Mol Cell Biochem (2014) 387:151–158 DOI 10.1007/s11010-013-1880-7

MicroRNA-128 regulates the differentiation of rat bone mesenchymal stem cells into neuron-like cells by Wnt signaling Rui Wu • Yue Tang • Wenqiao Zang • Yuanyuan Wang • Min Li • Yuwen Du Guoqiang Zhao • Yuming Xu



Received: 22 August 2013 / Accepted: 18 October 2013 / Published online: 4 December 2013 Ó Springer Science+Business Media New York 2013

Abstract Bone marrow mesenchymal stem cells (BMSCs) are a source of multipotent stem cells ideally suited for various cell-based therapies. BMSCs can differentiate into neuron-like cells under the appropriate conditions. MicroRNAs are members of a family of noncoding small RNAs that regulate gene expression at the posttranscriptional level, either by inhibiting mRNA translation or by promoting mRNA degradation. MicroRNAs play an important role in the differentiation of BMSCs into neurons. MicroRNA-128, a brain-enriched microRNA, was recently found to be necessary in the neural differentiation of BMSCs. Studies have shown that Wnt signaling pathway is involved in regulating MSC differentiation. Our goal here was to investigate whether microRNA-128 can regulate the differentiation of BMSCs through modulation of Wnt3a, a key component of the Wnt signaling pathway. By means of dual-luciferase reporter assay, we describe for the first time that by binding to a specific site in the 30 -UTR of Wnt3a in BMSCs, downregulated microRNA-128 may lead to the neural differentiation of mesenchymal stem cells. Transfection of microRNA-128 mimic decreased the nerve cell markers and

R. Wu  Y. Xu (&) Department of Neurology, The First Affiliated Hospital of Zhengzhou University, No. 1 Jianshe Road, Zhengzhou 450052, China e-mail: [email protected] R. Wu Department of Neurological Rehabilitation, The Second Affiliated Hospital of Zhengzhou University, Zhengzhou 450014, China Y. Tang  W. Zang  Y. Wang  M. Li  Y. Du  G. Zhao (&) College of Basic Medical Sciences, Zhengzhou University, No. 100 Kexue Road, Zhengzhou 450001, China e-mail: [email protected]

Wnt3a expression levels. On the other hand, the inhibition of microRNA-128 significantly elevated the nerve cell markers as well as the Wnt3a expression levels. This suggests that microRNA-128 acts as an endogenous attenuator of BMSCs differentiation into neurons. Keywords BMSCs  Neuron  Micror-128  Differentiation  Wnt3a

Introduction Bone marrow mesenchymal stem cells (BMSCs) belong to the category of multipotent adult stem cells that possess the ability to differentiate, in vivo and in vitro, into mesoderm, endoderm and even neuroectoderm cells [1–4]. Recent studies have described that BMSCs can be differentiated into neuron-like cells in vitro under specific-induced culture conditions [5, 6]. However, the mechanism of the BMSCs transformation into neurons is still unclear. Post-transcriptional mechanisms are believed to play an important role in the regulation of neural gene expression [7, 8]. MicroRNAs are a recently recognized class of small noncoding RNA molecules with functions that control the space–time differential expressions of various genes in BMSCs, both at the transcriptional level and the posttranscriptional level [9–13]. MicroRNA-128 is highly expressed in the central nervous system. Although microRNA-128 plays an important role in neural stem cells’ self-renewal and differentiation, there are no reports on whether microRNA-128 could affect or induce the neural differentiation of BMSCs. Differentiation of BMSCs into neurons involves multiple signaling pathways such as the Notch, Sox, and Wnt pathways [14]. Previous studies indicated that the

123

152

activation of the canonical Wnt signaling pathway is related to BMSCs’ directional differentiation [15, 16]. Using microRNA analysis software, we conjectured the possibility that microRNA-128 is targeting the 30 -UTR of Wnt3a, a key component of the Wnt signaling pathway. To explore the validity of our prediction, we investigated the molecular mechanism through which microRNA-128 regulates BMSC differentiation, with a focus on microRNA128’s modulation of Wnt3a in the Wnt signaling pathway.

Mol Cell Biochem (2014) 387:151–158

group, an Inducer group and a Blank group. Cells in the Mimic group were transfected by GMR-miRTM microRNA-128 mimics (Shanghai GenePharma); cells in the Inhibitor group were transfected by GMR-miRTM microRNA-128 inhibitors (Shanghai GenePharma); lastly, the cells in the Inducer group and Blank group were not transfected. For the transfection, 1 9 106 cells were treated with 50nM GMR-miRTM microRNA-128 mimics, or with GMR-miRTM microRNA-128 inhibitors, in 1 ll of LipofectamineTM2000 (Invitrogen, USA), according to the manufacturer’s instructions.

Materials and methods BMSCs’ differentiation into neuron-like cells Isolation and cultivation of rat BMSCs BMSCs were isolated from SD rats aged 4 weeks with license number: SCXK (Henan) 2005-0001 were provided by the Experimental Animal Center of Zhengzhou University. Using a syringe needle, the bone marrow were extracted from the dissected femurs and tibia and flushed with DMEM culture medium containing 100 U/ml Penicillin, 100 lg/ml streptomycin, and 10 % FBS (Gibco). Invitro BMSCs were cultured with the method of percoll (1.073 g/ml) density centrifugation and adherence to plastic dishes. After preparation with DMEM containing 10 % FBS, BMSCs (106/ml) were seeded in a 25 cm2culture flask in a 37 °C/5 % CO2 incubator. Non-adherent cells were removed after 48 h and the media was replaced every 2–3 days. When cell confluence reached 80–90 %, cultures were harvested with Trypsin–EDTA solution (0.25 % trypsin, 1 mM EDTA; Sigma). The cells were split 1:2 and passaged up to three times. This study was approved by the Human Research Ethics Committee of Zhengzhou University. BMSCs phenotypic identification The cells were adjusted to the density of 1 9 107/ml. Then the cells were incubated with a primary antibody for 40 min with saturating concentrations of monoclonal antibodies CD29, CD90, CD31, and CD45. After the cells were washed three times in a buffer and centrifuged at 200g for 5 min, they were resuspended in ice-cold PBS and incubated with either the FITC-labeled or TRITC-labeled secondary antibody for 30 min in the dark at 4 °C. Cell fluorescence was evaluated by flow cytometry in an FACS Calibur instrument (Becton–Dickinson); and the data were analyzed using Cell Quest software (Becton–Dickinson). Grouping and BMSCs transfection When the cells reached 60 % confluence, the cells were divided into four groups: a Mimic group, an Inhibitor

123

According to the method reported by Qin [17, 18], BMSCs with 70–80 % of cell confluence in 3 experimental groups, except Blank group, were pre-induced in the pre-induction medium for 7 days. After the pre-induction medium was removed and the pre-induced cells were washed with PBS for three times, 3 experimental group cells, except Blank group cells, were induced in 25 cm2-culture flask in the induction medium for 5 days. Cells in Blank group were only cultured under common condition. Pre-induction medium: DMEM/F12 medium was supplemented with 2 % B27 (Gibco), 20 ng/ml basic fibroblast growth factor (bFGF, Cytolab/peprotech, Asia), 20 ng/ml epidermal growth factor (EGF, Cytolab/peprotech, Asia), 100 U/ml penicillin, and 100 mg/ml streptomycin. Induction medium: DMEM/F12 medium was supplemented with 10 % FBS, 2 % B27, 10 ng/ml bFGF, 10 ng/ml EGF, 100 U/ml penicillin, and 100 mg/ml streptomycin. MicroRNA-128 expression detected by real-time quantitative RT-PCR Relative levels of microRNA-128 mRNA in induced BMSCs were determined by real-time quantitative RT-PCR, where the U6 snRNAs served as a control (primers for qRTPCR see Table 1). The total RNA was extracted from induced BMSCs with RNA Extraction Kit (Qiagen) and cDNA was extracted with miScript Reverse Transcription Kit (Qiagen), all according to the manufacturer’s instructions. Real-time quantitative RT-PCR was performed on a fluorescence-quantitative PCR instrument (ABI Prism7500). Then, qPCR amplification was conducted in 20-ll reaction buffer using ABI Power SYBRÒGreen PCR Master Mix (Applied Biosystems) under the following conditions: preheating at 95 °C for 15 min, denaturing at 94 °C for 15 s, reannealing at 55 °C for 30 s, elongation at 70 °C for 30 s, 40 cycles. The corresponding CT values were recorded with ABI Prism7500 SDS Software, and then the relative expression level of microRNA-128 was calculated according to the formula: 2-44Ct.

Mol Cell Biochem (2014) 387:151–158 Table 1 List of primers for qRT-PCR miR-128-RT

50 GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGACAGTGTCA 30

miR-128-F

50 TCCGA TTTCTCTGGCCAAG 30

miR-128-R

50 GTGCAGGGTCCGAGGT 30

U6 snRNA-RT

50 GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGACAAAATA 30

U6 snRNA-F

50 TCCGA TCGTGAAGCGTTC 30

U6 snRNA-R

50 GTGCAGGGTCCGAGGT 30

Detection of protein expression of nerve cell markers and Wnt3a by western blot Whole-cell lysates for western blotting were extracted with lysis buffer containing 50 mM Tris–Cl, pH 6.8, 10 mM EDTA, 2 % SDS, 5 mM DTT, 0.5 mM PMSF. Protein samples were resolved by 12 % SDS-PAGE gel and transferred to PVDF membrane. Then the PVDF membrane was incubated with individual antibodies (monoclonal mouse antibodies, Santa Cruz) according to manufacturer’s instruction and then incubated with a HRP-labeled goat antimouse IgG (Santa Cruz). After washing the membrane, visualization was performed with ECL solution. The signal strength in Western-blot chromogenic bands was quantitatively analyzed with imaging analysis software, with b-actin as the internal control. Immunofluorescence microscopy For immunofluorescence experiments, the cells were grown on 6-well chamber slides and fixed in 4 % formaldehyde for 15 min at room temperature. They were then permeabilized in 0.5 % Triton X-100 for 5 min, washed three times in PBS, and blocked in 5 % normal goat serum for 20 min. The slides were then incubated overnight at 4 °C with monoclonal mouse anti-glial fibrillary acidic protein (Santa Cruz, USA, dilution 1:500), or monoclonal mouse anti-Nestin (Santa Cruz, USA, dilution 1:500) diluted in PBS with 1 % BSA. After three washes in PBS, slides were incubated for 30 min at 37 °C with the secondary antibody Cy3-conjugated goat anti-mouse IgG (Chemicon, USA, dilution 1:2,000) diluted in PBS. Cells were examined using an Olympus BX 51 microscope equipped for immunofluorescence. Vector construction and transfection The rat Wnt3a (XM_003750837) 30 -UTR was amplified and cloned into a T-vector. The 211 bp (2,251–2,460 nt) fragment of Wnt3a 30 -UTR was excised from a T/A cloning recombinant, with XbaI ligated into the equivalent site of pGL3-promoter vector to construct a luciferase reporter

153

plasmid (pGL3-wt-Wnt3a). The QuikChange site-directed mutagenesis kit (Stratagene) was used to introduce mutation into the seed region of pGL3-wt-Wnt3a, resulting in pGL3-mut-Wnt3a . HEK293 cells were seeded in 96-well plates and transfected with 50 nM microRNA-128 mimics or microRNA-128 inhibitors, 200 ng of luciferase reporter plasmid (pGL3wt-Wnt3a/pGL3-mut-Wnt3a), and 25 ng of Renilla vector (pRL-TK) using LipofectamineTM2000 (Invitrogen).At 48 h after transfection, cells were harvested and luciferase activity was measured using the Dual-luciferase reporter assay (Promega). Dual-luciferase reporter (DLR) assay and bioluminescent measurements Cells were washed twice with PBS and harvested using passive lysis buffer (Promega), followed by centrifugation at 2,0009g for 5 min at 4 °C to pellet cellular debris. The firefly and Renilla luciferase activity was measured in the same well from a single sample, using DLR assay kit (Promega) on a Centro XS3 LB 960 (BERTHOLD). The average values were calculated from three replicates to set Firefly/Renilla luciferase expression in scramble microRNA and pGL3-wt-Wnt3a group to 100 %. Statistical analysis Results were analyzed using SPSS software 13.0 and compared using one-way analysis of variance (ANOVA). Data were presented as mean ± standard deviation (SD) of three independent experiments. p \ 0.05 was considered statistically significant.

Results BMSCs cultivation and identification of BMSCs surface antigens At 48 h after the initial seeding, many of the rounded as well as spindle shaped cells have attached to the base of the culture flask. The number of adherent cells were visibly increased, and they formed a colony-like cell group. After subculturing these adherent cells, their morphology gradually changed into a spindle shape. To identify the phenotypes, flow cytometry analysis was performed. Most cells showed the characteristic phenotypes of BMSCs positive for CD29 (96.04 ± 1.73 %) and CD90 (95.79 ± 1.08 %), while only a few cells positive for CD31 (3.75 ± 0.74 %) and CD45 (6.26 ± 1.06 %). This result indicated that high-purity BMSCs could be harvested and used for the next experiment.

123

154

Fig. 1 The relative fold microRNA-128 expression in each group Rat BMSCs in the Mimic group were transfected with microRNA-128 mimics, and then induced by bFGF and EGF. Rat BMSCs in the Inhibitor group were transfected with microRNA-128 inhibitors, and then induced by bFGF and EGF. Rat BMSCs in the Inducer group were not transfected, but were still induced by bFGF and EGF. Rat BMSCs in Blank group were neither transfected nor induced by bFGF and EGF. The relative expression level of microRNA-128 in each group is determined with qRT-PCR. This expression level is presented as a ratio of relative expression over the microRNA-128 expression in the Blank group. The relative fold (RF) of microRNA128 has significantly risen in the Mimic group on the fifth day of induction (p \ 0.01). On the other hand, it has significantly decreased in the Inhibitor group compared with the Blank group on the fifth day of induction (p \ 0.01)

Downregulated microRNA-128 may drive mesenchymal stem cells toward a neuronal fate We transfected the BMSCs with microRNA mimics to determine if the microRNA-1280 s gain-of-function can lead to the cells’ neuronal differentiation. Real-time quantitative RT-PCR result demonstrated that on the fifth day of

Fig. 2 a Western blot analysis of the 6 nerve cell markers from induced-BMSCs on the fifth day in each experimental group. The western blotting employed monoclonal mouse antibodies of 6 nerve cell markers and goat anti mouse IgG HRP. b The average values were calculated to set protein expression in the Inducer group to

123

Mol Cell Biochem (2014) 387:151–158

induction microRNA-128 in the Mimic group was overexpressed compared with the Blank group and the Inducer group (p \ 0.01) (Fig. 1). To construct loss-of-function, we transfected microRNA-128 Inhibitor into BMSCs. Real-time quantitative RT-PCR result demonstrated that on the fifth day of induction, microRNA-128 in the Inhibitor group was repressed when compared with the Blank group and the Inducer group (p \ 0.01) (Fig. 1). When the BMSCs induced with bFGF and EGF for 5 days are compared with the Blank group, the mRNArelative quantitation of NSE, Nestin, GFAP, NF-M, MAP2, and b3- tubulin were found to be significantly higher in all 3 experimental groups (p \ 0.01). The data indicated that bFGF and EGF can induce BMSCs to differentiate into neuron-like cells. In the microRNA-128 overexpressing cells, nerve cell markers mRNA and protein levels were significantly reduced compared with the Inducer group (p \ 0.01) (Fig. 2). Real-time RT-PCR and western blot analysis showed that the inhibition of microRNA-128 led to elevated nerve cell markers expression level, when compared with the Inducer group (p \ 0.01) (Fig. 2). Here we found microRNA-128 have an impact on the 6 nerve cell markers (NSE, Nestin, GFAP, NF-M, MAP-2, and b3tubulin) in the induced BMSCs in that the expression of the 6 nerve cell markers was suppressed by the microRNA-128 mimic but elevated by the microRNA-128 inhibitor. Immunofluorescence analysis showed that in all experimental groups, except the Blank group, nerve-cell-like changes occurred in a portion of the BMSCs. The cell body shrunk and the cells became polygonal or round in shape possessing long neurites that form local networks, which is a typical structure of nerve cells. In the Inhibitor group, the changes in cell morphology were more notable (Figs. 3, 4).

100 %. The relative quantitation of 6 nerve cell markers (NSE, Nestin, GFAP, NF-M, MAP-2, and b3- tubulin) is significantly higher in Inhibitor group (p \ 0.01), and is significantly lower in the Mimic group compared to the Inducer group (p \ 0.01). *p \ 0.01

Mol Cell Biochem (2014) 387:151–158

155

Fig. 3 Immunofluorescent images for GFAP of induced-BMSCs on the fifth day of each of the four groups. a Blank group (untreated cells), b inducer group (bFGF?EGF), c mimic group (bFGF?EGF?mimic), d inhibitor group (bFGF?EGF?inhibitor). Rat BMSCs in the Mimic group were transfected with microRNA-128 mimics, and then induced by bFGF and EGF. Rat BMSCs in the Inhibitor group were transfected with microRNA-128 inhibitors, and then induced by bFGF and EGF. Rat BMSCs in the Inducer group were not transfected, but were still induced by bFGF and EGF. Rat

BMSCs in Blank group were neither transfected nor induced by bFGF and EGF. Compared to cells in the Inducer group, cells in the Inhibitor group are the most neuron-like cells in morphology, displaying shrunken and round cell bodies. In the BMSCs induced with bFGF and EGF for 5 days, stain GFAP with monoclonal mouse anti-glial fibrillary acidic protein and secondary antibody Cy3conjugated goat anti-mouse IgG. The result of the Blank group, the Inducer group, the Mimic group, and the Inhibitor group were negative, positive, weak positive, and strong positive, respectively

In the Mimic group, the changes in cell morphology were not obvious, with the nerve cell-like changes only occurring in a few cells (Figs. 3, 4). These above cell morphology observations showed that microRNA-128 may influence BMSCs differentiation to neurons. To further determine nerve cell markers expression in the four groups, we examined GFAP and Nestin with immunofluorescence. For both GFAP and Nestin, the fluorescence intensity of the Blank group and the Inducer group were negative and positive, respectively. Particularly, the intensity of fluorescence in the Mimic group provided the strongest inhibitory effect while the intensity of fluorescence in the Inhibitor group provided the strongest enhancement effect (Figs. 3, 4). The results from the fluorescence intensity indicate that expression of the two nerve cell markers was suppressed by the microRNA-128 mimic, and was elevated by the microRNA-128 inhibitor, consistent with the result of western blot. In this section, the results from the western blot and immunofluorescence both showed that downregulated microRNA-128 may

induce the differentiation of mesenchymal stem cells toward neuron-like cells. MicroRNA-128 binds 30 -UTR of Wnt3a mRNA to modulate Wnt3a expression Wnt3a is a key component of the Wnt signaling pathway. To study the interaction between Wnt3a and microRNA128, western blotting and real-time RT-PCR analysis were used to analyze differences in Wnt3a expression in the aforementioned four groups. Transfection of microRNA128 mimic decreased Wnt3a’s expression levels, while microRNA-128 inhibitor elevated Wnt3a’s expression (Fig. 5a, b). This effect of microRNA-128 was specific because scrambled microRNA did not exhibit such effect. In the present study, we confirmed microRNA-128 acts as an attenuator of Wnt signaling pathway. The relationship between the Wnt3a-30 -UTR and its targeted miRNAs was predicted through bioinformatics analysis by TargetScan and miRanda that showed that the 30 -UTR

123

156

Mol Cell Biochem (2014) 387:151–158

Fig. 4 Immunofluorescent images for Nestin of induced-BMSCs on the fifth day of each group. a Blank group (untreated cells), b inducer group (bFGF?EGF), c mimic group (bFGF?EGF?mimic), d inhibitor group (bFGF?EGF?inhibitor). Rat BMSCs in the Mimic group were transfected with microRNA-128 mimics, and then induced by bFGF and EGF. Rat BMSCs in the Inhibitor group were transfected with microRNA-128 inhibitors, and then induced by bFGF and EGF. Rat BMSCs in the Inducer group were not transfected, but were still induced by bFGF and EGF. Rat BMSCs in Blank group were neither

transfected nor induced by bFGF and EGF. Compared to cells in the Inducer group, cells in the Inhibitor group are the most neuron-like cells in morphology, displaying shrunken and round-shaped cell bodies. In the BMSCs induced with bFGF and EGF for 5 days, stain Nestin with monoclonal mouse anti-Nestin and secondary antibody Cy3-conjugated goat anti-mouse IgG. The result of the Blank group, the Inducer group, the Mimic group and the Inhibitor group were negative, positive, weak positive, and strong positive, respectively

of Wnt3a might be targeted by microRNA-128 (Fig. 5c). To substantiate the hypothesis that microRNA-128 is a direct regulator of the down-regulated transcripts, we selected 211 bp fragment containing potential microRNA-128 binding sites within the 30 -UTR of Wnt3a for use in further validation using dual-luciferase reporter assays. Upon co-transfection in HEK293 cells, microRNA-128 mimic significantly repressed the luciferase expression of pGL3-wt-Wnt3a (Fig. 5d). In addition, we tested the effect of the microRNA-128 inhibitor on all constructs in HEK293 cells. The result showed a significant increase in luciferase expression of pGL3-wt-Wnt3a. MicroRNA-128 mimic or microRNA-128 inhibitor had no effect on pGL3-mut-Wnt3a. These assays demonstrated that Wnt3a is one of the target genes of microRNA-128.

tissues and cells. Under different conditions they can differentiate into mesoderm tissues, such as osteoblasts and cadiocytes. They can differentiate into ectodermal tissues, such as neurons. Deciphering the highly efficient neural differentiation of BMSCs, based on the current understanding of the differentiation process, remains a challenge. BMSCs’ differentiation into neurons was first reported by Woodbury [19], where adult rat and human BMSCs were induced by BME, DMSO, or BHA in vitro. The reasons that chemical inducers induced neuronal cell formation could be the chemical toxicity, which lead to cell contraction, or changes in the cytoskeleton. This does not represent complex process of cell differentiation. Cell proliferation and differentiation is affected by various growth factors, especially the neurotrophic factor. Sanchez-Ramos [20] once established a cell culture system based on the neurotrophic factor v in order to induce differentiation of BMSC into neurons. In recent years, studies have shown that EGF, bFGF, BDNF, and GDNF play an important role in the differentiation of BMSC into neurons.

Discussion BMSCs are adult stem cells that have the potential to undergo multi-lineage differentiation into multiple relevant

123

Mol Cell Biochem (2014) 387:151–158

157

Fig. 5 Validation of microRNA-128 targets. a The Wnt3a mRNA expression in each of the four groups: the mRNA expression level of Wnt3a in each group is determined with real-time RT-PCR. The mRNA expression of Wnt3a is significantly higher in the Inhibitor group (p \ 0.01) but is significantly lower in the Mimic group, as compared to the Blank group and the Inducer group (p \ 0.01). b Wnt3a protein expression in each of the four groups: The protein expression of Wnt3a is significantly higher in the Inhibitor group (p \ 0.01) but is significantly lower in the Mimic group, as compared to the Blank group and the Inducer group. c The target sites on Wnt3a-30 UTR: MicroRNA-128 is aligned with the mRNA of Wnt3a on the nucleotide position as indicated. Vertical lines indicate identity; gaps indicate mismatch. d Dual-luciferase reporter assay

and bioluminescent measurements: firefly luciferase reporter (pGL3wt-Wnt3a/pGL3-mut-Wnt3a) was cotransfected into HEK293 cells along with a Renilla control plasmid (pRL-TK), and microRNA (microRNA-128 mimic/microRNA-128 inhibitor/scramble microRNA). Presented are the relative luciferase values normalized to the fluorescence intensity in the group transfection with scrambled microRNA and pGL3-wt-Wnt3a. Upon co-transfection in HEK293 cells, microRNA-128 mimic visibly repressed the luciferase expression of pGL3-wt-Wnt3a; however, microRNA-128 inhibitor significantly increased the luciferase expression of pGL3-wt-Wnt3a. MicroRNA-128 mimic or microRNA-128 had no effect on pGL3mut-Wnt3a. This effect is specific to microR-128 because the same effects are not observed for the scrambled control

Using EGF and bFGF, Ye [21] induced BMSCs to differentiate into neural-like cells. In this article, we confirmed that BMSCs can be efficiently induced into neuron-like cells under the presence and influence of EGF and bFGF. Recently, researchers became concerned about the effect of microRNAs. Dicer is an important enzyme in the process of mature microRNAs. It found that without Dicer, not only will the early development of mouse retard, the proliferation of pluripotent stem cell will also be affected. These above examples all demonstrate the important role of miRNA in cellular development. A single miRNA can target hundreds of mRNAs, resulting in very substantial effects on the molecular constitution of cells. Thus, it is vital to understand the unique functions and targets of miRNA. MicroRNA-128, a brain-enriched miRNA, is highly expressed in the central nervous system, especially in the brain and spinal cord. MicroRNA-128 has been reported to specifically block glioma self-renewal [22]. Moreover, the over expression of microRNA-128 in glioma cells inhibits cell proliferation [23]. Results from the present study demonstrate that microRNA-128 is a key player in the development of the nervous system. Wang [24] measured the expression of microRNA-128 in the

BMSCs before and after induction. Results showed that the level of microRNA-128 in differentiated BMSCs was 0.070-fold of that in BMSCs (p \ 0.05). Here we also demonstrated that downregulated microRNA-128 may drive mesenchymal stem cells toward developing into neuron-like cells. We infer that during BMSCs’ differentiation microRNA-128 mainly inhibit phenotype original gene of marrow stromal stem cell. As the induction time increases and neuron gene expression stabilizes, microRNA-128 expression decrease. Gene knockout mice studies have shown that, Wnt signal pathway has a vital role in the development of the nervous system during embryonic development [25]. Wnt gene mutations lead to the loss or abnormality of the midbrain, hippocampus, spinal cord, neural crest, and other nerve tissues. Through Wnt3a expression, spinal cord motor neurons guide sensory neurons to connect with each other correctly, thus forming neural pathways that can control the muscles. The dual expression lentivirus vector carring Wnt3a was constructed with GatewayTM technology and transduced into BMSCs [26]. Then the cell morphology observation indicates that the BMSCs transfected with Wnt3a were induced into neuron-like cells. From this

123

158

information we deduced that Wnt3a can promote BMSCs to differentiate into neuron-like cells. We were interested in whether there is a cross-talk between microRNA and the Wnt signaling pathways during the differentiation of BMSC into neurons. So we constructed the reporter plasmid (pGL3-wt-Wnt3a) to verify if Wnt3a is one of target genes of microRNA-128. The results suggest that microRNA-128 can indeed bind to the 30 -UTR of Wnt3a mRNA to modulate Wnt3a Expression.

References 1. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284(5411):143–147 2. Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Ortiz-Gonzalez XR, Reyes M, Lenvik T, Lund T, Blackstad M, Du J, Aldrich S, Lisberg A, Low WC, Largaespada DA, Verfaillie CM (2002) Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418(6893):41–49 3. Torrente Y, Polli E (2008) Mesenchymal stem cell transplantation for neurodegenerative diseases. Cell Transpl 17(10–11):1103–1113 4. Wislet-Gendebien S, Laudet E, Neirinckx V, Rogister B (2012) Adult bone marrow: which stem cells for cellular therapy protocols in neurodegenerative disorders? J Biomed Biotechnol 2012:601560–601572 5. Deng W, Obrocka M, Fischer I, Prockop DJ (2001) In vitro differentiation of human marrow stromal cells into early progenitors of neural cells by conditions that increase intracellular cyclic AMP. Biochem Biophys Res Commun 282(1):148–152 6. Kim BJ, Seo JH, Bubien JK, Oh YS (2002) Differentiation of adult bone marrow stem cells into neuroprogenitor cells in vitro. Neuroreport 13(9):1185–1188 7. Tiedge H, Bloom FE, Richter D (1999) RNA, whither goest thou? Science 283(5399):186–187 8. Steward O, Schuman EM (2003) Compartmentalized synthesis and degradation of proteins in neurons. Neuron 40(2):347–359 9. Foshay KM, Gallicano GI (2007) Small RNAs, big potential: the role of MicroRNAs in stem cell function. Curr Stem Cell Res Ther 2(4):264–271 10. Wang Y, Russell I, Chen C (2009) MicroRNA and stem cell regulation. Curr Opin Mol Ther 11(3):292–298 11. Yi R, Fuchs E (2011) MicroRNAs and their roles in mammalian stem cells. J Cell Sci 124(11):1775–1783 12. Collino F, Bruno S, Deregibus MC, Tetta C, Camussi G (2011) MicroRNAs and mesenchymal stem cells. Vitam Horm 87:291–320

123

Mol Cell Biochem (2014) 387:151–158 13. Guo L, Zhao RC, Wu Y (2011) The role of microRNAs in selfrenewal and differentiation of mesenchymal stem cells. Exp Hematol 39(6):608–616 14. Yanjie J, Jiping S, Yan Z, Xiaofeng Z, Boai Z, Yajun L (2007) Effects of notch-1 signaling pathway on differentiation of marrow mesenchymal stem cells into neurons in vitro. Neuroreport 18(14):1443–1447 15. Boer J, Wang HJ, Blitterswijk C (2004) Effects of Wnt signa-ling on proliferation and differentiation of human mesenchymal stem cells. Tissue Eng 10(3–4):393–401 16. Zhang X, Podsypanina K, Huang S, Mohsin SK, Chamness GC, Hatsell S, Cowin P, Schiff R, Li Y (2005) Estrogen receptor positivity in mammary tumors of Wnt-1 transgenic mice is influenced by collaborating oncogenic mutations. Oncogene 24(26):4220–4231 17. Klein JD, Fauza DO (2011) Amniotic and placental mesenchymal stem cell isolation and culture. Methods Mol Biol 698:75–88 18. Yang Q, Mu J, Li Q, Li A, Zeng Z, Yang J, Zhang X, Tang J, Xie P (2008) A simple and efficient method for deriving neurospheres from bone marrow stromal cells. Biochem Biophys Res Commun 372(4):520–524 19. Woodbury D, Schwarz EJ, Prockop DJ, Black IB (2000) Adult rat and human bone marrow stromal cells differentiate into neurons. J Neurosci Res 61(4):364–370 20. Sanchez-Ramos J, Song S, Cardozo-Pelaez F, Hazzi C, Stedeford T, Willing A, Freeman TB, Saporta S, Janssen W, Patel N, Cooper DR, Sanberg PR (2000) Adult bone marrow stromal cells into neural cells in vitro. Exp Neurol 164(2):247–256 21. Ye Y, Zeng YM, Wan MR, Lu XF (2011) Induction of human bone marrow mesenchymal stem cells differentiation into neural-like cells using cerebrospinal fluid. Cell Biochem Biophys 59(3):179– 184 22. Godlewski J, Nowicki MO, Bronisz A, Williams S, Otsuki A, Nuovo G, Raychaudhury A, Newton HB, Chiocca EA, Lawler S (2008) Targeting of the Bmi-1oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res 68(22):9125–9130 23. Zhang Y, Chao T, Li R, Liu W, Chen Y, Yan X, Gong Y, Yin B, Liu W, Qiang B, Zhao J, Yuan J, Peng X (2009) MicroRNA-128 inhibits glioma cells proliferation by targeting transcription factor E2F3a. J Mol Med (Berl) 87(1):43–51 24. Wang JJ, Wang CF, Dang W, Li PF, Wei H (2010) Expression of miR-124 and miR-128 in the process of bone marrow stromal cells differentiating into neural cells. Chin J Histochem Cytochem 19(3):222–224 25. Clements WK, Ong KG, Traver D (2009) Zebrafish Wnt3 is expressed in developing neural tissue. Dev Dyn 238(7):1788–1795 26. Zeng R, Lin ZP, Guo WT, Hu ZB, Hao LIN (2012) Microarray analysis of the Wnt signaling pathway in bone marrow mesenchymal stem cell in neuron differentiation. Guangdong Med J 33(20):3031–3035

MicroRNA-128 regulates the differentiation of rat bone mesenchymal stem cells into neuron-like cells by Wnt signaling.

Bone marrow mesenchymal stem cells (BMSCs) are a source of multipotent stem cells ideally suited for various cell-based therapies. BMSCs can different...
429KB Sizes 0 Downloads 0 Views