microRNA-128 plays a critical role in human non-small cell lung cancer tumourigenesis, angiogenesis and lymphangiogenesis by directly targeting vascular endothelial growth factor-C.

European Journal of Cancer (2014) xxx, xxx– xxx

Available at www.sciencedirect.com

ScienceDirect journal homepage: www.ejcancer.com

microRNA-128 plays a critical role in human non-small cell lung cancer tumourigenesis, angiogenesis and lymphangiogenesis by directly targeting vascular endothelial growth factor-C Jing Hu a,b,c, Yongxia Cheng a,b, Yuezhen Li a, Zaishun Jin a, Yanming Pan a, Guibo Liu a, Songbin Fu b, Yafang Zhang b, Kejian Feng a, Yukuan Feng a,b,c,⇑ a Key Laboratory of Tumor Prevention and Treatment (Heilongjiang Higher Education Institutions), Mudanjiang Medical University, Mudanjiang 157011, China b School of Basic Medical Science, Harbin Medical University, Harbin 150086, China c Department of Cellular and Molecular Medicine, University of California, San Diego, CA 92093, USA

Received 25 February 2014; received in revised form 1 May 2014; accepted 5 June 2014

KEYWORDS microRNA Non-small cell lung cancer miRNA-128 VEGF-C

Abstract Recent studies have indicated that microRNAs (miRNAs) are important gene regulators that play critical roles in biological processes and function as either tumour suppressors or oncogenes. Therefore, the expression levels of miRNAs can be important and reliable biomarkers for cancer detection and prognostic prediction, and potentially serve as targets for cancer therapy. In this study, we showed that the expression level of miR-128 was significantly downregulated in non-small cell lung cancer (NSCLC) tissues and cancer cells, and was significantly correlated with NSCLC differentiation, pathological stage and lymph node metastasis. Ectopic miR-128 overexpression significantly suppressed in vitro proliferation, colony formation, immigration and invasion, and induced G1 arrest and apoptosis of NSCLC cells. Interestingly, ectopic miR-128 overexpression could significantly inhibit vascular endothelial growth factor (VEGF)-C expression and reduce the activity of a luciferase reporter containing the VEGF-C 30 -untranslated region. In addition, overexpression of miR-128 in NSCLC cells and human umbilical vein endothelial cells (HUVECs) cells led to decreased expression of VEGF-A, vascular endothelial growth factor receptor (VEGFR)-2 and VEGFR-3, critical factors responsible for cancer angiogenesis and lymphangiogenesis, and subsequently decreased phosphorylation of extracellular signal-regulated kinase (ERK), phosphatidylinositol 3-kinase (AKT) and p38 signalling pathways. Furthermore, in vivo

⇑ Corresponding author: Address: Key Laboratory of Tumor Prevention and Treatment, Mudanjiang Medical University, 3 Tongxiang Street, Mudanjiang, Heilongjiang Province 157011, China. Tel.: +86 453 6984591; fax: +86 453 6984041. E-mail address: [email protected] (Y. Feng).

http://dx.doi.org/10.1016/j.ejca.2014.06.005 0959-8049/Ó 2014 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Hu J. et al., microRNA-128 plays a critical role in human non-small cell lung cancer tumourigenesis, angiogenesis and lymphangiogenesis by directly targeting vascular endothelial growth factor-C, Eur J Cancer (2014), http://dx.doi.org/10.1016/ j.ejca.2014.06.005

2

J. Hu et al. / European Journal of Cancer xxx (2014) xxx–xxx

restoration of miR-128 significantly suppressed tumourigenicity of A549 cells in nude mice and inhibited both angiogenesis and lymphangiogenesis of tumour xenografts. These findings suggest that miR-128 could play a role in NSCLC tumourigenesis at least in part by modulation of angiogenesis and lymphangiogenesis through targeting VEGF-C, and could simultaneously block ERK, AKT and p38 signalling pathways. Therapeutic strategies to restore miR-128 in NSCLC could be useful to inhibit tumour progression. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Lung carcinoma is the leading cause of cancer-related death worldwide, and non-small cell lung cancer (NSCLC) accounts for 80–85% of all diagnosed lung cancers [1]. The majority of NSCLC patients have advanced disease (stage III/IV) when diagnosed, with poor prognosis [2,3]. Current treatments for NSCLC remain ineffective and novel approaches are needed to improve the therapeutic ratio, including the accurate identification of optimal molecular targets for use in molecular targeted therapy. Solid tumours, including NSCLC, can grow beyond 1–2 mm3 only after recruiting new blood and lymph vessels, as cancer cell proliferation is dependent on the availability of removing metabolic waste and acquiring self-sufficient oxygen and nutrients, a critical process that allows small developing neoplasia to enter a state of uncontrolled proliferation [4,5]. Pathways controlling tumour angiogenesis and lymphangiogenesis processes have been the focus of the development of novel therapeutics to inhibit these processes and starve developing tumours of oxygen and nutrients. Vascular endothelial growth factors (VEGFs) are important mediators of angiogenesis and lymphangiogenesis during tumour development [6]. These molecules and their receptors (VEGFRs) have been primary targets of therapies designed to target pathological angiogenic and lymphangiogenic signalling [7]. Among the VEGF family members, VEGF-A is mostly responsible for angiogenesis, while VEGF-C is believed to contribute to lymphangiogenesis [8,9]. Some recent studies suggest that VEGF-C stimulates angiogenesis in addition to lymphangiogenesis [10,11]. Furthermore, recent studies by us [12] as well as Kumar et al. [13] show evidence that VEGF-C may be a better target over VEGF-A to inhibit not only lymphangiogenesis but also angiogenesis, as there was a simultaneous decrease in expression levels of VEGF-A with the increase in knockdown of VEGF-C by RNA interference. To some extent, the above studies throw light on the transitory clinical efficacies achieved by anti-VEGF-A therapy [14,15]. In addition, some studies have shown that VEGF-C may act via multiple mechanisms to promote tumour progression, and that tumour cell proliferation, invasion and lymphatic metastasis involve VEGF-C/VEGFR-3 autocrine stimulation mechanisms [12,16]. Thus, these

results indicate that VEGF-C represents a powerful therapeutic target for controlling tumour growth and metastasis [17]. However, compared with the numerous data on VEGF-A, the experimental data on VEGF-C need to be further investigated, especially with respect to whether VEGF-C could be a meaningful therapeutic option. Recently, microRNAs (miRNAs) have gained attention as new posttranscriptional regulators of gene expression because of their capability of regulating gene expression by directly targeting mRNAs for translational repression or destabilisation [18–20]. Rapidly accumulating evidence supports miRNAs as therapeutic targets and diagnostic markers of cancer [21–25]. Although specific roles for miRNAs in NSCLC development and progression, especially in lung cancer angiogenesis and lymphangiogenesis, are poorly characterised to date, many of the previously described miRNAs have been found to function as important regulators of angiogenesis in other contexts [26,27]. For example, several miRNAs have been predicted to target VEGF-A through both competitive (miR-93, miR-125a, miR-302d, miR-373 and miR-378) and coordinated (miR-15b, miR-16b, miR-20a and miR-20b) interactions, and transfection of miR-20a and miR-20b has been shown to regulate the expression of VEGF and other angiogenic factors in human carcinoma cells in vitro [5,28]. To date, few studies have examined which miRNAs are critical regulators of lymphangiogenesis, and it is unclear which miRNAs directly target VEGF-C in NSCLC. We queried whether a miRNA could regulate VEGF-C and be a predictor of response to NSCLC angiogenesis and lymphangiogenesis. Genomic loss of a miRNA capable of downregulating VEGF-C would be expected to allow increased VEGF-C expression, thereby offering a more robust target for the NSCLC angiogenesis and lymphangiogenesis. It has been estimated that more than half of known human miRNAs reside in, or close to, fragile chromosomal sites that are susceptible to deletion, amplification or translocation in the establishment and progression of tumour [29]. At the same time, we used TargetScan 3.1 (http://www.targetscan.org) to search for candidate microRNAs that regulate VEGF-C and inquired if the predicted microRNA regulators of VEGF-C were localised to chromosomal regions known to be frequently lost in lung cancer. We identified



VEGF-C as a potential target of miR-128-3p (miR-128), the same major mature microRNA of miR-128-1 and miR-128-2. miR-128-1 and miR-128-2 locate on chromosome 2q and chromosome 3p, respectively, and allelic loss in chromosome 2q and chromosome 3p is a genetic event in lung carcinogenesis [30,31]. Especially the allelic loss in chromosome 3p is one of the most frequent and earliest genetic events in lung carcinogenesis, with up to 96% loss in lung cancer and 78% loss in preneoplastic or preinvasive lung epithelial samples [31]. For these reasons, we undertook to uncover the specific effects of miR-128 in these aberrant regions, with the hope that miR-128 may provide insights into the causal mechanism of NSCLC development. In this study, we identified downregulation of miR-128 in human NSCLC tissues and cancer cells, and show that it functions as a tumour suppressive miRNA by directly targeting VEGF-C. Ectopic expression of miR-128 inhibited VEGF-C, VEGF-A, VEGFR-2 and VEGFR-3 expression, inhibited in vitro proliferation, migration and invasion, and induced apoptosis of NSCLC cells. In addition, restoration of miR-128 expression in an NSCLC xenograft treatment model attenuated tumour growth, angiogenesis and lymphangiogenesis in vivo. 2. Materials and methods 2.1. Human NSCLC tissue samples Human NSCLC tissue samples were obtained from 30 patients with NSCLC who underwent surgery at Harbin Medical University Clinical Hospital (Harbin, China) from 2010 to 2012. Patients who underwent preoperative chemotherapy and radiotherapy were excluded. Informed consent was obtained from each potential subject using a human-subject protocol that was approved by the Institutional Review Board. Tissue samples were collected at surgery, immediately snap frozen in liquid nitrogen and stored at 80 °C until RNA extraction. All samples were thoroughly reviewed by two pathologists. 2.2. Cell culture Six NSCLC cell lines (A549, H1299, SK-MES-1, 95-D, NCI-H460 and NCI-H1688) and a human foetal lung fibroblast cell line (MRC-5) were purchased from the Institutes of Biochemistry and Cell Biology (Shanghai, China) and originated from American Type Culture Collection (ATCC, Manassas, VA, United States of America (USA)). MRC-5 and SK-MES-1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Shanghai, China), and the other NSCLC cells were cultured in RPMI-1640 medium. The media were supplemented with 10% foetal bovine serum (FBS; Gibco, Invitrogen, Carlsbad, CA, USA) and 1% penicillin-streptomycin. HUVECs were cultured on

3

gelatinised dishes in EGM2 medium (Clonetics, USA). All cells were maintained at 37 °C in a humidified 5% CO2 incubator. 2.3. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) Total RNA from cells and tissue was extracted using the RNAiso reagent (TaKaRa, Dalian, China). Complementary DNA was synthesised from total RNA using the PrimeScripte RT-PCR Kit (TaKaRa, Dalian, China) and Oligo dT Primer or corresponding microRNA RT primers according to the manufacturer’s instructions. The cDNA samples were used as template for amplification reactions carried out in a PCR Thermal Cycler Dice Real Time System with the SYBRÒ PrimeScript RT-PCR Kit (TaKaRa, Dalian, China) following our previously described procedure [12]. The expression of miR-128 was analysed with the 2–DDCT method. For each sample, triplicate determinations were performed, and mean values were adopted for further calculations. All values were normalised to an endogenous U6 control. The PCR primers for mature miR-128 or U6 were designed as follows: miR-128 sense, 50 -GCCGGCGCCCGAGCT CTGGCTC-30 and reverse, 50 -TCACAGTGAACCGGT CTCTTT-30 ; U6 sense, 50 -GTGCTCGCTTCGGCAGC ACAT-30 and reverse, 50 -TACCTTGCGAAGTGCTTA AAC-30 . 2.4. Western blot analysis Protein extractions were prepared using a previously described procedure [12] and Western blotting was performed in triplicate experiments. Protein lysates were subjected to electrophoresis on a 4% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and proteins were electrotransferred to polyvinylidene fluoride membranes (Millipore, USA). Membranes were incubated with 5% non-fat dry milk in TBS and probed with anti-VEGF-C, anti-VEGF-A, anti-VEGFR-2 and anti-VEGFR-3 (sc-1881, sc-507, sc-6251, sc-321, respectively; Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-pERK1/2, anti-ERK1/2, anti-pAKT, antiAKT, anti-phospho-p38, anti-p38 and anti-b-actin (#4377, #469, #4056, #9272, #4631, #9212, #4970, respectively; Cell Signaling Technology, USA) in TBST (0.1% Tween 20 in TBS). Horseradish peroxidaseconjugated anti-rabbit (or mouse) IgG (Cell Signaling Technology, USA) was used for detection of immunoreactive proteins by chemiluminescence (PierceÒ ECL kit). 2.5. Cell proliferation assay Cell proliferation assays were performed using the Cell Counting Kit-8 assay (CCK-8, Dojindo, Japan) following the manufacturer’s protocol. A total of 1 103


4


cells per well were seeded into 96 well plates and grown for 24, 48 and 72 h. Ten microlitres of the CCK-8 solution was added to each well, and samples were incubated for 4 h at 37 °C. Absorbance at 450 nm was read on a microplate reader (MultiSkan Spectrum). All experiments were performed in triplicate experiments, and the average of the results was calculated.

scratched with a p-200 ll pipette tip (Qiagen, Valencia, CA, USA) and then washed three times with PBS to clear cell debris and suspension cells. Fresh serum-free medium was added, and the cells were allowed to close the wound for 48 h under normal conditions. Photographs were taken at the same position of the wound with a computer-assisted microscope (Nikon).

2.6. Colony formation assay

2.10. Cell invasion assay

A total of 0.5 103 cells were seeded into six-well plates and cultured for 10 days. Media were replaced with fresh media on day 5. Following incubation, colonies were washed with PBS, fixed for 5 min with 4% paraformaldehyde and stained with 0.1% crystal violet for 30 s. The colony formation assay was repeated three times with duplicate wells.

Cell invasion experiments were performed using the QCMe 24-well Fluorimetric Cell Invasion Assay kit (ECM554, Chemicon International, Temecula, CA, USA) according to the manufacturer’s instructions. The kit uses an insert polycarbonate membrane with an 8-lm pore size. The insert was coated with a thin layer of ECMatrixe that occluded the membrane pores and blocked migration of non-invasive cells. Culture medium (500 ll) supplemented with 10% FBS was used as chemoattractant. Cells that migrated and invaded the underside of the membrane were fixed in 4% paraformaldehyde. The invaded cell numbers were determined by fluorescence and reported as relative fluorescence units (RFUs).

2.7. Flow cytometric analysis of cell cycle Cells were seeded in six-well culture plates and incubated in complete medium to 80–90% confluence. The cells were collected, washed with ice-cold PBS twice and fixed with 70% cold ethanol at 4 °C overnight. After incubation in 1 lg/ml RNase A at 37 °C for 30 min, the cells were stained with 50 lg/ml propidium iodide. Flow cytometric analysis was performed using a FACSCalibur flow cytometer (BD Biosciences, USA). Experiments were performed in triplicate.

2.11. Tumour xenograft treatment model

For cell apoptosis analysis, cells were collected and stained with an Annexin V-Fluorescein Isothiocyanate (FITC) Apoptosis Detection Kit II (BD Biosciences, Pharmingen, CA, USA) according to the manufacturer’s protocol. Briefly, cells were harvested and washed twice with 5 ml cold PBS. A total of 1.0 105 cells were resuspended in 100 ll binding buffer, and mixed with 5 ll of FITC-labelled Annexin V and 5 ll of propidium iodide (PI) at room temperature for 20 min in the dark. After incubation, 400 ll binding buffer was added. Apoptosis was analysed by flow cytometry (FACSCalibur, BD, USA) using CellQueste Pro software (version 4.0.2, Becton Dickinson). The apoptotic morphology assay was also detected by DAPI staining. In brief, cells were stained with 4,6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, USA) and those with fragmented or condensed nuclei were defined as apoptotic cells. At least five visual fields were observed under a fluorescence microscope for each sample.

Animal experimental procedures were approved by the Institutional Animal Care and Use Committee of Mudanjiang Medical University. A suspension of A549 cells (1 107) was injected subcutaneously into the left flank of each BALB/c nude mouse (5–6 weeks of age, 20–22 g). All mice were obtained from the Laboratory Animal Center (Shanghai, China) and maintained in laminar flow cabinets under specific pathogen-free conditions. When tumours formed on day 15 post-implantation, mice were randomly divided into three treatment groups (n = 8 per group): the Lv-miR128 group treated with lentivirus encoding miR-128; the Lv-miR-NC treated with negative control lentivirus; and untreated controls. Treatment groups received 250 ll lentivirus or PBS by intravenous (i.v.) injection into the tail vein every 24 h for 3 weeks. Tumour volumes were measured every 5 days using calipers two major axes after treatment, and calculated according to the formula: V = 0.5 L (length) W2 (width). Upon termination, each mouse was weighed and tumours were harvested for immunohistochemistry analysis, Western blot analysis and quantitative RT-PCR. The immunohistochemistry analysis was performed and measured according to our previously described method [12].

2.9. Wound-healing assay

2.12. Generation of stable cell lines expressing miR-128

Cells were seeded in six-well plates and cultured until they reached confluence. Confluent monolayer cells were

A DNA fragment containing the hsa-miR-128 was amplified from human foetal lung fibroblast cell line

2.8. Apoptosis assays



(MRC-5) genomic DNA and cloned into the pcDNAcopGFP vector (System Biosciences, USA). The PCR primers used were as follows: sense, 50 -GGAATTC AACCAACTGTCAATAACTGGAG-30 ; reverse, 50 CGGGATCCAATTTGTCATCCAAATCTACTTTG G-30 . The constructs were confirmed by DNA sequencing, and the lentivirus vector expressing miR-128 was named LV-miR-128. Lentiviral vectors LV-miR-128 or LV-miR-NC (which was used as a negative control) and Lentiviral packaging plasmids were co-transfected in 293FT packaging cells using Lipofectamine2000 (Invitrogen, CA,USA) according to the manufacturer’s instruction. Forty-eight hours after transfection, the lentivirus in the supernatant was collected, filtered and used to infect NSCLC cells A549, SK-MES-1, NCH-460 and HUVECs. After antibiotic selection for two weeks, stable clones were obtained and the expression of mature miR-128 was confirmed by real-time qRT-PCR. 2.13. 30 -UTR luciferase reporter assay To construct the VEGF-C-30 -UTR plasmid, the 30 UTR region of human VEGF-C mRNA, which includes a seed sequence of mature miR-128-binding sites, was amplified by PCR and cloned into the pGL3-basic vector (Promega, Madison, WI, USA) downstream of the luciferase reporter gene. The primers for VEGF-C-30 UTR were as follows: sense, 50 -GGGGTACCCATGTG GATAACTTTACAGAA-30 ; reverse, 50 -CCCAAGCTT TCATTTTATTTTAAACATATT-30 . The construct was designated as wild-type (WT) and named VEGFC 30 -UTR-WT. The mutated 30 -UTR was generated by using the site-directed mutagenesis kit (Takara) and PCR amplified WT 30 -UTR as template. For the mutated construct, the miR-128 target site (50 -CACTGT GA-30 ) was substituted with a 50 -CTAAGGTC-30 fragment; the primers were as follows: 50 -AACAATTGGTA AAACTCTAAGGTCTCAATATT-30 ; reverse, 50 -TAT AAAAATATGACCTTAGTGAGTTTTACC-30 . The mutated sequence was inserted into the luciferase reporter and named VEGF-C-30 -UTR-MT. The pRL-TK vector (Promega, Madison, WI, USA) was used as an internal control. Human HEK293T cells were cotransfected with mock LV-miR-NC or LV-miR-128 vector, firefly luciferase reporter with the WT or mutant 30 -UTR of VEGF-C and pRL-TK. Cells were harvested 48 h after co-transfection and assayed with the Dual Luciferase Assay kit (Promega, Madison, WI, USA) according to the manufacturer’s protocol. 2.14. In vitro angiogenesis assays Since capillary tube formation on Matrigel is an essential angiogenic property of HUVECs, the in vitro angiogenic activity of HUVECs was determined by tube formation assay. HUVECs after transfection were

5

serum-starved for 24 h by incubation in endothelial basal medium (EBM; Clonetics, CA, USA) with 0.2% BSA. After serum starvation, HUVECs were harvested and 8 104 cells were seeded in a 12-well plate coated with Matrigel basement membrane matrix (BD Biosciences, USA). After 8 h of incubation, tube formation was observed with a computer-assisted microscope (Nikon). Tube formation was defined as a tube-like structure with a length four times its width. Images of tube morphology were taken in 10 random microscopic fields per sample at 100 magnification, and the number of tubes was measured in three photographic fields using LAS software (Leica). 2.15. Statistical analyses Statistical analyses were performed using SPSS statistical software (16.0 for Windows). Experimental data were expressed as means ± standard deviation (SD). The differences between groups were analysed using Student’s t-test and one-way analysis of variance (ANOVA). All statistical tests performed were two sided. Differences were considered statistically significant at P < 0.05. All experiments were performed at least three times to insure reproducibility of the results. 3. Results 3.1. miR-128 expression was downregulated in human NSCLC and cell lines To determine whether miR-128 was involved in the regulation of tumourigenesis of human NSCLC, we assessed miR-128 expression in 30 matched NSCLC specimens and corresponding non-tumoural lung tissues by qRT-PCR. The clinicopathological characteristics of 30 NSCLC patients are shown in Table 1. As shown in Fig. 1A, miR-128 was significantly downregulated in tumour tissues compared with non-tumoural lung tissues (P < 0.01). miR-128 expression was also examined in human NSCLC A549, H1299, SK-MES-1, 95-D, NCI-H460 and NCI-H1688 cells. Expression of miR128 was significantly lower in all human NSCLC cell lines examined compared with the normal human foetal lung fibroblast cell line MRC-5 (Fig. 1B). Moreover, we also examined possible correlation of miR-128 expression with clinicopathological factors, and found that miR-128 downregulation was correlated with poor tumour differentiation, advanced pathological stage and lymph node metastasis in all NSCLC patients including adenocarcinoma (Ad) and squamous cell carcinoma (SCC) patients (Fig. 1C–E, P < 0.05). Thus, these results suggest that downregulation of miR-128 might play important roles in NSCLC progression and development, and that miR-128 might be involved in NSCLC carcinogenesis.


6


Table 1 Characteristics of non-small cell lung cancer patients. Characteristics

No. of patients (n = 30)

Gender (male/female) Age (years) (>60/660) Histological type (Ad/SCC/Ads) Tumour differentiation (well/moderate/poor) Pathological stage (pT) (T3–4/T1–2) Lymph node metastasis (pN) (N1+2+3/N0)

21/9 19/11 13/10/7 9/11/10 13/17 12/18

Note: Histological type: adenocarcinoma (Ad); squamous cell carcinoma (SCC); adenosquamous carcinoma (Ads).

3.2. Overexpression of miR-128 suppressed proliferation and triggered apoptosis of NSCLC cells To study the effect of miR-128 overexpression in NSCLC cells, human lung adenocarcinoma A549 cells, squamous cell carcinoma SK-MES-1 cells and large-cell lung carcinoma NCI-H460 cells were engineered to overexpress human miR-128. Stable cell lines were generated by pcDNA-copGFP lentiviral vector bearing a green fluorescent protein that allows measurement of

transfection and transduction efficiency. High transduction efficiency was confirmed in these cells by fluorescent microscopy (Fig. 2A). Multiple cellular RNA preparations were assayed for miR-128 expression by qRT-PCR. The qRT-PCR analysis showed that the miR-128 expression level in LV-miR-128 cells was significantly higher than in control cell lines (Fig. 2A). To examine if miR-128 may function as a tumour suppressor, the effects of miR-128 overexpression on the proliferation of NSCLC cells were determined in vitro. As shown in Fig. 2B and C, miR-128 overexpression significantly decreased the growth rate of A549, SK-MES-1 and NCI-H460 NSCLC cells, as analysed by CCK-8 and colony formation assays. To further analyse the mechanisms by which miR-128 expression affects cell proliferation, flow cytometric analysis was performed to examine the cell cycle distribution of NSCLC cells after transfection with LV-miR-128. As shown in Fig. 2D, ectopic expression of miR-128 dramatically decreased the percentage of cells in S phase (A549-miR-128 cells/A549-Untreated cells: 26.53%/44.54%; SK-MES-1-miR-128 cells/SK-MES-1Untreated cells: 25.06%/38.74%; NCI-H460-miR-128 cells/NCI-H460-Untreated cells: 30.67%/45.21%) and

Fig. 1. miR-128 expression in non-small cell lung cancer (NSCLC) tissues and its clinical significance. (A) Relative expression of miR-128 in NSCLC tissues in comparison with corresponding non-tumour lung tissues. (B) Relative expression of miR-128 in six NSCLC cell lines in comparison with the human foetal lung fibroblast cell line MRC-5. (C, D and E) miR-128 expression was significantly lower in patients with poor tumour differentiation, higher pathological stage (pT3–4) and lymph node metastasis (N1 + 2 + 3) than in those with good and moderate tumour differentiation, lower pathological stage (pT1–2) and no lymph node metastasis (N0). miR-128 expression was normalised to U6 expression, and results are mean ± SD of three independent experiments. Ad, adenocarcinoma; SCC, squamous cell carcinoma; *P < 0.05, **P < 0.01.



significantly increased the percentage of cells in G1/G0 phase (A549-miR-128 cells/A549-Untreated cells: 72.76%/44.40%; SK-MES-1-miR-128 cells/SK-MES-1Untreated cells: 74.70%/52.95%; NCI-H460-miR-128 cells/NCI-H460-Untreated cells: 68.02%/48.33%). Taken together, these results indicate that overexpression of miR-128 resulted in the G1/G0 arrest of NSCLC cells and suppressed NSCLC cell proliferation in vitro. To determine whether apoptosis was contributing to the growth inhibition, we performed apoptotic morphology analysis and flow cytometric analysis of NSCLC cells after transfection with LV-miR-128 or LV-miRCon vector. As shown in Fig. 2E, DAPI staining revealed obvious increased chromatin condensation and fragmentation in NSCLC cells ectopically overexpressing miR-128 in contrast to control NSCLC cells. Consistent with the morphology results, flow cytometric analysis revealed that NSCLC cells underwent apoptosis

7

48 h after transfection with LV-miR-128. In NSCLC cells ectopically overexpressing miR-128, the rates of early (lower right quadrant, LR) and late apoptosis/ necrosis (upper right quadrant, UR) were dramatically increased (A549, miR-128 cells/Untreated: 15.84% and 74.89%/3.13% and 3.81%; SK-MES-1, miR-128 cells/ Untreated: 31.42% and 47.97%/3.12% and 5.32%; NCI-H460, miR-128 cells/Untreated: 19.33% and 21.57%/3.24% and 1.56%, respectively) (Fig. 2F). These results suggested that ectopic expression of miR-128 could induce enhanced apoptosis in NSCLC cells. 3.3. Overexpression of miR-128 inhibited migration and invasion of NSCLC cells Our data shown that miR-128 was significantly downregulated in samples from patients and cell lines of NSCLC. Therefore, we hypothesised that the

Fig. 2. Effects of MiR-128 overexpression in vitro on proliferation and apoptosis of non-small cell lung cancer (NSCLC) cells. (A) Stable cell lines expressing Lv-miR-128 were examined by fluorescent microscopy and miR-128 expression was measured by quantitative reverse transcriptasepolymerase chain reaction (qRT-PCR). (B) CCK8 assay was performed to determine the proliferation of cells at 24, 48 and 72 h after transfection. (C) Representative results of colony formation of NLCSC cells stably transfected with Lv-miR-128 or Lv-miR-NC. (D) Flow cytometric analysis of cell cycles was performed. (E) Morphology of apoptotic cell nuclei was observed by DAPI staining. (F) Cell apoptosis was detected by Annexin V/ PI assay. Data are representative of three independent experiments. *P < 0.01.


8


overexpression of miR-128 would have an inhibitory effect on NSCLC cell migration and invasion. To test this hypothesis, we first used a wound-healing assay to examine the effect of miR-128 on cell migration. As shown in Fig. 3A, miR-128-overexpressing cells showed considerably slower migration compared with miR-Con cells. Quantification of wound closure showed that miR-128overexpressing cells closed the wound significantly slower than miR-Con cells (A549, miR-128 cells/miR-Con cells: 50.02%/84.03%; SK-MES-1, miR-128 cells/miR-Con cells: 25.57%/88.95%; NCI-H460, miR-128 cells/miRCon cells: 3.57%/78.73%, respectively). Furthermore, invasion assays revealed that miR-128-overexpressing cells showed a remarkable decrease in invasive capacity compared with control cells. The invaded miR-128-overexpressing cell number was reduced to 44.83%, 58.79% and 50.78% compared with control cells (A549, SK-MES-1 and NCI-H460 cells, respectively; P < 0.01) (Fig. 3B). Collectively, these results indicated that ectopic expression of miR-128 could significantly inhibit migration and invasion of NSCLC cells.

3.4. miR-128 directly targets VEGF-C gene by interaction with the 30 -UTRs miRNAs function primarily as mediators of gene silencing, so we used the computer-aided Target-Scan database to predict the potential targets of miR-128 in humans. The database search results identified VEGF-C as a possible target of miR-128. To confirm this possibility, the miR-128 binding sequences in the 30 -UTR of VEGF-C mRNA (VEGF-C 30 -UTR-WT) or the mutated sequence (VEGF-C 30 -UTR-MT) were subcloned downstream of the firefly luciferase reporter gene in the pGL3 vector. The constructs were co-transfected with pcDNA/miR-128 (or pcDNA/miR-NC) into HEK293T cells. The relative luciferase activity of the reporter with the wild-type 30 -UTR was significantly decreased by 56.4% when pcDNA/miR-128 was co-transfected. However, the luciferase activity of the mutant reporter was unaffected by simultaneous transfection of pcDNA/ miR-128 (P < 0.01) (Fig. 4A), suggesting that miR-128 might suppress VEGF-C expression through the miR-128-binding sequence in the 30 -UTR of VEGF-C. Western blot analysis showed that the levels of VEGF-C protein expression in miR-128-overexpressing NSCLC cells were significantly inhibited by 75.39%, 58.24% and 72.68% compared with untreated cells (A549, SK-MES-1 and NCI-H460 cells, respectively; P < 0.01) (Fig. 4B). These data indicated that miR-128 could directly target VEGF-C in NSCLC cells by interaction with the 30 -UTR in the VEGF-C gene. Our previous studies [12] indicated that VEGF-C could perform multiple biological functions to promote tumour progression, such as having autocrine stimulation effects on the expression of VEGF-A, VEGFR-3

and VEGFR-2, which are required for tumour angiogenesis and lymphangiogenesis. To investigate whether overexpression of miR-128 was involved in VEGF-C-induced autocrine effects on the VEGF family, we first analysed whether miR-128-mediated VEGF-C inhibition could affect the protein levels of VEGF-A, VEGFR-2 and VEGFR-3. The protein levels of VEGF-A, VEGFR-2 and VEGFR-3 in miR-128overexpressing NSCLC cells were significantly reduced simultaneously compared with untreated cells (P < 0.05, Fig. 4B). VEGFRs activate the phosphatidylinositol 3-kinase-AKT, extracellular signal-regulated kinase (ERK1/2) and p38 pathways, and these intracellular signalling pathways are critical for cellular growth and survival both in endothelial cells and in cancer cells. Therefore, we next examined whether these pathways may be involved in miR-128-induced growth suppression and apoptosis enhancement. Ectopic expression of miR-128 significantly decreased the phosphorylation of signalling molecules ERK1/2, p38-MAPK and AKT in NSCLC cells (P < 0.01) (Fig. 4C). Together this indicates that miR-128 could interfere with the activation of AKT, ERK1/2 and p38 stimulated by VEGFR-2- and VEGFR-3-dependent signalling pathways through targeting the VEGF-C gene by interaction with the 30 -UTR.

3.5. miR-128 inhibited tumour growth, angiogenesis and lymphangiogenesis in tumour xenografts To explore whether the level of miR-128 expression affects tumour growth in vivo, we performed a xenograft experiment with A549 cells to elucidate the therapeutic effects of miR-128 on tumour cell growth. Mice bearing subcutaneous tumours were treated with therapy beginning 15 days after tumour cell injection. Treatment groups received 250 ll lentivirus or PBS by i.v. injection into the tail vein every 24 h for 3 weeks. At the end of experiment, the tumour volume of mice treated with Lv-miR-128 was 44.97% and 43.53% of mice treated with Lv-miR-128-Con and PBS (383.67 ± 35.31 versus 853.14 ± 71.78, 881.44 ± 56.45, respectively, P < 0.01) (Fig. 5A). Furthermore, tumour weights were significantly lower in Lv-miR-128-treated tumours compared with Lv-miR-128-Con treated tumours (549.37 ± 106.11 versus 926.57 ± 96.93, respectively; P < 0.01) (Fig. 5B). Next, qRT-PCR analysis of miR-128 expression and Western blot analysis of VEGF-C and VEGF-A protein were performed in resected tumour tissues. As shown in Fig. 5C, miR-128 expression in Lv-miR-128 treated groups was significantly higher than that in control groups (P < 0.01). VEGF-C and VEGF-A protein levels in Lv-miR-128-treated groups were significantly lower than that in control groups (P < 0.01, Fig. 5D). To further investigate the therapeutic effect of miR-128 on tumour growth, we performed



9

Fig. 3. Ectopic miR-128 expression inhibits migration and invasion of non-small cell lung cancer (NSCLC) cells. (A) Wound-healing assay was performed to determine the effect of miR-128 on cell migration. (B) Cells invading through the membrane were measured by relative fluorescence units (RFU) of CyQUANT dye binding by cellular nucleic acids in the lysates. Inhibitory effects on invasion are presented as the percentage of fluorescent readings standardised to cell controls (mean ± SD of triplicates). *P < 0.01.

Ki67 immunohistochemical staining to observe cancer cell proliferation. As shown in Fig. 5E, Ki67 expression was markedly decreased in the Lv-miR-128 treated group compared with the control group. Among the VEGF family members, VEGF-C and VEGF-A are responsible for angiogenesis and lymphangiogenesis. To analyse angiogenesis and lymphangiogenesis of tumours, tumour tissues were analysed by immunohistochemical staining with anti-CD34 and anti-LYVE-1 antibodies. Quantitative analysis showed significant reductions in the blood and lymph vessels in Lv-miR128 treated groups compared with controls (P < 0.01, Fig. 5F). Taken together, these data indicated that the expression of miR-128 greatly inhibited the process of tumour progression in vivo, and miR-128 would seem to regulate tumourigenesis via inhibiting VEGF-Cand VEGF-A-mediated angiogenesis and lymphangiogenesis. 3.6. Overexpression of miR-128 inhibited tube formation in vitro Since capillary tube formation on Matrigel is an essential angiogenic property of HUVECs, we investigated whether downregulation of VEGF-C, VEGF-A

and their receptors by miR-128 affected tube formation. At 48 h after transfection with LV-miR-128 or LV-miR-NC, HUVECs were serum-staved for 24 h and the following day, cells were cultured on a Matrigel-coated 12-well plate for 8 h. As seen in Fig. 6A, LV-miR-NC-transfected HUVECs formed well-organised capillary-like structures. However, transfection with miR-128 resulted in a significant impairment of tubeforming activity. Thus, our data indicated that miR128 plays negative roles in angiogenesis of HUVECs. Since ERK1/2, AKT and p38 are critical downstream pathways of VEGF/VEGFR signals, and we found that VEGF-C, VEGF-A and their receptors (VEGFR-3 and VEGFR-2) were negatively regulated in miR-128-overexpressing HUVECs (Fig. 6B), we then examined whether miR-128 has effects on ERK1/2, AKT and p38 phosphorylation. As shown in Fig. 6C, ERK1/2, AKT and p38 phosphorylation were significantly reduced in miR-128-transfected HUVECs compared with miR-128-NC-transfected HUVECs. These results indicate that a decrease of VEGF-C protein by miR-128 suppresses VEGFR-induced activation of the ERK, p38 and AKT signalling pathways as evident by reduction in ERK1/2, AKT and p38 phosphorylation.


10


Fig. 4. miR-128 directly targets vascular endothelial growth factor (VEGF)-C. (A) The sequence of miR-128 matches VEGF-C 30 -UTR (in bold). The mutated nucleotides of the VEGF-C 30 -UTR are labelled by asterisk. Relative luciferase activities of VEGF-C wild-type (WT) and mutant (MT) 30 -UTR regions were calculated. (B) Western blot analysis of the expression levels of VEGF-C, VEGF-A, vascular endothelial growth factor receptor (VEGFR)-2 and VEGFR-3 in cells. (C) Total and phosphorylated ERK, p38 and AKT were analysed by Western blotting. Results are presented as mean ± SD from three independent experiments. Bars indicate standard error. *P < 0.01, **P < 0.05.



11

Fig. 5. Therapeutic effects of miR-128 on human lung cancer xenografts. (A) The volume of tumours in vivo was compared with the controls (n = 8 per group). (B) The tumour weight was investigated for tumour growth. (C) The expression level of miRNA-128 in miR-128-treated tumours was lower than those in control groups. (D) Vascular endothelial growth factor (VEGF)-C and VEGF-A protein levels were detected by Western blotting. (E) Immunohistochemical staining for Ki67 showed a marked decrease in the miR-128 treated group compared with the control group. (F) Tumour tissues from miR-128-treated mice showed significantly reduced microvessel densities (MVD) and lymphatic microvessel densities (LMVD) by immunohistochemical analysis. Columns indicate means; bars are the standard error; scale bar, 100 lm. *P < 0.01.

4. Discussion Recently, accumulating evidence has implicated miRNAs as regulators of the tumour phenotype through their ability to regulate the expression of critical genes and signalling pathways involved in tumourigenesis and downstream malignant processes [32–34]. Our study first showed that mature miR-128 expression was significantly downregulated in NSCLC tissues compared with corresponding non-tumour lung tissues. Moreover, the relative expression level of miR-128 in

NSCLC patients was associated with tumour differentiation, pathological stage and the status of lymph node metastasis. In addition, the level of miR-128 expression in NSCLC cell lines was dramatically lower than that in a human foetal lung fibroblast cell line. In fact, some recent studies established that miRNA expression may be a more accurate classifier of tumour origin and stage than mRNA profiling and standard histological procedures [35]. Recently, Parikh et al. showed that the expression of miR-181a and the phosphorylation of its functional target Smad2 were associated with shorter


12


Fig. 6. Overexpression of miR-128 inhibits tube formation ability of HUVECs. (A) Micrographs of capillary-like structures formed by HUVECs transfected with miR-128 or miR-NC. The number of tubes was measured in three photographic fields using LAS software (Leica). (B) Western blot analysis of the expression levels of vascular endothelial growth factor (VEGF)-C, VEGF-A, vascular endothelial growth factor receptor (VEGFR)-2 and VEGFR-3 in overexpressing miR-128 HUVEC cells. (C) Total and phospho-ERK, -p38 and -AKT in overexpressing miR-128 HUVEC cells were analysed by Western blotting. *P < 0.01.

time to recurrence and poor outcome in patients with epithelial ovarian cancer. The authors proposed miR-181a as a more functionally relevant prognostic biomarker to stratify patients in their primary tumour before chemotherapy treatment, so as to predict clinical response and survival [36]. Our study only included a small size of patient tissues, and further investigation of a larger patient population is necessary to confirm its clinical significance in NSCLC. However, our observations present the first evidence that miR-128 may be a useful biomarker in NSCLC. To further investigate the functions of miR-128 in NSCLC, we performed a rescue experiment by established lentivirus-mediated miR-128-overexpression A549, SK-MES-1 and NCI-H460 lung cancer cells. Our results clearly demonstrated that miR-128 significantly suppressed NSCLC cell proliferation, colony

formation, immigration and invasion, and induced G1 arrest and apoptosis in vitro. Furthermore, our in vivo study indicated that overexpression of miR-128 could suppress NSCLC xenograft tumour growth in nude mice. miR-128 has been described as a tumour suppressor, and downregulated levels of miR-128 were first identified in glioblastoma [37]. Aberrant expression of miR-128 contributes to the malignant phenotypes of cancer cells, such as proliferation [38], cell motility, invasion [39,40], apoptosis [41] and self-renewal [42,43], but its roles in human NSCLC remain to be elucidated. Here we extended the current knowledge by highlighting the role of miR-128 in NSCLC cells. In addition, we also investigated the effect of miR-128 on HUVEC proliferation and apoptosis by established lentivirus-mediated miR-128-overexpression HUVECs, and we obtained the same results (data not shown). These results imply



that miR-128 acts as an inhibitor of NSCLC tumourigenesis. miR-128 may be considered not only as a critical biomarker for diagnosis, but also as an effective target for NSCLC therapy. In addition to having effects on cancer cells, these effects of miR-128 may also be involved in other cells in the tumour, such as endothelial and other cells, and further investigation is necessary. Although some recent studies implicate miRNAs in the regulation of various aspects of angiogenesis [28,44], there are few published data concerning the role of miRNA in angiogenesis and lymphangiogenesis of NSCLC. Our study is the first to show that miR-128 functions as a tumour suppressor in NSCLC, and the first study to show that VEGF-C is negatively regulated by miR-128 at the posttranscriptional level via binding to the 30 -UTR of VEGF-C mRNA in NSCLC cells. Our present study revealed that miR-128 was complementary to the VEGF-C 30 -UTR, and the interaction can inhibit the overexpression of VEGF-C in NSCLC cells. Ectopic expression of miR-128 was able to efficiently reduce the expression of VEGF-C in HUVEC cells and inhibit the angiogenic activity of HUVECs in vitro. Meanwhile, we showed that overexpression of miR-128 in NSCLC cells and HUVECs led to decreased expression of VEGF-A, VEGFR-2 and VEGFR-3, critical factors in cancer angiogenesis and lymphangiogenesis, and subsequent downregulation of phosphorylation of ERK, AKT and p38. In vivo restoration of miR-128 significantly suppressed tumourigenicity of A549 cells in nude mice and inhibited both angiogenesis and lymphangiogenesis of tumour xenograft. These evidences suggested miR-128 as a potential tumour suppressor gene in NSCLC development, by directly targeting the angiogenesis and lymphangiogenesis-related factor VEGF-C. Studies by us [12] as well as Kumar et al. [13] showed that VEGF-C has a particularly important role in the biology of some cancer cells, and knockdown of VEGF-C could result in down expression of VEGFA. Kumar et al. [13] also found that knockdown of VEGF-A could result in over expression of VEGF-C, which possibly to compensate for VEGF-A depleted levels. In addition, recent study by Li et al. [45]showed that tumours may develop resistance to anti-VEGF-A therapy by activating the VEGF-C pathway, and indicated that dual targeting of VEGF-A and VEGF-C may improve the efficacy of anti-angiogenic therapy and overcome drug resistance to anti-VEGF-A therapy. Therefore, we speculated that VEGF-C could be a better target over VEGF-A to inhibit not only lymphangiogenesis but also angiogenesis. In our study, by directly targeting VEGF-C, miR-128 downregulated both VEGF-C and VEGF-A, and simultaneously blocked ERK, AKT and p38 signalling pathways, indicating that miR-128 plays a critical role in NSCLC angiogenesis and lymphangiogenesis. As illustrated in Fig. 7, our findings

13

Fig. 7. Hypothetical model of miR-128 suppressive function in nonsmall cell lung cancer (NSCLC) cancer cells and endothelial cells. Vascular endothelial growth factor (VEGF)-C was downregulated upon being directly targeted by miR-128 both in cancer cells and endothelial cells. VEGF-C downregulation mediated by miR-128 resulted in decreased expression level of VEGF-A. In addition, VEGFC downregulation mediated by miR-128 also resulted in decreased expression of vascular endothelial growth factor receptor (VEGFR)-2 and VEGFR-3. In a result, downstream VEGFR signalling pathways ERK, AKT and p38 MAPK were simultaneously blocked, which ultimately inhibited NSCLC progression, angiogenesis and lymphangiogenesis.

indicated the critical roles of miR-128 on the regulation of expression of both VEGF-C and VEGF-A, and provide the basis for the development of novel anti-NSCLC therapies, especially anti-angiogenesis and antilymphangiogenesis approaches. Many current studies have clearly indicated that one miRNA could control multiple oncogenes, so re-expression of miRNAs had been suggested to hold considerable potential in tumour gene therapy. Thus, our in vivo NSCLC xenograft treatment model data provide strong evidence that restoration of miR-128 expression may have considerable therapeutic significance for NSCLC. In conclusion, this study shows that miR-128 is downregulated in NSCLC, and functions as a tumour suppressor in NSCLC by directly targeting VEGF-C.


14


Ectopic expression of miR-128 inhibited tumour progression, angiogenesis and lymphangiogenesis, and could simultaneously block ERK, AKT and p38 signal pathways. Our data indicated that restoration of miR128 in cancer and endothelial cells could inhibit multiple targets and pathways involved in tumour progression, angiogenesis and lymphangiogenesis at the same time. Together these data may provide a strategy for targeting the miR-128/VEGF-C interaction as a new therapy to treat NSCLC cancer. Conflict of interest statement None declared. Acknowledgements This work was supported by National Science Foundation of China (81372293 and 81241088 to Y.K.F., 81273161 to K.J.F.), Post-Doctoral Science Foundation of China (2012M520762 to Y.K.F.), New Century Excellent Talents in Heilongjiang Province University (to Y.K.F.), Department of Science & Technology of Heilongjiang Province of China (QC2011C056 to J.H.), Program for Innovation Research Team in Science and Technology in Heilongjiang Province University (to Y.K.F. and Z.S.J.), and Program from China Scholarship Council (to Y.K.F.). References [1] Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin 2011;61(2):69–90. [2] Cao M, Hou D, Liang H, Gong F, Wang Y, Yan X, et al. MiR150 promotes the proliferation and migration of lung cancer cells by targeting SRC kinase signalling inhibitor 1. Eur J Cancer 2014;50(5):1013–24. [3] Guo X, Wang W, Hu J, Feng K, Pan Y, Zhang L, et al. Lentivirus-mediated RNAi knockdown of NUPR1 inhibits human nonsmall cell lung cancer growth in vitro and in vivo. Anat Rec (Hoboken) 2012;295(12):2114–21. [4] Menakuru SR, Brown NJ, Staton CA, Reed MW. Angiogenesis in pre-malignant conditions. Br J Cancer 2008;99(12):1961–6. [5] Du L, Pertsemlidis A. MicroRNAs and lung cancer: tumors and 22-mers. Cancer Metastasis Rev 2010;29(1):109–22. [6] Kerbel RS. Tumor angiogenesis: past, present and the near future. Carcinogenesis 2000;21(3):505–15. [7] Kerbel RS. Tumor angiogenesis. N Engl J Med 2008;358(19):2039–49. [8] Cebe-Suarez S, Zehnder-Fjallman A, Ballmer-Hofer K. The role of VEGF receptors in angiogenesis; complex partnerships. Cell Mol Life Sci 2006;63(5):601–15. [9] Lohela M, Bry M, Tammela T, Alitalo K. VEGFs and receptors involved in angiogenesis versus lymphangiogenesis. Curr Opin Cell Biol 2009;21(2):154–65. [10] Tammela T, Zarkada G, Wallgard E, Murtomaki A, Suchting S, Wirzenius M, et al. Blocking VEGFR-3 suppresses angiogenic sprouting and vascular network formation. Nature 2008;454(7204):656–60. [11] Benest AV, Harper SJ, Herttuala SY, Alitalo K, Bates DO. VEGF-C induced angiogenesis preferentially occurs at a distance from lymphangiogenesis. Cardiovasc Res 2008;78(2):315–23.

[12] Feng Y, Hu J, Ma J, Feng K, Zhang X, Yang S, et al. RNAimediated silencing of VEGF-C inhibits non-small cell lung cancer progression by simultaneously down-regulating the CXCR4, CCR7, VEGFR-2 and VEGFR-3-dependent axes-induced ERK, p38 and AKT signalling pathways. Eur J Cancer 2011;47(15):2353–63. [13] Kumar B, Chile SA, Ray KB, Reddy GE, Addepalli MK, Kumar AS, et al. VEGF-C differentially regulates VEGF-A expression in ocular and cancer cells; promotes angiogenesis via RhoA mediated pathway. Angiogenesis 2011;14(3):371–80. [14] Bergers G, Hanahan D. Modes of resistance to anti-angiogenic therapy. Nat Rev Cancer 2008;8(8):592–603. [15] Shojaei F, Ferrara N. Antiangiogenic therapy for cancer: an update. Cancer J 2007;13(6):345–8. [16] Feng LZ, Zheng XY, Zhou LX, Fu B, Yu YW, Lu SC, et al. Correlation between expression of S100A4 and VEGF-C, and lymph node metastasis and prognosis in gastric carcinoma. J Int Med Res 2011;39(4):1333–43. [17] Stacker SA, Williams SP, Karnezis T, Shayan R, Fox SB, Achen MG. Lymphangiogenesis and lymphatic vessel remodelling in cancer. Nat Rev Cancer 2014;14(3):159–72. [18] Cho WC. OncomiRs: the discovery and progress of microRNAs in cancers. Mol Cancer 2007;6:60. [19] Esquela-Kerscher A, Slack FJ. Oncomirs – microRNAs with a role in cancer. Nat Rev Cancer 2006;6(4):259–69. [20] Zhao G, Wang B, Liu Y, Zhang JG, Deng SC, Qin Q, et al. MiRNA-141, downregulated in pancreatic cancer, inhibits cell proliferation and invasion by directly targeting MAP4K4. Mol Cancer Ther 2013;12(11):2569–80. [21] Ma L, Reinhardt F, Pan E, Soutschek J, Bhat B, Marcusson EG, et al. Therapeutic silencing of miR-10b inhibits metastasis in a mouse mammary tumor model. Nat Biotechnol 2010;28(4): 341–7. [22] Si ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY. MiR-21-mediated tumor growth. Oncogene 2007;26(19):2799–803. [23] Felicetti F, Errico MC, Bottero L, Segnalini P, Stoppacciaro A, Biffoni M, et al. The promyelocytic leukemia zinc finger-microRNA-221/-222 pathway controls melanoma progression through multiple oncogenic mechanisms. Cancer Res 2008;68(8):2745–54. [24] Wickramasinghe NS, Manavalan TT, Dougherty SM, Riggs KA, Li Y, Klinge CM. Estradiol downregulates miR-21 expression and increases miR-21 target gene expression in MCF-7 breast cancer cells. Nucleic Acids Res 2009;37(8):2584–95. [25] O’Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. CMyc-regulated microRNAs modulate E2F1 expression. Nature 2005;435(7043):839–43. [26] Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, et al. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 2006;9(3):189–98. [27] Fish JE, Srivastava D. MicroRNAs: opening a new vein in angiogenesis research. Sci Signal 2009;2(52):pe1. [28] Hua Z, Lv Q, Ye W, Wong CK, Cai G, Gu D, et al. MiRNAdirected regulation of VEGF and other angiogenic factors under hypoxia. PLoS One 2006;1:e116. [29] Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A 2004;101(9):2999–3004. [30] Shiseki M, Kohno T, Nishikawa R, Sameshima Y, Mizoguchi H, Yokota J. Frequent allelic losses on chromosomes 2q, 18q, and 22q in advanced non-small cell lung carcinoma. Cancer Res 1994;54(21):5643–8. [31] Wistuba II, Behrens C, Virmani AK, Mele G, Milchgrub S, Girard L, et al. High resolution chromosome 3p allelotyping of human lung cancer and preneoplastic/preinvasive bronchial epithelium reveals multiple, discontinuous sites of 3p allele loss and three regions of frequent breakpoints. Cancer Res 2000;60(7):1949–60.


J. Hu et al. / European Journal of Cancer xxx (2014) xxx–xxx [32] Chen CZ. MicroRNAs as oncogenes and tumor suppressors. N Engl J Med 2005;353(17):1768–71. [33] Yang D, Sun Y, Hu L, Zheng H, Ji P, Pecot CV, et al. Integrated analyses identify a master microRNA regulatory network for the mesenchymal subtype in serous ovarian cancer. Cancer Cell 2013;23(2):186–99. [34] Kumar MS, Lu J, Mercer KL, Golub TR, Jacks T. Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nat Genet 2007;39(5):673–7. [35] Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, et al. MicroRNA expression profiles classify human cancers. Nature 2005;435(7043):834–8. [36] Parikh A, Lee C, Joseph P, Marchini S, Baccarini A, Kolev V, et al. MicroRNA-181a has a critical role in ovarian cancer progression through the regulation of the epithelial-mesenchymal transition. Nat Commun 2014;5:2977. [37] Ciafre SA, Galardi S, Mangiola A, Ferracin M, Liu CG, Sabatino G, et al. Extensive modulation of a set of microRNAs in primary glioblastoma. Biochem Biophys Res Commun 2005;334(4): 1351–8. [38] Zhang Y, Chao T, Li R, Liu W, Chen Y, Yan X, et al. MicroRNA-128 inhibits glioma cells proliferation by targeting transcription factor E2F3a. J Mol Med (Berl) 2009;87(1):43–51. [39] Evangelisti C, Florian MC, Massimi I, Dominici C, Giannini G, Galardi S, et al. MiR-128 up-regulation inhibits Reelin and DCX

[40]

[41]

[42]

[43]

[44]

[45]

15

expression and reduces neuroblastoma cell motility and invasiveness. FASEB J 2009;23(12):4276–87. Khan AP, Poisson LM, Bhat VB, Fermin D, Zhao R, KalyanaSundaram S, et al. Quantitative proteomic profiling of prostate cancer reveals a role for miR-128 in prostate cancer. Mol Cell Proteomics 2010;9(2):298–312. Adlakha YK, Saini N. MicroRNA-128 downregulates Bax and induces apoptosis in human embryonic kidney cells. Cell Mol Life Sci 2011;68(8):1415–28. Godlewski J, Nowicki MO, Bronisz A, Williams S, Otsuki A, Nuovo G, et al. Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res 2008;68(22):9125–30. Tu Y, Gao X, Li G, Fu H, Cui D, Liu H, et al. MicroRNA-218 inhibits glioma invasion, migration, proliferation, and cancer stem-like cell self-renewal by targeting the polycomb group gene Bmi1. Cancer Res 2013;73(19):6046–55. Sun CY, She XM, Qin Y, Chu ZB, Chen L, Ai LS, et al. MiR-15a and miR-16 affect the angiogenesis of multiple myeloma by targeting VEGF. Carcinogenesis 2013;34(2):426–35. Li D, Xie K, Ding G, Li J, Chen K, Li H, et al. Tumor resistance to anti-VEGF therapy through up-regulation of VEGF-C expression. Cancer Lett 2014;346(1):45–52.


Therapeutic options targeting angiogenesis in nonsmall cell lung cancer.

Endothelial PFKFB3 plays a critical role in angiogenesis.

Role of hypoxia and vascular endothelial growth factors in lymphangiogenesis.

Role of hypoxia and vascular endothelial growth factors in lymphangiogenesis.

Vascular endothelial growth factor directly stimulates tumour cell proliferation in non-small cell lung cancer.

Quercetin inhibits angiogenesis-mediated human retinoblastoma growth by targeting vascular endothelial growth factor receptor.

Inhibition of miR-92b suppresses nonsmall cell lung cancer cells growth and motility by targeting RECK.

Actin-tethered junctional complexes in angiogenesis and lymphangiogenesis in association with vascular endothelial growth factor.

Critical role of vascular endothelial growth factor secreted by mesenchymal stem cells in hyperoxic lung injury.

Targeting angiogenesis in small cell lung cancer.

Overexpression of both platelet-derived growth factor-BB and vascular endothelial growth factor-C and its association with lymphangiogenesis in primary human non-small cell lung cancer.

Hypoxia-induced factor-1 alpha upregulates vascular endothelial growth factor C to promote lymphangiogenesis and angiogenesis in breast cancer patients.

Targeting oncogenic KRAS in non-small cell lung cancer cells by phenformin inhibits growth and angiogenesis.

SARI inhibits angiogenesis and tumour growth of human colon cancer through directly targeting ceruloplasmin.

Targeting Angiogenesis in Cancer Therapy: Moving Beyond Vascular Endothelial Growth Factor.

Vascular endothelial growth factor plays a critical role in the formation of the pre-metastatic niche via prostaglandin E2.

A role for p38 MAPK in head and neck cancer cell growth and tumor-induced angiogenesis and lymphangiogenesis.

Prostaglandin E2 and vascular endothelial growth factor A mediate angiogenesis of human ovarian follicular endothelial cells.

D to promote lymphangiogenesis in human gastric cancer.

Exchange protein directly activated by cAMP plays a critical role in bacterial invasion during fatal rickettsioses.

microRNA-363 plays a tumor suppressive role in osteosarcoma by directly targeting MAP2K4.

Targeting NRASQ61K mutant delays tumor growth and angiogenesis in non-small cell lung cancer.

Azithromycin effectively inhibits tumor angiogenesis by suppressing vascular endothelial growth factor receptor 2-mediated signaling pathways in lung cancer.

Strategies targeting angiogenesis in advanced non-small cell lung cancer.