Mol Cell Biochem (2014) 387:227–239 DOI 10.1007/s11010-013-1888-z

MicroRNA expression signature for Satb2-induced osteogenic differentiation in bone marrow stromal cells Yiming Gong • Fei Xu • Ling Zhang • Yanyan Qian • Jake Chen • Huijun Huang Youcheng Yu

•

Received: 2 August 2013 / Accepted: 5 November 2013 / Published online: 12 November 2013 Ó Springer Science+Business Media New York 2013

Abstract Satb2 acts as a potent transcription factor to promote osteoblast differentiation and bone regeneration. Recently, microRNAs (miRNA) have been identified as critical regulators of osteogenic differentiation. This study aimed to identify specific miRNAs and their regulatory roles in the process of Satb2-induced osteogenic differentiation. We studied the differentially expressed miRNAs by Satb2 overexpression in murine bone marrow stromal cells using miRNA microarray. Ten down-regulated miRNAs including miR-27a, miR-125a-5p, and miR-466f-3p, and 18 up-regulated miRNAs including miR-17, miR-20a and miR-210 were found to be differentially expressed and their expression were verified by quantitative real time PCR. The differentially expressed miRNAs were further subjected to gene ontology and KEGG analysis. The highly enriched GOs and KEGG pathway showed target genes of these miRNAs were significantly involved in multiple biological processes (mesenchymal cell differentiation, bone formation, and skeletal development), and several osteogenic pathways (TGF-b/BMP, MAPK, and Wnt

Y. Gong  Y. Yu (&) Department of Stomatology, Zhongshan Hospital, Fudan University, 180 Fenglin Road, Shanghai, China e-mail: [email protected] F. Xu  Y. Qian  H. Huang Department of Biochemistry and Molecular Biology, Shanghai Medical College, Fudan University, Shanghai, China L. Zhang Fusen Laboratory, Fusen Biological Technology Co., Ltd, Shanghai, China J. Chen Division of Oral Biology, Tufts School of Dental Medicine, Boston, MA, USA

signaling pathway). Finally, miR-27a was selected for target verification and function analysis. BMP2, BMPR1A, and Smad9, members of the TGF-b/BMP superfamily, which were predicted to be target genes of miR-27a, were confirmed to be significantly up-regulated in Satb2-overexpressing cells by quantitative real time PCR. Overexpression of miR-27a significantly inhibited osteogenesis and repressed BMP2, BMPR1A, and Smad9 expression. In this study, we identified that a number of differentially regulated miRNAs, whose target genes involved in the TGF-b/BMP signaling pathway, play an important role in the early stage of Satb2-induced osteogenic differentiation. Keywords Osteogenic differentiation  MicroRNA  Satb2  Bone marrow stromal cell  Transforming growth factor b  BMP

Introduction Bone marrow stromal cells (BMSCs), a potential cell source capable of differentiating into several mesenchymal cell types including osteoblasts and chondrocytes, are considered ideal seed cells in bone tissue engineering approach [1]. To maximize the capacity of BMSCs to regenerate bone, the combination of gene therapies and BMSCs could be an optimal clinic strategy for tissue repair, where BMSCs are genetically modified to express higher levels of some specific factors that have the potential to accelerate osteogenesis in bone defects; these factors include growth factors such as bone morphogenic proteins (BMP) and transcription factors such as Runx2 and Osterix [2–4]. Satb2 is a member of the special family of AT-rich binding transcription factors that play a pivotal role in craniofacial patterning and osteoblast differentiation [5–7].

123

228

Satb2 interacts with nuclear matrix attachment regions and activates gene transcription. Satb2-/- mice exhibit both craniofacial defects that resemble those observed in human carrying a translocation in SATB2 and defects in osteoblast differentiation and function. Satb2 works as a protein scaffold to increase the activity of Runx2 and ATF4, two transcription factors that play essential roles in inducing osteogenic differentiation [6]. The overexpression of Satb2 significantly promotes osteogenic differentiation and accelerates bone tissue regeneration [5, 8, 9], indicating that Satb2 can be served as a potent osteo-inductive factor in bone regeneration. MicroRNAs (miRNAs) are the key negative regulators of diverse biological processes, including cell growth, cell differentiation, and apoptosis [10, 11]. Initial evidence indicates that specific miRNAs control osteogenic differentiation in part by regulating master transcription factors and signaling pathways linked to the respective lineages. Some of these miRNAs, including miR-30, miR-133, and miR-204/211, have been identified to inhibit osteogenesis by targeting the bone-specific transcription factor Runx2 [12–14]. Recent studies indicated that Satb2 is involved in the regulatory network of the miR cluster 23a*27a*24-2 that controls the progression and maintenance of the osteocyte phenotype [15]. A Runx2, Satb2, and miR-31 regulatory mechanism was shown to play an important role in inducing BMSCs osteogenic differentiation [16]. In addition, miR-34s were also found to inhibit osteoblast proliferation and differentiation in the mouse by directly targeting Satb2 [17]. These findings suggest that specific miRNAs play a critical role in the process of Satb2-induced osteogenic differentiation. However, systemic research on the roles of specific miRNAs in the Satb2induced osteogenic differentiation is still obscure. In this study, we studied the differentially expressed miRNAs by Satb2 overexpression in murine BMSCs using miRNA microarray. The target genes of the selected differentially expressed miRNAs were also analyzed in the gene ontology (GO) and KEGG biological pathway. We identified a number of differentially regulated miRNAs, whose target genes involved in the TGF-b/BMP signaling pathway, play an important role in the early stage of Satb2induced osteogenic differentiation. Further study of these miRNAs may elucidate the mechanism of Satb2-induced osteogenic differentiation, and thus provide basis for bone tissue engineering applications.

Mol Cell Biochem (2014) 387:227–239

All procedures were approved by the Animal Research Committee of Zhongshan Hospital, Fudan University, Shanghai, China. Briefly, mice were sacrificed by cervical dislocation, and the tibias and femurs were dissected under aseptic conditions. Using a syringe containing 10 ml of icecold a-MEM (Invitrogen, Carlsbad, CA, USA) containing 10 % fetal bovine serum (FBS) and 1 % penicillin/streptomycin, the bone marrow was flushed, homogenized, and filtered through a 70 lm cell strainer. The filtered cell suspension was centrifuged at 5009g for 5 min, and the cell pellet was re-suspended and plated in 75 cm2 culture flasks. After 3 days, medium was replaced, and the hematopoietic cells that did not adhere to the flasks were removed. The cultured cells were harvested when they became confluent (*2 weeks). The cells were detached with trypsin/ethylenediaminetetraacetic acid (EDTA) and subcultured till the third passage for further analyses. The characteristics of BMSCs were validated using flow cytometry as previously described [19]. Lentivirus production and transduction The Satb2 coding sequence was amplified from mouse genomic DNA by PCR using primers 50 -GAAGGAGGAAA GAGAAAGGAAGAC-30 (forward) and 50 -TCATTTATCT CGTGGGTCTTCC-30 (reverse). The amplified Satb2 gene was cloned into the pTA2 vector and transferred into the lentiviral vector pCDH-CMV-MCS-EF1-copGFP using in vitro recombination to generate the recombinant lentiviral expression vector LV-Satb2. Recombinant lentiviruses were produced in 293T cells co-transfected with LV-Satb2 [20], the packaging plasmids pCDH-PACK-GAG, pCDH-PACKREV, and VSV-G using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The empty lentiviral vector LV-GFP was also packaged and used as a control. The virus-containing supernatant was filtered and stored at -80 °C. For transduction, BMSC cultures at the third passage were incubated with lentiviral particles in 8 lg/ml polybrene (SigmaAldrich, Basel, Switzerland). After 24 h, transduction medium was changed with fresh a-MEM containing 10 % FBS. The expression of GFP was examined under a fluorescent microscope, and the intensity of green fluorescence indicated transduction efficiency. Induction of osteogenic differentiation

Materials and methods Isolation, purification, and culture of BMSCs Primary BMSCs from bone marrow were harvested from C57BL6 mice using methods described previously [18].

123

The untransduced BMSCs and the BMSCs transduced with the Satb2 or GFP lentiviral particles were plated in normal media in six-well plates at 3 9 103 cells/cm2 and cultured at 37 °C. After 24 h, cells were resuspended in osteogenic differentiation medium (Saiye, Guangzhou, China) containing 50 lg/ml ascorbic acid, 10 nM dexamethasone, and

Mol Cell Biochem (2014) 387:227–239

5 mM b-glycerophosphate, and used for study 7 and 14 days post inoculation. The osteogenic differentiation medium was changed every 3 days. Alkaline phosphatase (ALP) staining and Alizarin Red S staining Alkaline phosphatase (ALP) staining was implicated as a marker of osteoblast differentiation which is expressed early in the process. After cells were cultured in the osteogenic supplements for 7 days, ALP staining was performed using an ALP detection kit (Beyotime, Shanghai, China). Cells were washed twice in PBS, fixed in 10 % formalin for 30 min, incubated in NBT/BCIP solution for 30 min at room temperature, and then rinsed with water. Alizarin Red S staining was performed to detect the calcification at late stage of induction. Cells cultured for 14 days in the differentiation medium were washed with PBS, fixed in 10 % formalin for 30 min, washed with PBS, and stained with the Alizarin Red solution [1 g Tris base and 0.1 g alizarin red (Sigma-Aldrich, USA) in 100 ml distilled water] for 30 min at room temperature. Cells were photographed after washed with water for two times. miRNA microarray and computational analysis At day 7 after osteogenic stimulation, total RNA was isolated from control BMSCs and the BMSCs transduced with the Satb2 lentiviral particles. Total RNA was purified using the mirVanaTM miRNA isolation kit (Ambion, Austin, TX, USA) following the manufacturer’s instructions. AffymetrixÒ GeneChip miRNA array analysis was performed to examine the expression of miRNAs by Gimix (Shanghai, China). Oligo-nucleotide hybridization was detected using an AffymetrixÒ scanner and graphs were generated using the GCOS1.4 software. Data were analyzed with the miRNA QC tool using the default parameters. Genes with changes in expression levels of C1.5-fold than those of the controls were defined as differentially expressed genes. GO analysis and KEGG pathway annotation based on miRNA expression profile The target genes of differentially expressed miRNAs between the BMSCs transduced with Satb2 lentiviral particles and untransduced BMSCs were selected from the Sanger database using bioinformatics tools (http://micron. sangerac.uk/) [21]. The top 25 % target genes that have been assigned the highest numbers of miRNA interaction sites were selected. These genes were subjected to GO term analysis and grouped into hierarchical categories to uncover the miRNA-gene regulatory network based on biological processes and molecular functions. Meanwhile,

229

KEGG pathway annotation was also performed for these genes using the DAVID gene annotation tool (http://david. abcc.ncifcrf.gov/) [22]. Chi square test and two-sided Fisher’s exact test were performed to classify the GO categories and KEGG pathways, and the false discovery rate (FDR) was calculated to correct the P value. P value \0.01 and FDR \ 0.05 were used as the thresholds to select significant GO categories. For a significant GO category, the enrichment Re was calculated using Re = (nf/n)/(Nf/N), where nf is the number of flagged genes within the particular category, n is the total number of genes within the same category, Nf is the number of flagged genes in the entire microarray, and N is the total number of genes in the microarray. Quantitative real time PCR (qRT-PCR) analysis Cultured cells were lysed in TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The total RNA was extracted and reverse transcribed into cDNA using the One Step PrimeScriptÒ miRNA cDNA Synthesis Kit (Takara, Dalian, China). A SYBER Premix TaqTM II kit (Takara, Dalian, China) was used for qRT-PCR, which were performed in a 25 ll reaction volume using the ABI PRISM 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA) following the recommended protocol for SYBR green. Relative transcript levels were measured and normalized with GAPDH levels. All primers used for qRT-PCR are listed in Table 1. To confirm the miRNA expression profiles obtained using miRNA microarray analysis, the expressions of miRNAs were also examined using qRT-PCR. The expression levels were normalized to that of U6, which was used as an internal control. Relative expression of a specific gene was calculated using the comparative Ct method. Western blot analysis For Western blot analysis, whole cell lysates were extracted using lysis buffer (50 mM Tris–HCl pH 7.6, 150 mM NaCl, 1 mM EDTA, 10 % glycerol, and 0.5 % NP-40) containing protease inhibitors (Sigma, USA). Protein lysates were resolved on 10 % SDS-PAGE gels and transferred to nitrocellulose membranes. The membranes were incubated in primary anti-Satb2 antibody (Abcam, USA), anti-BMP2 antibody (Abcam, USA), anti-BMPR1A antibody (Abcam, USA), or anti-Smad9 antibody (Abcam, USA), followed by horseradish peroxidase-conjugated secondary antibody (Santa Cruz, USA) according to the manufacturers’ instructions. The signals were developed with the SuperSignal West Pico chemiluminescent substrate (Pierce, Rockford, IL, USA) according to the manufacturer’s instruction.

123

230

Mol Cell Biochem (2014) 387:227–239

Table 1 The sequences of the primers for qRT-PCR in the experiment

miRNA transfection assay

Primer

We selected miR-27a for target verification and functional analysis. To construct a lentiviral vector for miR-27a, 307 nt pre-miRNA encompassing the stem-loop was PCR amplified from mouse genomic DNA using primers AAAGCTAGCT CACAAATCACATTGCCAG (forward) and AAAGGATC CCAACTGTGTTTCAGCTCAGTA (reverse). The PCR product was digested with NheI and BamHI, and then subcloned into the lentiviral vector pCDH -CMV-MCS-EF1copGFP. BMSCs at the third passage were transfected according to the manufacturer’s protocol as described above. miRNA negative control was also transfected. Cells were harvested 72 h after transfection for protein and mRNA analysis. To examine the effect of miR-27a on differentiation, BMSCs transfected with miR-27a and the negative control were cultured in osteogenic differentiation medium. ALP staining and Alizarin Red S staining were performed at 7 and 14 days after inoculation, respectively.

Satb2 Runx2 ALP OPN OCN BMP2 BMPR1A Smad9 Bambi AcvR1b

Sequence Sense

TGCCTCTAGCAGTCCCAGCTCC

Anti-sense

CGTTGGCGCCGTCCACCTTA

Sense

TCGCACTGGCGGTGCAACAA

Anti-sense

AGGCATTTCGGAGCTCGGCG

Sense

CCAACTCTTTTGTGCCAGAGA

Anti-sense

GGCTACATTGGTGTTGAGCTTTT

Sense Anti-sense

AGCAAGAAACTCTTCCAAGCAA GTGAGATTCGTCAGATTCATCCG

Sense

GCGCTCTGTCTCTCTGACCT

Anti-sense

GCCGGAGTCTGTTCACTACC

Sense

TCTTCCGGGAACAGATACAGG

Anti-sense

TGGTGTCCAATAGTCTGGTCA

Sense

TGCAAGGATTCACCGAAAGC

Anti-sense

TGCCATCAAAGAACGGACCTAT

Sense

CTGCATCAACCCATACCATTACC

Anti-sense

CTGCGGAAACACATGGCCT

Sense

GATCGCCACTCCAGCTACTTC

Anti-sense

GCAGGCACTAAGCTCAGACTT

Sense

TTCTTCCCCCTTGTTGTCCTC

Anti-sense

ACAGGTGTAGTTGGTCTGTAGG

Smad6

Sense

TCCGAAGTCCGCTCGGTAG

GAPDH

Anti-sense Sense

TCACCGTCTCGCAGTCACT AGGTCGGTGTGAACGGATTTG

Anti-sense

GGGGTCGTTGATGGCAACA

Fig. 1 Satb2-overexpressing BMSCs induced by recombinant lentiviruses transduction. a Fluorescence microscopy analysis for GFP expression. GFP could initially be detected in cells 48 h after transduction and more than 80 % of the cells transduced with LVSatb2 and LV-GFP showed green fluorescent by fluorescence microscopy. b Western blot and c qRT-PCR showed increased Satb2

123

Statistical analysis Data are presented as mean ± SD. Student’s t test was performed to compare two groups. ANOVA was used for multiple comparisons. In both cases, differences with P \ 0.05 were considered statistically significant.

expression at day 3 after gene transduction in cells transduced with Satb2. Data are expressed as mean ± SE of each group of cells from three separate experiments. *P \ 0.05, compared to BMSCs and LVGFP group. BMSC bone marrow stromal cells, qRT-PCR quantitative real time PCR. (Color figure online)

Mol Cell Biochem (2014) 387:227–239

231

Fig. 2 Satb2 overexpression increased the expression of genes involved in osteogenic differentiation. Data are expressed as mean ± SE of each group of cells from three separate experiments. *P \ 0.05, compared to BMSCs and LV-GFP group. **P \ 0.05, compared to BMSCs group

Fig. 3 Increased ALP staining and Alizarin Red S staining in Satb2overexpressing BMSCs after osteogenic differentiation. BMSCs w/o OS BMSCs without osteogenic supplements (OS), BMSCs ? OS

BMSCs with OS, LV-GFP ? OS BMSCs with OS plus GFP, LVSatb2 ? OS BMSCs with OS plus Satb2, ALP alkaline phosphatase, w/o without

Results

whereas Satb2 was undetectable in cells transduced with GFP (Fig. 1b, c).

Gene transduction Recombinant lentivirus transduced BMSCs were analyzed for GFP expression with fluorescent microscopy. GFP was initially detected in cells 48 h after transduction and more than 80 % of BMSCs showed green fluorescence (Fig. 1a). Western blot and qRT-PCR analyses confirmed the exogenous expression of Satb2 in cells transduced with Satb2,

Satb2 promotes the osteogenic differentiation of BMSCs The expression of genes involved in osteogenic differentiation was determined by qRT-PCR. Satb2-overexpressing cells showed higher mRNA levels of Runx2, ALP, OPN, and OCN when compared with the controls (Fig. 2). There

123

232

Mol Cell Biochem (2014) 387:227–239

Fig. 4 Ten down-regulated and 18 up-regulated miRNAs were differentially expressed between Satb2-overexpressing BMSCs and untransduced cells after 7 days of osteogenic stimulation from miRNA microarrays analysis

was a significant increase in the ALP staining (day 7) and Alizarin Red S staining (day 14) of the Satb2-overexpressing cells cultured with osteogenic supplements as compared to the controls (Fig. 3). miRNA expression during Satb2-induced osteogenic differentiation Microarray hybridization identified 28 miRNAs that were differentially expressed during Satb2-induced osteogenic differentiation. Ten miRNAs were down-regulated and 18 miRNAs were up-regulated in Satb2-overexpressing BMSCs when compared with untransduced cells (Fig. 4). qRT-PCR showed that all 10 down-regulated miRNAs and 16 of the 18 up-regulated miRNAs were differentially expressed in Satb2-overexpressing BMSCs, except for miR-2134 and miR-720 due to non-efficient amplification (Ct values were higher than 35) (Fig. 5). The less than 10 % discrepancy between these two methods further confirmed the effectiveness of using microarray for screening differentially expressed miRNAs. GO category and KEGG pathway analyses The top 30 highly enriched GOs targeted by the up-regulated miRNAs were regulators of neuron differentiation, neuron development, and neurogenesis, indicating the potential for neurogenic differentiation of BMSCs was inhibited in Satb2-overexpressing BMSCs after 7 day’s osteogenic stimulation (Table 2). In contrast, the highly enriched GOs subjected to down-regulation of miRNAs

123

Fig. 5 qRT-PCR confirmation of miRNA expression between the cells transduced with LV-Satb2 and untransduced. a Ten miRNAs were validated to be significantly down-regulated in Satb2-overexpressing BMSCs. b Sixteen of 18 miRNAs were validated to be significantly up-regulated in Satb2-overexpressing BMSCs except for miR-2134 and miR-720. Data are expressed as mean ± SE of each group of cells from three separate experiments. *P \ 0.05, compared to BMSCs and LV-GFP group. miRNA microRNA

represented mesenchymal cell differentiation, bone formation, and skeletal development as well as BMP signaling pathway and transforming growth factor-b (TGF-b) receptor signaling pathway (Table 3). A separate functional analysis by KEGG pathway revealed that these target genes were highly enriched in 32 up-regulated and 24 down-regulated signaling pathways (Fig. 6). Many of these signal transduction pathways, such as TGF-b, MAPK, Wnt, hedgehog, and VEGF pathway, were previously shown to participate in the osteogenic differentiation of BMSCs as well as other cellular processes, including cell proliferation, differentiation, and cell cycle control.

Mol Cell Biochem (2014) 387:227–239

233

Table 2 Up-regulated microRNAs target significant GO in Satb2-induced osteogenic differentiation by GO analysis Category ID

Category name

Enrichment

P value

FDR

GO:0021954

Central nervous system neuron development

5.680135

0.001224

0.028959

GO:0006473

Protein amino acid acetylation

5.206790

0.001958

0.041358

GO:0043524

Negative regulation of neuron apoptosis

4.820000

4.77E-04

0.01267

GO:0043543

Protein amino acid acylation

4.462963

0.001877

0.040085

GO:0021700

Developmental maturation

3.711771

9.38E-05

0.003243

GO:0048469

Cell maturation

3.570370

0.001826

0.039826

GO:0045664

Regulation of neuron differentiation

3.412854

4.05E-04

0.011049

GO:0050767

Regulation of neurogenesis

2.840067

0.001299

0.030373

GO:0009952

Anterior/posterior pattern formation

2.800290

5.96E-04

0.015624

GO:0048812

Neuron projection morphogenesis

2.738636

3.15E-04

0.009062

GO:0045165 GO:0032990

Cell fate commitment Cell part morphogenesis

2.732426 2.652516

0.001192 1.33E-04

0.028537 0.004232

GO:0048858

Cell projection morphogenesis

2.651265

2.01E-04

0.005974

GO:0031175

Neuron projection development

2.579511

1.93E-04

0.005900

GO:0030900

Forebrain development

2.565536

0.001465

0.033464

GO:0006325

Chromatin organization

2.295238

1.31E-04

0.004242 0.007307

GO:0048666

Neuron development

2.292618

2.50E-04

GO:0043066

Negative regulation of apoptosis

2.240818

0.001587

0.035794

GO:0030182

Neuron differentiation

2.214703

3.96E-05

0.001673

GO:0043069

Negative regulation of programmed cell death

2.194900

0.002012

0.042060

GO:0045893

Positive regulation of transcription, DNA-dependent

2.188568

3.73E-05

0.001639

GO:0060548

Negative regulation of cell death

2.185941

0.002117

0.043351

GO:0051254

Positive regulation of RNA metabolic process

2.172898

4.31E-05

0.001782

GO:0048699

Generation of neurons

2.155153

9.26E-06

5.75E-04

GO:0030030

Cell projection organization

2.098572

8.94E-04

0.021972

GO:0010628

Positive regulation of gene expression

2.085155

3.42E-05

0.001602

GO:0051173 GO:0007417

Positive regulation of nitrogen compound metabolic process Central nervous system development

2.036333 2.031918

3.44E-05 6.67E-04

0.001578 0.017042

GO:0010557

Positive regulation of macromolecule biosynthetic process

1.970440

8.78E-05

0.003087

GO:0045595

Regulation of cell differentiation

1.942429

0.001311

0.030322

TGF-b/BMP signaling pathway were differentially expressed during Satb2-induced osteogenic differentiation Among all these differentially regulated GOs and KEGG pathways, TGF-b/BMP signaling pathway appeared to be significantly enriched in both bioinformatics analyses. Thus, we selected three under-expressed miRNAs (miR27a, miR-125a-5p, and miR-466f-3p) and three overexpressed miRNAs (miR-17, miR-20a, and miR-210) for target prediction. Of these, miR-27a, miR-125a-5p, and miR-466f-3p were predicted to have target site in the 30 UTR of Satb2 using the miRNA target prediction algorithms TargetScan. miR-17, miR-20a, and miR-210 are closely related to osteogenic differentiation, which have been confirmed by several studies [23–26]. We observed that a group of osteo-genes in the TGF-b/ BMP superfamily was predicted to be target genes of these

differentially expressed miRNAs (Table 4). Among them, BMP2, BMPR1A, and Smad9, which are positive regulators in osteoblast differentiation, were confirmed to be significantly up-regulated in Satb2-overexpressing cells by qRT-PCR; while Bambi, AcvR1b, and Smad6, which are negative regulators of the TGF-b/BMP superfamily, were shown to be significantly down-regulated (Fig. 7). Inhibition of osteogenic differentiation by miR-27a miR-27a is confirmed as the conserved site at position 19-25 of Satb2 30 UTR by Targetscan (http://genes.mit.edu/ targetscan), PicTar (http://pictar.mdc-berlin.de), and miRanda (http://www/microrna.org). Meanwhile, miR-27a was predicted to target BMP2, BMPR1a, and Smad9, which are involved in TGF-b/BMP signaling pathway. To study whether BMP2, BMPR1A, and Smad9 were targets for miR-27a and identify whether miR-27a could influence

123

234

Mol Cell Biochem (2014) 387:227–239

Table 3 Down-regulated microRNAs target significant GO in Satb2-induced osteogenic differentiation by GO analysis Category ID

Category name

GO:0002763

Positive regulation of myeloid leukocyte differentiation

9.783267

0.001264

0.020149

GO:0030878

Thyroid gland development

9.084462

0.001715

0.025656

GO:0045639

Positive regulation of myeloid cell differentiation

7.122218

3.33E-04

0.006477

GO:0031346

Positive regulation of cell projection organization

6.635607

0.001709

0.025717

GO:0030509

BMP signaling pathway

6.359123

0.00209

0.030472

GO:0002761

Regulation of myeloid leukocyte differentiation

6.139843

7.81E-04

0.013324

GO:0021983

Pituitary gland development

6.139843

7.81E-04

0.013324

GO:0060021

Palate development

5.814056

3.56E-04

0.006779

GO:0045637

Regulation of myeloid cell differentiation

4.987548

1.44E-04

0.003096

GO:0048704

Embryonic skeletal system morphogenesis

4.769343

3.46E-05

9.32E-04

GO:0007179 GO:0021536

Transforming growth factor beta receptor signaling pathway Diencephalon development

4.769343 4.68567

5.04E-04 0.003366

0.009244 0.046050

GO:0060485

Mesenchyme development

4.578569

6.70E-04

0.011757

GO:0014031

Mesenchymal cell development

4.329616

0.002219

0.031957

GO:0007178

Transmembrane receptor protein serine/threonine kinase signaling pathway

4.239416

4.83E-05

0.001236

GO:0035270

Endocrine system development

4.239416

1.06E-04

0.002417

GO:0048762

Mesenchymal cell differentiation

4.152897

0.002833

0.039744

GO:0045927

Positive regulation of growth

4.088008

0.001443

0.022548

GO:0006469

Negative regulation of protein kinase activity

3.990038

0.003569

0.048007

GO:0033673

Negative regulation of kinase activity

3.990038

0.003569

0.048007

GO:0001656

Metanephros development

3.947042

0.001818

0.027019

GO:0051216

Cartilage development

3.913307

2.20E-04

0.004539

GO:0048706

Embryonic skeletal system development

3.677565

3.83E-04

0.007189

GO:0050678

Regulation of epithelial cell proliferation

3.633785

0.003097

0.042669

GO:0009953

Dorsal/ventral pattern formation

3.577007

0.00342

0.046532

GO:0001822

Kidney development

3.565864

7.37E-05

0.001745

GO:0045597 GO:0001655

Positive regulation of cell differentiation Urogenital system development

3.488433 3.484451

3.62E-07 4.35E-06

1.65E-05 1.57E-04

GO:0048732

Gland development

3.357101

2.23E-07

1.12E-05

GO:0048705

Skeletal system morphogenesis

3.326311

4.92E-05

0.001247

osteogenic differentiation, overexpression of miR-27a was transfected into BMSCs (Fig. 8a). Western blot showed that transfection with miR-27a decreased the protein expression of BMP2, BMPR1A, and Smad9 when compared with transfection with negative control (Fig. 8b), suggesting that BMP2, BMPR1A, and Smad9 may be target site of miR-27a. For functional analysis, the osteogenic induction was conducted 3 days after transfection. At day 7 post the induction of differentiation, ALP staining was significantly lower in cells transduced with miR-27a than in cells transduced with negative control (Fig. 8c). Alizarin Red S staining also decreased at day 14. Consistently, miR-27aoverexpressing cells showed lower mRNA levels of Runx2, ALP, OPN, and OCN when compared with the controls (Fig. 9).

123

Enrichment

P value

FDR

Discussion In this study, we used miRNA microarray technique to profile miRNA expression in Satb2-overexpressing BMSCs after 7 days of osteogenic stimulation. Among these differentially expressed miRNAs, miR-27a, and miR-125a-5p were predicted to target Satb2 in the 30 UTR by in silico analysis. Satb2 has been validated as a direct target gene of miR27a by luciferase assay [15]. Hassan et al. [15] demonstrated that miR-27a is an early negative regulator of osteogenic differentiation in MC3T3-E1 cells, which delays osteoblast differentiation through down-regulation of Satb2. Schoolmeesters et al. [27] showed that miR-27a is essential for the regulation of osteogenesis, and can down-regulate osteogenic differentiation of human BMSCs

Mol Cell Biochem (2014) 387:227–239

235

Fig. 6 KEGG pathway analysis for putative target gene. a Pathway probably upregulated by enrichment miRNAs in Satb2overexpressing BMSCs. b Pathway probably downregulated by enrichment miRNAs in Satb2overexpressing BMSCs. The vertical axis is the pathway category, and the horizontal axis is the enrichment of pathways. P value of\0.001 and a FDR of \0.05 were used as a threshold to select significant KEGG pathways. IgP is the negative logarithm of the P value

through repression of GCA, PEX7, and APL. Conversely, Wang et al. [28] reported that miR-27 is a positive regulator of osteoblast differentiation by modulating Wnt signaling through accumulation of b-catenin. These inconsistent results may come from different experimental design and approach: First, Wang et al. used human fetal osteoblastic 1.19 cell line, while we and other authors used BMSCs or MC3T3-E1 cells. Second, the study of Wang et al. showed an increased miR-27 level in osteoblast cultured in differentiation medium for 3 days, while we and Schoolmeesters et al. performed miRNA analysis at day 6 or 7 post the induction of differentiation. Interestingly, Hassan et al. [15] showed a temporal expression

pattern for the miR-23a*27a*24-2 cluster with very low expression from the osteoprogenitor to the mature osteoblast up to day 12, and maximum expression during the mineralization stage. Our findings are partly consistent with the results of Hassan et al. and Schoolmeesters et al. Furthermore, the functional analysis showed that miR-27aoverexpressing BMSCs significantly decreased ALP staining at day 7 and Alizarin Red S staining at day 14 post the induction of osteogenic differentiation. The expression of genes involved in osteogenic differentiation was also down-regulated. These data indicated that miR-27a is a negative regulator in the early stage of osteogenic differentiation. The attenuation of miR-27a in Satb2-

123

236

Mol Cell Biochem (2014) 387:227–239

Table 4 Predicted target genes of differentially expressed miRNAs in the ‘‘TGF-b/BMP signaling pathway’’ gene ontology group miRNA

Target genes

Function

mmu-miR27a

BMP2,5, BMPR1A

Osteogenesis, signal transduction

Smad1, 9

Osteogenesis, signal transduction

TGFBR1

Receptor for growth and differentiation factor

AcvR1c

Receptor for growth and differentiation factor

mmu-miR125a-5p

BMPR2

Intracellular signaling cascade

Smad2, 4

Osteogenesis

mmu-miR446f-3p

BMPR1B,

BMP receptor

TGFBR1,

Receptor for growth and differentiation factor

Smad6, 7,

Osteogenesis, signal transduction

mmu-miR20a

mmu-miR-17

mmu-miR210

MAPK3

Cell cycle control, apoptosis

BMP2

Osteogenesis

Bambi

Negatively regulates TGF-b/BMP signaling

Smad5, 6, 7

Osteogenesis, signal transduction

AcvR1b

Receptor for growth and differentiation factor

BMP2, BMPR2

Osteogenesis, signal transduction

Bambi

Negatively regulates TGF-b/BMP signaling

Smad6, 7

Osteogenesis, signal transduction

AcvR1b

Receptor for growth and differentiation factor

AcvR1b

Receptor for growth and differentiation factor

Fig. 7 Six osteo-genes in the TGF-b/BMP superfamily which were predicted to be target genes of the differentially expressed miRNAs were confirmed to be significantly regulated in Satb2-overexpressing cells by qRT-PCR. Data are expressed as mean ± SE of each group of cells from three separate experiments. *P \ 0.05, compared to BMSCs and LV-GFP group

123

overexpressing cells can be due to the regulatory network between Satb2 and miR-27a, which may play an essential role in the process of Satb2-induced osteogenic differentiation. The miR-125 family is represented by miR-125a and miR-125b, which differs by two nucleotides at positions 14 and 15. miR-125a and miR-125b are significantly downregulated during osteogenic differentiation in human adipose-derived stem cells [29]. miR-125b is an osteo-miR inhibiting osteoblastic differentiation by the down-regulation of cell proliferation [30]. In keeping with previous studies, our data showed miR-125-5p was significantly down-regulated in Satb2-induced osteogenic differentiation, but their exact function merits further investigation. miR-210 is a positive regulator of osteoblastic differentiation and inhabits the activity of AcvR1b and the TGFb/activin signaling pathway [23]. miR-20a promotes osteogenic differentiation of human BMSCs in a co-regulatory pattern by targeting PPARc, Bambi, and Crim1, the negative regulators of BMP signaling [25]. miR-17 has been reported to regulate osteoblast differentiation in human periodontal ligament tissue-derived mesenchymal stem cells. Under normal conditions, miR-17 negatively regulates osteogenic differentiation, but in a chronic inflammatory microenvironment, miR-17 induces osteogenic differentiation [26]. In this study, miR-210, miR-17, and miR-20a were detected up-regulated in the early stage of Satb2-induced osteogenic differentiation, possibly indicating their positive regulatory role in this process. In this study, the main obstacle to further investigate the regulatory role of these differentially miRNAs was the insufficient annotation of their functions. Bioinformatics analysis will be helpful in overcoming this problem. Abundant high-enrichment GOs of target genes regulated by differential miRNAs might involve several biological processes such as mesenchymal cell differentiation, bone formation, and skeletal development as well as BMP signaling pathway, and TGF-b receptor signaling pathway. In accordance with the GO assay, specific KEGG pathways targeted by deregulation miRNAs were found involved in TGF-b, MAPK, Wnt, hedgehog, and VEGF pathway. Among those, the TGF-b/BMP signaling pathway is of interest, as it has been reported to play a prominent role in promoting osteoblast differentiation and bone formation [31]. Our results are therefore supportive of a critical role for this pathway in Satb2-induced osteogenic differentiation. Using online software, putative targets of six differentially expressed miRNAs involving in the TGF-b/BMP signaling pathway were classified according to their contribution in osteogenic differentiation (Table 4). We found that some key regulators of osteogenesis such as BMP2, BMPR1A, BMPR1B, Smad1, 6, 7, 9, Bambi, and AcvR1b

Mol Cell Biochem (2014) 387:227–239

237

Fig. 8 Function analysis of miR-27a in the osteogenic differentiation of BMSCs. a miR-27a-overexpressing BMSCs showed increased expression of miR-27a by qRTPCR. Data are expressed as mean ± SE of each group of cells from three separate experiments. *P \ 0.05, compared to negative control. b Western blot analysis showed decreased protein expression of BMP2, BMPR1A, and Smad9 in miR-27a-overexpressing BMSCs at day 3 after gene transduction. c Decreased ALP staining and Alizarin red S staining in miR-27aoverexpressing BMSCs after osteogenic differentiation Fig. 9 Down-regulated mRNA levels of Runx2, ALP, OPN, and OCN after osteogenic differentiation in miR-27aoverexpressing BMSCs. Data are expressed as mean ± SE of each group of cells from three separate experiments. *P \ 0.05, compared to negative control

which function as positive/negative regulator of osteogenesis and signal transduction mediators are included. BMP2 is a member of the TGF-b/BMP superfamily and plays a key regulatory role as a cell–cell signaling molecule during bone formation and repair. BMP receptors (BMPRs) including BMPR1A, BMPR1B, and BMPR2 are also involved in endochondral bone formation and embryogenesis. BMPs bind to BMP receptor complex to regulate cellular functions including cell differentiation and growth via the phosphorylation of Smad 1/5/8. P-Smad 1/5/ 8 proteins then translocate to the nucleus and act as transcription factors to induce the expression of BMP-

responsive genes [31]. In this study, BMP2, BMPR1A, and Smad9, which were predicted to be target gene of miR-27a, were confirmed to be significantly up-regulated in Satb2overexpressing cells by qRT-PCR. In the functional analysis, we further confirmed that overexpression of miR-27a decreased protein expression of BMP2, BMPR1A, and Smad9 when compared with negative control, suggesting that the negative regulatory role of miR-27a in the early stage of Satb2-induced osteogenic differentiation may be through directly targeting BMP2, BMPR1A, and Smad9. Further functional studies are needed to clarify this hypothesis.

123

238

Mol Cell Biochem (2014) 387:227–239

Bambi, a pseudo-receptor of TGF-b/BMP superfamily, can inactivate ligand–receptor complexes and antagonize BMP signaling, which is demonstrated as a target gene of miR-20a to potentially inhibit osteogenic differentiation [25, 32, 33]. AcvR1b is predicted to be target gene of miR17, miR-20a, and miR-210. As a type I receptor, AcvR1b transmits signals from activin together with the type II receptor AcvRII. Previous study has indicated that miR210 promotes osteoblastic differentiation by inhibition of TGF-b/activin signaling pathway through targeting of AcvR1b [23]. Smad6 is involved in a negative feedback loop regulating BMP signaling and is required to limit BMP signaling during endochondral bone formation [31]. Our data showed that Bambi, AcvR1b, and Smad6, which are negative regulators of the TGF-b/BMP superfamily, were significantly down-regulated in Satb2-induced osteogenic differentiation. It can be supposed that these upregulated miRNAs might positively regulate Satb2-induced osteogenic differentiation by inhibiting these negative regulators of TGF-b/BMP superfamily. In summary, our findings suggest that a number of the differentially regulated miRNAs, whose target genes involved in the TGF-b/BMP signaling pathway, play an important role in the early stage of Satb2-induced osteogenic differentiation. We hope our results will facilitate our understanding of the mechanism of Satb2-induced osteogenic differentiation, and subsequently provide high performance seed cells for tissue-engineered bone regeneration. Acknowledgments This work was supported by a grant from Major Scientific and Technological Research Projects of Science and Technology Commission of Shanghai Municipality (No. 10JC1402600). Conflict of interest

All authors have no conflicts of interest.

References 1. Dennis JE, Haynesworth SE, Young RG, Caplan AI (1992) Osteogenesis in marrow-derived mesenchymal cell porous ceramic composites transplanted subcutaneously: effect of fibronectin and laminin on cell retention and rate of osteogenic expression. Cell Transplant 1:23–32 2. Franceschi RT (2005) Biological approaches to bone regeneration by gene therapy. J Dent Res 84:1093–1103 3. Partridge K, Yang X, Clarke NM, Okubo Y, Bessho K, Sebald W, Howdle SM, Shakesheff KM, Oreffo RO (2002) Adenoviral BMP-2 gene transfer in mesenchymal stem cells: in vitro and in vivo bone formation on biodegradable polymer scaffolds. Biochem Biophys Res Commun 292:144–152 4. Samee M, Kasugai S, Kondo H, Ohya K, Shimokawa H, Kuroda S (2008) Bone morphogenetic protein-2 (BMP-2) and vascular endothelial growth factor (VEGF) transfection to human periosteal cells enhances osteoblast differentiation and bone formation. J Pharmacol Sci 108:18–31 5. Zhang J, Tu Q, Grosschedl R, Kim MS, Griffin T, Drissi H, Yang P, Chen J (2011) Roles of SATB2 in osteogenic differentiation and bone regeneration. Tissue Eng A 17:1767–1776

123

6. Dobreva G, Chahrour M, Dautzenberg M, Chirivella L, Kanzler B, Farin˜as I, Karsenty G, Grosschedl R (2006) SATB2 is a multifunctional determinant of craniofacial patterning and osteoblast differentiation. Cell 125:971–986 7. Kim IS, Jeong SJ, Kim SH, Jung JH, Park YG, Kim SH (2012) Special AT-rich sequence-binding protein 2 and its related genes play key roles in the differentiation of MC3T3-E1 osteoblast like cells. Biochem Biophys Res Commun 17:697–703 8. Ye JH, Xu YJ, Gao J, Yan SG, Zhao J, Tu Q, Zhang J, Duan XJ, Sommer CA, Mostoslavsky G, Kaplan DL, Wu YN, Zhang CP, Wang L, Chen J (2011) Critical-size calvarial bone defects healing in a mouse model with silk scaffolds and SATB2-modified iPSCs. Biomaterials 32:5065–5076 9. Yan SG, Zhang J, Tu QS, Ye JH, Luo E, Schuler M, Kim MS, Griffin T, Zhao J, Duan XJ, Cochran DJ, Murray D, Yang PS, Chen J (2011) Enhanced osseointegration of titanium implant through the local delivery of transcription factor SATB2. Biomaterials 32:8676–8683 10. Stefani G, Slack FJ (2008) Small non-coding RNAs in animal development. Nat Rev Mol Cell Biol 9:219–230 11. Guo L, Zhao RC, Wu Y (2011) The role of microRNAs in selfrenewal and differentiation of mesenchymal stem cells. Exp Hematol 39:608–616 12. Zhang Y, Xie RL, Croce CM, Stein JL, Lian JB, van Wijnen AJ, Stein GS (2011) A program of microRNAs controls osteogenic lineage progression by targeting transcription factor Runx2. Proc Natl Acad Sci USA 108:9863–9868 13. Wu T, Zhou H, Hong Y, Li J, Jiang X, Huang H (2012) miR-30 family members negatively regulate osteoblast differentiation. J Biol Chem 287:7503–7511 14. Huang J, Zhao L, Xing L, Chen D (2010) MicroRNA-204 regulates Runx2 protein expression and mesenchymal progenitor cell differentiation. Stem Cells 28:357–364 15. Hassan MQ, Gordon JA, Beloti MM, Croce CM, van Wijnen AJ, Stein JL, Stein GS, Lian JB (2010) A network connecting Runx2, SATB2, and the miR-23a*27a*24-2 cluster regulates the osteoblast differentiation program. Proc Natl Acad Sci USA 107:19879–19884 16. Deng Y, Wu S, Zhou H, Bi X, Wang Y, Hu Y, Gu P, Fan X (2013) Effects of a miR-31, Runx2, and Satb2 regulatory loop on the osteogenic differentiation of bone mesenchymal stem cells. Stem Cells Dev 22:2278–2286 17. Wei J, Shi Y, Zheng L, Zhou B, Inose H, Wang J, Guo XE, Grosschedl R, Karsenty G (2012) miR-34s inhibit osteoblast proliferation and differentiation in the mouse by targeting SATB2. J Cell Biol 197:509–521 18. Zhao Z, Zhao M, Xiao G, Franceschi RT (2005) Gene transfer of the Runx2 transcription factor enhances osteogenic activity of bone marrow stromal cells in vitro and in vivo. Mol Ther 12:247–253 19. Suomi S, Taipaleenma¨ki H, Seppa¨nen A, Ripatti T, Va¨a¨na¨nen K, Hentunen T, Sa¨a¨ma¨nen AM, Laitala-Leinonen T (2008) MicroRNAs regulate osteogenesis and chondrogenesis of mouse bone marrow stromal cells. Gene Regul Syst Biol 2:177–191 20. Tiscornia G, Singer O, Verma IM (2006) Design and cloning of lentiviral vectors expressing small interfering RNAs. Nat Protoc 1:234–240 21. Gene Ontology Consortium (2006) The Gene Ontology (GO) project in 2006. Nucleic Acids Res 34:D322–D326 22. Dennis G Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA (2003) DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol 4:P3 23. Mizuno Y, Tokuzawa Y, Ninomiya Y, Yagi K, Yatsuka-Kanesaki Y, Suda T, Fukuda T, Katagiri T, Kondoh Y, Amemiya T, Tashiro H, Okazaki Y (2009) miR-210 promotes osteoblastic differentiation through inhibition of AcvR1b. FEBS Lett 583:2263–2268

Mol Cell Biochem (2014) 387:227–239 24. Zhou M, Ma J, Chen S, Chen X, Yu X (2013) MicroRNA-17-92 cluster regulates osteoblast proliferation and differentiation. Endocrine (Epub ahead of print) 25. Zhang JF, Fu WM, He ML, Xie WD, Lv Q, Wan G, Li G, Wang H, Lu G, Hu X, Jiang S, Li JN, Lin MC, Zhang YO, Kung HF (2011) miRNA-20a promotes osteogenic differentiation of human mesenchymal stem cells by co-regulating BMP signaling. RNA Biol 8:829–838 26. Liu Y, Liu W, Hu C, Xue Z, Wang G, Ding B, Luo H, Tang L, Kong X, Chen X, Liu N, Ding Y, Jin Y (2011) MiR-17 modulates osteogenic differentiation through a coherent feed-forward loop in mesenchymal stem cells isolated from periodontal ligaments of patients with periodontitis. Stem Cells 29:1804–1816 27. Schoolmeesters A, Eklund T, Leake D, Vermeulen A, Smith Q, Force Aldred S, Fedorov Y (2009) Functional profiling reveals critical role for miRNA in differentiation of human mesenchymal stem cells. PLoS ONE 4:e5605 28. Wang T, Xu Z (2010) miR-27 promotes osteoblast differentiation by modulating Wnt signaling. Biochem Biophys Res Commun 402:186–189

239 29. Zhang ZJ, Zhang H, Kang Y, Sheng PY, Ma YC, Yang ZB, Zhang ZQ, Fu M, He AS, Liao WM (2012) miRNA expression profile during osteogenic differentiation of human adiposederived stem cells. J Cell Biochem 113:888–898 30. Mizuno Y, Yagi K, Tokuzawa Y, Kanesaki-Yatsuka Y, Suda T, Katagiri T, Fukuda T, Maruyama M, Okuda A, Amemiya T, Kondoh Y, Tashiro H, Okazaki Y (2008) miR-125b inhibits osteoblastic differentiation by down-regulation of cell proliferation. Biochem Biophys Res Commun 368:267–272 31. Chen G, Deng C, Li YP (2012) TGF-b and BMP signaling in osteoblast differentiation and bone formation. Int J Biol Sci 8:272–288 32. Liu DD, Zhang JC, Zhang Q, Wang SX, Yang MS (2013) TGF-b/ BMP signaling pathway is involved in cerium-promoted osteogenic differentiation of mesenchymal stem cells. J Cell Biochem 114:1105–1114 33. Gazzerro E, Canalis E (2006) Bone morphogenetic proteins and their antagonists. Rev Endocr Metab Disord 7:51–65

123