GENE-40420; No. of pages: 6; 4C: Gene xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1 Chao-Feng Chen, Jinyu Huang, Hong Li, Chu Zhang, Xurui Huang, Guoxin Tong, Yi-Zhou Xu ⁎ Department of Cardiology, Hangzhou First People's Hospital, Hangzhou Hospital of Nanjing Medical University, Hangzhou 310006, China
a r t i c l e
i n f o
Article history: Received 21 December 2014 Received in revised form 13 March 2015 Accepted 7 April 2015 Available online xxxx Keywords: Adiponectin AdipoR1 miR-221 NF-kB NO
a b s t r a c t Adiponectin exerts anti-atherosclerosis property through its 2 receptors (AdipoR1 and AdipoR2). The mechanism regulating the expression of adiponectin receptors is unclear. Bioinformatics analysis showed that miR-221 targeted the 3′-untranslated region (3′UTR) of the AdipoR1 mRNA. The protein level and the mRNA level of AdipoR1 were reduced when miR-221 was expressed in human umbilical vein endothelial cells (HUVECs). Meanwhile, miR-221 repressed the activity of luciferase reporter containing the 3′UTR of AdipoR1. The inhibitory effect of miR-221 was abolished when the miR-221 binding site within the AdipoR1 3′UTR was deleted. Overexpression of miR-221 inhibited adiponectin-stimulated nitric oxide (NO) production in HUVECs. Furthermore, miR-221 abolished the inhibitory effect of adiponectin on NF-kB activation and the expression of adhesion molecules. Altogether, these results indicated that miR-221 targets AdipoR1 to regulate endothelial inflammatory response. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Endothelial dysfunction, characterized by inflammation and diminished endothelial production of nitric oxide (NO), is associated with the development and progression of atherosclerosis (Gimbrone et al., 2000). NO, synthesized by endothelial NO synthase (eNOS), protects vascular function by enhancing vasodilation and inhibiting platelet aggregation, monocyte adhesion, and smooth muscle cell proliferation (Huang, 2003). Dysfunction in endothelial NO production is closely related with atherosclerotic lesion formation (Napoli et al., 2006). On the other hand, the expression of inflammatory genes promotes atherosclerosis. Nuclear factor-kappa B (NF-kB) is considered to be the central transcriptional factor for the induction of endothelial cell inflammation (Collins et al., 1995; De Martin et al., 2000; Choi et al., 2004). In resting situations, the inhibitory protein IkB binds to NF-kB and retains NF-kB in the cytosol. Under stimulation, IkB is degraded and NF-kB is then translocated into the nucleus, where it stimulates the transcription of inflammatory genes (Baeuerle and Baltimore, 1996). Adiponectin/Acrp30 is an adipocyte-derived factor with antidiabetic, and insulin-sensitizing metabolic effects (Berg et al., 2002). It has been reported that adiponectin also exerts vascular-protecting properties by improving endothelial function and having anti-inflammatory effects in
Abbreviations: AdipoR, adiponectin receptor; NF-kB, nuclear factor-kappa B; TNF-α, tumor necrosis factor alpha; HUVEC, human umbilical vein endothelial cell; NO, nitric oxide. ⁎ Corresponding author. E-mail address: [email protected] (Y.-Z. Xu).
the vascular wall. Adiponectin stimulates the production of NO in endothelial cells through phosphatidylinositol 3-kinase-dependent pathway involving phosphorylation of eNOS at Ser1179 by AMPK (Chen et al., 2003). Adiponectin has also been reported to inhibit endothelial NF-kB signaling, and further reduces the expression of adhesion molecules (Ouchi et al., 2000). However, the regulation of adiponectin-inhibited inflammatory response remains to be identified. The physiological effects of adiponectin are mediated by its 2 receptors (AdipoR1 and AdipoR2) (Yamauchi et al., 2003). AdipoR1 and AdipoR2 have been shown to be involved in adiponectin-activated AMP-activated protein kinase (AMPK), peroxisome proliferatoractivated receptor (PPAR)-α, and the p38 mitogen-activated protein kinase (MAPK) pathways (Yamauchi et al., 2003). Overexpression of adiponectin receptors potentiates the anti-inflammatory action of globular adiponectin in vascular endothelial cells (Zhang et al., 2009), indicating a role of adiponectin receptors in mediating the vascularprotecting effects of adiponectin. MicroRNAs (miRNAs) are a class of ~ 22 nucleotide RNAs that regulate gene expression at the post-transcriptional level. MiRNAs silence their target genes by cleaving mRNA molecules or inhibiting their translations and thus regulate various physiological or pathological processes (Bartel, 2004). Evidence showed that miRNAs act as key regulators for endothelial biology and function (Qin et al., 2012). miR126 was reported to inhibit the expression of VCAM-1 and the adherence of leukocyte to endothelial cells (ECs), which provides the first evidence that miRNAs can control vascular inflammation (Harris et al., 2008). miR-221/222 was reported to regulate angiotensin IIinduced endothelial inflammation and migration (Zhu et al., 2011). In
http://dx.doi.org/10.1016/j.gene.2015.04.014 0378-1119/© 2015 Elsevier B.V. All rights reserved.
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
2
C.-F. Chen et al. / Gene xxx (2015) xxx–xxx
this study, we identified AdipoR1 as a direct target for miR-221. Furthermore, our data showed that miR-221 inhibited NO production and activated NF-kB signaling in human endothelial cells.
release was determined by quantitative detection of nitrite (NO2–) and nitrate (NO3–) using Nitric Oxide Assay Kit (Pierce). NO levels were normalized to control group.
2. Materials and methods 2.7. NF-kB activation assay 2.1. Cell culture Human umbilical vein endothelial cells (HUVECs) were purchased from Cascade Biologics and cultured in medium 200 supplemented with low serum growth supplement (Cascade Biologics). 2.2. Bioinformatics analysis To identify putative miRNAs targeting AdipoR1, we queried the online target prediction programs TargetScan (www.targetscan.org) and miRanda (www.microrna.org). In order to improve the likelihood of the candidate miRNAs, we also performed an inverse search by using each candidate miRNA as a bait to identify its potential target genes. Through this approach, miR-221 was identified as one of miRNAs targeting AdipoR1. 2.3. Plasmid construction Wild-type 3′-untranslated region (3′UTR) of AdipoR1 gene containing predicted miR-221 target sites was amplified by PCR using the primer sets AdipoR1-F(GCTCTAGAGCCTTCCCACCTGCGGGGTG)/AdipoR1-R(GCTCTA GAGAAATCTTTGAATGCCAAGTG) from HUVEC cDNAs. Seed sequencedeleted mutant of AdipoR1 3′UTR was generated by overlap-extension PCR method. During the first PCR cycle, the 5′ fragment and 3′ fragment of AdipoR1 3′UTR was amplified using the primer sets AdipoR1-F/ AdipoR1-mut-R(AAAATGGATGGCCTGTTATAAG) and AdipoR1-mutF(ACACTTTTCAAAAACAATTATAT)/AdipoR1-R. The PCR products were mixed and used as the template, and the second PCR cycle was carried out using the primer set AdipoR1-F/AdipoR1-R. Both the wild-type and mutated 3′UTR fragments were cloned into the downstream of firefly luciferase coding region in the XbaI site of pGL3-control plasmid (Promega). Myc-tagged AdipoR1 expression plasmid was constructed as previously reported (Xu et al., 2011).
NF-kB activation was detected as reported previously (Xu et al., 2011). Briefly, HUVECs were transfected with pNFkB-Luc, a cisreporter plasmid containing the luciferase reporter gene linked to five repeats of NF-kB binding sites (Stratagene). After 24 h, HUVECs were treated with or without 10 μg/mL of adiponectin (R&D systems) for 24 h, and then incubated with or without 10 U/mL of TNF-α for 4 h. The luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega).
2.8. RNA isolation, reverse transcription and real-time quantitative PCR (qPCR) Total RNA was isolated using Trizol reagent (Invitrogen) and 2 μg total RNA was used for cDNA synthesis. Real-time quantitative PCR analysis was performed using SYBR Premix Ex Taq (Takara) in an ABI7900 system (Applied biosystem). Primers 5′-TGCCAAAGCTGC TCTAGCCTTG-3′ and 5′-TGTTGTTGCCAGTGTTCAGCCAG-3′ were used for E-selectin amplification. Primers 5′-TCCCCTGGACCCCGGA TTGC-3′ and 5′-AGGGAATGAGTAGAGCTCCACCTG-3′ were used for VCAM-1 amplification. Primers 5′-CGAGCACAGAGCCTCGCCTTT-3′ and 5′-TCATCATCCATGGTGAGCTGGCG-3′ were used for β-actin gene amplification. The expression levels of E-selectin and VCAM-1 were normalized to β-actin.
2.9. Statistical analysis The data were presented as means ± SD from 3 independent experiments. The statistical significance between groups was determined using Student's t test.
2.4. Transfections
3. Results
HUVECs were transiently transfected with 20 nM of the chemically synthesized miR-221 (5′-AGCUACAUUGUCUGCUGGGUUUC-3′), or negative control miRNA (NC: 5′-UUCUCCGAACGUGUCACGU-3′) (Genepharma, Shanghai, China) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's recommendations. After 24-h transfection, cells were used for subsequent experiments.
3.1. miR-221 targets AdipoR1 mRNA
2.5. Immunoblotting Cells were washed with ice-cold phosphate buffered saline and lysed in ice-cold lysis buffer (100 mM Tris–HCl, pH 7.5, 300 mM NaCl, 0.5% NP-40, 1 mM DTT) containing the protease inhibitor cocktail tablets (Sigma). Cell lysates were resuspended in SDS loading buffer, heated at 95 °C for 5 min, and separated by SDS-PAGE. Immunocomplexes were analyzed by Western blot using anti-AdipoR1 antibody (Cell Signaling Technology), anti-IkBα (Cell Signaling Technology), antiphospho-eNOS (Cell Signaling Technology), or anti-eNOS (Cell Signaling Technology). Immunodetection was performed with an enhanced chemiluminescence (ECL) kit (Amersham). 2.6. NO measurement HUVECs transfected with miR-221 were treated with or without adiponectin. The supernatant was then collected for NO detection. NO
To identify potential AdipoR1-targeting miRNAs, we first performed in silico search using publicly available algorithms including TargetScan and MIRanda. miR-221 was identified as a candidate miRNA targeting AdipoR1. Phylogenetic analysis showed that miR-221 is well conserved among different species (Fig. 1A). Six nucleotides in the 3′UTR of the human AdipoR1 mRNA were perfectly complementary to the nucleotides 2–7 of miR-221 (Fig. 1B). To test whether miR-221 targets the 3′UTR of AdipoR1, we applied luciferase assays. The 3′UTR of AdipoR1 gene was cloned to the downstream of the coding sequence of luciferase. The construct was then co-transfected into HUVECs with miR-221 or control RNA. Data showed that miR-221 specifically decreased the luciferase levels. The inhibitory effect of miR-221 was abolished when the miR-221 binding site within the AdipoR1 3′UTR was deleted (Fig. 1B). Next, we employed several approaches to determine whether miR-221 regulates AdipoR1 expression in cells. Overexpression of miR-221 mimics reduced the AdipoR1 mRNA level to about 70% of control group (Fig. 1C). The protein level of AdipoR1 was also significantly reduced when cells were transfected with miR221 mimics (Fig. 1D). These results suggested that miR-221 directly binds to the 3′UTR of AdipoR1 mRNA and reduces AdipoR1 expression.
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
C.-F. Chen et al. / Gene xxx (2015) xxx–xxx
3
Fig. 1. miR-221 down-regulates AdipoR1 expression through direct binding to the 3′UTR of AdipoR1 mRNA. (A) Conservation of predicted binding site of miR-221 within AdipoR1 3′UTRs (hsa, Homo sapiens; mmu, Mus musculus; rno, Rattus norvegicus; cfa, Canis familiaris). (B) HUVECs were transfected with AdipoR1-UTR-Luc (AdipoR1-WT) or seed sequence-deleted mutant (AdipoR1-del), together with miR-221. Luciferase activities were detected 24 h later. Data shown are means ± SD of 3 independent experiments. **Indicates P b 0.01. (C) HUVECs were transfected with or without miR-221 and the mRNA levels of AdipoR1 and AdipoR2 were detected by RT-qPCR. Data shown are means ± SD of 3 independent experiments. *Indicates P b 0.05. (D) HUVECs were transfected with or without miR-221 and the protein levels of AdipoR1 and AdipoR2 were detected by immunoblotting.
3.2. miR-221 inhibits adiponectin-stimulated NO production in endothelial cells Adiponectin was reported to stimulate phosphorylation of eNOS at Ser1179 and NO production in endothelial cells (Chen et al., 2003). The NO-stimulating effect of adiponectin is mediated by adiponectin receptors (Cheng et al., 2007). Therefore, the inhibition of AdipoR1 by miR-221 prompted us to think that miR-221 might affect adiponectinstimulated NO production. This was indeed the case. Adiponectin treatment significantly increased NO production in HUVECs, while expression of miR-221 inhibited NO synthesis (Fig. 2A). Phosphorylation
of eNOS is essential for NO synthesis. Our data showed that adiponectin increased phosphorylation of eNOS at Ser1179 and the phosphorylation level decreased when miR-221 was expressed (Fig. 2B). These data indicated that miR-221 inhibits adiponectin-stimulated eNOS phosphorylation and NO production. To exclude the possibility that the reduced NO production after miRNA-221 expression is due to other miR-221 targets, we performed rescue experiment. AdipoR1 gene without 3′UTR was co-expressed with miR-221 and NO production was then examined. Data showed that reduced NO level by miR-221 was restored after AdipoR1 expression (Fig. 2C). Immunoblotting data showed that the phosphorylation
Fig. 2. miR-221 inhibits adiponectin-stimulated NO production in endothelial cells. (A) HUVECs transfected with or without miR-221 were treated with or without 10 μg/mL of adiponectin for 30 min. NO release in the conditioned medium was measured. Data shown are means ± SD of 3 independent experiments. **Indicates P b 0.01. (B) HUVECs transfected with or without miR-221 were treated with or without 10 μg/mL of adiponectin for 10 min. The phosphorylation of eNOS at Ser1179 was detected by immunoblotting. (C) HUVECs transfected with miR-221 together with or without AdipoR1 gene were treated with 10 μg/mL of adiponectin for 30 min. NO release in the conditioned medium was measured. Data shown are means ± SD of 3 independent experiments. **Indicates P b 0.01, * indicates P b 0.05. (D) HUVECs transfected with miR-221 together with or without AdipoR1 gene were treated with 10 μg/mL of adiponectin for 30 min. The phosphorylation of eNOS at Ser1179 was detected by immunoblotting.
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
4
C.-F. Chen et al. / Gene xxx (2015) xxx–xxx
level of eNOS was decreased in miR-221-expressing group and restored when AdipoR1 was co-expressed (Fig. 2D). These data suggested that miR-221-repressed NO production is specifically mediated by AdipoR1. 3.3. miR-221 activates NF-kB signaling in endothelial cells Adiponectin was reported to inhibit TNF-α-induced NF-kB signaling in endothelial cells (Ouchi et al., 2000). We therefore detected the effect of miR-221 on endothelial NF-kB activation. The activation of NF-kB is controlled by the rapid phosphorylation and degradation of the cytoplasmic inhibitor IkB-α. Therefore, we first determined the effect of miR-221 on the cytoplasmic protein level of IkB-α. Data showed that cytoplasmic IkB-α decreased significantly after TNF-α treatment, while adiponectin pretreatment stabilized IkB-α, indicating an inhibitory role of adiponectin in NF-kB activation. The protein level of IkB-α decreased when miR-221 was expressed (Fig. 3A). Next, we examined the effects of adiponectin and miR-221 on NF-kB activation by using luciferase assays. Data showed that adiponectin treatment decreased the luciferase activity induced by TNF-α stimulation, while miR-221 expression increased luciferase activity (Fig. 3B). These data suggested that miR-221 represses AdipoR1 expression and activates NF-kB signaling in endothelial cells. 3.4. miR-221 promotes the expressions of adhesion molecules in endothelial cells NF-kB activation increases the expression of adhesion molecules in endothelial cells, including endothelial-leukocyte adhesion molecule-1 (E-selectin), and vascular cell adhesion molecule-1 (VCAM-1), which promote monocyte adhesion to arterial endothelium. We therefore detected the effect of miR-221 on adhesion molecule expression. RTqPCR analysis showed that TNF-α treatment increased mRNA levels of E-selectin and VCAM-1, while pretreatment with adiponectin
Fig. 4. miR-221 promotes the expressions of adhesion molecules in endothelial cells. HUVECs transfected with or without miR-221 were pretreated for 24 h with or without 10 μg/mL of adiponectin, and then incubated with 10 U/mL of TNF-α for 4 h. The mRNA levels of E-selectin (A), or VCAM-1 (B) were determined by RT-qPCR analysis. Data shown are means ± SD of 3 independent experiments. **Indicates P b 0.01, *indicates P b 0.05.
significantly suppressed the expressions of those endothelial adhesion molecules (Fig. 4). The inhibitory effect of adiponectin was abolished when miR-221 was overexpressed, suggesting that miR-221 promotes adhesion molecule expression by inhibiting adiponectin signaling. 4. Discussion
Fig. 3. miR-221 activates NF-kB signaling in endothelial cells. (A) HUVECs transfected with or without miR-221 were pretreated for 24 h with or without 10 μg/mL of adiponectin, and then incubated with 10 U/mL of TNF-α for 30 min. The cytoplasmic IkBα level was detected by immunoblotting. (B) HUVECs transfected with pNFkB-Luc together with miR-221 were pretreated for 24 h with or without 10 μg/mL of adiponectin, and then incubated with 10 U/mL of TNF-α for another 4 h. The luciferase activities were then detected. Data shown are means ± SD of 3 independent experiments. **Indicates P b 0.01.
Adiponectin is an abundant plasma protein secreted from adipocytes that have protective effects on the vasculature and myocardium. Adiponectin receptors are expressed in endothelial cells (Motoshima et al., 2004) and have a key role in mediating the vascular effects of adiponectin. However, the mechanism regulating the expression of adiponectin receptors is unclear. In this study, we found that miR-221 directly repressed the expression of adiponectin receptor 1 (AdipoR1). Moreover, we demonstrated that miR-221 inhibited NO synthesis and activated NF-kB signaling. NF-kB signaling pathway is essential for the expression of inflammatory genes and EC pathology (Collins et al., 1995; De Martin et al., 2000; Choi et al., 2004). The effects of adiponectin on NF-kB activation and inflammatory responses in ECs are complicated. A bundle of studies supported that a major effect of adiponectin is the suppression of proinflammatory endothelial responses, which include reversing the
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
C.-F. Chen et al. / Gene xxx (2015) xxx–xxx
activation of NF-kB, reducing adhesion molecule expression, enhancing nitric oxide bioavailability (Goldstein and Scalia, 2004, 2007). However, Hattori et al. reported that the globular adiponectin (gAd), one form of adiponectin, activated NF-kB pathway and inflammatory gene expression in cultured endothelial cells (Hattori et al., 2006, 2007), although it was not clear whether cleavage of adiponectin at sites of inflammation in vivo results in sufficient gAd generation to activate NF-kB. Our data showed that adiponectin treatment inhibited NF-kB activation and its target gene expression, supporting an anti-inflammatory role. Evidence showed that miR-221 regulates multiple aspects of endothelial behaviors. By targeting cyclin dependent kinase inhibitor 1b (cdkn1b) and phosphoinositide-3-kinase regulatory subunit 1 (pik3r1), miR-221 promotes endothelial tip cell proliferation and migration during vascular development (Nicoli et al., 2012). miR-221 also promotes tumor angiogenesis in human hepatocellular carcinoma (Santhekadur et al., 2012). miR-221/222 in human umbilical vein endothelial cells could regulate angiotensin II-induced endothelial inflammation and migration (Zhu et al., 2011). Our data showed that miR-221 targeted AdipoR1 to activate NF-kB signaling and promote the expressions of NF-kB target genes in endothelial cells. Based on the central role of NF-kB in endothelial inflammatory signaling, our data suggested that miR-221 might be involved in regulation of endothelial inflammation in vascular diseases such as atherosclerosis. Interestingly, miR-221 was reported to be a transcriptional target of NF-kB. TNF-α treatment downregulates miR-221 expression (Meerson et al., 2013) and NF-kB can induce miR-221 expression (Galardi et al., 2011). Therefore, miR221 and NF-kB might form a positive feedback loop to enhance the inflammatory response. Adiponectin signaling also plays important roles in glucose/fat metabolism and muscle cell function. Evidence showed that miR-221 repressed AdipoR1 translation in muscle cells. The expression of miR221 was reduced, which resulted in up-regulation of AdipoR1 during muscle cell differentiation, indicating that miR-221 is involved in muscle differentiation by targeting AdipoR1 (Lustig et al., 2014). Lustig et al. showed that AdipoR1 mRNA did not change significantly after the overexpression of miR-221 in HepG2 cells, suggesting that miR211 acts at the translational level. However, our data showed that overexpression of miR-221 mimics reduced the AdipoR1 mRNA level in HUVECs. The discrepancy might be due to different cell types (Lustig et al., 2014). miR-221 also participates in glucose/fat metabolism. Obese mice showed high miR-221 levels and low AdipoR1 levels (Lustig et al., 2014). miR-221 overexpression upregulated several proteins involved in fat metabolism, mimicking peroxisome proliferatoractivated receptor (PPAR) activation (Meerson et al., 2013). All these data support that miR-221 indeed inhibits AdipoR1 expression and suggest that miR-221 regulates AdipoR1 signaling in different pathological processes. Adiponectin protects the vascular system partly through stimulation of endothelial nitric oxide (NO) production and endothelium-dependent vasodilation (Chen et al., 2003). Adiponectin receptors mediate the endothelium actions of adiponectin, since adiponectin-induced phosphorylation of eNOS at Ser1177 and NO production was abrogated when expression of adiponectin receptors were suppressed (Cheng et al., 2007). Our study presented evidence that miR-221 inhibited AdipoR1 expression thereby further inhibited adiponectin-stimulated eNOS phosphorylation and NO production (Fig. 2). In agreement with our data, miR-221 was reported to be up-regulated in senescent human aortic endothelial cells (Rippe et al., 2012). Evidence also showed that miR-221 was negatively associated with eNOS level in endothelial cells (Suarez et al., 2007; Rippe et al., 2012). Therefore, miR-221 might regulate NO production by reducing eNOS phosphorylation or eNOS expression. In summary, we have identified AdipoR1 as a direct target of miR221. Furthermore, miR-221 inhibits NO production and abolishes the inhibitory effect of adiponectin on NF-kB activation in human umbilical
5
vein endothelial cells. These results indicated that miR-221 targets AdipoR1 to regulate endothelial inflammatory response.
Acknowledgments The work was supported by grants from the National Natural Science Foundation of China (30971187), the Natural Science Foundation of Zhejiang Province (Y206937), and the Hangzhou Science and Technology Development Program (20120533Q03, 20090833B01).
References Baeuerle, P.A., Baltimore, D., 1996. NF-kappa B: ten years after. Cell 87, 13–20. Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297. Berg, A.H., Combs, T.P., Scherer, P.E., 2002. ACRP30/adiponectin: an adipokine regulating glucose and lipid metabolism. Trends Endocrinol. Metab. 13, 84–89. Chen, H., Montagnani, M., Funahashi, T., Shimomura, I., Quon, M.J., 2003. Adiponectin stimulates production of nitric oxide in vascular endothelial cells. J. Biol. Chem. 278, 45021–45026. Cheng, K.K., Lam, K.S., Wang, Y., Huang, Y., Carling, D., Wu, D., Wong, C., Xu, A., 2007. Adiponectin-induced endothelial nitric oxide synthase activation and nitric oxide production are mediated by APPL1 in endothelial cells. Diabetes 56, 1387–1394. Choi, J., Enis, D.R., Koh, K.P., Shiao, S.L., Pober, J.S., 2004. T lymphocyte-endothelial cell interactions. Annu. Rev. Immunol. 22, 683–709. Collins, T., Read, M.A., Neish, A.S., Whitley, M.Z., Thanos, D., Maniatis, T., 1995. Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa B and cytokineinducible enhancers. FASEB J. 9, 899–909. De Martin, R., Hoeth, M., Hofer-Warbinek, R., Schmid, J.A., 2000. The transcription factor NF-kappa B and the regulation of vascular cell function. Arterioscler. Thromb. Vasc. Biol. 20, E83–E88. Galardi, S., Mercatelli, N., Farace, M.G., Ciafre, S.A., 2011. NF-kB and c-Jun induce the expression of the oncogenic miR-221 and miR-222 in prostate carcinoma and glioblastoma cells. Nucleic Acids Res. 39, 3892–3902. Gimbrone Jr., M.A., Topper, J.N., Nagel, T., Anderson, K.R., Garcia-Cardena, G., 2000. Endothelial dysfunction, hemodynamic forces, and atherogenesis. Ann. N. Y. Acad. Sci. 902, 230–239 (discussion 239–40). Goldstein, B.J., Scalia, R., 2004. Adiponectin: a novel adipokine linking adipocytes and vascular function. J. Clin. Endocrinol. Metab. 89, 2563–2568. Goldstein, B.J., Scalia, R., 2007. Adipokines and vascular disease in diabetes. Curr. Diab. Rep. 7, 25–33. Harris, T.A., Yamakuchi, M., Ferlito, M., Mendell, J.T., Lowenstein, C.J., 2008. MicroRNA-126 regulates endothelial expression of vascular cell adhesion molecule 1. Proc. Natl. Acad. Sci. U. S. A. 105, 1516–1521. Hattori, Y., Hattori, S., Kasai, K., 2006. Globular adiponectin activates nuclear factorkappaB in vascular endothelial cells, which in turn induces expression of proinflammatory and adhesion molecule genes. Diabetes Care 29, 139–141. Hattori, Y., Hattori, S., Akimoto, K., Nishikimi, T., Suzuki, K., Matsuoka, H., Kasai, K., 2007. Globular adiponectin activates nuclear factor-kappaB and activating protein-1 and enhances angiotensin II-induced proliferation in cardiac fibroblasts. Diabetes 56, 804–808. Huang, P.L., 2003. Endothelial nitric oxide synthase and endothelial dysfunction. Curr. Hypertens. Rep. 5, 473–480. Lustig, Y., Barhod, E., Ashwal-Fluss, R., Gordin, R., Shomron, N., Baruch-Umansky, K., Hemi, R., Karasik, A., Kanety, H., 2014. RNA-binding protein PTB and microRNA-221 coregulate AdipoR1 translation and adiponectin signaling. Diabetes 63, 433–445. Meerson, A., Traurig, M., Ossowski, V., Fleming, J.M., Mullins, M., Baier, L.J., 2013. Human adipose microRNA-221 is upregulated in obesity and affects fat metabolism downstream of leptin and TNF-alpha. Diabetologia 56, 1971–1979. Motoshima, H., Wu, X., Mahadev, K., Goldstein, B.J., 2004. Adiponectin suppresses proliferation and superoxide generation and enhances eNOS activity in endothelial cells treated with oxidized LDL. Biochem. Biophys. Res. Commun. 315, 264–271. Napoli, C., de Nigris, F., Williams-Ignarro, S., Pignalosa, O., Sica, V., Ignarro, L.J., 2006. Nitric oxide and atherosclerosis: an update. Nitric Oxide 15, 265–279. Nicoli, S., Knyphausen, C.P., Zhu, L.J., Lakshmanan, A., Lawson, N.D., 2012. miR-221 is required for endothelial tip cell behaviors during vascular development. Dev. Cell 22, 418–429. Ouchi, N., Kihara, S., Arita, Y., Okamoto, Y., Maeda, K., Kuriyama, H., Hotta, K., Nishida, M., Takahashi, M., Muraguchi, M., Ohmoto, Y., Nakamura, T., Yamashita, S., Funahashi, T., Matsuzawa, Y., 2000. Adiponectin, an adipocyte-derived plasma protein, inhibits endothelial NF-kappaB signaling through a cAMP-dependent pathway. Circulation 102, 1296–1301. Qin, B., Yang, H., Xiao, B., 2012. Role of microRNAs in endothelial inflammation and senescence. Mol. Biol. Rep. 39, 4509–4518. Rippe, C., Blimline, M., Magerko, K.A., Lawson, B.R., LaRocca, T.J., Donato, A.J., Seals, D.R., 2012. MicroRNA changes in human arterial endothelial cells with senescence: relation to apoptosis, eNOS and inflammation. Exp. Gerontol. 47, 45–51. Santhekadur, P.K., Das, S.K., Gredler, R., Chen, D., Srivastava, J., Robertson, C., Baldwin Jr., A.S., Fisher, P.B., Sarkar, D., 2012. Multifunction protein staphylococcal nuclease domain containing 1 (SND1) promotes tumor angiogenesis in human hepatocellular carcinoma through novel pathway that involves nuclear factor kappaB and miR221. J. Biol. Chem. 287, 13952–13958. Suarez, Y., Fernandez-Hernando, C., Pober, J.S., Sessa, W.C., 2007. Dicer dependent microRNAs regulate gene expression and functions in human endothelial cells. Circ. Res. 100, 1164–1173.
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
6
C.-F. Chen et al. / Gene xxx (2015) xxx–xxx
Xu, Y., Zhang, C., Wang, N., Ling, F., Li, P., Gao, Y., Hua, W., 2011. Adiponectin inhibits lymphotoxin-beta receptor-mediated NF-kappaB signaling in human umbilical vein endothelial cells. Biochem. Biophys. Res. Commun. 404, 1060–1064. Yamauchi, T., Kamon, J., Ito, Y., Tsuchida, A., Yokomizo, T., Kita, S., Sugiyama, T., Miyagishi, M., Hara, K., Tsunoda, M., Murakami, K., Ohteki, T., Uchida, S., Takekawa, S., Waki, H., Tsuno, N.H., Shibata, Y., Terauchi, Y., Froguel, P., Tobe, K., Koyasu, S., Taira, K., Kitamura, T., Shimizu, T., Nagai, R., Kadowaki, T., 2003. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423, 762–769.
Zhang, P., Wang, Y., Fan, Y., Tang, Z., Wang, N., 2009. Overexpression of adiponectin receptors potentiates the antiinflammatory action of subeffective dose of globular adiponectin in vascular endothelial cells. Arterioscler. Thromb. Vasc. Biol. 29, 67–74. Zhu, N., Zhang, D., Chen, S., Liu, X., Lin, L., Huang, X., Guo, Z., Liu, J., Wang, Y., Yuan, W., Qin, Y., 2011. Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis 215, 286–293.
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1 Chao-Feng Chen, Jinyu Huang, Hong Li, Chu Zhang, Xurui Huang, Guoxin Tong, Yi-Zhou Xu ⁎ Department of Cardiology, Hangzhou First People's Hospital, Hangzhou Hospital of Nanjing Medical University, Hangzhou 310006, China
a r t i c l e
i n f o
Article history: Received 21 December 2014 Received in revised form 13 March 2015 Accepted 7 April 2015 Available online xxxx Keywords: Adiponectin AdipoR1 miR-221 NF-kB NO
a b s t r a c t Adiponectin exerts anti-atherosclerosis property through its 2 receptors (AdipoR1 and AdipoR2). The mechanism regulating the expression of adiponectin receptors is unclear. Bioinformatics analysis showed that miR-221 targeted the 3′-untranslated region (3′UTR) of the AdipoR1 mRNA. The protein level and the mRNA level of AdipoR1 were reduced when miR-221 was expressed in human umbilical vein endothelial cells (HUVECs). Meanwhile, miR-221 repressed the activity of luciferase reporter containing the 3′UTR of AdipoR1. The inhibitory effect of miR-221 was abolished when the miR-221 binding site within the AdipoR1 3′UTR was deleted. Overexpression of miR-221 inhibited adiponectin-stimulated nitric oxide (NO) production in HUVECs. Furthermore, miR-221 abolished the inhibitory effect of adiponectin on NF-kB activation and the expression of adhesion molecules. Altogether, these results indicated that miR-221 targets AdipoR1 to regulate endothelial inflammatory response. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Endothelial dysfunction, characterized by inflammation and diminished endothelial production of nitric oxide (NO), is associated with the development and progression of atherosclerosis (Gimbrone et al., 2000). NO, synthesized by endothelial NO synthase (eNOS), protects vascular function by enhancing vasodilation and inhibiting platelet aggregation, monocyte adhesion, and smooth muscle cell proliferation (Huang, 2003). Dysfunction in endothelial NO production is closely related with atherosclerotic lesion formation (Napoli et al., 2006). On the other hand, the expression of inflammatory genes promotes atherosclerosis. Nuclear factor-kappa B (NF-kB) is considered to be the central transcriptional factor for the induction of endothelial cell inflammation (Collins et al., 1995; De Martin et al., 2000; Choi et al., 2004). In resting situations, the inhibitory protein IkB binds to NF-kB and retains NF-kB in the cytosol. Under stimulation, IkB is degraded and NF-kB is then translocated into the nucleus, where it stimulates the transcription of inflammatory genes (Baeuerle and Baltimore, 1996). Adiponectin/Acrp30 is an adipocyte-derived factor with antidiabetic, and insulin-sensitizing metabolic effects (Berg et al., 2002). It has been reported that adiponectin also exerts vascular-protecting properties by improving endothelial function and having anti-inflammatory effects in
Abbreviations: AdipoR, adiponectin receptor; NF-kB, nuclear factor-kappa B; TNF-α, tumor necrosis factor alpha; HUVEC, human umbilical vein endothelial cell; NO, nitric oxide. ⁎ Corresponding author. E-mail address: [email protected] (Y.-Z. Xu).
the vascular wall. Adiponectin stimulates the production of NO in endothelial cells through phosphatidylinositol 3-kinase-dependent pathway involving phosphorylation of eNOS at Ser1179 by AMPK (Chen et al., 2003). Adiponectin has also been reported to inhibit endothelial NF-kB signaling, and further reduces the expression of adhesion molecules (Ouchi et al., 2000). However, the regulation of adiponectin-inhibited inflammatory response remains to be identified. The physiological effects of adiponectin are mediated by its 2 receptors (AdipoR1 and AdipoR2) (Yamauchi et al., 2003). AdipoR1 and AdipoR2 have been shown to be involved in adiponectin-activated AMP-activated protein kinase (AMPK), peroxisome proliferatoractivated receptor (PPAR)-α, and the p38 mitogen-activated protein kinase (MAPK) pathways (Yamauchi et al., 2003). Overexpression of adiponectin receptors potentiates the anti-inflammatory action of globular adiponectin in vascular endothelial cells (Zhang et al., 2009), indicating a role of adiponectin receptors in mediating the vascularprotecting effects of adiponectin. MicroRNAs (miRNAs) are a class of ~ 22 nucleotide RNAs that regulate gene expression at the post-transcriptional level. MiRNAs silence their target genes by cleaving mRNA molecules or inhibiting their translations and thus regulate various physiological or pathological processes (Bartel, 2004). Evidence showed that miRNAs act as key regulators for endothelial biology and function (Qin et al., 2012). miR126 was reported to inhibit the expression of VCAM-1 and the adherence of leukocyte to endothelial cells (ECs), which provides the first evidence that miRNAs can control vascular inflammation (Harris et al., 2008). miR-221/222 was reported to regulate angiotensin IIinduced endothelial inflammation and migration (Zhu et al., 2011). In
http://dx.doi.org/10.1016/j.gene.2015.04.014 0378-1119/© 2015 Elsevier B.V. All rights reserved.
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
2
C.-F. Chen et al. / Gene xxx (2015) xxx–xxx
this study, we identified AdipoR1 as a direct target for miR-221. Furthermore, our data showed that miR-221 inhibited NO production and activated NF-kB signaling in human endothelial cells.
release was determined by quantitative detection of nitrite (NO2–) and nitrate (NO3–) using Nitric Oxide Assay Kit (Pierce). NO levels were normalized to control group.
2. Materials and methods 2.7. NF-kB activation assay 2.1. Cell culture Human umbilical vein endothelial cells (HUVECs) were purchased from Cascade Biologics and cultured in medium 200 supplemented with low serum growth supplement (Cascade Biologics). 2.2. Bioinformatics analysis To identify putative miRNAs targeting AdipoR1, we queried the online target prediction programs TargetScan (www.targetscan.org) and miRanda (www.microrna.org). In order to improve the likelihood of the candidate miRNAs, we also performed an inverse search by using each candidate miRNA as a bait to identify its potential target genes. Through this approach, miR-221 was identified as one of miRNAs targeting AdipoR1. 2.3. Plasmid construction Wild-type 3′-untranslated region (3′UTR) of AdipoR1 gene containing predicted miR-221 target sites was amplified by PCR using the primer sets AdipoR1-F(GCTCTAGAGCCTTCCCACCTGCGGGGTG)/AdipoR1-R(GCTCTA GAGAAATCTTTGAATGCCAAGTG) from HUVEC cDNAs. Seed sequencedeleted mutant of AdipoR1 3′UTR was generated by overlap-extension PCR method. During the first PCR cycle, the 5′ fragment and 3′ fragment of AdipoR1 3′UTR was amplified using the primer sets AdipoR1-F/ AdipoR1-mut-R(AAAATGGATGGCCTGTTATAAG) and AdipoR1-mutF(ACACTTTTCAAAAACAATTATAT)/AdipoR1-R. The PCR products were mixed and used as the template, and the second PCR cycle was carried out using the primer set AdipoR1-F/AdipoR1-R. Both the wild-type and mutated 3′UTR fragments were cloned into the downstream of firefly luciferase coding region in the XbaI site of pGL3-control plasmid (Promega). Myc-tagged AdipoR1 expression plasmid was constructed as previously reported (Xu et al., 2011).
NF-kB activation was detected as reported previously (Xu et al., 2011). Briefly, HUVECs were transfected with pNFkB-Luc, a cisreporter plasmid containing the luciferase reporter gene linked to five repeats of NF-kB binding sites (Stratagene). After 24 h, HUVECs were treated with or without 10 μg/mL of adiponectin (R&D systems) for 24 h, and then incubated with or without 10 U/mL of TNF-α for 4 h. The luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega).
2.8. RNA isolation, reverse transcription and real-time quantitative PCR (qPCR) Total RNA was isolated using Trizol reagent (Invitrogen) and 2 μg total RNA was used for cDNA synthesis. Real-time quantitative PCR analysis was performed using SYBR Premix Ex Taq (Takara) in an ABI7900 system (Applied biosystem). Primers 5′-TGCCAAAGCTGC TCTAGCCTTG-3′ and 5′-TGTTGTTGCCAGTGTTCAGCCAG-3′ were used for E-selectin amplification. Primers 5′-TCCCCTGGACCCCGGA TTGC-3′ and 5′-AGGGAATGAGTAGAGCTCCACCTG-3′ were used for VCAM-1 amplification. Primers 5′-CGAGCACAGAGCCTCGCCTTT-3′ and 5′-TCATCATCCATGGTGAGCTGGCG-3′ were used for β-actin gene amplification. The expression levels of E-selectin and VCAM-1 were normalized to β-actin.
2.9. Statistical analysis The data were presented as means ± SD from 3 independent experiments. The statistical significance between groups was determined using Student's t test.
2.4. Transfections
3. Results
HUVECs were transiently transfected with 20 nM of the chemically synthesized miR-221 (5′-AGCUACAUUGUCUGCUGGGUUUC-3′), or negative control miRNA (NC: 5′-UUCUCCGAACGUGUCACGU-3′) (Genepharma, Shanghai, China) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's recommendations. After 24-h transfection, cells were used for subsequent experiments.
3.1. miR-221 targets AdipoR1 mRNA
2.5. Immunoblotting Cells were washed with ice-cold phosphate buffered saline and lysed in ice-cold lysis buffer (100 mM Tris–HCl, pH 7.5, 300 mM NaCl, 0.5% NP-40, 1 mM DTT) containing the protease inhibitor cocktail tablets (Sigma). Cell lysates were resuspended in SDS loading buffer, heated at 95 °C for 5 min, and separated by SDS-PAGE. Immunocomplexes were analyzed by Western blot using anti-AdipoR1 antibody (Cell Signaling Technology), anti-IkBα (Cell Signaling Technology), antiphospho-eNOS (Cell Signaling Technology), or anti-eNOS (Cell Signaling Technology). Immunodetection was performed with an enhanced chemiluminescence (ECL) kit (Amersham). 2.6. NO measurement HUVECs transfected with miR-221 were treated with or without adiponectin. The supernatant was then collected for NO detection. NO
To identify potential AdipoR1-targeting miRNAs, we first performed in silico search using publicly available algorithms including TargetScan and MIRanda. miR-221 was identified as a candidate miRNA targeting AdipoR1. Phylogenetic analysis showed that miR-221 is well conserved among different species (Fig. 1A). Six nucleotides in the 3′UTR of the human AdipoR1 mRNA were perfectly complementary to the nucleotides 2–7 of miR-221 (Fig. 1B). To test whether miR-221 targets the 3′UTR of AdipoR1, we applied luciferase assays. The 3′UTR of AdipoR1 gene was cloned to the downstream of the coding sequence of luciferase. The construct was then co-transfected into HUVECs with miR-221 or control RNA. Data showed that miR-221 specifically decreased the luciferase levels. The inhibitory effect of miR-221 was abolished when the miR-221 binding site within the AdipoR1 3′UTR was deleted (Fig. 1B). Next, we employed several approaches to determine whether miR-221 regulates AdipoR1 expression in cells. Overexpression of miR-221 mimics reduced the AdipoR1 mRNA level to about 70% of control group (Fig. 1C). The protein level of AdipoR1 was also significantly reduced when cells were transfected with miR221 mimics (Fig. 1D). These results suggested that miR-221 directly binds to the 3′UTR of AdipoR1 mRNA and reduces AdipoR1 expression.
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
C.-F. Chen et al. / Gene xxx (2015) xxx–xxx
3
Fig. 1. miR-221 down-regulates AdipoR1 expression through direct binding to the 3′UTR of AdipoR1 mRNA. (A) Conservation of predicted binding site of miR-221 within AdipoR1 3′UTRs (hsa, Homo sapiens; mmu, Mus musculus; rno, Rattus norvegicus; cfa, Canis familiaris). (B) HUVECs were transfected with AdipoR1-UTR-Luc (AdipoR1-WT) or seed sequence-deleted mutant (AdipoR1-del), together with miR-221. Luciferase activities were detected 24 h later. Data shown are means ± SD of 3 independent experiments. **Indicates P b 0.01. (C) HUVECs were transfected with or without miR-221 and the mRNA levels of AdipoR1 and AdipoR2 were detected by RT-qPCR. Data shown are means ± SD of 3 independent experiments. *Indicates P b 0.05. (D) HUVECs were transfected with or without miR-221 and the protein levels of AdipoR1 and AdipoR2 were detected by immunoblotting.
3.2. miR-221 inhibits adiponectin-stimulated NO production in endothelial cells Adiponectin was reported to stimulate phosphorylation of eNOS at Ser1179 and NO production in endothelial cells (Chen et al., 2003). The NO-stimulating effect of adiponectin is mediated by adiponectin receptors (Cheng et al., 2007). Therefore, the inhibition of AdipoR1 by miR-221 prompted us to think that miR-221 might affect adiponectinstimulated NO production. This was indeed the case. Adiponectin treatment significantly increased NO production in HUVECs, while expression of miR-221 inhibited NO synthesis (Fig. 2A). Phosphorylation
of eNOS is essential for NO synthesis. Our data showed that adiponectin increased phosphorylation of eNOS at Ser1179 and the phosphorylation level decreased when miR-221 was expressed (Fig. 2B). These data indicated that miR-221 inhibits adiponectin-stimulated eNOS phosphorylation and NO production. To exclude the possibility that the reduced NO production after miRNA-221 expression is due to other miR-221 targets, we performed rescue experiment. AdipoR1 gene without 3′UTR was co-expressed with miR-221 and NO production was then examined. Data showed that reduced NO level by miR-221 was restored after AdipoR1 expression (Fig. 2C). Immunoblotting data showed that the phosphorylation
Fig. 2. miR-221 inhibits adiponectin-stimulated NO production in endothelial cells. (A) HUVECs transfected with or without miR-221 were treated with or without 10 μg/mL of adiponectin for 30 min. NO release in the conditioned medium was measured. Data shown are means ± SD of 3 independent experiments. **Indicates P b 0.01. (B) HUVECs transfected with or without miR-221 were treated with or without 10 μg/mL of adiponectin for 10 min. The phosphorylation of eNOS at Ser1179 was detected by immunoblotting. (C) HUVECs transfected with miR-221 together with or without AdipoR1 gene were treated with 10 μg/mL of adiponectin for 30 min. NO release in the conditioned medium was measured. Data shown are means ± SD of 3 independent experiments. **Indicates P b 0.01, * indicates P b 0.05. (D) HUVECs transfected with miR-221 together with or without AdipoR1 gene were treated with 10 μg/mL of adiponectin for 30 min. The phosphorylation of eNOS at Ser1179 was detected by immunoblotting.
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
4
C.-F. Chen et al. / Gene xxx (2015) xxx–xxx
level of eNOS was decreased in miR-221-expressing group and restored when AdipoR1 was co-expressed (Fig. 2D). These data suggested that miR-221-repressed NO production is specifically mediated by AdipoR1. 3.3. miR-221 activates NF-kB signaling in endothelial cells Adiponectin was reported to inhibit TNF-α-induced NF-kB signaling in endothelial cells (Ouchi et al., 2000). We therefore detected the effect of miR-221 on endothelial NF-kB activation. The activation of NF-kB is controlled by the rapid phosphorylation and degradation of the cytoplasmic inhibitor IkB-α. Therefore, we first determined the effect of miR-221 on the cytoplasmic protein level of IkB-α. Data showed that cytoplasmic IkB-α decreased significantly after TNF-α treatment, while adiponectin pretreatment stabilized IkB-α, indicating an inhibitory role of adiponectin in NF-kB activation. The protein level of IkB-α decreased when miR-221 was expressed (Fig. 3A). Next, we examined the effects of adiponectin and miR-221 on NF-kB activation by using luciferase assays. Data showed that adiponectin treatment decreased the luciferase activity induced by TNF-α stimulation, while miR-221 expression increased luciferase activity (Fig. 3B). These data suggested that miR-221 represses AdipoR1 expression and activates NF-kB signaling in endothelial cells. 3.4. miR-221 promotes the expressions of adhesion molecules in endothelial cells NF-kB activation increases the expression of adhesion molecules in endothelial cells, including endothelial-leukocyte adhesion molecule-1 (E-selectin), and vascular cell adhesion molecule-1 (VCAM-1), which promote monocyte adhesion to arterial endothelium. We therefore detected the effect of miR-221 on adhesion molecule expression. RTqPCR analysis showed that TNF-α treatment increased mRNA levels of E-selectin and VCAM-1, while pretreatment with adiponectin
Fig. 4. miR-221 promotes the expressions of adhesion molecules in endothelial cells. HUVECs transfected with or without miR-221 were pretreated for 24 h with or without 10 μg/mL of adiponectin, and then incubated with 10 U/mL of TNF-α for 4 h. The mRNA levels of E-selectin (A), or VCAM-1 (B) were determined by RT-qPCR analysis. Data shown are means ± SD of 3 independent experiments. **Indicates P b 0.01, *indicates P b 0.05.
significantly suppressed the expressions of those endothelial adhesion molecules (Fig. 4). The inhibitory effect of adiponectin was abolished when miR-221 was overexpressed, suggesting that miR-221 promotes adhesion molecule expression by inhibiting adiponectin signaling. 4. Discussion
Fig. 3. miR-221 activates NF-kB signaling in endothelial cells. (A) HUVECs transfected with or without miR-221 were pretreated for 24 h with or without 10 μg/mL of adiponectin, and then incubated with 10 U/mL of TNF-α for 30 min. The cytoplasmic IkBα level was detected by immunoblotting. (B) HUVECs transfected with pNFkB-Luc together with miR-221 were pretreated for 24 h with or without 10 μg/mL of adiponectin, and then incubated with 10 U/mL of TNF-α for another 4 h. The luciferase activities were then detected. Data shown are means ± SD of 3 independent experiments. **Indicates P b 0.01.
Adiponectin is an abundant plasma protein secreted from adipocytes that have protective effects on the vasculature and myocardium. Adiponectin receptors are expressed in endothelial cells (Motoshima et al., 2004) and have a key role in mediating the vascular effects of adiponectin. However, the mechanism regulating the expression of adiponectin receptors is unclear. In this study, we found that miR-221 directly repressed the expression of adiponectin receptor 1 (AdipoR1). Moreover, we demonstrated that miR-221 inhibited NO synthesis and activated NF-kB signaling. NF-kB signaling pathway is essential for the expression of inflammatory genes and EC pathology (Collins et al., 1995; De Martin et al., 2000; Choi et al., 2004). The effects of adiponectin on NF-kB activation and inflammatory responses in ECs are complicated. A bundle of studies supported that a major effect of adiponectin is the suppression of proinflammatory endothelial responses, which include reversing the
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
C.-F. Chen et al. / Gene xxx (2015) xxx–xxx
activation of NF-kB, reducing adhesion molecule expression, enhancing nitric oxide bioavailability (Goldstein and Scalia, 2004, 2007). However, Hattori et al. reported that the globular adiponectin (gAd), one form of adiponectin, activated NF-kB pathway and inflammatory gene expression in cultured endothelial cells (Hattori et al., 2006, 2007), although it was not clear whether cleavage of adiponectin at sites of inflammation in vivo results in sufficient gAd generation to activate NF-kB. Our data showed that adiponectin treatment inhibited NF-kB activation and its target gene expression, supporting an anti-inflammatory role. Evidence showed that miR-221 regulates multiple aspects of endothelial behaviors. By targeting cyclin dependent kinase inhibitor 1b (cdkn1b) and phosphoinositide-3-kinase regulatory subunit 1 (pik3r1), miR-221 promotes endothelial tip cell proliferation and migration during vascular development (Nicoli et al., 2012). miR-221 also promotes tumor angiogenesis in human hepatocellular carcinoma (Santhekadur et al., 2012). miR-221/222 in human umbilical vein endothelial cells could regulate angiotensin II-induced endothelial inflammation and migration (Zhu et al., 2011). Our data showed that miR-221 targeted AdipoR1 to activate NF-kB signaling and promote the expressions of NF-kB target genes in endothelial cells. Based on the central role of NF-kB in endothelial inflammatory signaling, our data suggested that miR-221 might be involved in regulation of endothelial inflammation in vascular diseases such as atherosclerosis. Interestingly, miR-221 was reported to be a transcriptional target of NF-kB. TNF-α treatment downregulates miR-221 expression (Meerson et al., 2013) and NF-kB can induce miR-221 expression (Galardi et al., 2011). Therefore, miR221 and NF-kB might form a positive feedback loop to enhance the inflammatory response. Adiponectin signaling also plays important roles in glucose/fat metabolism and muscle cell function. Evidence showed that miR-221 repressed AdipoR1 translation in muscle cells. The expression of miR221 was reduced, which resulted in up-regulation of AdipoR1 during muscle cell differentiation, indicating that miR-221 is involved in muscle differentiation by targeting AdipoR1 (Lustig et al., 2014). Lustig et al. showed that AdipoR1 mRNA did not change significantly after the overexpression of miR-221 in HepG2 cells, suggesting that miR211 acts at the translational level. However, our data showed that overexpression of miR-221 mimics reduced the AdipoR1 mRNA level in HUVECs. The discrepancy might be due to different cell types (Lustig et al., 2014). miR-221 also participates in glucose/fat metabolism. Obese mice showed high miR-221 levels and low AdipoR1 levels (Lustig et al., 2014). miR-221 overexpression upregulated several proteins involved in fat metabolism, mimicking peroxisome proliferatoractivated receptor (PPAR) activation (Meerson et al., 2013). All these data support that miR-221 indeed inhibits AdipoR1 expression and suggest that miR-221 regulates AdipoR1 signaling in different pathological processes. Adiponectin protects the vascular system partly through stimulation of endothelial nitric oxide (NO) production and endothelium-dependent vasodilation (Chen et al., 2003). Adiponectin receptors mediate the endothelium actions of adiponectin, since adiponectin-induced phosphorylation of eNOS at Ser1177 and NO production was abrogated when expression of adiponectin receptors were suppressed (Cheng et al., 2007). Our study presented evidence that miR-221 inhibited AdipoR1 expression thereby further inhibited adiponectin-stimulated eNOS phosphorylation and NO production (Fig. 2). In agreement with our data, miR-221 was reported to be up-regulated in senescent human aortic endothelial cells (Rippe et al., 2012). Evidence also showed that miR-221 was negatively associated with eNOS level in endothelial cells (Suarez et al., 2007; Rippe et al., 2012). Therefore, miR-221 might regulate NO production by reducing eNOS phosphorylation or eNOS expression. In summary, we have identified AdipoR1 as a direct target of miR221. Furthermore, miR-221 inhibits NO production and abolishes the inhibitory effect of adiponectin on NF-kB activation in human umbilical
5
vein endothelial cells. These results indicated that miR-221 targets AdipoR1 to regulate endothelial inflammatory response.
Acknowledgments The work was supported by grants from the National Natural Science Foundation of China (30971187), the Natural Science Foundation of Zhejiang Province (Y206937), and the Hangzhou Science and Technology Development Program (20120533Q03, 20090833B01).
References Baeuerle, P.A., Baltimore, D., 1996. NF-kappa B: ten years after. Cell 87, 13–20. Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297. Berg, A.H., Combs, T.P., Scherer, P.E., 2002. ACRP30/adiponectin: an adipokine regulating glucose and lipid metabolism. Trends Endocrinol. Metab. 13, 84–89. Chen, H., Montagnani, M., Funahashi, T., Shimomura, I., Quon, M.J., 2003. Adiponectin stimulates production of nitric oxide in vascular endothelial cells. J. Biol. Chem. 278, 45021–45026. Cheng, K.K., Lam, K.S., Wang, Y., Huang, Y., Carling, D., Wu, D., Wong, C., Xu, A., 2007. Adiponectin-induced endothelial nitric oxide synthase activation and nitric oxide production are mediated by APPL1 in endothelial cells. Diabetes 56, 1387–1394. Choi, J., Enis, D.R., Koh, K.P., Shiao, S.L., Pober, J.S., 2004. T lymphocyte-endothelial cell interactions. Annu. Rev. Immunol. 22, 683–709. Collins, T., Read, M.A., Neish, A.S., Whitley, M.Z., Thanos, D., Maniatis, T., 1995. Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa B and cytokineinducible enhancers. FASEB J. 9, 899–909. De Martin, R., Hoeth, M., Hofer-Warbinek, R., Schmid, J.A., 2000. The transcription factor NF-kappa B and the regulation of vascular cell function. Arterioscler. Thromb. Vasc. Biol. 20, E83–E88. Galardi, S., Mercatelli, N., Farace, M.G., Ciafre, S.A., 2011. NF-kB and c-Jun induce the expression of the oncogenic miR-221 and miR-222 in prostate carcinoma and glioblastoma cells. Nucleic Acids Res. 39, 3892–3902. Gimbrone Jr., M.A., Topper, J.N., Nagel, T., Anderson, K.R., Garcia-Cardena, G., 2000. Endothelial dysfunction, hemodynamic forces, and atherogenesis. Ann. N. Y. Acad. Sci. 902, 230–239 (discussion 239–40). Goldstein, B.J., Scalia, R., 2004. Adiponectin: a novel adipokine linking adipocytes and vascular function. J. Clin. Endocrinol. Metab. 89, 2563–2568. Goldstein, B.J., Scalia, R., 2007. Adipokines and vascular disease in diabetes. Curr. Diab. Rep. 7, 25–33. Harris, T.A., Yamakuchi, M., Ferlito, M., Mendell, J.T., Lowenstein, C.J., 2008. MicroRNA-126 regulates endothelial expression of vascular cell adhesion molecule 1. Proc. Natl. Acad. Sci. U. S. A. 105, 1516–1521. Hattori, Y., Hattori, S., Kasai, K., 2006. Globular adiponectin activates nuclear factorkappaB in vascular endothelial cells, which in turn induces expression of proinflammatory and adhesion molecule genes. Diabetes Care 29, 139–141. Hattori, Y., Hattori, S., Akimoto, K., Nishikimi, T., Suzuki, K., Matsuoka, H., Kasai, K., 2007. Globular adiponectin activates nuclear factor-kappaB and activating protein-1 and enhances angiotensin II-induced proliferation in cardiac fibroblasts. Diabetes 56, 804–808. Huang, P.L., 2003. Endothelial nitric oxide synthase and endothelial dysfunction. Curr. Hypertens. Rep. 5, 473–480. Lustig, Y., Barhod, E., Ashwal-Fluss, R., Gordin, R., Shomron, N., Baruch-Umansky, K., Hemi, R., Karasik, A., Kanety, H., 2014. RNA-binding protein PTB and microRNA-221 coregulate AdipoR1 translation and adiponectin signaling. Diabetes 63, 433–445. Meerson, A., Traurig, M., Ossowski, V., Fleming, J.M., Mullins, M., Baier, L.J., 2013. Human adipose microRNA-221 is upregulated in obesity and affects fat metabolism downstream of leptin and TNF-alpha. Diabetologia 56, 1971–1979. Motoshima, H., Wu, X., Mahadev, K., Goldstein, B.J., 2004. Adiponectin suppresses proliferation and superoxide generation and enhances eNOS activity in endothelial cells treated with oxidized LDL. Biochem. Biophys. Res. Commun. 315, 264–271. Napoli, C., de Nigris, F., Williams-Ignarro, S., Pignalosa, O., Sica, V., Ignarro, L.J., 2006. Nitric oxide and atherosclerosis: an update. Nitric Oxide 15, 265–279. Nicoli, S., Knyphausen, C.P., Zhu, L.J., Lakshmanan, A., Lawson, N.D., 2012. miR-221 is required for endothelial tip cell behaviors during vascular development. Dev. Cell 22, 418–429. Ouchi, N., Kihara, S., Arita, Y., Okamoto, Y., Maeda, K., Kuriyama, H., Hotta, K., Nishida, M., Takahashi, M., Muraguchi, M., Ohmoto, Y., Nakamura, T., Yamashita, S., Funahashi, T., Matsuzawa, Y., 2000. Adiponectin, an adipocyte-derived plasma protein, inhibits endothelial NF-kappaB signaling through a cAMP-dependent pathway. Circulation 102, 1296–1301. Qin, B., Yang, H., Xiao, B., 2012. Role of microRNAs in endothelial inflammation and senescence. Mol. Biol. Rep. 39, 4509–4518. Rippe, C., Blimline, M., Magerko, K.A., Lawson, B.R., LaRocca, T.J., Donato, A.J., Seals, D.R., 2012. MicroRNA changes in human arterial endothelial cells with senescence: relation to apoptosis, eNOS and inflammation. Exp. Gerontol. 47, 45–51. Santhekadur, P.K., Das, S.K., Gredler, R., Chen, D., Srivastava, J., Robertson, C., Baldwin Jr., A.S., Fisher, P.B., Sarkar, D., 2012. Multifunction protein staphylococcal nuclease domain containing 1 (SND1) promotes tumor angiogenesis in human hepatocellular carcinoma through novel pathway that involves nuclear factor kappaB and miR221. J. Biol. Chem. 287, 13952–13958. Suarez, Y., Fernandez-Hernando, C., Pober, J.S., Sessa, W.C., 2007. Dicer dependent microRNAs regulate gene expression and functions in human endothelial cells. Circ. Res. 100, 1164–1173.
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
6
C.-F. Chen et al. / Gene xxx (2015) xxx–xxx
Xu, Y., Zhang, C., Wang, N., Ling, F., Li, P., Gao, Y., Hua, W., 2011. Adiponectin inhibits lymphotoxin-beta receptor-mediated NF-kappaB signaling in human umbilical vein endothelial cells. Biochem. Biophys. Res. Commun. 404, 1060–1064. Yamauchi, T., Kamon, J., Ito, Y., Tsuchida, A., Yokomizo, T., Kita, S., Sugiyama, T., Miyagishi, M., Hara, K., Tsunoda, M., Murakami, K., Ohteki, T., Uchida, S., Takekawa, S., Waki, H., Tsuno, N.H., Shibata, Y., Terauchi, Y., Froguel, P., Tobe, K., Koyasu, S., Taira, K., Kitamura, T., Shimizu, T., Nagai, R., Kadowaki, T., 2003. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423, 762–769.
Zhang, P., Wang, Y., Fan, Y., Tang, Z., Wang, N., 2009. Overexpression of adiponectin receptors potentiates the antiinflammatory action of subeffective dose of globular adiponectin in vascular endothelial cells. Arterioscler. Thromb. Vasc. Biol. 29, 67–74. Zhu, N., Zhang, D., Chen, S., Liu, X., Lin, L., Huang, X., Guo, Z., Liu, J., Wang, Y., Yuan, W., Qin, Y., 2011. Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis 215, 286–293.
Please cite this article as: Chen, C.-F., et al., MicroRNA-221 regulates endothelial nitric oxide production and inflammatory response by targeting adiponectin receptor 1, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.04.014
