Acta Biochim Biophys Sin, 2016, 48(3), 290–297 doi: 10.1093/abbs/gmv136 Advance Access Publication Date: 1 February 2016 Original Article
Original Article
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7 Dongguang Guo, Yaqiong Ye, Junjie Qi, Lifeng Xu, Lihua Zhang, Xiaotong Tan, Zhigang Tan, Xiaofang Yu, Yuan Zhang, Yongjiang Ma, and Yugu Li* College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, China *Correspondence address. Tel/Fax: +86-20-85283226; E-mail: [email protected]; [email protected] Received 13 August 2015; Accepted 2 November 2015
Abstract MiR-195 has been implicated in inhibiting cell proliferation in different types of tumors. Whether it contributes to the process of thymic epithelial cells (TECs) proliferation remains unclear. In this study, we found that miR-195a-5p was highly up-regulated in the TECs isolated from the aging mice. Further experiments showed that miR-195a-5p mimic transfection inhibited the proliferation of mouse medullary thymic epithelial cell line 1 (MTEC1), whereas the transfection of miR-195a-5p inhibitor in MTEC1 had the opposite effect. In addition, miR-195a-5p had no obvious effect on MTEC1 apoptosis. Furthermore, Smad7, a negative regulator of transforming growth factor β pathway, was confirmed as a direct target of miR-195a-5p by luciferase assays. Taken together, our results indicate that miR195a-5p inhibits MTEC1 proliferation, at least in part, via down-regulation of Smad7. Key words: miR-195a-5p, mouse thymic epithelial cell, cell proliferation, Smad7
Introduction The thymus is a vital central organ responsible for the development, selection, and maintenance of the peripheral T-cell pool [1]. Thymocytes and thymic epithelial cells (TECs) are two major cell types in the thymus. TECs can provide unique microenvironment and signals for various stages of T-cell development [2–4]. However, with aging, the thymus undergoes progressively involution, resulting in a decline in the production of naive T-cells [5,6]. Moreover, age-related thymus involution is often accompanied by the quantitative and qualitative changes of TECs [7–9], and this change in TECs can account for the physiological process of age-related thymus involution [10]. Numerous studies have demonstrated that age-related thymus involution is one of the main causes of immunosenescence [11–13], and it is regulated by many gene expression and signal pathways [14–16]. MicroRNAs (miRNAs) are a class of small, non-coding RNAs that affect gene regulation by targeting the 3′UTR regions of the genes [17]. Several studies have shown that miRNA plays a key role in the regulation of gene expression during the process of aging, including aging
heart, lung, and skeletal muscle [18–22]. MiR-195, as a tumor suppressor, has been implicated in inhibiting cell proliferation in different types of tumors. However, whether it contributes to the process of TECs proliferation remains unclear. In our study, we found that miR-195a-5p was strikingly up-regulated in the thymus tissues and TECs from the 19-month-old mice compared with those from 1-month-old mice. Thus, we speculated that miR-195a-5p may play a key role in the age-related thymus involution. It has been reported that transforming growth factor beta (TGF-β) signal pathway plays important roles in regulating cell proliferation, differentiation, apoptosis, and senescence [23–26]. For example, Moses et al. [27] reported that TGF-β1 had a potent inhibitory role in the proliferation of the skin keratinocytes. Another study also showed that TGF-β signaling might play an age-dependent negative role in controlling thymus weight and cellularity [15], especially on mTEC proliferation and differentiation [28]. Moreover, several studies demonstrated that reducing the expression of TGF-β in the aged thymus could decrease the regression of thymus and promote the
Published by Oxford University Press ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US. 290
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7 proliferation of TECs [29–31]. All these studies underscore the important roles of the TGF-β signal in the age-related thymus involution. Smad7, a negative regulator of Smad signaling, can inhibit TGF-β activity through preventing the phosphorylation of Smad2/3 [24,32]. The regulatory role of miRNAs on Smad7 has been reported in many studies. For example, Lin et al. [33] and Li et al. [34] demonstrated that miR-21 can inhibit proliferation of renal tubular epithelial cells and differentiation of osteoblast cells by directly targeting Smad7. Recently, Yu et al. [35] also reported that miR-17-5p can activate hepatic stellate cells through targeting Smad7. However, the association between Smad7 and miR-195a in the age-related thymus involution is still unknown. Therefore, the aims of this study were to investigate the potential regulatory roles of miR-195a-5p on Smad7 in mouse medullary thymic epithelial cell line 1 (MTEC1) cells proliferation, and to explore the relevant evidence that the expression of miR-195a-5p in mice TECs may involve in the age-related thymus involution.
Materials and Methods Animals Specific pathogen-free Balb/c mice (1-, 10-, and 19-month-old) were purchased from the Center of Laboratory Animal Science in Guangdong (Guangzhou, China). Protocols for all animal experiments performed in this study were approved by the Animal Care Committee of the South China Agricultural University (Guangzhou, China) in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.
Isolation of TECs TECs from 1-, 10-, and 19-month-old mice were isolated and purified according to a previously described method [36]. In brief, thymus tissues from the 1-, 10-, and 19-month-old mice were harvested and transferred into the complete Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Carlsbad, USA). Thymic lobes were finely minced to release the majority of thymocytes. The remaining thymic tissue
291
was further digested with collagenase D (1.5 mg/ml; Roche Diagnostics, Indianapolis, USA), DNase I (1.0 mg/ml; Sigma, St Louis, USA), and Dispase (1.25 mg/ml; Roche Diagnostics) at 37°C for 20 min with intermittent shaking. This step was repeated for three times. After complete digestion, the enriched TECs were obtained passing through LS magnetic columns. The isolated TECs were used in quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) to detect the expression of miR-195a-5p.
Cell culture and cell transfection MTEC1 were obtained from Peking University Health Science Center (Beijing, China). Both MTEC1 and HEK-293T cells were cultured in DMEM (Gibco) containing 10% fetal bovine serum (FBS; Gibco) in a humidified atmosphere containing 5% CO2 at 37°C. For cell transfection, MTEC1 cells were seeded in 24-well plates at a density of 0.5– 1 × 105 cells per well. After 24 h, oligonucleotides [50 nmol mimic or mimic negative control (mimic-NC), 100 nmol inhibitor or inhibitor-NC] were transfected into cultured cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instruction. The miR-195a-5p mimic, inhibitor and mimic/ inhibitor-NC were purchased from RiboBio (Guangzhou, China).
qRT-PCR Total RNAs were extracted from TECs and MTEC1 cells with TRIzol (Takara, Kusatsu, Japan). cDNA was synthesized using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) in accordance with the manufacturer’s instructions. qRT-PCR was performed with SYBR Green real-time PCR Master Mix (Toyobo). For measuring the expression of miR-195a-5p in isolated TECs, the bulge-loop miRNA qRT-PCR Primer Sets (including one reverse transcription primer and a pair of quantitative PCR primers for each set) specific for the miR-195a-5p were designed by RiboBio (Guangzhou, China). The relative gene primers for mRNA (Table 1) were designed by the Primer Premier 5.0 software according to the published genome sequences.
Table 1. Primers used in the qRT-PCRs Gene
Accession no.
Primer sequence (5′–3′)
Size (bp)
Usage
Smad7
NM_001042660
188
qRT-PCR
Cyclin D1
NM_007631.2
176
qRT-PCR
Cyclin D3
NM_001081635
106
qRT-PCR
Cyclin E1
NM_007633
191
qRT-PCR
Cdk4
NM_009870
118
qRT-PCR
Cdk6
NM_009873
159
qRT-PCR
C-myc
NM_010849
134
qRT-PCR
E2F1
NM_ 007891.5
140
qRT-PCR
Cdk1
NM_007659
165
qRT-PCR
Cdk2
NM_183417
186
qRT-PCR
β-actin
NM_007393
F: CATCTTCATCAAGTCCGCCACAC R: CCTTCACAAAGCTGATCTGCACG F: AGGCGGATGAGAACAAGCAGAC R: CGGTAGCAGGAGAGGAAGTTG F: ACACTCGCTTTGTTTGGGT R: TGCAGGACATCTGTTTTTGG F: GCGTCTAAGCCCTCTGACCATTG R: CAGAAGCAGCGAGGACACCATAAG F: CTACATACGCAACACCCG R: TCAAAGATTTTCCCCAACT F: GGACATCATTGGACTCCCAGGA R: GGATTAAACGTCAGGCATTTCAGAA F: CTATCACCAGCAACAGCAG R: CAACATAGGATGGAGAGCAGAG F: CGTAAAAGTGGCCCGGACT R: GGCCATGGCGCTCACGGCCC F: ACGGCTTGGATTTGCTCTCA R: ACGATCTTCCCCTACGACCA F: AGCTCTCCTTGCGTTCCATC R: ACGTGCCCTCTCCAATCTTC F: CATCCGTAAAGACCTCTATGCCAACC R: ATGGAGCCACCGATCCACA
171
qRT-PCR
292
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
β-actin and U6 were used to normalize the relative abundance of mRNA and miRNA, respectively. qPCR analysis was performed using Bio-Rad CFX96 Real-Time PCR system (Bio-Rad, Hercules, USA). The relative expression level of each gene was calculated from three different experiments and was determined by using the 2−ΔΔCT method.
Western blot analysis Cultured MTEC1 cells were lysed in radio-immunoprecipitation assay buffer supplemented with protease and phosphatase inhibitor mixture (Sigma) and vortexed briefly. After centrifugation at 15,000 g for 15 min at 4°C, the protein was collected, and the protein concentrations were determined by bicinchoninic acid kit (Beyotime, Nanjing, China). Sample buffer was used to dilute the lysates, and the proteins (20 μg) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Millipore, Billerica, USA). After being blocked with skimmed milk, the blots were incubated overnight at 4°C with mouse monoclonal antibodies, including anti-Cmyc, anti-Cdk4, anti-Cyclin D1, anti-Cyclin E1, anti-Smad7, or anti-Tublin (Santa Cruz Biotechnology, Santa Cruz, USA) diluted in 1:1000, respectively. Then the membranes were washed and incubated with horseradish peroxidase-conjugated secondary antibodies diluted in 1:5000 (Santa Cruz Biotechnology) at 37°C for 90 min, and finally developed with the BeyoECL Plus kit (Beyotime).
Cell viability assay MTEC1 were seeded in 96-well plates at a density of 2–5 × 103 cells per well, and transfected with miR-195a-5p mimic, miR-195a-5p inhibitor, or miR-NC as the described above. Cell viability was analyzed at the indicated time points (24, 48, and 72 h) using the cell-counting kit-8 (CCK-8) regents (Beyotime) according to the manufacturer’s instructions.
Cell cycle assay MTEC1 cells cultured in DMEM containing 10% FBS were collected at 48 h after transfection, and then fixed in 70% ethanol overnight at −20°C for 24 h. The cell cycle assay was determined using the Cell Cycle Analysis Kit (Beyotime) with a flow cytometer (BD Biosciences, San Jose, USA) and ModFit Lt 4.1 software (Verity Software House, Topsham, USA).
Dual luciferase reporter assay pmiRGLO-Smad7 (wt/mut) plasmids (400 ng) were transfected into HEK-293T cells using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations. Dual-luciferase activity was analyzed at 48 h after transfection using the Dual Luciferase Reporter Assay system (Promega) according to the manufacturer’s instructions.
Statistical analysis All experiments were performed in triplicate and repeated at least three times. The statistical analysis was performed by using Student’s t-test to determine the existence of significant differences with commercial software (SPSS 17; SPSS, Chicago, USA). A value of P < 0.05 was deemed statistically significant.
Results Effects of miR-195a-5p supplementation on cells viability and apoptosis Our pervious study demonstrated that the expression of miR-195a-5p was gradually increased in 1-, 10-, and 19-month-old mice thymus tissues, and a significant difference was observed between the 1-month-old mice thymus tissue and 19-month-old mice thymus tissue [37]. In this study, we found that the expression levels of miR-195a-5p were also increased in the TECs isolated from 19-month-old mice, when compared with those from 1- and 10-month-old mice (Fig. 1A). This result indicated that miR-195a-5p may play an important role in the age-related thymus involution. To further define the role of miR-195a-5p in TECs, MTEC1 cells were used and transfected with miR-195a-5p mimic and mimic-NC or miR-195a-5p inhibitor and inhibitor-NC. CCK-8 was used to monitor the cell viability at 24, 48, and 72 h. As shown in Fig. 1B, miR-195a-5p mimic significantly inhibited cell viability after 24 and 48 h transfection when compared with the mimic-NC group. As expected, the miR-195a-5p inhibitor had an opposite effect on MTEC1 cells viability (Fig. 1C). The results indicated that ectopic expression of miR-195a-5p in MTEC1 cells significantly suppressed the cell viability. In addition, to investigate the effect of miR-195a-5p on apoptosis, flow cytometric analysis was performed. The results showed that no obviously change was observed in the miR-195a-5p mimictransfected and miR-195a-5p inhibitor-transfected cells (Fig. 1D).
Cell apoptosis assay At 48 h after transfection, the cell apoptosis rate was quantified by gating propidium iodide and Annexin V-positive cells on a fluorescenceactivated cell-sorting flow cytometer (BD Biosciences) according to the instructions of Apoptosis and Necrosis Assay Kit (Kaiji, Nanjing, China).
Construction of recombinant expression vectors The web of TargetScan 6.2 (www.targetscan.org) was used to predict the targets of miR-195a-5p. Oligonucleotides containing the rat Smad7 3′UTR target sequences were amplified and cloned into the luciferase reporter vector pmiRGLO (Promega, Madison, USA). The 3′UTR target sequence of Smad7 for miR-195a-5p ( positions 69– 75 bp) was as follows: forward, 5′-CGAGCTCGATCGTGAGCCG AGCAG-3′ and reverse, 5′-GCGTCGACCCGAGCGTGTCC AAAA-3′. The mutant Smad7 3′UTR plasmids was generated by using a Stratagene mutation kit (Stratagene, Heidelberg, Germany) by GENEray company (Shanghai, China), and the corresponding sequences were mutated from ‘UGCUGCUA’ to ‘UACGGAUA’.
Over-expression of miR-195a-5p inhibits cell proliferation and down-regulates cell cycle-related genes in MTEC1 cells To further investigate the role of miR-195a-5p in MTEC1 cells, cell cycle assay was performed by flow cytometry. The results indicated that the percentage of cells in S phase was significantly increased (P < 0.01) and the percentage of cells in G2 phase was significantly decreased (P < 0.01) with miR-195a-5p over-expression (Fig. 2A,B). While in the miR-195a-5p-knockdown group, the percentage of cells in G1 phase was significantly decreased (P < 0.05) and the percentage of cells in S + G2 phase was significantly increased (P < 0.01) (Fig. 2C,D). Previous studies have shown that miR-195 may function as a potent regulator in cell cycle progression. Cyclin D1, Cyclin E1, Cyclin D3, Cdk1, Cdk2, Cdk4, Cdk6, E2F1, and C-myc play important roles in cell proliferation. Therefore, to further examine the regulation of miR-195a-5p on the cell cycle-related genes in MTEC1 cells, the mRNA and protein expressions of the cell cycle-related genes were
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
293
Figure 1. The expression of miR-195a-5p in isolated TECs and the effects of miR-195a-5p supplementation on cell viability and apoptosis (A) miR-195a-5p was detected by qRT-PCR in TECs from 1-, 10- and 19-month-old mice, U6 was used as a reference. (B, C) Cell viability analysis was performed by CCK-8 at 24, 48, and 72 h after transfection. (D) At 48 h after transfection, cell apoptosis was analyzed by flow cytometer. Data were presented as the mean ± SD of three experiments. *P < 0.05, **P < 0.01.
Figure 2. The cell cycle distribution of MTEC1 cells at 48 h after treatment with miR-195a-5p mimic or inhibitor Cell cycle was performed by flow cytometry after transfection with miR-195a-5p mimic/mimic-NC (A, B) and miR-195a-5p inhibitor/inhibitor-NC (C, D). Data were presented as the mean ± SD of three experiments. *P < 0.05, **P < 0.01.
294
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
measured by qRT-PCR and western blot analysis. As shown in Fig. 3A, the results of qPCR showed that the expression levels of Cyclin D1, Cyclin E1, Cdk1, Cdk2, Cdk4, and C-myc were significantly decreased in the miR-195a-5p mimic group compared with those in the mimic-NC group. Meanwhile, the levels of Cyclin D1, Cyclin E1, Cdk4, and C-myc were significantly increased in the miR-195a-5p inhibitor group compared with those in the inhibitor-NC group (Fig. 3B). In addition, western blot showed that the protein levels of Cyclin D1, Cyclin E1, Cdk4, and C-myc were down-regulated in the miR-195a-5p mimic group when compared with those in the mimic-NC group. Consistent with the mRNA expression in the miR-195a-5p inhibitor group, the protein levels of Cyclin D1, Cyclin E1, Cdk4, and C-myc were up-regulated in miR-195a inhibitor-transfected cells compared with those in inhibitor-NC transfected cells (Fig. 3C,D). All these data suggested that ectopic expression of miR-195a-5p in MTEC1 cells can down-regulate the cell cycle-related genes and inhibit cell proliferation.
Smad7 is a target gene of miR-195a-5p in MTEC1 cells To further understand the mechanism by which miR-195a-5p regulates MTEC1 cell proliferation, the putative targets of miR-195a-5p are predicted using miRNA target analysis tools. As shown in
Fig. 4A, Smad7 was predicted as a direct target of miR-195a-5p. To determine whether Smad7 could be regulated by miR-195a-5p in MTEC1 cells, the 3′UTR region of Smad7 was cloned into pmiRGLO luciferase vector, and the 3′UTR mutant was constructed by altering the nucleotides in the seed sequence. Subsequently, miR-195a-5p mimic and mimic-NC with the pmiRGLO-UTR-wt (wild-type) and pmiRGLO-UTR-mut (mutant-type) were co-transfected into HEK293T cells. As shown in Fig. 4B, in the 3′UTR-wt of the Smad7transfected group, miR-195a-5p mimic induced a significant reduction of luciferase activity compared with mimic-NC (P < 0.01). While in the 3′UTR mut-Smad7-transfected group, no significant difference was observed between the miR-195a-5p mimic and mimic-NC groups, indicating that Smad7 is a target gene of miR-195a-5p in MTEC1 cells. To further confirm the above-mentioned results, the expression of Smad7 in MTEC1 cells was examined by qPCR and western blot analysis. As shown in Fig. 4C,D, the ectopic expression of miR-195a-5p can significantly down-regulate the expression of Smad7 at mRNA and protein levels in miR-195a-5p mimic-transfected MTEC1 cells, when compared with that in the mimic-NC group (P < 0.05). However, the expression of Smad7 was increased when the expression of miR-195a-5p was suppressed in MTEC1 cells (P < 0.05) (Fig. 4C,
Figure 3. Expressions of cell cycle-related genes analyzed by qPCR and western blot analysis (A) The mRNA expressions of Cyclin D1, Cyclin E1, Cyclin D3, Cdk1, Cdk2, Cdk4, E2F1, and C-myc in miR-195a-5p mimic group. (B) The expressions of Cyclin D1, Cyclin E1, Cyclin D3, Cdk4, Cdk6, E2F1, and C-myc in miR-195a-5p inhibitor group. (C, D) The protein expressions of Cdk4, Cyclin D1, Cyclin E1, and C-myc in miR-195a-5p mimic and inhibitor-transfected MTEC1 cells, respectively. The data were normalized to the level of β-actin for mRNA and to the level of tubulin for protein in each sample. *P < 0.05, **P < 0.01.
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
295
Figure 4. Confirmation of Smad7 as a direct target gene of miR-195a-5p (A) The putative binding sites in Smad7 3′UTRs for miR-195a were predicted by Targetscan and the three muted nucleotides in mutant Smad7 3′UTR were shown. (B) The luciferase activity assay in HEK-293T cells were calculated as ratio of firefly to renilla after the cells were co-transfected with miR-195a-5p mimic or mimic-NC with pmiRGLO-Smad7-mut and pmiRGLO-Smad7-wt. Data were presented as the mean ± SD of three experiments. **P < 0.01. (C) The mRNA and (D) protein expression levels of Smad7 in MTEC1 cells 48 h after transfected with miR-195a-5p mimic, mimic-NC, miR-195a-5p inhibitor or inhibitor-NC. Data were normalized to the level of β-actin for mRNA and to the level of tubulin for protein in each sample. *P < 0.05.
D). Collectively, these results suggested that Smad7 is a direct target of miR-195a-5p, and the regulatory effect of miR-195a-5p on MTEC1 cell proliferation is at least in part through the down-regulation of Smad7.
Discussion TECs provide a highly specialized microenvironment for the generation of a functional and self-tolerant T-cell repertoire [38]. The most prominent changes in the age-related thymus involution often link to the dramatic decline in the number of TECs [39]. It has been shown that miRNAs play important roles in regulating cell death and proliferation during the process of aging [40]. Several studies have revealed that miRNAs are necessary in the maintenance and function of the TECs [36,40–42]. However, whether miR-195a directly regulates TECs function remains unclear. In this study, we found that the expression of miR-195a-5p was strikingly up-regulated in TECs from 19-month-old mice (Fig. 1A) and exhibited the same expression trends in thymus tissues. Therefore, we assumed that miR-195a-5p may play a key role in TECs involved in the age-related thymus involution. To verify this hypothesis, MTEC1 cells were used in our study, the cell viability experiment indicated that over-expression of miR-195a-5p in MTEC1 cells had an obvious
effect on suppressing cell viability (Fig. 1B). Meanwhile, the results of cell cycle assay showed that miR-195a-5p can inhibit cell proliferation through blocking the cell cycle progression in the G2/S transition (Fig. 2A,B). Furthermore, no obvious cell apoptosis was observed in this study (Fig. 1D). All these results indicated that miR-195a-5p plays a crucial role in the proliferation of TECs. It was known that the proliferation of a cell through the cell cycle (G0, G1, S, and G2/M) is controlled in part by a series of protein kinases, which is further regulated by a group of proteins called cyclins [43]. The cyclins act in concert with their cyclin-dependent kinases (CDKs) and drive the cell from one cell cycle to the next, which is necessary for cells growth and proliferation [44]. For example, Cyclin D1 and E1 are related to the control of G1/S phase in cell cycle progression [45]. C-myc is indispensable for regulating cell growth, proliferation and development [46,47]. C-myc was also reported to be necessary for skin keratinocytes proliferation [27]. Serine–threonine kinase Cdk4 is a serine/threonine kinase family member which controls the cell cycle G1 phase of the cell cycle process [48]. Lin et al. [49] reported that Cdk4 was targeted by miR-195 in bladder cancer cells. In this study, we showed that over-expression or suppression of miR-195a-5p in MTEC1 cells has a profound influence on the cell cycle progression. The qPCR and western blot analysis indicated that miR-195a-5p inhibited the expression of the cell cycle-related
296
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
genes, including Cyclin D1, Cyclin E1, Cdk4, and C-myc at mRNA and protein levels. These results further confirmed the inhibitory role of miR-195a-5p on MTEC1 cell proliferation. These results suggest that miR-195a-5p plays a crucial role in TECs proliferation. It has been shown that transgenic mice with Smad7 expression develops severe thymic atrophy and massive thymocyte death, which suggests that Smad signaling in TECs plays a crucial role for thymocyte survival [50]. On the other hand, biochemical studies have demonstrated that Smad7 blocks signal transduction of TGF-β [34,51]. Furthermore, it has also been reported that in the physiologic process, the age-related thymus involution in aged mice is mitigated in the TGF-RII deficient TECs [28]. Moreover, He et al. [50] demonstrated that the proliferation rates of both medullar and cortical TEC cell lines were reduced when exposed to TGF-β in vitro. All these studies showed that Smad7 is an important molecule in regulating TECs-related thymus involution and atrophy in TECs. In this study, Smad7 was identified as a direct target of miR-195a-5p. Western blot analysis and qPCR analysis demonstrated that the expression of Smad7 was down-regulated by ectopic expression of miR-195a-5p in MTEC1 cells. It was further confirmed by the luciferase reporter assays. The result showed that miR-195a-5p directly targeted Smad7 via the miR-195a-5p binding sites in the 3′UTRs. This result suggested that miR-195a-5p could suppress cell proliferation through TGF-β signal pathway, which was activated by miR-195a-5p directly targeting Smad7 in MTEC1 cells. To further clarify whether the expressions of miR-195a-5p and Smad7 in mice TECs are associated with the age-related thymus involution. The expression levels of Smad7 mRNA were detected in TECs from 1-, 3-, 8-, and 13-month-old mice (Supplementary Fig. S1). The results showed that no significant difference was seen between the TECs from 3-, 8-, and 13-month-old mice and those from the 1-month-old mice. Our results are consistent with the previous studies showing that low levels of Smad7 were expressed in normal epithelial tissues compared with in certain cancers [52–54] and also with another study showing that when Smad7 was over-expressed in TECs, the size of the 10-day-old thymi was only ∼1/5 of the normal thymi [50]. This result indicates that over-expression of Smad7 in young mice TECs will have a negative influence on mice thymus development. So, we infer that the cell proliferations in TECs may be mainly affected by the difference in the expression of miR-195a-5p, which is associated with the age-related thymus involution through regulating the signaling of Smad7 and TGF-β. In summary, our study confirms that miR-195a-5p is up-regulated in the TECs from aged mice. We have demonstrated for the first time that miR-195a-5p inhibits MTEC1 cell proliferation by targeting the novel target Smad7. Our data suggest an important role of miR-195a-5p in the mice TECs and implicate that the restoration of miR-195a-5p in TECs may slow down the age-related thymus involution and atrophy. The aberrant expression of miR-195a-5p in TECs may be a useful biomarker for the thymus involution.
Supplementary Data Supplementary Data are available at ABBS online.
Funding This work was supported by the grants from the National Natural Science Foundation of China (Nos. 31272519 and 31572475).
References 1. Gruver AL, Hudson LL, Sempowski GD. Immunosenescence of ageing. J Pathol 2007, 211: 144–156. 2. Takahama Y, Takada K, Murata S, Tanaka K. β5t-containing thymoproteasome: specific expression in thymic cortical epithelial cells and role in positive selection of CD8+ T cells. Curr Opin Immunol 2012, 24: 92–98. 3. Anderson G, Lane PJ, Jenkinson EJ. Generating intrathymic microenvironments to establish T-cell tolerance. Nat Rev Immunol 2007, 7: 954–963. 4. Xing Y, Jameson SC, Hogquist KA. Thymoproteasome subunit-beta5T generates peptide-MHC complexes specialized for positive selection. Proc Natl Acad Sci USA 2013, 110: 6979–6984. 5. Aw D, Silva AB, Maddick M, von Zglinicki T, Palmer DB. Architectural changes in the thymus of aging mice. Aging Cell 2008, 7: 158–167. 6. Hsu HC, Li L, Zhang HG, Mountz JD. Genetic regulation of thymic involution. Mech Ageing Dev 2005, 126: 87–97. 7. Olsen NJ, Olson G, Viselli SM, Gu X, Kovacs WJ. Androgen receptors in thymic epithelium modulate thymus size and thymocyte development. Endocrinology 2001, 142: 1278–1283. 8. Gray DH, Seach N, Ueno T, Milton MK, Liston A, Lew AM, Goodnow CC, et al. Developmental kinetics, turnover, and stimulatory capacity of thymic epithelial cells. Blood 2006, 108: 3777–3785. 9. Gui J, Zhu X, Dohkan J, Cheng L, Barnes PF, Su DM. The aged thymus shows normal recruitment of lymphohematopoietic progenitors but has defects in thymic epithelial cells. Int Immunol 2007, 19: 1201–1211. 10. Hauri-Hohl MM, Zuklys S, Keller MP, Jeker LT, Barthlott T, Moon AM, Roes J, et al. TGF-beta signaling in thymic epithelial cells regulates thymic involution and post-irradiation reconstitution. Blood 2008, 112: 626–634. 11. Maue AC, Yager EJ, Swain SL, Woodland DL, Blackman MA, Haynes L. T-cell immunosenescence: lessons learned from mouse models of aging. Trends Immunol 2009, 30: 301–305. 12. Dorshkind K, Swain S. Age-associated declines in immune system development and function: causes, consequences, and reversal. Curr Opin Immunol 2009, 21: 404–407. 13. Foster AD, Sivarapatna A, Gress RE. The aging immune system and its relationship with cancer. Aging Health 2011, 7: 707–718. 14. Gui J, Morales AJ, Maxey SE, Bessette KA, Ratcliffe NR, Kelly JA, Craig RW. MCL1 increases primitive thymocyte viability in female mice and promotes thymic expansion into adulthood. Int Immunol 2011, 23: 647–659. 15. Bravo-Nuevo A, O’Donnell R, Rosendahl A, Chung JH, Benjamin LE, Odaka C. RhoB deficiency in thymic medullary epithelium leads to early thymic atrophy. Int Immunol 2011, 23: 593–600. 16. Ortman CL, Dittmar KA, Witte PL, Le PT. Molecular characterization of the mouse involuted thymus: aberrations in expression of transcription regulators in thymocyte and epithelial compartments. Int Immunol 2002, 14: 813–822. 17. Pillai RS. MicroRNA function: multiple mechanisms for a tiny RNA? RNA 2005, 11: 1753–1761. 18. Chen LH, Chiou GY, Chen YW, Li HY, Chiou SH. MicroRNA and aging: a novel modulator in regulating the aging network. Ageing Res Rev 2010, 1: 59–66. 19. Drummond MJ, McCarthy JJ, Sinha M, Spratt HM, Volpi E, Esser KA, Rasmussen BB. Aging and microRNA expression in human skeletal muscle: a microarray and bioinformatics analysis. Physiol Genomics 2011, 43: 595–603. 20. Lanceta J, Prough RA, Liang R, Wang E. MicroRNA group disorganization in aging. Exp Gerontol 2010, 45: 269–278. 21. Zhang X, Azhar G, Wei JY. The expression of microRNA and microRNA clusters in the aging heart. PLoS One 2012, 7: e34688. 22. Williams AE, Perry MM, Moschos SA, Lindsay MA. microRNA expression in the aging mouse lung. BMC Genomics 2007, 8: 172. 23. Lin HY, Moustakas A. TGF-beta receptors: structure and function. Cell Mol Biol 1994, 40: 337–349. 24. Hayashi H, Abdollah S, Qiu Y, Cai J, Xu YY, Grinnell BW, Richardson MA, et al. The MAD-related protein SMAD7 associates with
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
25.
26. 27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37. 38. 39.
the TGFbeta receptor and functions as an antagonist of TGFbeta signaling. Cell 1997, 89: 1165–1173. Heldin CH, Landstrom M, Moustakas A. Mechanism of TGF-beta signaling to growth arrest, apoptosis, and epithelial-mesenchymal transition. Cell Biol 2009, 21: 166–176. Massague J. TGF beta signaling in context. Nat Rev Mol Cell Biol 2012, 13: 616–630. Moses HL, Pietenpol JA, Münger K, Murphy CS, Yang EY. TGF beta regulation of epithelial cell proliferation: role of tumor suppressor genes. Princess Takamatsu Symp 1991, 22: 183–195. Hauri-Hohl M, Zuklys S, Holländer GA, Ziegler SF. A regulatory role for TGF-β signaling in the establishment and function of the thymic medulla. Nat Immunol 2014, 15: 554–561. Olsen NJ, Zhou P, Ong H, Kovacs WJ. Testosterone induces expression of transforming growth factor-beta 1 in the murine thymus. J Steroid Biochem Mol Biol 1993, 45: 327–332. Sempowski GD, Hale LP, Sundy JS, Massey JM, Koup RA, Douek DC, Patel DD, et al. Leukemia inhibitory factor, oncostatin M, IL-6, and stem cell factor mRNA expression in human thymus increases with age and is associated with thymic atrophy. J Immunol 2000, 164: 2180–2187. Kumar R, Langer JC, Snoeck HW. Transforming growth factor-beta 2 is involved in quantitative genetic variation in thymic involution. Blood 2006, 107: 1974–1979. Kavsak P, Rasmussen RK, Causing CG, Bonni S, Zhu H, Thomsen GH, Wrana JL. SMAD7 binds to Smurf 2 to form an E3 ubiquitin ligase that targets the TGF beta receptor for degradation. Mol Cell 2000, 6: 1365–1375. Lin L, Gan H, Zhang H. MicroRNA-21 inhibits SMAD7 expression through a target sequence in the 3′ untranslated region and inhibits proliferation of renal tubular epithelial cells. Mol Med Rep 2014, 10: 707–712. Li HL, Yang F, Wang Z, Fu Q, Liang A. MicroRNA-21 promotes osteogenic differentiation by targeting small mothers against decapentaplegic 7. Mol Med Rep 2015, 12: 1561–1567. Yu FJ, Guo Y, Chen BC, Dong PH, Zheng JJ. MicroRNA-17-5p activates hepatic stellate cells through targeting of Smad7. Lab Invest 2015, 95: 781–789. Guo ZB, Chi F, Song Y, Wang CS, Yu RX, Wei TL, Gui JG, et al. Transcriptome analysis of murine thymic epithelial cells reveals age-associated changes in microRNA expression. Int J Mol Med 2013, 32: 835–842. Ye YQ, Li DT, Ouyang D, Deng L, Zhang Y, Ma YJ, Li YG. MicroRNA expression in the aging mouse thymus. Gene 2014, 547: 218–225. Aichinger M, Hinterberger M, Klein L. Probing gene function in thymic epithelial cells. Eur J Cell Biol 2012, 91: 24–30. Parent AV, Russ HA, Khan IS, LaFlam TN, Metzger TC, Anderson MS, Hebrok M. Generation of functional thymic epithelium from human embryonic stem cells that supports host T cell development. Cell Stem Cell 2013, 13: 219–229.
297
40. Khan IS, Taniguchi RT, Fasano KJ, Anderson MS, Jeker LT. Canonical microRNAs in thymic epithelial cells promotes central tolerance. Eur J Immunol 2014, 44: 1313–1319. 41. Zuklys S, Mayer CE, Zhanybekova S, Stefanski HE, Nusspaumer G, Gill J, Barthlott T, et al. MicroRNAs control the maintenance of thymic epithelia and their competence for T lineage commitment and thymocyte selection. J Immunol 2012, 189: 3894–3904. 42. Ucar O, Rattay K. Promiscuous gene expression in the thymus: a matter of epigenetics, miRNA, and more? Front Immunol 2015, 6: 93. 43. Dirks PB, Rutka JT. Current concepts in neuro-oncology: the cell cycle—a review. Neurosurgery 1997, 40: 1000–1013. 44. Culotti J, Hartwell LH. Genetic control of the cell division cycle in yeast. 3. Seven genes controlling nuclear division. Exp Cell Res 1971, 67: 389–401. 45. Wang H, Lu YT, Lu L, Li WS, Liang CF, He HY, Ba YY. MicroRNA-195 inhibits the proliferation of human glioma cells by directly targeting Cyclin D1 and Cyclin E1. PLoS One 2013, 8: e54932. 46. Lin F, Ding RL, Zheng S, Xing DY, Hong WW, Zhou ZJ, Shen J. Decrease expression of microRNA-744 promotes cell proliferation by targeting C-myc in human hepatocellular carcinoma. Cancer Cell Int 2014, 14: 58–66. 47. Zheng L, Zhang GW, Li J, Liu JB, Lv PF. The tumor-suppressive microRNA-135b targets C-myc in osteoscarcoma. PLoS One 2014, 9: e102621. 48. Tyagi A, Agarwal C, Harrison G, Glode LM, Agarwal R. Silibinin causes cell cycle arrest and apoptosis in human bladder transitional cell carcinoma cells by regulating CDKI-CDK-cyclin cascade, and caspase 3 and PARP cleavages. Carcinogenesis 2004, 25: 1711–1720. 49. Lin YW, Wu J, Chen H, Mao YQ, Liu YF, Mao QQ, Yang K, et al. Cyclindependent kinase 4 is a novel target in micoRNA-195-mediated cell cycle arrest in bladder cancer cells. FEBS Lett 2012, 586: 442–447. 50. He W, Li AG, Wang D, Han S, Zheng B, Goumans MJ, Ten DP, et al. Overexpression of Smad7 results in severe pathological alterations in multiple epithelial tissues. EMBO J 2002, 21: 2580–2590. 51. Wrana JL. Signaling by the TGFβ superfamily. Cold Spring Harb Perspect Biol 2013, 5: a011197. 52. Kleeff J, Ishiwata T, Maruyama H, Friess H, Truong P, Büchler MW, Falb D, et al. The TGF-beta signaling inhibitor Smad7 enhances tumorigenicity in pancreatic cancer. Oncogene 1999, 18: 5363–5372. 53. Boulay JL, Mild G, Reuter J, Lagrange M, Terracciano L, Lowy A, Laffer U, et al. Combined copy status of 18q21 genes in colorectal cancer shows frequent retention of SMAD7. Genes Chromosomes Cancer 2001, 31: 240–247. 54. He W, Cao T, Smith DA, Myers TE, Wang XJ. Smads mediate signaling of the TGFbeta superfamily in normal keratinocytes but are lost during skin chemical carcinogenesis. Oncogene 2001, 20: 471–483.
Original Article
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7 Dongguang Guo, Yaqiong Ye, Junjie Qi, Lifeng Xu, Lihua Zhang, Xiaotong Tan, Zhigang Tan, Xiaofang Yu, Yuan Zhang, Yongjiang Ma, and Yugu Li* College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, China *Correspondence address. Tel/Fax: +86-20-85283226; E-mail: [email protected]; [email protected] Received 13 August 2015; Accepted 2 November 2015
Abstract MiR-195 has been implicated in inhibiting cell proliferation in different types of tumors. Whether it contributes to the process of thymic epithelial cells (TECs) proliferation remains unclear. In this study, we found that miR-195a-5p was highly up-regulated in the TECs isolated from the aging mice. Further experiments showed that miR-195a-5p mimic transfection inhibited the proliferation of mouse medullary thymic epithelial cell line 1 (MTEC1), whereas the transfection of miR-195a-5p inhibitor in MTEC1 had the opposite effect. In addition, miR-195a-5p had no obvious effect on MTEC1 apoptosis. Furthermore, Smad7, a negative regulator of transforming growth factor β pathway, was confirmed as a direct target of miR-195a-5p by luciferase assays. Taken together, our results indicate that miR195a-5p inhibits MTEC1 proliferation, at least in part, via down-regulation of Smad7. Key words: miR-195a-5p, mouse thymic epithelial cell, cell proliferation, Smad7
Introduction The thymus is a vital central organ responsible for the development, selection, and maintenance of the peripheral T-cell pool [1]. Thymocytes and thymic epithelial cells (TECs) are two major cell types in the thymus. TECs can provide unique microenvironment and signals for various stages of T-cell development [2–4]. However, with aging, the thymus undergoes progressively involution, resulting in a decline in the production of naive T-cells [5,6]. Moreover, age-related thymus involution is often accompanied by the quantitative and qualitative changes of TECs [7–9], and this change in TECs can account for the physiological process of age-related thymus involution [10]. Numerous studies have demonstrated that age-related thymus involution is one of the main causes of immunosenescence [11–13], and it is regulated by many gene expression and signal pathways [14–16]. MicroRNAs (miRNAs) are a class of small, non-coding RNAs that affect gene regulation by targeting the 3′UTR regions of the genes [17]. Several studies have shown that miRNA plays a key role in the regulation of gene expression during the process of aging, including aging
heart, lung, and skeletal muscle [18–22]. MiR-195, as a tumor suppressor, has been implicated in inhibiting cell proliferation in different types of tumors. However, whether it contributes to the process of TECs proliferation remains unclear. In our study, we found that miR-195a-5p was strikingly up-regulated in the thymus tissues and TECs from the 19-month-old mice compared with those from 1-month-old mice. Thus, we speculated that miR-195a-5p may play a key role in the age-related thymus involution. It has been reported that transforming growth factor beta (TGF-β) signal pathway plays important roles in regulating cell proliferation, differentiation, apoptosis, and senescence [23–26]. For example, Moses et al. [27] reported that TGF-β1 had a potent inhibitory role in the proliferation of the skin keratinocytes. Another study also showed that TGF-β signaling might play an age-dependent negative role in controlling thymus weight and cellularity [15], especially on mTEC proliferation and differentiation [28]. Moreover, several studies demonstrated that reducing the expression of TGF-β in the aged thymus could decrease the regression of thymus and promote the
Published by Oxford University Press ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US. 290
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7 proliferation of TECs [29–31]. All these studies underscore the important roles of the TGF-β signal in the age-related thymus involution. Smad7, a negative regulator of Smad signaling, can inhibit TGF-β activity through preventing the phosphorylation of Smad2/3 [24,32]. The regulatory role of miRNAs on Smad7 has been reported in many studies. For example, Lin et al. [33] and Li et al. [34] demonstrated that miR-21 can inhibit proliferation of renal tubular epithelial cells and differentiation of osteoblast cells by directly targeting Smad7. Recently, Yu et al. [35] also reported that miR-17-5p can activate hepatic stellate cells through targeting Smad7. However, the association between Smad7 and miR-195a in the age-related thymus involution is still unknown. Therefore, the aims of this study were to investigate the potential regulatory roles of miR-195a-5p on Smad7 in mouse medullary thymic epithelial cell line 1 (MTEC1) cells proliferation, and to explore the relevant evidence that the expression of miR-195a-5p in mice TECs may involve in the age-related thymus involution.
Materials and Methods Animals Specific pathogen-free Balb/c mice (1-, 10-, and 19-month-old) were purchased from the Center of Laboratory Animal Science in Guangdong (Guangzhou, China). Protocols for all animal experiments performed in this study were approved by the Animal Care Committee of the South China Agricultural University (Guangzhou, China) in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.
Isolation of TECs TECs from 1-, 10-, and 19-month-old mice were isolated and purified according to a previously described method [36]. In brief, thymus tissues from the 1-, 10-, and 19-month-old mice were harvested and transferred into the complete Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Carlsbad, USA). Thymic lobes were finely minced to release the majority of thymocytes. The remaining thymic tissue
291
was further digested with collagenase D (1.5 mg/ml; Roche Diagnostics, Indianapolis, USA), DNase I (1.0 mg/ml; Sigma, St Louis, USA), and Dispase (1.25 mg/ml; Roche Diagnostics) at 37°C for 20 min with intermittent shaking. This step was repeated for three times. After complete digestion, the enriched TECs were obtained passing through LS magnetic columns. The isolated TECs were used in quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) to detect the expression of miR-195a-5p.
Cell culture and cell transfection MTEC1 were obtained from Peking University Health Science Center (Beijing, China). Both MTEC1 and HEK-293T cells were cultured in DMEM (Gibco) containing 10% fetal bovine serum (FBS; Gibco) in a humidified atmosphere containing 5% CO2 at 37°C. For cell transfection, MTEC1 cells were seeded in 24-well plates at a density of 0.5– 1 × 105 cells per well. After 24 h, oligonucleotides [50 nmol mimic or mimic negative control (mimic-NC), 100 nmol inhibitor or inhibitor-NC] were transfected into cultured cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instruction. The miR-195a-5p mimic, inhibitor and mimic/ inhibitor-NC were purchased from RiboBio (Guangzhou, China).
qRT-PCR Total RNAs were extracted from TECs and MTEC1 cells with TRIzol (Takara, Kusatsu, Japan). cDNA was synthesized using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) in accordance with the manufacturer’s instructions. qRT-PCR was performed with SYBR Green real-time PCR Master Mix (Toyobo). For measuring the expression of miR-195a-5p in isolated TECs, the bulge-loop miRNA qRT-PCR Primer Sets (including one reverse transcription primer and a pair of quantitative PCR primers for each set) specific for the miR-195a-5p were designed by RiboBio (Guangzhou, China). The relative gene primers for mRNA (Table 1) were designed by the Primer Premier 5.0 software according to the published genome sequences.
Table 1. Primers used in the qRT-PCRs Gene
Accession no.
Primer sequence (5′–3′)
Size (bp)
Usage
Smad7
NM_001042660
188
qRT-PCR
Cyclin D1
NM_007631.2
176
qRT-PCR
Cyclin D3
NM_001081635
106
qRT-PCR
Cyclin E1
NM_007633
191
qRT-PCR
Cdk4
NM_009870
118
qRT-PCR
Cdk6
NM_009873
159
qRT-PCR
C-myc
NM_010849
134
qRT-PCR
E2F1
NM_ 007891.5
140
qRT-PCR
Cdk1
NM_007659
165
qRT-PCR
Cdk2
NM_183417
186
qRT-PCR
β-actin
NM_007393
F: CATCTTCATCAAGTCCGCCACAC R: CCTTCACAAAGCTGATCTGCACG F: AGGCGGATGAGAACAAGCAGAC R: CGGTAGCAGGAGAGGAAGTTG F: ACACTCGCTTTGTTTGGGT R: TGCAGGACATCTGTTTTTGG F: GCGTCTAAGCCCTCTGACCATTG R: CAGAAGCAGCGAGGACACCATAAG F: CTACATACGCAACACCCG R: TCAAAGATTTTCCCCAACT F: GGACATCATTGGACTCCCAGGA R: GGATTAAACGTCAGGCATTTCAGAA F: CTATCACCAGCAACAGCAG R: CAACATAGGATGGAGAGCAGAG F: CGTAAAAGTGGCCCGGACT R: GGCCATGGCGCTCACGGCCC F: ACGGCTTGGATTTGCTCTCA R: ACGATCTTCCCCTACGACCA F: AGCTCTCCTTGCGTTCCATC R: ACGTGCCCTCTCCAATCTTC F: CATCCGTAAAGACCTCTATGCCAACC R: ATGGAGCCACCGATCCACA
171
qRT-PCR
292
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
β-actin and U6 were used to normalize the relative abundance of mRNA and miRNA, respectively. qPCR analysis was performed using Bio-Rad CFX96 Real-Time PCR system (Bio-Rad, Hercules, USA). The relative expression level of each gene was calculated from three different experiments and was determined by using the 2−ΔΔCT method.
Western blot analysis Cultured MTEC1 cells were lysed in radio-immunoprecipitation assay buffer supplemented with protease and phosphatase inhibitor mixture (Sigma) and vortexed briefly. After centrifugation at 15,000 g for 15 min at 4°C, the protein was collected, and the protein concentrations were determined by bicinchoninic acid kit (Beyotime, Nanjing, China). Sample buffer was used to dilute the lysates, and the proteins (20 μg) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Millipore, Billerica, USA). After being blocked with skimmed milk, the blots were incubated overnight at 4°C with mouse monoclonal antibodies, including anti-Cmyc, anti-Cdk4, anti-Cyclin D1, anti-Cyclin E1, anti-Smad7, or anti-Tublin (Santa Cruz Biotechnology, Santa Cruz, USA) diluted in 1:1000, respectively. Then the membranes were washed and incubated with horseradish peroxidase-conjugated secondary antibodies diluted in 1:5000 (Santa Cruz Biotechnology) at 37°C for 90 min, and finally developed with the BeyoECL Plus kit (Beyotime).
Cell viability assay MTEC1 were seeded in 96-well plates at a density of 2–5 × 103 cells per well, and transfected with miR-195a-5p mimic, miR-195a-5p inhibitor, or miR-NC as the described above. Cell viability was analyzed at the indicated time points (24, 48, and 72 h) using the cell-counting kit-8 (CCK-8) regents (Beyotime) according to the manufacturer’s instructions.
Cell cycle assay MTEC1 cells cultured in DMEM containing 10% FBS were collected at 48 h after transfection, and then fixed in 70% ethanol overnight at −20°C for 24 h. The cell cycle assay was determined using the Cell Cycle Analysis Kit (Beyotime) with a flow cytometer (BD Biosciences, San Jose, USA) and ModFit Lt 4.1 software (Verity Software House, Topsham, USA).
Dual luciferase reporter assay pmiRGLO-Smad7 (wt/mut) plasmids (400 ng) were transfected into HEK-293T cells using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations. Dual-luciferase activity was analyzed at 48 h after transfection using the Dual Luciferase Reporter Assay system (Promega) according to the manufacturer’s instructions.
Statistical analysis All experiments were performed in triplicate and repeated at least three times. The statistical analysis was performed by using Student’s t-test to determine the existence of significant differences with commercial software (SPSS 17; SPSS, Chicago, USA). A value of P < 0.05 was deemed statistically significant.
Results Effects of miR-195a-5p supplementation on cells viability and apoptosis Our pervious study demonstrated that the expression of miR-195a-5p was gradually increased in 1-, 10-, and 19-month-old mice thymus tissues, and a significant difference was observed between the 1-month-old mice thymus tissue and 19-month-old mice thymus tissue [37]. In this study, we found that the expression levels of miR-195a-5p were also increased in the TECs isolated from 19-month-old mice, when compared with those from 1- and 10-month-old mice (Fig. 1A). This result indicated that miR-195a-5p may play an important role in the age-related thymus involution. To further define the role of miR-195a-5p in TECs, MTEC1 cells were used and transfected with miR-195a-5p mimic and mimic-NC or miR-195a-5p inhibitor and inhibitor-NC. CCK-8 was used to monitor the cell viability at 24, 48, and 72 h. As shown in Fig. 1B, miR-195a-5p mimic significantly inhibited cell viability after 24 and 48 h transfection when compared with the mimic-NC group. As expected, the miR-195a-5p inhibitor had an opposite effect on MTEC1 cells viability (Fig. 1C). The results indicated that ectopic expression of miR-195a-5p in MTEC1 cells significantly suppressed the cell viability. In addition, to investigate the effect of miR-195a-5p on apoptosis, flow cytometric analysis was performed. The results showed that no obviously change was observed in the miR-195a-5p mimictransfected and miR-195a-5p inhibitor-transfected cells (Fig. 1D).
Cell apoptosis assay At 48 h after transfection, the cell apoptosis rate was quantified by gating propidium iodide and Annexin V-positive cells on a fluorescenceactivated cell-sorting flow cytometer (BD Biosciences) according to the instructions of Apoptosis and Necrosis Assay Kit (Kaiji, Nanjing, China).
Construction of recombinant expression vectors The web of TargetScan 6.2 (www.targetscan.org) was used to predict the targets of miR-195a-5p. Oligonucleotides containing the rat Smad7 3′UTR target sequences were amplified and cloned into the luciferase reporter vector pmiRGLO (Promega, Madison, USA). The 3′UTR target sequence of Smad7 for miR-195a-5p ( positions 69– 75 bp) was as follows: forward, 5′-CGAGCTCGATCGTGAGCCG AGCAG-3′ and reverse, 5′-GCGTCGACCCGAGCGTGTCC AAAA-3′. The mutant Smad7 3′UTR plasmids was generated by using a Stratagene mutation kit (Stratagene, Heidelberg, Germany) by GENEray company (Shanghai, China), and the corresponding sequences were mutated from ‘UGCUGCUA’ to ‘UACGGAUA’.
Over-expression of miR-195a-5p inhibits cell proliferation and down-regulates cell cycle-related genes in MTEC1 cells To further investigate the role of miR-195a-5p in MTEC1 cells, cell cycle assay was performed by flow cytometry. The results indicated that the percentage of cells in S phase was significantly increased (P < 0.01) and the percentage of cells in G2 phase was significantly decreased (P < 0.01) with miR-195a-5p over-expression (Fig. 2A,B). While in the miR-195a-5p-knockdown group, the percentage of cells in G1 phase was significantly decreased (P < 0.05) and the percentage of cells in S + G2 phase was significantly increased (P < 0.01) (Fig. 2C,D). Previous studies have shown that miR-195 may function as a potent regulator in cell cycle progression. Cyclin D1, Cyclin E1, Cyclin D3, Cdk1, Cdk2, Cdk4, Cdk6, E2F1, and C-myc play important roles in cell proliferation. Therefore, to further examine the regulation of miR-195a-5p on the cell cycle-related genes in MTEC1 cells, the mRNA and protein expressions of the cell cycle-related genes were
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
293
Figure 1. The expression of miR-195a-5p in isolated TECs and the effects of miR-195a-5p supplementation on cell viability and apoptosis (A) miR-195a-5p was detected by qRT-PCR in TECs from 1-, 10- and 19-month-old mice, U6 was used as a reference. (B, C) Cell viability analysis was performed by CCK-8 at 24, 48, and 72 h after transfection. (D) At 48 h after transfection, cell apoptosis was analyzed by flow cytometer. Data were presented as the mean ± SD of three experiments. *P < 0.05, **P < 0.01.
Figure 2. The cell cycle distribution of MTEC1 cells at 48 h after treatment with miR-195a-5p mimic or inhibitor Cell cycle was performed by flow cytometry after transfection with miR-195a-5p mimic/mimic-NC (A, B) and miR-195a-5p inhibitor/inhibitor-NC (C, D). Data were presented as the mean ± SD of three experiments. *P < 0.05, **P < 0.01.
294
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
measured by qRT-PCR and western blot analysis. As shown in Fig. 3A, the results of qPCR showed that the expression levels of Cyclin D1, Cyclin E1, Cdk1, Cdk2, Cdk4, and C-myc were significantly decreased in the miR-195a-5p mimic group compared with those in the mimic-NC group. Meanwhile, the levels of Cyclin D1, Cyclin E1, Cdk4, and C-myc were significantly increased in the miR-195a-5p inhibitor group compared with those in the inhibitor-NC group (Fig. 3B). In addition, western blot showed that the protein levels of Cyclin D1, Cyclin E1, Cdk4, and C-myc were down-regulated in the miR-195a-5p mimic group when compared with those in the mimic-NC group. Consistent with the mRNA expression in the miR-195a-5p inhibitor group, the protein levels of Cyclin D1, Cyclin E1, Cdk4, and C-myc were up-regulated in miR-195a inhibitor-transfected cells compared with those in inhibitor-NC transfected cells (Fig. 3C,D). All these data suggested that ectopic expression of miR-195a-5p in MTEC1 cells can down-regulate the cell cycle-related genes and inhibit cell proliferation.
Smad7 is a target gene of miR-195a-5p in MTEC1 cells To further understand the mechanism by which miR-195a-5p regulates MTEC1 cell proliferation, the putative targets of miR-195a-5p are predicted using miRNA target analysis tools. As shown in
Fig. 4A, Smad7 was predicted as a direct target of miR-195a-5p. To determine whether Smad7 could be regulated by miR-195a-5p in MTEC1 cells, the 3′UTR region of Smad7 was cloned into pmiRGLO luciferase vector, and the 3′UTR mutant was constructed by altering the nucleotides in the seed sequence. Subsequently, miR-195a-5p mimic and mimic-NC with the pmiRGLO-UTR-wt (wild-type) and pmiRGLO-UTR-mut (mutant-type) were co-transfected into HEK293T cells. As shown in Fig. 4B, in the 3′UTR-wt of the Smad7transfected group, miR-195a-5p mimic induced a significant reduction of luciferase activity compared with mimic-NC (P < 0.01). While in the 3′UTR mut-Smad7-transfected group, no significant difference was observed between the miR-195a-5p mimic and mimic-NC groups, indicating that Smad7 is a target gene of miR-195a-5p in MTEC1 cells. To further confirm the above-mentioned results, the expression of Smad7 in MTEC1 cells was examined by qPCR and western blot analysis. As shown in Fig. 4C,D, the ectopic expression of miR-195a-5p can significantly down-regulate the expression of Smad7 at mRNA and protein levels in miR-195a-5p mimic-transfected MTEC1 cells, when compared with that in the mimic-NC group (P < 0.05). However, the expression of Smad7 was increased when the expression of miR-195a-5p was suppressed in MTEC1 cells (P < 0.05) (Fig. 4C,
Figure 3. Expressions of cell cycle-related genes analyzed by qPCR and western blot analysis (A) The mRNA expressions of Cyclin D1, Cyclin E1, Cyclin D3, Cdk1, Cdk2, Cdk4, E2F1, and C-myc in miR-195a-5p mimic group. (B) The expressions of Cyclin D1, Cyclin E1, Cyclin D3, Cdk4, Cdk6, E2F1, and C-myc in miR-195a-5p inhibitor group. (C, D) The protein expressions of Cdk4, Cyclin D1, Cyclin E1, and C-myc in miR-195a-5p mimic and inhibitor-transfected MTEC1 cells, respectively. The data were normalized to the level of β-actin for mRNA and to the level of tubulin for protein in each sample. *P < 0.05, **P < 0.01.
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
295
Figure 4. Confirmation of Smad7 as a direct target gene of miR-195a-5p (A) The putative binding sites in Smad7 3′UTRs for miR-195a were predicted by Targetscan and the three muted nucleotides in mutant Smad7 3′UTR were shown. (B) The luciferase activity assay in HEK-293T cells were calculated as ratio of firefly to renilla after the cells were co-transfected with miR-195a-5p mimic or mimic-NC with pmiRGLO-Smad7-mut and pmiRGLO-Smad7-wt. Data were presented as the mean ± SD of three experiments. **P < 0.01. (C) The mRNA and (D) protein expression levels of Smad7 in MTEC1 cells 48 h after transfected with miR-195a-5p mimic, mimic-NC, miR-195a-5p inhibitor or inhibitor-NC. Data were normalized to the level of β-actin for mRNA and to the level of tubulin for protein in each sample. *P < 0.05.
D). Collectively, these results suggested that Smad7 is a direct target of miR-195a-5p, and the regulatory effect of miR-195a-5p on MTEC1 cell proliferation is at least in part through the down-regulation of Smad7.
Discussion TECs provide a highly specialized microenvironment for the generation of a functional and self-tolerant T-cell repertoire [38]. The most prominent changes in the age-related thymus involution often link to the dramatic decline in the number of TECs [39]. It has been shown that miRNAs play important roles in regulating cell death and proliferation during the process of aging [40]. Several studies have revealed that miRNAs are necessary in the maintenance and function of the TECs [36,40–42]. However, whether miR-195a directly regulates TECs function remains unclear. In this study, we found that the expression of miR-195a-5p was strikingly up-regulated in TECs from 19-month-old mice (Fig. 1A) and exhibited the same expression trends in thymus tissues. Therefore, we assumed that miR-195a-5p may play a key role in TECs involved in the age-related thymus involution. To verify this hypothesis, MTEC1 cells were used in our study, the cell viability experiment indicated that over-expression of miR-195a-5p in MTEC1 cells had an obvious
effect on suppressing cell viability (Fig. 1B). Meanwhile, the results of cell cycle assay showed that miR-195a-5p can inhibit cell proliferation through blocking the cell cycle progression in the G2/S transition (Fig. 2A,B). Furthermore, no obvious cell apoptosis was observed in this study (Fig. 1D). All these results indicated that miR-195a-5p plays a crucial role in the proliferation of TECs. It was known that the proliferation of a cell through the cell cycle (G0, G1, S, and G2/M) is controlled in part by a series of protein kinases, which is further regulated by a group of proteins called cyclins [43]. The cyclins act in concert with their cyclin-dependent kinases (CDKs) and drive the cell from one cell cycle to the next, which is necessary for cells growth and proliferation [44]. For example, Cyclin D1 and E1 are related to the control of G1/S phase in cell cycle progression [45]. C-myc is indispensable for regulating cell growth, proliferation and development [46,47]. C-myc was also reported to be necessary for skin keratinocytes proliferation [27]. Serine–threonine kinase Cdk4 is a serine/threonine kinase family member which controls the cell cycle G1 phase of the cell cycle process [48]. Lin et al. [49] reported that Cdk4 was targeted by miR-195 in bladder cancer cells. In this study, we showed that over-expression or suppression of miR-195a-5p in MTEC1 cells has a profound influence on the cell cycle progression. The qPCR and western blot analysis indicated that miR-195a-5p inhibited the expression of the cell cycle-related
296
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
genes, including Cyclin D1, Cyclin E1, Cdk4, and C-myc at mRNA and protein levels. These results further confirmed the inhibitory role of miR-195a-5p on MTEC1 cell proliferation. These results suggest that miR-195a-5p plays a crucial role in TECs proliferation. It has been shown that transgenic mice with Smad7 expression develops severe thymic atrophy and massive thymocyte death, which suggests that Smad signaling in TECs plays a crucial role for thymocyte survival [50]. On the other hand, biochemical studies have demonstrated that Smad7 blocks signal transduction of TGF-β [34,51]. Furthermore, it has also been reported that in the physiologic process, the age-related thymus involution in aged mice is mitigated in the TGF-RII deficient TECs [28]. Moreover, He et al. [50] demonstrated that the proliferation rates of both medullar and cortical TEC cell lines were reduced when exposed to TGF-β in vitro. All these studies showed that Smad7 is an important molecule in regulating TECs-related thymus involution and atrophy in TECs. In this study, Smad7 was identified as a direct target of miR-195a-5p. Western blot analysis and qPCR analysis demonstrated that the expression of Smad7 was down-regulated by ectopic expression of miR-195a-5p in MTEC1 cells. It was further confirmed by the luciferase reporter assays. The result showed that miR-195a-5p directly targeted Smad7 via the miR-195a-5p binding sites in the 3′UTRs. This result suggested that miR-195a-5p could suppress cell proliferation through TGF-β signal pathway, which was activated by miR-195a-5p directly targeting Smad7 in MTEC1 cells. To further clarify whether the expressions of miR-195a-5p and Smad7 in mice TECs are associated with the age-related thymus involution. The expression levels of Smad7 mRNA were detected in TECs from 1-, 3-, 8-, and 13-month-old mice (Supplementary Fig. S1). The results showed that no significant difference was seen between the TECs from 3-, 8-, and 13-month-old mice and those from the 1-month-old mice. Our results are consistent with the previous studies showing that low levels of Smad7 were expressed in normal epithelial tissues compared with in certain cancers [52–54] and also with another study showing that when Smad7 was over-expressed in TECs, the size of the 10-day-old thymi was only ∼1/5 of the normal thymi [50]. This result indicates that over-expression of Smad7 in young mice TECs will have a negative influence on mice thymus development. So, we infer that the cell proliferations in TECs may be mainly affected by the difference in the expression of miR-195a-5p, which is associated with the age-related thymus involution through regulating the signaling of Smad7 and TGF-β. In summary, our study confirms that miR-195a-5p is up-regulated in the TECs from aged mice. We have demonstrated for the first time that miR-195a-5p inhibits MTEC1 cell proliferation by targeting the novel target Smad7. Our data suggest an important role of miR-195a-5p in the mice TECs and implicate that the restoration of miR-195a-5p in TECs may slow down the age-related thymus involution and atrophy. The aberrant expression of miR-195a-5p in TECs may be a useful biomarker for the thymus involution.
Supplementary Data Supplementary Data are available at ABBS online.
Funding This work was supported by the grants from the National Natural Science Foundation of China (Nos. 31272519 and 31572475).
References 1. Gruver AL, Hudson LL, Sempowski GD. Immunosenescence of ageing. J Pathol 2007, 211: 144–156. 2. Takahama Y, Takada K, Murata S, Tanaka K. β5t-containing thymoproteasome: specific expression in thymic cortical epithelial cells and role in positive selection of CD8+ T cells. Curr Opin Immunol 2012, 24: 92–98. 3. Anderson G, Lane PJ, Jenkinson EJ. Generating intrathymic microenvironments to establish T-cell tolerance. Nat Rev Immunol 2007, 7: 954–963. 4. Xing Y, Jameson SC, Hogquist KA. Thymoproteasome subunit-beta5T generates peptide-MHC complexes specialized for positive selection. Proc Natl Acad Sci USA 2013, 110: 6979–6984. 5. Aw D, Silva AB, Maddick M, von Zglinicki T, Palmer DB. Architectural changes in the thymus of aging mice. Aging Cell 2008, 7: 158–167. 6. Hsu HC, Li L, Zhang HG, Mountz JD. Genetic regulation of thymic involution. Mech Ageing Dev 2005, 126: 87–97. 7. Olsen NJ, Olson G, Viselli SM, Gu X, Kovacs WJ. Androgen receptors in thymic epithelium modulate thymus size and thymocyte development. Endocrinology 2001, 142: 1278–1283. 8. Gray DH, Seach N, Ueno T, Milton MK, Liston A, Lew AM, Goodnow CC, et al. Developmental kinetics, turnover, and stimulatory capacity of thymic epithelial cells. Blood 2006, 108: 3777–3785. 9. Gui J, Zhu X, Dohkan J, Cheng L, Barnes PF, Su DM. The aged thymus shows normal recruitment of lymphohematopoietic progenitors but has defects in thymic epithelial cells. Int Immunol 2007, 19: 1201–1211. 10. Hauri-Hohl MM, Zuklys S, Keller MP, Jeker LT, Barthlott T, Moon AM, Roes J, et al. TGF-beta signaling in thymic epithelial cells regulates thymic involution and post-irradiation reconstitution. Blood 2008, 112: 626–634. 11. Maue AC, Yager EJ, Swain SL, Woodland DL, Blackman MA, Haynes L. T-cell immunosenescence: lessons learned from mouse models of aging. Trends Immunol 2009, 30: 301–305. 12. Dorshkind K, Swain S. Age-associated declines in immune system development and function: causes, consequences, and reversal. Curr Opin Immunol 2009, 21: 404–407. 13. Foster AD, Sivarapatna A, Gress RE. The aging immune system and its relationship with cancer. Aging Health 2011, 7: 707–718. 14. Gui J, Morales AJ, Maxey SE, Bessette KA, Ratcliffe NR, Kelly JA, Craig RW. MCL1 increases primitive thymocyte viability in female mice and promotes thymic expansion into adulthood. Int Immunol 2011, 23: 647–659. 15. Bravo-Nuevo A, O’Donnell R, Rosendahl A, Chung JH, Benjamin LE, Odaka C. RhoB deficiency in thymic medullary epithelium leads to early thymic atrophy. Int Immunol 2011, 23: 593–600. 16. Ortman CL, Dittmar KA, Witte PL, Le PT. Molecular characterization of the mouse involuted thymus: aberrations in expression of transcription regulators in thymocyte and epithelial compartments. Int Immunol 2002, 14: 813–822. 17. Pillai RS. MicroRNA function: multiple mechanisms for a tiny RNA? RNA 2005, 11: 1753–1761. 18. Chen LH, Chiou GY, Chen YW, Li HY, Chiou SH. MicroRNA and aging: a novel modulator in regulating the aging network. Ageing Res Rev 2010, 1: 59–66. 19. Drummond MJ, McCarthy JJ, Sinha M, Spratt HM, Volpi E, Esser KA, Rasmussen BB. Aging and microRNA expression in human skeletal muscle: a microarray and bioinformatics analysis. Physiol Genomics 2011, 43: 595–603. 20. Lanceta J, Prough RA, Liang R, Wang E. MicroRNA group disorganization in aging. Exp Gerontol 2010, 45: 269–278. 21. Zhang X, Azhar G, Wei JY. The expression of microRNA and microRNA clusters in the aging heart. PLoS One 2012, 7: e34688. 22. Williams AE, Perry MM, Moschos SA, Lindsay MA. microRNA expression in the aging mouse lung. BMC Genomics 2007, 8: 172. 23. Lin HY, Moustakas A. TGF-beta receptors: structure and function. Cell Mol Biol 1994, 40: 337–349. 24. Hayashi H, Abdollah S, Qiu Y, Cai J, Xu YY, Grinnell BW, Richardson MA, et al. The MAD-related protein SMAD7 associates with
MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7
25.
26. 27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37. 38. 39.
the TGFbeta receptor and functions as an antagonist of TGFbeta signaling. Cell 1997, 89: 1165–1173. Heldin CH, Landstrom M, Moustakas A. Mechanism of TGF-beta signaling to growth arrest, apoptosis, and epithelial-mesenchymal transition. Cell Biol 2009, 21: 166–176. Massague J. TGF beta signaling in context. Nat Rev Mol Cell Biol 2012, 13: 616–630. Moses HL, Pietenpol JA, Münger K, Murphy CS, Yang EY. TGF beta regulation of epithelial cell proliferation: role of tumor suppressor genes. Princess Takamatsu Symp 1991, 22: 183–195. Hauri-Hohl M, Zuklys S, Holländer GA, Ziegler SF. A regulatory role for TGF-β signaling in the establishment and function of the thymic medulla. Nat Immunol 2014, 15: 554–561. Olsen NJ, Zhou P, Ong H, Kovacs WJ. Testosterone induces expression of transforming growth factor-beta 1 in the murine thymus. J Steroid Biochem Mol Biol 1993, 45: 327–332. Sempowski GD, Hale LP, Sundy JS, Massey JM, Koup RA, Douek DC, Patel DD, et al. Leukemia inhibitory factor, oncostatin M, IL-6, and stem cell factor mRNA expression in human thymus increases with age and is associated with thymic atrophy. J Immunol 2000, 164: 2180–2187. Kumar R, Langer JC, Snoeck HW. Transforming growth factor-beta 2 is involved in quantitative genetic variation in thymic involution. Blood 2006, 107: 1974–1979. Kavsak P, Rasmussen RK, Causing CG, Bonni S, Zhu H, Thomsen GH, Wrana JL. SMAD7 binds to Smurf 2 to form an E3 ubiquitin ligase that targets the TGF beta receptor for degradation. Mol Cell 2000, 6: 1365–1375. Lin L, Gan H, Zhang H. MicroRNA-21 inhibits SMAD7 expression through a target sequence in the 3′ untranslated region and inhibits proliferation of renal tubular epithelial cells. Mol Med Rep 2014, 10: 707–712. Li HL, Yang F, Wang Z, Fu Q, Liang A. MicroRNA-21 promotes osteogenic differentiation by targeting small mothers against decapentaplegic 7. Mol Med Rep 2015, 12: 1561–1567. Yu FJ, Guo Y, Chen BC, Dong PH, Zheng JJ. MicroRNA-17-5p activates hepatic stellate cells through targeting of Smad7. Lab Invest 2015, 95: 781–789. Guo ZB, Chi F, Song Y, Wang CS, Yu RX, Wei TL, Gui JG, et al. Transcriptome analysis of murine thymic epithelial cells reveals age-associated changes in microRNA expression. Int J Mol Med 2013, 32: 835–842. Ye YQ, Li DT, Ouyang D, Deng L, Zhang Y, Ma YJ, Li YG. MicroRNA expression in the aging mouse thymus. Gene 2014, 547: 218–225. Aichinger M, Hinterberger M, Klein L. Probing gene function in thymic epithelial cells. Eur J Cell Biol 2012, 91: 24–30. Parent AV, Russ HA, Khan IS, LaFlam TN, Metzger TC, Anderson MS, Hebrok M. Generation of functional thymic epithelium from human embryonic stem cells that supports host T cell development. Cell Stem Cell 2013, 13: 219–229.
297
40. Khan IS, Taniguchi RT, Fasano KJ, Anderson MS, Jeker LT. Canonical microRNAs in thymic epithelial cells promotes central tolerance. Eur J Immunol 2014, 44: 1313–1319. 41. Zuklys S, Mayer CE, Zhanybekova S, Stefanski HE, Nusspaumer G, Gill J, Barthlott T, et al. MicroRNAs control the maintenance of thymic epithelia and their competence for T lineage commitment and thymocyte selection. J Immunol 2012, 189: 3894–3904. 42. Ucar O, Rattay K. Promiscuous gene expression in the thymus: a matter of epigenetics, miRNA, and more? Front Immunol 2015, 6: 93. 43. Dirks PB, Rutka JT. Current concepts in neuro-oncology: the cell cycle—a review. Neurosurgery 1997, 40: 1000–1013. 44. Culotti J, Hartwell LH. Genetic control of the cell division cycle in yeast. 3. Seven genes controlling nuclear division. Exp Cell Res 1971, 67: 389–401. 45. Wang H, Lu YT, Lu L, Li WS, Liang CF, He HY, Ba YY. MicroRNA-195 inhibits the proliferation of human glioma cells by directly targeting Cyclin D1 and Cyclin E1. PLoS One 2013, 8: e54932. 46. Lin F, Ding RL, Zheng S, Xing DY, Hong WW, Zhou ZJ, Shen J. Decrease expression of microRNA-744 promotes cell proliferation by targeting C-myc in human hepatocellular carcinoma. Cancer Cell Int 2014, 14: 58–66. 47. Zheng L, Zhang GW, Li J, Liu JB, Lv PF. The tumor-suppressive microRNA-135b targets C-myc in osteoscarcoma. PLoS One 2014, 9: e102621. 48. Tyagi A, Agarwal C, Harrison G, Glode LM, Agarwal R. Silibinin causes cell cycle arrest and apoptosis in human bladder transitional cell carcinoma cells by regulating CDKI-CDK-cyclin cascade, and caspase 3 and PARP cleavages. Carcinogenesis 2004, 25: 1711–1720. 49. Lin YW, Wu J, Chen H, Mao YQ, Liu YF, Mao QQ, Yang K, et al. Cyclindependent kinase 4 is a novel target in micoRNA-195-mediated cell cycle arrest in bladder cancer cells. FEBS Lett 2012, 586: 442–447. 50. He W, Li AG, Wang D, Han S, Zheng B, Goumans MJ, Ten DP, et al. Overexpression of Smad7 results in severe pathological alterations in multiple epithelial tissues. EMBO J 2002, 21: 2580–2590. 51. Wrana JL. Signaling by the TGFβ superfamily. Cold Spring Harb Perspect Biol 2013, 5: a011197. 52. Kleeff J, Ishiwata T, Maruyama H, Friess H, Truong P, Büchler MW, Falb D, et al. The TGF-beta signaling inhibitor Smad7 enhances tumorigenicity in pancreatic cancer. Oncogene 1999, 18: 5363–5372. 53. Boulay JL, Mild G, Reuter J, Lagrange M, Terracciano L, Lowy A, Laffer U, et al. Combined copy status of 18q21 genes in colorectal cancer shows frequent retention of SMAD7. Genes Chromosomes Cancer 2001, 31: 240–247. 54. He W, Cao T, Smith DA, Myers TE, Wang XJ. Smads mediate signaling of the TGFbeta superfamily in normal keratinocytes but are lost during skin chemical carcinogenesis. Oncogene 2001, 20: 471–483.
