic engineering of Escherichia coli for (2S)-pinocembrin production from glucose by a modular metabolic strategy. Metabolic Engineering, 16, 48–55. 38. Lerner, C. G., & Inouye, M. (1990). Low copy number plasmids for regulated low-level expression of cloned genes in Escherichia coli with blue/white insert screening capability. Nucleic Acids Research, 18, 4631. 39. Lim, H. N., Lee, Y., & Hussein, R. (2011). Fundamental relationship between operon organization and gene expression. Proceedings of the National Academy of Sciences of the United States of America, 108, 10626–10631. 40. Kovacs, K., Hurst, L. D., & Papp, B. (2009). Stochasticity in Protein Levels Drives Colinearity of Gene Order in Metabolic Operons of Escherichia coli. Plos Biology, 7. 41. Zhou, H., Liao, X., Wang, T., Du, G., & Chen, J. (2010). Enhanced l-phenylalanine biosynthesis by co-expression of pheA(fbr) and aroF(wt). Bioresource Technology, 101, 4151–4156.
Metabolic Engineering of Escherichia coli for Production of 2-phenylethanol from Renewable Glucose Zhen Kang & Chuanzhi Zhang & Guocheng Du & Jian Chen
Received: 7 October 2013 / Accepted: 27 November 2013 / Published online: 8 December 2013 # Springer Science+Business Media New York 2013
Abstract 2-Phenylethanol (2-PE) is an important aromatic alcohol with a rose-like odor and has wide applications. The present work aims to construct a synthetic pathway for 2-PE synthesis from glucose in Escherichia coli. First, the genes adh1 (encoding alcohol dehydrogenase) and kdc (encoding phenylpyruvate decarboxylase) from Saccharomyces cerevisiae S288c and Pichia pastoris GS115 were investigated in E. coli, respectively, and single overexpression of adh1 or kdc significantly increased 2-PE accumulation. When co-overexpressing adh1 and kdc, 2-PE was increased up to 130 from 57 mg/L. Furthermore, by optimizing coordinated expression of the four committed genes aroF, pheA, adh1 and kdc, 2-PE was improved to 285 mg/L which was the highest production of 2-PE by the recombinant E. coli system. In addition, our results also demonstrated that the tyrB gene, which encodes aromatic-amino-acid transaminase, plays an important role on 2-PE synthesis. Keywords Metabolic engineering . 2-Phenylethanol . Gene expression control . Escherichia coli . L-phenylalanine Z. Kang (*) : G. Du : J. Chen Synergetic Innovation Center of Food Safety and Nutrition, Wuxi 214122, China e-mail: [email protected] Z. Kang : C. Zhang The Key Laboratory of Industrial Biotechnology, Ministry of Education, Jiangnan University, Wuxi 214122, China Z. Kang : C. Zhang : G. Du : J. Chen School of Biotechnology, Jiangnan University, Wuxi 214122, China J. Chen National Engineering Laboratory for Cereal Fermentation Technology, Jiangnan University, Wuxi 214122, China G. Du The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi 214122, China
Appl Biochem Biotechnol (2014) 172:2012–2021
2013
Introduction 2-Phenylethanol (2-PE), an aroma compound with a rose-like odor, has been widely used in perfumery, cosmetics and food industries [1]. In addition, 2-phenylethanol is also considered to be an alternative biofuel because of its advantage of a higher energy density [2]. To date, the majority of the 2-PE currently in use is primarily produced by chemical synthesis. However, chemical synthesis processes are often environmentally unfriendly (high temperature, high pressure and strong acid or alkali) and many unwanted byproducts increase the purify cost. Moreover, according to US and European legislations, chemically synthesized flavor compounds are restricted from being used in beverages, food and cosmetics [3]. Therefore, for these applications, natural 2-PE is always preferred. Naturally, in most cases, concentrations of 2-PE are too low to justify extraction (except for rose oil), resulting in a high price [4]. As a result, microbial production of 2-PE would be much more attractive. In the past, several microbial species have been described as possessing the ability to synthesize 2-PE [1, 5]. In 1992, Jollivet et al. reported that Microbacterium sp. and Brebibacteriumlinens have the ability to synthesize 2-PE [6]. Among the fungi, a multitude of species are known as producers of aroma compounds. Phellinus ignarius, P. laevigatus, P. tremulae, Ischnoderma benzoinum and Geotrichum penicillatum were demonstrated to accumulate 2-PE under specific conditions. However, cultivation process is long and the titer is low [1]. In 2001, Lomascolo et al. discovered that by addition of a precursor L-Phe, Aspergillus niger CIMICC 298302 could accumulate 2-PE to 1,375 mg in 9 days [7]. Subsequently, yeast as a good candidate was extensively investigated for 2-PE transformation from L-Phe [1] and considerable progresses have been achieved by applying many strategies, such as optimization of transformation process, screening of stress-tolerant strain and metabolic engineering of related pathways [8–13]. In addition, Yarrowia lipolytica was also considered to be a novel and promising natural 2-phenylethanol producer [14]. E. coli as the most well known microorganism has been widely applied in industrial biotechnology for production of proteins and biochemicals such as biofuels, organic acid, amino acids, sugar alcohols and biopolymers because of its numerous advantages [15–17]. Applying strategies of metabolic engineering and adaptive evolution, many robust E. coli strains have been developed for many unnatural higher alcohol and compounds [18–20]. Recently, E. coli has been also proposed as a potential candidate for production of aromatic compounds, especially for 2-PE [21, 22]. In this study, we constructed a heterologous pathway (Fig. 1) to produce 2-PE directly from glucose in E. coli. To improve 2-PE production, the involved shikimic acid and branch acid pathways were first optimized by overexpression of the committed enzymes 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase and bifunctional enzyme chorismate mutase (CM)-prephenate dehydratase (PD). Subsequently, two enzymes phenylpyruvate decarboxylase (Kdc) from Pichia pastoris GS115 and alcohol dehydrogenase (Adh1) from Saccharomyces cerevisiae S288c were introduced and investigated. After optimization of the involved key enzymes, a titer of 285 mg/L 2-PE was accumulated from the renewable resource glucose. To our knowledge, it was the highest report in E. coli.
Materials and Methods Bacterial Strains and Plasmids Bacterial strains, plasmids and oligonucleotides used in this study are listed in Tables 1 and 2. E. coli JM109 was applied for molecular cloning and manipulation of plasmids. E. coli BP-42
2014
Appl Biochem Biotechnol (2014) 172:2012–2021
Fig. 1 Schematic representation of 2-PE synthetic pathway from glucose in engineered E. coli. PEP, phosphoenopyruvate; Ery-4P, erythrose-4-phosphate; DAHP, 3-deoxy-D-arabino-hept-2-ulosonate 7-phosphate; CHA, Chorismate; PA, Prephenate; PPA, Phenylpyruvate; PAD, phenylacetaldehyde; 2-PE, 2-phenylethanol; L-Phe, L-phenylalanine; DS, 3-deoxy-7-phosphoheptulonate synthase; CM-PT, Chorismate mutase/prephenate dehydratase; KDC, Phenylpyruvate decarboxylase from Pichia pastoris GS115; ADH, Alcohol dehydrogenase from Saccharomyces cerevisiae S288c
as the parent strain was engineered for producing 2-PE. Gene pheAfbr and aroFwt was amplified from plasmid pAP-B03, genes kdc, and adh1 and adh2 were amplified from genomic DNA of Pichia pastoris GS115 and Saccharomyces cerevisiae S288c, respectively. After digestion, the fragments were subcloned into related plasmid-constructed recombinant plasmids in Table 1. To increase the translation efficiency, the Shine-Dalgarno sequence (AGGAGGA) was artificially added in the upstream of starting codon ATG (Table 2). Media and Culture Conditions E. coli cells were routinely grown in LB medium for 12 h at 37 °C and 200 rpm on rotary shakers. Antibiotic was used at related concentration as required (AmpR 100 μg/L, SpcR 80 μg/L). The seed LB medium contains (g/L) 5 yeast extract, 10 peptone and 10 NaCl. The fermentation medium contains (g/L) 20 glucose, 5 (NH4)2SO4, 3 KH2PO4, 3 MgSO4 ·7H2O, 1 NaCl, 1.5 Na-Citrate, 0.015 CaCl2 ·2H2O, 0.1125 FeSO4 ·7H2O, 0.075 Thiamine-HCl, 0.4 L-Tyr, 3 yeast extract and 1.5 mL/L trace elements solution (TES). TES contained (g/L) 2.0 Al2(SO4)3 · 18H2O, 0.75 CoSO4 ·7H2O, 2.5 CuSO4 ·5H2O, 0.5 H3BO3, 24 MnSO4 ·7H2O, 3.0 Na2MoO4 · 2H2O, 2.5 NiSO4 ·6H2O and 15 ZnSO4 ·7H2O. Shake flask fermentations were carried out in 500 mL Erlenmeyer flask supplied with 50 mL fermentation medium at an agitation of 200 rpm. Calcium carbonate (12 g/L) was added to adjust the pH of the medium. A 10 % (v/v) inoculum from an overnight culture for 12 h was used. For temperature-induced systems, the temperature was initially maintained at 33 °C and elevated to 38 °C when the value of OD600 reached 1.5–2.0. In contrast, the chemical-induced systems were constantly operated at 37 °C with addition of 1 mM IPTG at initial. Samples were taken and measured with an interval of 6 h. Analysis of Fermentation Parameters Optical density (OD) was measured at 600 nm with a spectrophotometer-722 (Third Analytical Instrument Factory, Shanghai, China) after an appropriate dilution. For analyzing 2-PE and phenylacetaldehyde, 5 mL of cell culture was centrifuged (10,000×g for 10 min at 4 °C) and
Appl Biochem Biotechnol (2014) 172:2012–2021
2015
Table 1 Strains and plasmids used in this study Strains and plasmids
Relevant properties or genotype
Source or reference
E. coli JM109
F′traD36 proA+B+ lacIq Δ(lacZ)M15/Δ(lac-proAB) glnV44e14- gyrA96 recA1 relA1 endA1 thi hsdR17
Lab stock
E. coli DH5α
Δ(lacZYA-argF)U169 deoR gyrA96 thi-I hsdR17 supE44 relAI
Lab stock
S. cerevisiae S288c P. pastoris GS115
MATα SUC2 gal2 mal mel flo1 flo8-1 hap1 ho bio1 bio6 his4 Mut+ His- (aox1+, aox2+)
Lab stock Lab stock
Strains
E. coli DHP1
E. coli DH5α harboring pAP-B03
This work
E. coli DHP2
E. coli DH5α harboring pAP-B03 and pCL1920-adh1
This work
E. coli DHP3
E. coli DH5α harboring pAP-B03 and pCL1920-adh2
This work
E. coli DHP4
E. coli DH5α harboring pAP-B03 and pCL1920-kdc
This work
E. coli DHP5
E. coli DH5α harboring pAP-B03 and pCL1920-adh1-kdc
This work
E. coli DCU1
E. coli DH5α harboring pCL1920-pheAfbr-aroFwt
This work
E. coli DCU2 E. coli DCU3
E. coli DH5α harboring pCL1920-pheAfbr-aroFwt and pUC19-adh1 E. coli DH5α harboring pCL1920-pheAfbr-aroFwt and pUC19-kdc
This work This work
E. coli DCU4
E. coli DH5α harboring pCL1920-pheAfbr-aroFwt and pUC19-adh1-kdc
This work
E. coli DCB
E. coli DH5α with deletion of tyrB gene
This work
E. coli DCB1
E. coli DCB harboring pCL1920-pheAfbr-aroFwt
This work
E. coli DCB2 E. coli DCB3
E. coli DCB harboring pCL1920-pheAfbr-aroFwt and pUC19-adh1 E. coli DCB harboring pCL1920-pheAfbr-aroFwt and pUC19-kdc
This work This work
E. coli DCB4
E. coli DCB harboring pCL1920-pheAfbr-aroFwt and pUC19-adh1-kdc
This work
pMD-19 pCL1920
Cloning vector, AmpR SpcR, Plac
Takara Lab stock
pUC19
AmpR, Plac
Lab stock
pAP-B03
pPL450 derivative, containing pheAfbr gene and aroFwt gene
[41]
pCL1920-adh1
pCL1920 containing adh1 gene
This work
Plasmids
pCL1920-adh2
pCL1920 containing adh2 gene
This work
pCL1920-kdc
pCL1920 containing kdc gene
This work
pCL1920-adh1-kdc
pCL1920 containing adh1 gene and kdc gene
This work
pCL1920-pheAfbr-aroFwt pUC19-adh1
pCL1920 containing pheAfbr gene and aroFwt gene pUC19 containing adh1 gene
This work This work
pUC19-kdc
pUC19 containing kdc gene
This work
pUC19-adh1-kdc
pUC19 containing adh1 gene and kdc gene
This work
the supernatant was then filtered with a 0.22 μm syringe filter for analysis. The Agilent 1200 HPLC (Agilent, Santa Clara, USA) system was equipped with a 250×4.6 mm ZORBAX SBAq column (Agilent, Santa Clara, USA), a standard G 1329A autosampler (Agilent, Santa Clara, USA) and a G13158 diode array detector (DAD) (Agilent, Santa Clara, USA). Na2HPO4 (0.138 mol/L). One percent acetonitrile (v/v) adjusted to pH 2.0 with phosphoric acid was used as the mobile phase at a flow rate of 1.0 mL/min. The detection wavelength was 210 nm and the column temperature was maintained at 35 °C. For analyzing amino acids,
2016
Appl Biochem Biotechnol (2014) 172:2012–2021
Table 2 Primers used in this study. The base underlined means the restriction enzyme sites, the base in bold means the Shine-Dalgarno sequence added artificially Primers
Sequence (5′-3′)
adh1-F
AAAACTGCAGGTAAAAGGAGGATATACATATGTCTATCCCAGAAACTCAAAAAGGTGT
adh1-R
CGCGGATCCGAATTTTCGTTTTAAAACCTAAGAGTCACTTTA
adh2-F
CGCGGATCCAAGGAGGATATACATATGTCTATTCCAGAAACTCAAAAAGCC
adh2-R
CGAGCTCGGTACCCGGGTTATTTAGAAGTGTCAACAACGTATCTACCA
kdc-F
TCCCCCGGGAAGGAGGATATACATATGGCCCCAGTTCCAGATATAGCA
kdc-R
CGAGCTCTTAACCTACGATTTTGGCTTTGTTCTTG
aroFwt-F
TCCCCGCGG AAAGGAGGACACGCATGCAAAAAGACGCGCTGAATAACG
aroFwt-R pheAfbr-F
CGCGGATCCCCGCTCGAGTTAAGCCACGCGAGCCGTCA CCCAAGCTTAAAGGAGGACACGCATGACATCGGAAAACCCGTTACT
pheAfbr-R
TGCACTCCAGTCCCCGCGGTCAGGTTGGATCAACAGGCACTA
5 mL of cell culture was centrifuged (10,000×g for 10 min at 4 °C). The supernatant was diluted with trichloroacetic acid (5 g/L) and filtered with a 0.22 μm syringe filter for analysis. Subsequently, amino acids were precolumn derivatized by o-phthaldialdehyde (OPA) and analyzed with the Agilent 1100 HPLC (Agilent, Palo Alto, USA) system equipped with a reverse-phase column (Zorbax Eclipse-AAA) and UV detector (338 nm).
Results and Discussion Tolerance Analysis of 2-PE to E. coli It has been demonstrated 2-PE has inhibitory effects on cell growth of S. cerevisiae, which involved in nutrients uptake, cell membrane damage and reduction in respiratory capacity [13]. As a result, the tolerance investigation of 2-PE to E. coli was firstly carried out. As shown in Fig. 2, an OD600 of to 9.2 was accumulated without addition of 2-PE. When the concentration of 2-PE was below 1.0 g/L, no significant inhibition was observed. However, when 2-PE was increased above 1.0 g/L, remarkable inhibitory effect to cell growth was detected, which was similar with other higher alcohols [23–25]. Correspondingly, many strategies such as genome engineering [18, 20], global factor engineering [26, 27], pump proteins [28], random mutation [29] and adaptive evolution [30, 31] have been developed and intensively utilized for construction of robust E. coli factories to produce alcohols. Therefore, these approaches could also be conducted to engineer E. coli to increase its tolerance capacity. In addition, it was interesting that although a small biomass was accumulated, shorter lag phase occurred when high concentration of 2-PE was added, indicating that low concentration of 2-PE at initial phase might have greater inhibition to cell growth. Construction of 2-PE Synthetic Pathway in L-Phe Producing E. coli To construct 2-PE synthetic pathway, the genes kdc and adh1 which encode phenylpyruvate decarboxylase (Kdc) and alcohol dehydrogenase were amplified from Pichia pastoris GS115 and Saccharomyces cerevisiae S288c and introduced to E. coli. As a consequence, the recombinants E. coli DHP2 (pCL1920-adh1), E. coli DHP3 (pCL1920-kdc), E. coli DHP4
Appl Biochem Biotechnol (2014) 172:2012–2021
2017
Fig. 2 Effect of exogenous 2-PE on E. coli cell growth. Cultures were carried out in LB medium
(pCL1920-adh1-kdc) constructed were comparatively cultured and investigated with the L-Phe producing E. coli DHP1 (pAP-B03) (Fig. 3). As expected, no 2-PE was detected in the parent E. coli BP-43 although high concentration of L-Phe was accumulated (6.06 g/L) (Fig. 3). Interestingly, single overexpression of kdc and adh1 resulted in significant increase of 2-PE which was 32 and 57 mg/L, respectively (Fig. 3). Recently, novel PPA synthetic pathway involved in amino acid aminotransferase was proposed in rose protoplasts [32]. Hence, the results suggested that some natural amino acid aminotransferases and alcohol dehydrogenases might drive the flux from phenylpyruvate to 2-PE in E. coli. In fact, three candidate genes yqhD, yjgB, and yahK have been identified and yqhD has been experimentally confirmed as a broad-substrate alcohol dehydrogenase [33]. Furthermore, the results also confirmed that both kdc and adh1 were essential for 2-PE synthesis. To our anticipation, co-overexpression of kdc and adh1 increased 2-PE up to 130 mg/L (Fig. 3). In comparison, overexpression of the adh2 gene from S. cerevisiae generated no 2-PE accumulation (Fig. 3), which further demonstrated that the alcohol dehydrogenase encoded by adh2 preferentially catalyzes the conversion of ethanol to acetaldehyde but not acetaldehyde to ethanol [34]. Optimization of the 2-PE Synthetic Pathway by Reassembling the Committed Genes To improve microbial productivity of aimed products, many critical genes of the targeted pathway generally require modifications with variety of approaches such as plasmid copy numbers, promoter strength and placement of genes in operons [35–37]. As a consequence, the rate-limiting enzymes pheA, aroF, kdc and adh1 were rationally reassembled with plasmids pCL1920 [38] and pUC19 whose replicons were pSC101 (low copy number) and pMB1 (high copy number). Meanwhile, the orders of the genes were also optimized for genes aligned in operons appear in the same order as they are needed in metabolism [39] and the transcriptional level of the first gene is higher than that of subsequent genes [40]. As shown in Fig. 4, E. coli DCU1 (pCL1920-pheAfbr-aroFwt) accumulated a large amount of L-Phe while no 2-PE was detected throughout the whole cultivation process. In contrast, E. coli DCU2 (pCL1920-pheAfbr-aroFwt, pUC19-adh1) and E. coli DCU3 (pCL1920-pheAfbr-aroFwt, pUC1920-kdc) accumulated 2-PE to 27 and 220 mg/L, respectively (Fig. 4). Impressively, the highest level of 2-PE (285 mg/L) was produced by the recombinant E. coli DCU4 (pCL1920-pheAfbr-aroFwt, pUC19-adh1-kdc), which was 2.2-fold of that of E. coli DHP5 (pAP-B03, pCL1920-adh1-kdc).
2018
Appl Biochem Biotechnol (2014) 172:2012–2021
Fig. 3 Characterization of different recombinant strains with respect to 2-PE. Data are presented as the mean±standard deviation (SD) (n=3)
Moreover, the intermediate phenylacetaldehyde was also comparatively investigated. As shown in Fig. 4, without introduction of the kdc gene, nearly no phenylacetaldehyde was detected. Nevertheless, single overexpression of the kdc gene gave rise to a significantly
Fig. 4 Accumulation of 2-PE by recombinants with modulated overexpression of key enzymes. Data are presented as the mean±SD (n=3)
Appl Biochem Biotechnol (2014) 172:2012–2021
2019
Fig. 5 Accumulation of 2-PE by recombinants with inactivation of the tyrB gene. Data are presented as the mean±SD (n=3)
increased phenylacetaldehyde (96 mg/L), indicating an unbalanced flux arose. When introducing the adh1 gene, phenylacetaldehyde was decreased to 34 mg/L, coupled with an increased 2-PE (Fig. 4). Taken together, the results demonstrated that optimization of the key genes with respect to copy numbers, position in operon and transcriptional strength is of great importance for high-level accumulation of the targeted product. Inactivation of the tyrB Gene Resulted in an Unbalanced Flux To drive more carbon flux to 2-PE, the tyrB gene which encodes aromatic-amino-acid transaminase was inactivated. As anticipated, deletion of the tyrB gene resulted in substantial decrease of L-Phe (0.76 g/L). However, when overexpressing the kdc gene, 2-PE was not increased but dramatically decreased to a low level (Fig. 5). At the same time, the intermediate phenylacetaldehyde was sharply increased to 156 mg/L (Fig. 5) with inhibited cell growth (data not shown). The results suggested that although E. coli equips three genes aspC, hisC and tyrB in charge of conversion of phenylpyruvate and 4-hydroxy-phenylpyruvate to L-Phe and L-Tyr, respectively, tyrB should be the largest contributor. Furthermore, the aromaticamino-acid transaminase encoded by tyrB might play an important role on 2-PE synthesis. Inactivation of the tyrB gene blocked the metabolic flux from phenylpyruvate to L-Phe which leads to high concentration of phenylacetaldehyde and eventually caused poor cell growth [1].
Conclusion In the present work, we cloned the phenylpyruvate decarboxylase (Kdc) from Pichia pastoris GS115 and alcohol dehydrogenase (Adh1) from Saccharomyces cerevisiae S288c and
2020
Appl Biochem Biotechnol (2014) 172:2012–2021
introduced into the L-Phe producing E. coli to construct a synthetic pathway for 2-PE synthesis. Single overexpression of kdc or adh1 could endow E. coli the ability to produce 2-PE and co-overexpression kdc and adh1 improved 2-PE to a titer of 130 mg/L. Furthermore, by optimizing coordinated expression of the four key enzymes aroFfbr, pheAfbr, kdc and adh1, the high titer of 285 mg/L 2-PE was achieved. Moreover, deletion of the tyrB gene resulted in unbalanced flux, large amounts of accumulated phenylacetaldehyde and repressed cell growth, suggesting a critical role of aromatic-amino-acid transaminase encoded by tyrB on aromatic amino acids and 2-PE synthesis. Acknowledgments This work was financially supported by the Major State Basic Research Development Program of China (973 Program, 2014CB745103, 2013CB733602), the National Natural Science Foundation of China (31200020), the National High Technology Research and Development Program of China (2012AA021201), the National Science Foundation for Post-doctoral Scientists of China (2013 M540414), the Jiangsu Planned Projects for Postdoctoral Research Funds (1301010B), the 111 Project and the Priority Academic Program Development of Jiangsu Higher Education Institutions.
References 1. Etschmann, M. M., Bluemke, W., Sell, D., & Schrader, J. (2002). Biotechnological production of 2-phenylethanol. Applied Microbiology and Biotechnology, 59, 1–8. 2. Atsumi, S., Hanai, T., & Liao, J. C. (2008). Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature, 451, 86–89. 3. Xu, P., Hua, D., & Ma, C. (2007). Microbial transformation of propenylbenzenes for natural flavour production. Trends in Biotechnology, 25, 571–576. 4. Hua, D., & Xu, P. (2011). Recent advances in biotechnological production of 2-phenylethanol. Biotechnology Advances, 29, 654–660. 5. Jin, J. Z., Li, H., & Zhang, J. (2010). Improved synthesis of (S)-1-phenyl-2-propanol in high concentration with coupled whole cells of Rhodococcus erythropolis and Bacillus subtilis on preparative scale. Applied Biochemistry and Biotechnology, 162, 2075–2086. 6. Jollivet, N., Bézenger, M. C., Vayssier, Y., & Belin, J. M. (1992). Production of volatile compounds in liquid cultures by six strains of coryneform bacteria. Applied Microbiology and Biotechnology, 36, 790–794. 7. Lomascolo, A., Lesage-Meessen, L., Haon, M., Navarro, D., Antona, C., Faulds, C., & Marcel, A. (2001). Evaluation of the potential of Aspergillus niger species for the bioconversion of L-phenylalanine into 2-phenylethanol. World Journal of Microbiology and Biotechnology, 17, 99–102. 8. Stark, D., Zala, D., Münch, T., Sonnleitner, B., Marison, I., & Von Stockar, U. (2003). Inhibition aspects of the bioconversion of l-phenylalanine to 2-phenylethanol by Saccharomyces cerevisiae. Enzyme and Microbial Technology, 32, 212–223. 9. Eshkol, N., Sendovski, M., Bahalul, M., Katz-Ezov, T., Kashi, Y., & Fishman, A. (2009). Production of 2phenylethanol from L-phenylalanine by a stress tolerant Saccharomyces cerevisiae strain. Journal of Applied Microbiology, 106, 534–542. 10. Seo, W. T., & Ahn, K. C. (2003). Production of phenylethanol from L-phenylalanine by Candida sp S-8. Food Science and Biotechnology, 12, 644–648. 11. Serp, D., von Stockar, U., & Marison, I. W. (2003). Enhancement of 2-phenylethanol productivity by Saccharomyces cerevisiae in two-phase fed-batch fermentations using solvent immobilization. Biotechnology and Bioengineering, 82, 103–110. 12. Wang, H., Dong, Q. F., Meng, C., Shi, X. A., & Guo, Y. H. (2011). A continuous and adsorptive bioprocess for efficient production of the natural aroma chemical 2-phenylethanol with yeast. Enzyme and Microbial Technology, 48, 404–407. 13. Stark, D., Munch, T., Sonnleitner, B., Marison, I. W., & von Stockar, U. (2002). Extractive bioconversion of 2-phenylethanol from L-phenylalanine by Saccharomyces cerevisiae. Biotechnology Progress, 18, 514–523. 14. Celinska, E., Kubiak, P., Bialas, W., Dziadas, M., & Grajek, W. (2013). Yarrowia lipolytica: the novel and promising 2-phenylethanol producer. Journal of Industrial Microbiology & Biotechnology, 40, 389–392. 15. Chen, X., Zhou, L., Kangming, T., Kumar, A., Singh, S., Prior, B. A., Wang, Z. (2013). Metabolic engineering of Escherichia coli: a sustainable industrial platform for bio-based chemical production. Biotechnology Advances.
Appl Biochem Biotechnol (2014) 172:2012–2021
2021
16. Keasling, J. D. (2008). Synthetic biology for synthetic chemistry. ACS Chemical Biology, 3, 64–76. 17. Goss, R. J., Shankar, S., & Fayad, A. A. (2012). The generation of “unnatural” products: synthetic biology meets synthetic chemistry. Natural Product Reports, 29, 870–889. 18. Atsumi, S., Wu, T. Y., Machado, I. M., Huang, W. C., Chen, P. Y., Pellegrini, M., & Liao, J. C. (2010). Evolution, genomic analysis, and reconstruction of isobutanol tolerance in Escherichia coli. Molecular Systems Biology, 6, 449. 19. Smith, K. M., & Liao, J. C. (2011). An evolutionary strategy for isobutanol production strain development in Escherichia coli. Metabolic Engineering, 13, 674–681. 20. Woodruff, L. B., Boyle, N. R., & Gill, R. T. (2013). Engineering improved ethanol production in Escherichia coli with a genome-wide approach. Metabolic Engineering, 17, 1–11. 21. Koma, D., Yamanaka, H., Moriyoshi, K., Ohmoto, T., & Sakai, K. (2012). Production of aromatic compounds by metabolically engineered Escherichia coli with an expanded shikimate pathway. Applied and Environmental Microbiology, 78, 6203–6216. 22. Gosset, G. (2009). Production of aromatic compounds in bacteria. Current Opinion in Biotechnology, 20, 651–658. 23. Brynildsen, M. P., & Liao, J. C. (2009). An integrated network approach identifies the isobutanol response network of Escherichia coli. Molecular Systems Biology, 5, 277. 24. Zheng, Y. N., Li, L. Z., Xian, M., Ma, Y. J., Yang, J. M., Xu, X., & He, D. Z. (2009). Problems with the microbial production of butanol. Journal of Industrial Microbiology & Biotechnology, 36, 1127–1138. 25. Woodruff, L. B., Pandhal, J., Ow, S. Y., Karimpour-Fard, A., Weiss, S. J., Wright, P. C., & Gill, R. T. (2013). Genome-scale identification and characterization of ethanol tolerance genes in Escherichia coli. Metabolic Engineering, 15, 124–133. 26. Zhang, H. F., Chong, H. Q., Ching, C. B., Song, H., & Jiang. R. R. (2012). Engineering global transcription factor cyclic AMP receptor protein of Escherichia coli for improved 1-butanol tolerance. Applied Microbiology and Biotechnology, 94, 1107–1117. 27. Liu, H., Liu, K., Yan, M., Xu, L., & Ouyang, P. (2011). gTME for improved adaptation of Saccharomyces cerevisiae to corn cob acid hydrolysate. Applied Biochemistry and Biotechnology, 164, 1150–1159. 28. Dunlop, M. J., Dossani, Z. Y., Szmidt, H. L., Chu, H. C., Lee, T. S., Keasling, J. D., Hadi, M. Z., & Mukhopadhyay, A. (2011). Engineering microbial biofuel tolerance and export using efflux pumps. Molecular Systems Biology, 7, 487. 29. Reyes, L. H., Almario, M. P., & Kao, K. C. (2011). Genomic library screens for genes involved in n-butanol tolerance in Escherichia coli. Plos One, 6. 30. Minty, J. J., Lesnefsky, A. A., Lin, F., Chen, Y., Zaroff, T. A., Veloso, A. B., Xie, B., McConnell, C. A., Ward, R. J., Schwartz, D. R., Rouillard, J. M., Gao, Y., Gulari, E., & Lin, X. N. (2011). Evolution combined with genomic study elucidates genetic bases of isobutanol tolerance in Escherichia coli. Microbial Cell Factories, 10, 18. 31. Ting, C. N., Wu, J., Takahashi, K., Endo, A., & Zhao, H. (2012). Screened butanol-tolerant Enterococcus faecium capable of butanol production. Applied Biochemistry and Biotechnology, 168, 1672–1680. 32. Hirata, H., Ohnishi, T., Ishida, H., Tomida, K., Sakai, M., Hara, M., & Watanabe, N. (2012). Functional characterization of aromatic amino acid aminotransferase involved in 2-phenylethanol biosynthesis in isolated rose petal protoplasts. Journal of Plant Physiology, 169, 444–451. 33. Jarboe, L. R. (2011). YqhD: a broad-substrate range aldehyde reductase with various applications in production of biorenewable fuels and chemicals. Applied Microbiology and Biotechnology, 89, 249–257. 34. Russell, D. W., Smith, M., Williamson, V. M., & Young, E. T. (1983). Nucleotide sequence of the yeast alcohol dehydrogenase II gene. The Journal of Biological Chemistry, 258, 2674–2682. 35. Juminaga, D., Baidoo, E. E., Redding-Johanson, A. M., Batth, T. S., Burd, H., Mukhopadhyay, A., Petzold, C. J., & Keasling, J. D. (2012). Modular engineering of L-tyrosine production in Escherichia coli. Applied and Environmental Microbiology, 78, 89–98. 36. Kang, Z., Wang, Y., Gu, P., Wang, Q., & Qi, Q. (2011). Engineering Escherichia coli for efficient production of 5-aminolevulinic acid from glucose. Metabolic Engineering, 13, 492–498. 37. Wu, J., Du, G., Zhou, J., & Chen, J. (2013). Metabolic engineering of Escherichia coli for (2S)-pinocembrin production from glucose by a modular metabolic strategy. Metabolic Engineering, 16, 48–55. 38. Lerner, C. G., & Inouye, M. (1990). Low copy number plasmids for regulated low-level expression of cloned genes in Escherichia coli with blue/white insert screening capability. Nucleic Acids Research, 18, 4631. 39. Lim, H. N., Lee, Y., & Hussein, R. (2011). Fundamental relationship between operon organization and gene expression. Proceedings of the National Academy of Sciences of the United States of America, 108, 10626–10631. 40. Kovacs, K., Hurst, L. D., & Papp, B. (2009). Stochasticity in Protein Levels Drives Colinearity of Gene Order in Metabolic Operons of Escherichia coli. Plos Biology, 7. 41. Zhou, H., Liao, X., Wang, T., Du, G., & Chen, J. (2010). Enhanced l-phenylalanine biosynthesis by co-expression of pheA(fbr) and aroF(wt). Bioresource Technology, 101, 4151–4156.
