Rev. Neurosci. 2014; 25(5): 675–686

Néstor F. Díaz, Mónica S. Cruz-Reséndiz, Héctor Flores-Herrera, Guadalupe García-López and Anayansi Molina-Hernández*

MicroRNAs in central nervous system development Abstract: During early and late embryo neurodevelopment, a large number of molecules work together in a spatial and temporal manner to ensure the adequate formation of an organism. Diverse signals participate in embryo patterning and organization synchronized by time and space. Among the molecules that are expressed in a temporal and spatial manner, and that are considered essential in several developmental processes, are the microRNAs (miRNAs). In this review, we highlight some important aspects of the biogenesis and function of miRNAs as well as their participation in ectoderm commitment and their role in central nervous system (CNS) development. Instead of giving an extensive list of miRNAs involved in these processes, we only mention those miRNAs that are the most studied during the development of the CNS as well as the most likely mRNA targets for each miRNA and its protein functions. Keywords: corticogenesis; miR-124; small noncoding RNAs. DOI 10.1515/revneuro-2014-0014 Received February 17, 2014; accepted May 13, 2014; previously published online June 5, 2014

Introduction MicroRNAs (miRNAs) are a class of small noncoding RNAs of about 22 nucleotides that regulate gene expression in *Corresponding author: Anayansi Molina-Hernández, Departamento de Biología Celular, Instituto Nacional de Perinatología, Montes Urales 800, Colonia Lomas de Virreyes, Miguel Hidalgo, CP 11000, México, e-mail: anayansimolina@gmail. com; [email protected] Néstor F. Díaz, Mónica S. Cruz-Reséndiz and Guadalupe GarcíaLópez: Departamento de Biología Celular, Instituto Nacional de Perinatología, Montes Urales 800, Colonia Lomas de Virreyes, Miguel Hidalgo, CP 11000, México Héctor Flores-Herrera: Departamento de Inmunobioquímica, Instituto Nacional de Perinatología, Montes Urales 800, Colonia Lomas de Virreyes, Miguel Hidalgo, CP 11000, México

a variety of organisms by means of base pairing to one or more mRNAs. miRNAs are expressed in almost all cell types of living organisms, and more than 1000 have been reported in humans. Approximately 70% are expressed in the central nervous system (CNS) (Krichevsky et al., 2003; Miska et al., 2004; Sempere et al., 2004; Ji et al., 2013). It has been estimated that miRNAs regulate the translation of more than 60% of the genes that encode proteins. It is expected that they are involved in the regulation of processes such as cell proliferation, differentiation, apoptosis, and migration. All of these events are important during early embryo and CNS development (Krichevsky et  al., 2003; Wienholds and Plasterk, 2005; Wienholds et al., 2005; Fiore et al., 2008; Nielsen et al., 2009). In 1993, two different research groups reported lossof-function mutations in lin-4, a heterochronic gene, that affects the timing of developmental events that specify the temporal fates of cells during larval development in Caenorhabditis elegans (Chalfie et  al., 1981). lin-4 was in fact a small noncoding molecule that posttranscriptionally regulated lin-14 by direct base-pairing interaction to an element repeated seven times in the 3′-untranslated region (3′-UTR) of lin-14 mRNAs, which encodes a protein essential for the transition from larval stage 1–2 in the development of this nematode (Lee et al., 1993; Wightman et  al., 1993). Following these studies, it was reported as a novel mechanism of control translational (antisense), since there was no evidence for other genes that could regulate mRNA translation via antisense interaction with the 3′-UTR. It was the first report of a general mechanism for regulating gene expression that we know now is carried out by miRNAs and started to identify several properties later recognized as common to all miRNAs, such as the identification of a long form of these molecules (premiRNA) and a small one (mature miRNA) (Lee et al., 1993; Wightman et al., 1993; Lee and Ambros, 2001; Lagos-Quintana et al., 2003). In general, miRNAs are classified into families by the homology of their ‘seed’ sequence. This implies that members of a same family contain the same sequence from the second to the eighth nucleotide of the mature sequence (Table 1) (Bartel 2009). Furthermore, the miRNA

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

676      N.F. Díaz et al.: miRNAs and neural development Table 1 Seed miRNA sequences from an miRNA family. miRNA

 

miR-17-5p   miR-20a-5p   miR-93-5p   miR-106b-5p  

Mature sequence

 

CAAAGUGCUUACAGUGCAGGUAG   UAAAGUGCUUAUAGUGCAGGUAG   CAAAGUGCUGUUCGUGCAGGUAG   UAAAGUGCUGACAGUGCAGAU  

Family miR-17/92

Mature sequences of some of the miRNAs from the miR-17/92 family are shown. Seed sequence is highlighted in red. The miRNAs sequences in the table are identical in mice and humans.

sequence that binds to the 3′-UTR of its mRNA target is commonly conserved among mammals, which could suggest common targets among species. However, a single miRNA can have several targets with a wide range of functions depending on the timing and spatial expression (Lewis et al., 2003; Liu et al., 2008; Gao, 2010; Barca-Mayo and De Pietri Tonelli, 2014). Another important feature of miRNAs is that, unlike most RNAs, they are extremely stable when subjected to adverse conditions such as boiling, extreme pH, extended storage, and freeze-thaw cycles, etc (Chen et  al., 2008). They have been detected in various body fluids, such as urine, saliva, amniotic fluid, plasma, serum, and pleural fluid (Cortez et  al., 2011). miRNAs show change in their profiles of expression depending on the physiological state of the organism (Liu et al., 2008; Barca-Mayo and De Pietri Tonelli, 2014). Taking together all of these properties, it has been proposed that miRNAs can serve as biomarkers in physiological and/or pathological conditions (Chen et  al., 2008; Cortez and Calin, 2009; Boeri et  al., 2011; Greene and Copp, 2012; Gu et al., 2012). In this review, we will focus on aspects regarding miRNAs biogenesis, inactivation, and function as well as its participation during CNS development.

miRNA biosynthesis The biogenesis of miRNAs begins in the nucleus and ends in the cytoplasm, where they perform their function. There are two main pathways for miRNA synthesis: (a) the canonical pathway and (b) the noncanonical pathway (Ruby et al., 2007; Qureshi and Mehler, 2012). In the canonical pathway, miRNAs are transcribed by RNA polymerase II, which produces a long RNA molecule of up to 1 kb nucleotides in length, known as primary miRNA (pri-miRNA). These large immature miRNA products contain 7-ethylguanosine ends and polyadenosines at the 5′ and 3′, respectively. The

pri-miRNA structure forms a ‘Harping-stem-loop’ (forkstem-loop) that is cut in its core by the endonuclease RNase III, known as Drosha, in association with DiGeorge syndrome critical region gene 8 (DGCR8) protein in mammalians, while, in Drosophila melanogaster and C. elegans, it is associated with Pasha (Borchert et al., 2006; Han et al., 2006). Drosha asymmetrically cuts both strands at sites close to the base of the forked primary structure, yielding a premiRNA of between 60 and 70 nucleotides in length (Lee et al., 2003; Han et al., 2006). The pre-miRNA is exported to the cytoplasm in an active manner through exportin-V, which is RAN-dependent guanosine triphosphate (GTP). Once in the cytoplasm, the pre-miRNA is released from the complex, and the molecule is cut by the endonuclease RNase III, called Dicer (Hutvagner et  al., 2001). In mammalians, Dicer forms a complex with transactivation response RNA-binding protein (TRBP), a double-stranded RNA binding protein that is required for the recruitment of Argonaut protein (Ago1-4) to the miRNA (Chendrimada et al., 2005). Once the pre-miRNA is processed, a doublestranded molecule known as miRNA duplex originates. Both of the chains of the pre-miRNA have affinity for Argo proteins, and its binding leads to miRNA maturation. However, only the mature chain can be incorporated into the ribonucleoprotein complex known as RNA silencing complex [RISC; of which Dicer, Ago (1–4), and TRBP are the major components] (Frank et al., 2010; Ghildiyal et al., 2010). At this moment, miRNAs can be responsible for the degradation and/or the translational inhibition of its mRNA target (Figure 1). On the contrary, at least two noncanonical or alternative pathways have been reported for the synthesis of miRNAs. One involves the generation of miRNAs in the nuclei, independent of Drosha/DGCR8 processing, which is more common in D. melanogaster and C. elegans. It is also reported in vertebrates, as is Dicer-independent biosynthesis in the cytosol described for erythrocyte maturation in mice (Du and Zamore, 2005; Berezikov et al., 2007; Ruby et al., 2007; Cheloufi et al., 2010; Chung et al., 2011). In independent Drosha/DGCR8 biosynthesis, a shorter sequence that mimics a pre-miRNA called mirtron is synthesized. The mirtron is generated using alternative RNA processing machinery, so that a short fragment of the mRNA is spliced from an intron region. The splicing generates a nonlinear intermediate, which must be debranched by a lariat debranching enzyme before the hairpin structure can be adopted. After this processing, the mirtron mimics a pre-miRNA and enters the canonical biogenesis pathway (Berezikov et al., 2007; Ruby et al., 2007) (Figure 1).

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

N.F. Díaz et al.: miRNAs and neural development      677

Canonical (pri-miRNA)

Non-canonical (mirton)

pri-miRNA us c le Nu m las top Cy

pre-miRNA DROSHA

DGCR8 Ex

po

rtin

V

pre-miRNA RISC

Dicer/TRBP

AAAAAAAA duplex-miRNA

RISC

Figure 1 Biosynthesis of miRNAs. miRNA transcription can be carried out by activation of its own promoter (intergenic) or the host gene promoter (intragenic). In the canonical pathway, the first product of transcription is called pri-miRNA, which is processed by Drosha/DGCR8 in the nucleus to yield pre-miRNA, whereas, in the noncanonical pathway, a mirtron is generated (by splicing). In both cases, they were exported to the cytoplasm through the exportin-V. Once in the cytosol, the miRNA complex is cut by Dicer/TRBP to yield miRNA duplex (pre-miRNA). One or both strands are associated with Argonaut protein (Argo) and the RISC to carry out its function.

Dicer-independent biosynthesis has only been reported for miR-451 in vertebrates. The maturation of premiRNA is due to the loading and cleaving of the pre-miRNA by the catalytic center of Ago, to generate an intermediate 3′-end, and further trimmed by a nonidentified nuclease that originates the mature miR-451 (Cheloufi et al., 2010; Cifuentes et al., 2010; Yang et al., 2010) (Figure 1). Although the genes encoding miRNAs are not well described, it is considered that, in the noncanonical pathway, the promoter of the host gene is used, while, in the canonical pathway, its own promoter for miRNAs transcription is used. Finally, it is important to mention that miRNAs can be derived from other RNAs such as small nuclear RNAs or transfer RNA (Yang and Lai, 2011).

miRNA function The main function of miRNAs is to repress the translation of their target mRNAs. As mentioned above, the first miRNAs were identified as key regulators of developmental timing in C. elegans by switching off a few mRNA targets (Lee et al., 1993; Reinhart et al., 2000). The targeted mRNAs that are subject to this type of regulation have multiple miRNA binding sites in their 3′-UTRs to facilitate the radical inhibition of translation through the cooperative actions of several miRNAs (Doench and Sharp, 2004).

Thus, it has been postulated that miRNAs can regulate specific targets selectively or that several miRNAs can regulate the same target in a cooperative way, functioning as master regulators for key processes. Although the miRNA action mechanism remains elusive, some models by which miRNAs can repress mRNA translation have been proposed. One involves the binding of the miRNA-RISC to its mRNA target once it has started translation (translational repression) (Olsen and Ambros, 1999). The second model considers that the miRNA-RISC cleaves directly to its mRNA target before the initiation of translation (Yekta et al., 2004). Furthermore, independently of the mechanisms of translation inhibition, the target mRNA can be bound to the miRNAs-RISC, which is captured by P-bodies (small cytoplasmic foci that contain most enzymes required for mRNA degradation) for its degradation or storage (Bhattacharyya et al., 2006). At least two proteins that are associated with RISC are essential for P-body formation: Rck (RNA helicase) and GW182 (TNRC6A in human), whose main function is to target Ago proteins to P-bodies (for review, see Kulkarni et al., 2010). As mentioned above, mature miRNAs can be classified into families based on shared bases of the second through the eighth nucleotides of the 5′-end. This is known as the heptameter seed sequence (Table 1) (Kozomara and Griffiths-Jones, 2011). Although it has been suggested that the target specificity for miRNA is given by the seed sequence,

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

678      N.F. Díaz et al.: miRNAs and neural development it is also known that, in some cases, the 3′-end is additionally involved in target selectivity (Bartel 2009; Friedman et al., 2009). The binding site of the miRNA to its mRNA target generally occurs at the 3′-UTR. In plants, the binding is generally perfect (Llave et al., 2002; Rhoades et al., 2002), whereas, in animals, the binding occurs in a partial manner (Lee et  al., 1993; Olsen and Ambros, 1999; Zeng et  al., 2002). The way that the miRNA interacts with its target determines the fate of the mRNA, since it has been reported that perfect complementarity promotes degradation, while multiple binding sites and partial complementarity inhibit translation without affecting mRNA levels strongly (Valencia-Sanchez et al., 2006) (Figure 2). As mentioned above, among the functions involving miRNAs are proliferation (Nielsen et  al., 2009; Delaloy et al., 2010), differentiation (Choi et al., 2008; Cheng et al., 2009; Zhao et  al., 2009), death (Cimmino et  al., 2005; Nan et  al., 2010), and cell maintenance – the processes involved in prenatal and postnatal and adult CNS development (Kapsimali et  al., 2007) and in the maintenance of physiological or pathological conditions such as pregnancy and cancer (Gilad et  al., 2008; Cortez and Calin, 2009). An interesting aspect of an miRNA function is the possible effect on different cells where they were synthesized. An evidence of this is the presence of pre-miRNAs and mature miRNAs in peripheral blood, both free and associated with exosomes (Gilad et al., 2008; Cortez and Calin, 2009). The mechanism by which the miRNAs reach the plasma, and the impact of these as a molecule capable of acting at sites distant from the cells in which they were

A

B

RISC

Cap

AAAAAAAA

synthesized, is unclear. It has been suggested that premiRNA is associated with multivesicular bodies (MVB), which are introduced in exosomes and released by exocytosis into the circulatory system. In the bloodstream, exosomes reach their target cells by endocytosis. In the target cell, the miRNA is released and matured to exert its function (Taylor and Gercel-Taylor, 2008; Cortez and Calin, 2009; Rabinowits et al., 2009) (Figure 3). Another interesting aspect of the miRNA is its spatiotemporal expression profile. In most cases, it is assumed that genes that transcribe identical or similar miRNAs necessarily have overlapping functions. However, this is not necessarily true. Indeed, expression domains constitute a strategy for the functional diversity of these molecules. The examples of miRNAs with identical sequences but synthesized from different genes are the miR-13b-1 (chromosome 3R) and miR-13b-2 (chromosome X) from D. melanogaster (Aboobaker et  al., 2005). These genes are differentially expressed in the CNS and muscle/intestine, respectively. These miRNAs have completely different mRNA targets and functions (Aboobaker et al., 2005). Another example is miR-124 that is encoded by three loci for the hairpin miR-124 precursors in mammals, which in turn encodes conserved sequences (chromosomes 14, 3, and 2) between species (Griffiths-Jones et al., 2006).

CNS development and miRNAs Our understanding of human preimplantation development, and the underlying regulatory mechanisms of

RISC

AAAAAAAA

Cap

RISC

RISC

Cap

Cap

AAAAAAAA

AAAAAAAA

Target mRNA degradation =

Inhibition of the translation of mRNA= no changes in mRNA levels

in mRNA levels

Reduction in protein translation =

in protein level

Figure 2 Functions of miRNAs. (A) The target mRNA is degraded by perfect complementarity with the miRNA-RISC. (B) A partial complementarity to its target promotes translation repression. Modified from Bartel (2004).

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

N.F. Díaz et al.: miRNAs and neural development      679

pri-miRNA

DROSHA

DGCR8

Ex

po

Nuc

Cyt

Endocytosis

Exosomes

rtin

Maduration

V

MVB

opl

leu

s

asm

Translation inhibition or mRNA degradation duplex-miRNA

Blood vessel

Target cell

Figure 3 Release of miRNAs to the circulatory system and its hypothetical introduction to target cell. Pre-miRNA molecules associated to MVB, incorporated into vesicles, and released by exocytosis to the circulatory system. Once it has reached its target cell by fusion with the plasma membrane, they enter by endocytosis. The image shows that pre-miRNAs or mature miRNAs are also found freely in blood. Modified from Cortez and Calin (2009).

differentiation of the CNS, is limited due to the scarcity of human research materials and ethical and legal restrictions regarding the use of human embryos for research purposes. Early human embryogenesis can only be studied in vitro. Functional studies are scarce, and data have been extrapolated from embryonic stem cell (ESC) lines and animal models. The notable role of miRNAs in the formation of the CNS beginning at germ layer specification is a process that is still not completely understood. It is proposed that miRNAs can modulate the response of embryonic blastomeres to signals involved in such specification in mammals (Du et al., 2013; Kaspi et al., 2013). The differentiation of the ectoderm/neuroectoderm is regulated by transcription factors such as sex determining region Y-box 1 (Sox1), nuclear receptor subfamily 2, group F, member 2 (Nr2f2), neurogenic differentiation 1 (NeuroD1), and paired box 6 protein (Pax6) (Seo et al., 2007; Suter et al., 2009; Zhang et al., 2010). Little is known about the role of miRNAs during these processes. Several studies have shown that some miRNAs play a primary role as repressors of ectoderm lineage and demonstrated that the decrease in the expression of certain miRNAs can promote ectoderm/neuroectoderm specification (Lichner et al., 2011; Colas et al., 2012; Kaspi et al., 2013). The miR-290-295 family is mostly expressed in mice ESC (mESCs) (Lichner et al., 2011). These miRNAs are transcribed early in the zygote as a single polycistronic unit, and their expression is controlled by the core transcription

factor regulatory network (Oct4, Sox2, and Nanog), which maintains mESCs in an undifferentiated state (Marson et al., 2008; Lichner et al., 2011). Null miR-290-295 mESCs showed a propensity to differentiate in ectodermal derivate, as measured by an increase in the expression of the ectoderm genes such as Pax6, Sox1, and Nestin. It has been suggested that the main target of miR-290-295 cluster family is Pax6 (Kaspi et al., 2013). Likewise, the let-7 and miR-18 families have been implicated in the ectoderm and mesoderm differentiation of mESC. The knockdown experiments of predicted targets followed by mutational analysis revealed that the activin type IB receptor and Smad2 are let-7 and miR-18 targets, respectively. Also, the down-regulation of these targets leads to attenuated Nodal responsiveness and to a pattern of signaling that determines whether cells become ectoderm and mesoderm fates (Colas et al., 2012). In human ESC, two miRNA families, miR-200 and miR-96, were down-regulated when the cells differentiated in neuroectodermal precursors. Furthermore, gainof-function and loss-of-function analyses found that the target for miR-200 family members is the zinc-finger E-boxbinding homeobox transcription factor, while Pax6 was a target of the miR-96 family. This is another example of miRNAs that suppress neural induction (Du et al., 2013). Neurons are the first differentiated cell type during CNS development. Neurogenesis is defined as the birth of neurons and is the process by which neurons are generated from the asymmetric cell division of neural stem

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

680      N.F. Díaz et al.: miRNAs and neural development cells (NSCs) and neural progenitor cells. Neurogenesis is most active during prenatal development. However, the adult mammalian brain (including the human) continues within the dentate gyrus of the hippocampus and the subventricular zone of the lateral ventricles (Gage et al., 1998; Alvarez-Buylla et al., 2008; Gil-Perotin et al., 2009). As mentioned above, miRNAs are known to play important roles during mammalian CNS development. These molecules present a wide diversity of expression in cerebral tissue during development and are known to be essential for cerebral cortex morphogenesis and adult neurogenesis (Krichevsky et  al., 2003; Kapsimali et  al., 2007; Miska et  al., 2007; Nielsen et  al., 2009). Interestingly, miRNAs circulating in humans had been proposed as having a diagnostic role in neural tube defects and neurodegenerative processes (Gu et al., 2012). The role of miRNAs during CNS development and neurogenesis has been addressed from different experimental designs, such as the use of Dicer conditional-null mice or Dicer knockout ESC, the profile expression of its levels during CNS development, and the reduction of its function by interfering in the binding to its target mRNA. The global effect of miRNAs in adults and the developing CNS has been studied by altering Dicer function. The inactivation of Dicer in Purkinje neurons, using Purkinjecell protein 2-Cre- mice, resulted in a slow progressive neurodegeneration (Schaefer et al., 2007). The loss of Dicer in dopaminergic neurons, using a dopamine transporter-Cre construction, increased apoptosis and neurodegeneration (Hebert and De Strooper, 2007; Kim et al., 2007). Its ablation in the developing olfactory placodes resulted in abnormal terminal differentiation of olfactory neuronal precursor cells and an altered maintenance of olfactory progenitor cells (Choi et  al., 2008). The inactivation of Dicer using a calmodulin kinase II-Cre in the cortex and hippocampus had dramatic effects on cellular and tissue morphology, axon growth, and apoptosis (Davis et  al., 2008). Moreover, Dicer-null cortical stem and progenitor cells continually produce one class of the deep-layer projection neuron, with no delay in cerebral cortex gliogenesis, despite the loss of multipotency and the failure of neuronal lineage progression (Saurat et  al., 2013). All these studies suggest that miRNAs are required for regulating CNS development and participating in neurodegenerative processes. On the contrary, miRNAs have a differential expression profile during development of the CNS of rat embryos, suggesting that they are involved in cell proliferation, migration, and neuronal differentiation. Between the onset of neurogenesis and before the neurogenic peak, several miRNAs are up-regulated or down-regulated.

Among the down-regulated miRNAs are miR-291-3p, miR-183, miR-200b and c, and miR-92, whereas miR-9, miR-124a, miR-125a and b, and miR-7 were up-regulated (Krichevsky et  al., 2003; Nielsen et  al., 2009). Predicted and experimental targets have been identified for some of these miRNAs. Nielsen et al. identified that a subset of miRNAs exhibits expression profiles that are negatively correlated with their predicted target mRNA and therefore may be a part of a gene expression regulatory network that assists during cortical neurogenesis (Nielsen et al., 2009). For example, some predicted targets for miR-183 encode proteins that promote neuronal differentiation, and for miR-92 targets mRNAs that are involved in the negative regulation of the cortical progenitor cell cycle, by reducing the inhibitor of cyclin-dependent kinase 1c translation (Nielsen et al., 2009). The miR-183 is a member of a family that includes two other homologous miRNAs (miR-96 and miR-182) from a single genetic locus in vertebrates. These miRNAs are expressed in cells of various organs, including the olfactory epithelium, eye, neuromast, zebrafish ear (Wienholds and Plasterk, 2005), cranial and spinal ganglia sensory neurons, and the sensory cells of the eye and ear in chicken and mice, where it is involved in the development and maturation of sensory epithelia in the inner ear (Darnell et  al., 2006; Kloosterman et  al., 2006; Weston et  al., 2006). In amphibians, the expression of miR-183 is restricted to the CNS and sensory ectodermal cells, beginning at the 72-h larval stage in both Branchiostoma lanceolatumy and Branchiostoma floridae. By using bioinformatic software to predict its targets, it has been shown that two good target candidates are calmodulin and netrin (Candiani et al., 2011). Calmodulin is a cytosolic calcium binding protein involved in the regulation of intracellular calcium levels (ion that affects many cellular functions, such as neuron differentiation and neurite formation) (Yu et al., 2011). Netrin is an extracellular matrix protein involved in axon growth and guidance during embryogenesis (Rajasekharan and Kennedy, 2009). However, experimental validation of these putative targets has not been done. The inhibition of miR-183 with morpholino antisense oligos in cochlear organotypic cultures revealed a negative correlation between the expression levels of miR-183 and ether-a-go-go-related gene type 1 protein (Erg1), insulin receptor substrate 1 (Irs1), and TAO kinase 1 (Taok1). Particularly, Taok1 has been associated with the activation of the mitogen-activated protein kinase pathway in response to stress and DNA damage (Hutchison et al., 1998; Raman et  al., 2007), and in human neuroblastoma cells, Taok1 transfection induces apoptosis (Wu and Wang, 2008).

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

N.F. Díaz et al.: miRNAs and neural development      681

Other evidenced targets for miR-183 confirm the antiapoptotic and prooncogenic role of miR-183 by inhibiting early growth response protein 1 (EGR1) (Sarver et al., 2010) and its effect, promoting cerebellar granule neuron (CGN) progenitor proliferation in a cooperative manner with the hedgehog signaling pathway (Zhang et al., 2013). miR-92a is a member of the miR-17/92 cluster, one of the best studied miRNA clusters, which is involved in cell cycle, proliferation, apoptosis, and other crucial processes, such as normal embryo development (Mogilyansky and Rigoutsos, 2013). Interestingly, this is the first group of miRNAs to be implicated in a human syndrome (Feingold syndrome, characterized by digital anomalies, microcephaly, facial dysmorphism, gastrointestinal atresias, and mild to moderate learning disability) (Marcelis et al., 2008). A direct participation of miR-92 in neuron maturation was assessed in primary cultures of postmitotic CGNs of 8-day-old rats (Barbato et al., 2010). During the maturation of CGNs in vitro, the miR-92 is progressively downregulated. In the same study, bioinformatics analysis showed that a putative mRNA target for this miRNA was the potassium-chloride cotransporter member 2 (KCC2, which has been observed to be timely regulated in CGNs in vivo during the postnatal development of the mouse cerebellum) (Barbato et al., 2010). This is a neuron-specific chloride potassium symporter, responsible for the establishment of the chloride ion gradient in neurons, through the maintenance of low intracellular chloride concentrations that participate in determining the physiological response to activation of ion-selective GABA and glycine receptors (Blaesse et  al., 2009). Furthermore, KCC2 is a critical mediator of synaptic inhibition and cellular protection against excitotoxicity and may also act as a modulator of neuroplasticity (Takayama and Inoue, 2007; Barbato et  al., 2010). The interaction between miR-92 and KCC2 was demonstrated by a luciferase assay using a firefly reporter vector, supporting the role of miR-92 in the control of KCC2 expression during CGN development. Moreover, the overexpression of miR-92 led to a change in the responsiveness to GABA. It was observed as a shift in the reversal potential of GABA-induced chloride currents to a more positive voltage, an effect reversed by KCC2 overexpression, which implies an excitatory effect of this neurotransmitter before granular cell maturation (Barbato et al., 2010). Three miRNAs that are up-regulated during neurogenesis are miR-9, miR-124a, and miR-125b. The first two are considered key regulators of the transition from progenitors to neurons (Krichevsky et  al., 2003, 2006; Visvanathan et  al., 2007), while miR-125b has been associated

with lin-28 as a suppressor of neuronal differentiation (Wu and Belasco, 2005). The most studied miRNA implicated in neurogenesis is miR-124a. This miRNA is up-regulated on embryo day (E) 13 in the rat and is constitutively expressed in neurons (Krichevsky et al., 2003; Cheng et al., 2009; Nielsen et al., 2009; Papagiannakopoulos and Kosik, 2009) (Figure  4). There are three loci that encode for the hairpin miR-124a precursors in mammals, in chromosomes 14, 3, and 2, which encode conserved sequences between species (Griffiths-Jones et al., 2006). All gene copies for miR-124a are controlled by the transcriptional repressor RE1-silencing transcription factor (REST), also known as neuronal restrictive silencing factor. In Xenopus, the dominant negative for REST generates abnormal development, while, in mice, the loss-of-function of CoREST (co-repressor of REST, involved in the assembly of the complex) generates significant defects in the radial migration in the cerebral cortex (Conaco et al., 2006; Olguin et al., 2006). Maiorano and Mallamaci (2009) reported that miR124a is expressed in a complex gradient pattern in the developing embryo cerebral cortex, presenting low levels in the ventricular zone (VZ), intermediate levels in the subventricular zone (SVZ), and high levels in the marginal zone. This suggests that the expression of miR-124a

Neurogenesis

Gliogenesis

miR-124a

miR-125b

miR-178

miR-131

miR-9 E12 E13 E14

E15 E18 E21

P5

P15

P30

Ad

Figure 4 Examples of the levels of some miRNAs in rat embryos and postnatal development. This scheme represents the levels of five miRNAs that are expressed during embryonic cortical development (E), postnatal (P), and adult (Ad). The vertical line represents the neurogenic peak.

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

682      N.F. Díaz et al.: miRNAs and neural development is up-regulated sharply in apical precursors that undergo direct neurogenesis and present intermediate expression level in late basal progenitors during indirect neurogenesis. These results were verified by overexpression experiments of miR-124a that led to direct neurogenesis and the promotion of the transition of neural precursors from the apical to the basal compartment (Maiorano and Mallamaci, 2009). Moreover, in vitro studies performed in ESC, P19 cell lines, mouse NSC, astrocyte, and HeLa cells have demonstrated the neuronal identity of miR-124a (Lim et al., 2005; Visvanathan et al., 2007; Maiorano and Mallamaci, 2009). The evidence from miR-124a gain-of-function studies include the following: during neuronal differentiation, the miR-124 reduces polypyrimidine tract binding protein 1 (PTBP1) levels, leading to the accumulation of correctly spliced PTBP2 mRNA as well as its protein. These events culminate in the transition from non-neuron-specific to neuron-specific transcriptome splicing (Makeyev et  al., 2007); the promotion of neurite outgrowth in differentiating P19 embryonal carcinoma cells and mouse cortical neuron cultures, while blocking miR-124 function delays the neurite outgrowth (Yu et al., 2008); the modulation of β1-integrin- and laminin-dependent attachment of NSCs to the basal membrane in chick embryos, an event that is essential for the development of the neural tube (Cao et  al., 2007); and finally the increase in neuronal differentiation of SVZ adult NSCs in rodents due to a decrease in the translation of the transcription factor Sox9 (Cheng et al., 2009). In a cooperative manner with miR-9*, miR-124a modulates the neuron-specific chromatin remodeling factor actin-related protein BAF53a in mammalian embryonic mice, a factor considered a key regulator of embryonic and adult stem cells (Yoo et al., 2009; Gao, 2010). miR-9 is involved in the maintenance of neural cell lineage among its targets in NR2E1 (also known as Tlx; nuclear receptor subfamily 2 group E member 1), which is responsible for regulating the self-renewal of NSCs (Gao, 2010). Finally, the loss of miR-9 induces the suppression of proliferation and promotes the migration of human NSCs. It has therefore been proposed as a coordinator between proliferation and migration (Delaloy et al., 2010). In summary, there are at least three pathways for the neural effect of miR-124: 1. The down-regulation of REST during the transition from progenitors to neurons leads to increased levels of miR-124a, which promotes the degradation of the small C-terminal domain phosphatase 1 (SCP1) mRNA that codifies a protein that functions as an antineural factor (Conaco et al., 2006; Visvanathan et al., 2007).

2. miR-124 directly targets the PTBP1 mRNA, which encodes a global repressor of alternative pre-mRNA splicing in nonneuronal cells. PTBP1 binds to a critical exon in the pre-mRNA of PTBP2 (nPTB/brPTB/PTBLP), a neural-enriched PTBP1 homolog. During neuronal differentiation, miR-124 reduces PTBP1 levels, leading to the accumulation of spliced PTBP2 mRNA and a dramatic increase in PTBP2 protein and neurogenesis (Makeyev et al., 2007). The connection between RNA silencing (miR-124) and splicing (PTB/nPTB) was confirmed by reciprocal expression analyses of these genes in several differentiated and precursor cell stages (Makeyev et al., 2007; Fiore et al., 2008). 3. Another target of miR-124 is Sox9, a SRY-box transcription factor, which is an important regulator of the temporal progression of adult neurogenesis in mice SVZ. In vitro, the knockdown of endogenous miR-124 maintains SVZ stem cells as dividing precursors, whereas ectopic miR-124 expression led to precocious and increased neuron formation (Cheng et al., 2009). Another miRNA that is up-regulated during the neurogenic stage is miR-125b. This miRNAs is a homolog of lin-4 and is highly conserved from flies to humans. The expression of this miRNA is enriched in the CNS, including the brain, spinal cord, and particularly the midbrain-hindbrain boundary of mice and zebrafish (Sempere et  al., 2004; Smirnova et  al., 2005; Wienholds and Plasterk, 2005; Wienholds et al., 2005). Interestingly, in C. elegans (lin-4) and Drosophila (miR-125), they are expressed only in postembryonic stages (Olsen and Ambros, 1999; Caygill and Johnston, 2008), while, in mice and rats, the expression increases gradually from E12 until birth (Krichevsky et al., 2003; Miska et al., 2004; Nielsen et al., 2009). Le et al. reported that six miRNAs were up-regulated during neuronal differentiation of the human neuroblastoma cell line SH-SY5Y, induced by all-trans-retinoic acid and brain-derived neurotrophic factors, among which were miR-124a and miR-125b. The overexpression of these two miRNAs increases spontaneously the stimulated neuron differentiation and neurite outgrowth in the neuroblastoma cells and the human neural progenitor cell (Le et al., 2009). In accordance with this finding, it has been shown that the overexpression of miR-125b in long-term self-renewing neuroepithelial-like stem cells from human pluripotent stem cells impairs its self-renewal and induces differentiation into neurons (Roese-Koerner et al., 2013). The gain-of-function and loss-of-function experiments for miR-125b have demonstrated that miRNA is essential for brain morphogenesis in zebrafish. Also, the

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

N.F. Díaz et al.: miRNAs and neural development      683

loss of miR-125b resulted in an accumulation of mitotic cells, an increase in cell death, and a reduction in neural differentiation. Finally, its ectopic expression disturbed the formation of ventricles probably due to overproliferation and/or decrease in apoptosis (Le et al., 2010). The ectopic expression of miR-125b in SH-SY5Y cells utilizing a global gene expression analysis demonstrated that the genes related to metabolism and transcriptional regulation were down-regulated and that miR-125b promotes neuron differentiation by repressing multiple targets such as AP1M1, STK11IP, PSMD8, ITCH, TBC1D1, TDG, MKNK2, DGAT1, GAB2, and SGPL1. All these targets were validated by reverse transcription-quantitative polymerase chain reaction (PCR) and luciferase assay. As a result, it has been proposed that the neurogenic effect of miR-125b is probably due to a reduction in cell metabolism and proliferation (Le et al., 2009). Two years later, the same group reported 20 new validated targets, all related to the p53 pathway in humans, mice, and zebrafish. Employing an miRNA pull-down assay, it was shown that miR-125b regulates in a negative manner the apoptotic genes BCL2antagonist/killer 1 (Bak1), tumor protein p53-inducible nuclear protein 1 (Tp53inp1), protein phosphatase 1, catalytic subunit, α isoform (Ppp1ca), and protein kinase, interferon-inducible double-stranded RNA-dependent activator (Prkra), as well as cell cycle regulators such as cyclin C, cell division cycle 25C (Cdc25c), cyclin-dependent kinase inhibitor 2C (Cdkn2c), endothelin 1 (Edn1), Ppp1ca, and sel-1 suppressor of lin-12-like (Sel1l). Interestingly, although an miRNA-target pair was seldom conserved, the miR-125b regulation of the p53 pathway is conserved at the network level (Le et al., 2011). This study suggests that miR-125b buffers and fine-tunes the p53 network activity by regulating both proliferative and apoptotic regulators. In summary, the loss of miRNA-125b promotes the accumulation of mitotic cells, an increase in cell death, and a reduction in differentiation, while the overexpression of miR-125b has the opposite effect (Le et al., 2009).

Conclusions miRNAs are molecules that have generated great interest in the last 15 years in CNS development. These small noncoding RNAs are considered temporal and spatial developmental regulators involved in the control of proliferation, differentiation, migration, and cell death. It is important to continue studying the miRNAs and their targets in early development and CNS as well as their participation in pathological processes, since few of a long list of miRNAs have so far been studied.

Acknowledgments: The research of our group is supported by the Instituto Nacional de Perinatología and the Consejo Nacional de Ciencia y Tecnología. M.S. Cruz-Reséndiz received a Consejo Nacional de Ciencia y Tecnología fellowship at the Programa de Posgrado en Ciencias Biológicas at the Universidad Nacional Autónoma de México. We thank David Connolly and Adam Pixler for the language editing and correction. Conflict of interest statement Competing interests: The authors have declared that no competing interests exist. Authors’ contributions: All authors participated in the preparation of the manuscript and read and approved the final manuscript.

References Aboobaker, A.A., Tomancak, P., Patel, N., Rubin, G.M., and Lai, E.C. (2005). Drosophila microRNAs exhibit diverse spatial expression patterns during embryonic development. Proc. Natl. Acad. Sci. USA 102, 18017–18022. Alvarez-Buylla, A., Kohwi, M., Nguyen, T.M., and Merkle, F.T. (2008). The heterogeneity of adult neural stem cells and the emerging complexity of their niche. Cold Spring Harb. Symp. Quant. Biol. 73, 357–365. Barbato, C., Ruberti, F., Pieri, M., Vilardo, E., Costanzo, M., Ciotti, M.T., Zona, C., and Cogoni, C. (2010). MicroRNA-92 modulates K+ Cl- co-transporter KCC2 expression in cerebellar granule neurons. J. Neurochem. 113, 591–600. Barca-Mayo, O. and De Pietri Tonelli, D. (2014). Convergent microRNA actions coordinate neocortical development. Cell. MoLi, L.fe Sci. DOI 10.1007/s00018-014-1576-5. Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297. Bartel, D.P. (2009). MicroRNAs: target recognition and regulatory functions. Cell 136, 215–233. Berezikov, E., Chung, W.J., Willis, J., Cuppen, E., and Lai, E.C. (2007). Mammalian mirtron genes. Mol. Cell. 28, 328–336. Bhattacharyya, S.N., Habermacher, R., Martine, U., Closs, E.I., and Filipowicz, W. (2006). Relief of microRNA-mediated translational repression in human cells subjected to stress. Cell 125, 1111–1124. Blaesse, P., Airaksinen, M.S., Rivera, C., and Kaila, K. (2009). Cation-chloride cotransporters and neuronal function. Neuron 61, 820–838. Boeri, M., Verri, C., Conte, D., Roz, L., Modena, P., Facchinetti, F., Calabro, E., Croce, C.M., Pastorino, U., and Sozzi, G. (2011). MicroRNA signatures in tissues and plasma predict development and prognosis of computed tomography detected lung cancer. Proc. Natl. Acad. Sci. USA 108, 3713–3718. Borchert, G.M., Lanier, W., and Davidson, B.L. (2006). RNA polymerase III transcribes human microRNAs. Nat. Struct. Mol. Biol. 13, 1097–1101.

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

684      N.F. Díaz et al.: miRNAs and neural development Candiani, S., Moronti, L., De Pietri Tonelli, D., Garbarino, G., and Pestarino, M. (2011). A study of neural-related microRNAs in the developing amphioxus. Evodevo 2, 15. Cao, X., Pfaff, S.L., and Gage, F.H. (2007). A functional study of miR124 in the developing neural tube. Genes Dev. 21, 531–536. Caygill, E.E. and Johnston, L.A. (2008). Temporal regulation of metamorphic processes in Drosophila by the let-7 and miR-125 heterochronic microRNAs. Curr. Biol. 18, 943–950. Cifuentes, D., Xue, H., Taylor, D.W., Patnode, H., Mishima, Y., Cheloufi, S., Ma, E., Mane, S., Hannon, G.J., Lawson, N.D., et al. (2010). A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity. Science 328, 1694–1698. Cimmino, A., Calin, G.A., Fabbri, M., Iorio, M.V., Ferracin, M., Shimizu, M., Wojcik, S.E., Aqeilan, R.I., Zupo, S., Dono, M., et al. (2005). miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc. Natl. Acad. Sci. USA 102, 13944–13949. Colas, A.R., McKeithan, W.L., Cunningham, T.J., Bushway, P.J., Garmire, L.X., Duester, G., Subramaniam, S., and Mercola, M. (2012). Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes Dev. 26, 2567–2579. Conaco, C., Otto, S., Han, J.J., and Mandel, G. (2006). Reciprocal actions of REST and a microRNA promote neuronal identity. Proc. Natl. Acad. Sci. USA 103, 2422–2427. Cortez, M.A. and Calin, G.A. (2009). MicroRNA identification in plasma and serum: a new tool to diagnose and monitor diseases. Expert Opin. Biol. Ther. 9, 703–711. Cortez, M.A., Bueso-Ramos, C., Ferdin, J., Lopez-Berestein, G., Sood, A.K., and Calin, G.A. (2011). MicroRNAs in body fluids – the mix of hormones and biomarkers. Nat. Rev. Clin. Oncol. 8, 467–477. Chalfie, M., Horvitz, H.R., and Sulston, J.E. (1981). Mutations that lead to reiterations in the cell lineages of C. elegans. Cell 24, 59–69. Cheloufi, S., Dos Santos, C.O., Chong, M.M., and Hannon, G.J. (2010). A dicer-independent miRNA biogenesis pathway that requires Ago catalysis. Nature 465, 584–589. Chen, X., Ba, Y., Ma, L., Cai, X., Yin, Y., Wang, K., Guo, J., Zhang, Y., Chen, J., Guo, X., et al. (2008). Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res. 18, 997–1006. Chendrimada, T.P., Gregory, R.I., Kumaraswamy, E., Norman. J., Cooch, N., Nishikura, K., and Shiekhattar, R. (2005). TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 436, 740–744. Cheng, L.C., Pastrana, E., Tavazoie, M., and Doetsch, F. (2009). miR124 regulates adult neurogenesis in the subventricular zone stem cell niche. Nat. Neurosci. 12, 399–408. Choi, P.S., Zakhary, L., Choi, Y.W., Caron, S., Alvarez-Saavedra, E., Miska, E.A., McManus, M., Harfe, B., Giraldez, A.J., Horvitz, H.R., et al. (2008). Members of the miRNA-200 family regulate olfactory neurogenesis. Neuron 57, 41–55. Chung, W.J., Agius, P., Westholm, J.O., Chen, M., Okamura, K., Robine, N., Leslie, C.S., and Lai, E.C. (2011). Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans. Genome Res. 21, 286–300. Darnell, D.K., Kaur, S., Stanislaw, S., Konieczka, J.H., Yatskievych, T.A., and Antin, P.B. (2006). MicroRNA expression during chick embryo development. Dev. Dyn. 235, 3156–3165.

Davis, T.H., Cuellar, T.L., Koch, S.M., Barker, A.J., Harfe, B.D., McManus, M.T., and Ullian, E.M. (2008). Conditional loss of Dicer disrupts cellular and tissue morphogenesis in the cortex and hippocampus. J. Neurosci. 28, 4322–4330. Delaloy, C., Liu, L., Lee, J.A., Su, H., Shen, F., Yang, Y.G., Young, W.L., Ivey, K.N., and Gao, F.B. (2010). MicroRNA-9 coordinates proliferation and migration of human embryonic stem cell-derived neural progenitors. Cell Stem Cell. 6, 323–335. Doench, J.G. and Sharp, P.A. (2004). Specificity of microRNA target selection in translational repression. Genes Dev. 18, 504–511. Du, T. and Zamore, P.D. (2005). microPrimer: the biogenesis and function of microRNA. Development 132, 4645–4652. Du, Z.W., Ma, L.X., Phillips, C., and Zhang, S.C. (2013). miR-200 and miR-96 families repress neural induction from human embryonic stem cells. Development 140, 2611–2618. Fiore, R., Siegel, G., and Schratt, G. (2008). MicroRNA function in neuronal development, plasticity and disease. Biochim. Biophys. Acta 1779, 471–478. Frank, F., Sonenberg, N., and Nagar, B. (2010). Structural basis for 5′-nucleotide base-specific recognition of guide RNA by human AGO2. Nature 465, 818–822. Friedman, R.C., Farh, K.K., Burge, C.B., and Bartel, D.P. (2009). Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 19, 92–105. Gage, F.H., Kempermann, G., Palmer, T.D., Peterson, D.A., and Ray, J. (1998). Multipotent progenitor cells in the adult dentate gyrus. J. Neurobiol. 36, 249–266. Gao, F.B. (2010). Context-dependent functions of specific microRNAs in neuronal development. Neural Dev. 5, 25. Ghildiyal, M., Xu, J., Seitz, H., Weng, Z., and Zamore, P.D. (2010). Sorting of Drosophila small silencing RNAs partitions microRNA* strands into the RNA interference pathway. RNA 16, 43–56. Gil-Perotin, S., Alvarez-Buylla, A., and Garcia-Verdugo, J.M. (2009). Identification and characterization of neural progenitor cells in the adult mammalian brain. Adv. Anat. Embryol. Cell. Biol. 203, 1–101, ix. Gilad, S., Meiri, E., Yogev, Y., Benjamin, S., Lebanony, D., Yerushalmi, N., Benjamin, H., Kushnir, M., Cholakh, H., Melamed, N., et al. (2008). Serum microRNAs are promising novel biomarkers. PLoS One 3, e3148. Greene, N.D. and Copp, A.J. (2012). Could microRNAs be biomarkers for neural tube defects? J. Neurochem. 122, 485–486. Griffiths-Jones, S., Grocock, R.J., Van Dongen, S., Bateman, A., and Enright, A.J. (2006). miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 34, D140–D144. Gu, H., Li, H., Zhang, L., Luan, H., Huang, T., Wang, L., Fan, Y., Zhang, Y., Liu, X., Wang, W., et al. (2012). Diagnostic role of microRNA expression profile in the serum of pregnant women with fetuses with neural tube defects. J. Neurochem. 122, 641–649. Han, J., Lee, Y., Yeom, K.H., Nam, J.W., Heo, I., Rhee, J.K., Sohn, S.Y., Cho, Y., Zhang, B.T., and Kim, V.N. (2006). Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex. Cell 125, 887–901. Hebert, S.S. and De Strooper, B. (2007). Molecular biology. miRNAs in neurodegeneration. Science 317, 1179–1180. Hutchison, M., Berman, K.S., and Cobb, M.H. (1998). Isolation of TAO1, a protein kinase that activates MEKs in stress-activated protein kinase cascades. J. Biol. Chem. 273, 28625–28632. Hutvagner, G., McLachlan, J., Pasquinelli, A.E., Balint, E., Tuschl, T., and Zamore, P.D. (2001). A cellular function for the RNA-

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

N.F. Díaz et al.: miRNAs and neural development      685 interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293, 834–838. Ji, F., Lv, X., and Jiao, J. (2013). The role of microRNAs in neural stem cells and neurogenesis. J. Genet. Genomics 40, 61–66. Kapsimali, M., Kloosterman, W.P., De Bruijn, E., Rosa, F., Plasterk, R.H., and Wilson, S.W. (2007). MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system. Genome Biol. 8, R173. Kaspi, H., Chapnik, E., Levy, M., Beck, G., Hornstein, E., and Soen, Y. (2013). Brief report: miR-290-295 regulate embryonic stem cell differentiation propensities by repressing Pax6. Stem Cells 31, 2266–2272. Kim, J., Inoue, K., Ishii, J., Vanti, W.B., Voronov, S.V., Murchison, E., Hannon, G., and Abeliovich, A. (2007). A microRNA feedback circuit in midbrain dopamine neurons. Science 317, 1220–1224. Kloosterman, W.P., Wienholds, E., De Bruijn, E., Kauppinen, S., and Plasterk, R.H. (2006). In situ detection of miRNAs in animal embryos using LNA-modified oligonucleotide probes. Nat. Methods 3, 27–29. Kozomara, A. and Griffiths-Jones, S. (2011). miRBase: integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res. 39, D152–D157. Krichevsky, A.M., King, K.S., Donahue, C.P., Khrapko, K., and Kosik, K.S. (2003). A microRNA array reveals extensive regulation of microRNAs during brain development. RNA 9, 1274–1281. Krichevsky, A.M., Sonntag, K.C., Isacson, O., and Kosik, K.S. (2006). Specific microRNAs modulate embryonic stem cell-derived neurogenesis. Stem Cells 24, 857–864. Kulkarni, M., Ozgur, S., and Stoecklin, G. (2010). On track with P-bodies. Biochem. Soc. Trans. 38, 242–251. Lagos-Quintana, M., Rauhut, R., Meyer, J., Borkhardt, A., and Tuschl, T. (2003). New microRNAs from mouse and human. RNA 9, 175–179. Le, M.T., Xie, H., Zhou, B., Chia, P.H., Rizk, P., Um, M., Udolph, G., Yang, H., Lim, B., and Lodish, H.F. (2009). MicroRNA-125b promotes neuronal differentiation in human cells by repressing multiple targets. Mol. Cell. Biol. 29, 5290–5305. Le, M.T.N., Teh, C., Shyh-Chang, N., Korzh, V., Lodish, H.F., and Lim, B. (2010). Function of miR-125b in zebrafish neurogenesis. Int. J. Biol. Life Sci. Eng. 4, 635–640. Le, M.T., Shyh-Chang, N., Khaw, S.L., Chin, L., Teh, C., Tay, J., O’Day, E., Korzh, V., Yang, H., Lal, A., et al. (2011). Conserved regulation of p53 network dosage by microRNA-125b occurs through evolving miRNA-target gene pairs. PLoS Genet. 7, e1002242. Lee, R.C. and Ambros, V. (2001). An extensive class of small RNAs in Caenorhabditis elegans. Science 294, 862–864. Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843–854. Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim, S., et al. (2003). The nuclear RNase III Drosha initiates microRNA processing. Nature 425, 415–419. Lewis, B. P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., and Burge, C.B. (2003). Prediction of mammalian microRNA targets. Cell 115, 787–798. Lichner, Z., Pall, E., Kerekes, A., Pallinger, E., Maraghechi, P., Bosze, Z., and Gocza, E. (2011). The miR-290-295 cluster promotes pluripotency maintenance by regulating cell cycle phase distribution in mouse embryonic stem cells. Differentiation 81, 11–24.

Lim, L.P., Lau, N.C., Garrett-Engele, P., Grimson, A., Schelter, J.M., Castle, J., Bartel, D.P., Linsley, S.P., and Johnson, J.M. (2005). Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433, 769–773. Liu, N., Okamura, K., Tyler, D.M., Phillips, M.D., Chung, W.J., and Lai, E.C. (2008). The evolution and functional diversification of animal microRNA genes. Cell Res. 18, 985–996. Llave, C., Xie, Z., Kasschau, K.D., and Carrington, J.C. (2002). Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 297, 2053–2056. Maiorano, N.A. and Mallamaci, A. (2009). Promotion of embryonic cortico-cerebral neuronogenesis by miR-124. Neural Dev. 4, 40. Makeyev, E.V., Zhang, J., Carrasco, M.A., and Maniatis, T. (2007). The microRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. Mol. Cell. 27, 435–448. Marcelis, C.L., Hol, F.A., Graham, G.E., Rieu, P.N., Kellermayer, R., Meijer, R.P., Lugtenberg, D., Scheffer, H., Van Bokhoven, H., Brunner, H.G., et al. (2008). Genotype-phenotype correlations in MYCN-related Feingold syndrome. Hum. Mutat. 29, 1125–1132. Marson, A., Levine, S.S., Cole, M.F., Frampton, G.M., Brambrink, T., Johnstone, S., Guenther, M.G., Johnston, W.K., Wernig, M., Newman, J., et al. (2008). Connecting microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells. Cell 134, 521–533. Miska, E.A., Alvarez-Saavedra, E., Townsend, M., Yoshii, A., Sestan, N., Rakic, P., Constantine-Paton, M., and Horvitz, H.R. (2004). Microarray analysis of microRNA expression in the developing mammalian brain. Genome Biol. 5, R68. Miska, E.A., Alvarez-Saavedra, E., Abbott, A.L., Lau, N.C., Hellman, A.B., McGonagle, S.M., Bartel, D.P., Ambros, V.R., and Horvitz, H.R. (2007). Most Caenorhabditis elegans microRNAs are individually not essential for development or viability. PLoS Genet. 3, e215. Mogilyansky, E. and Rigoutsos, I. (2013). The miR-17/92 cluster: a comprehensive update on its genomics, genetics, functions and increasingly important and numerous roles in health and disease. Cell Death Differ. 20, 1603–1614. Nan, Y., Han, L., Zhang, A., Wang, G., Jia, Z., Yang, Y., Yue, X., Pu, P., Zhong, Y., and Kang, C. (2010). miRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 1359, 14–21. Nielsen, J.A., Lau, P., Maric, D., Barker, J.L., and Hudson, L.D. (2009). Integrating microRNA and mRNA expression profiles of neuronal progenitors to identify regulatory networks underlying the onset of cortical neurogenesis. BMC Neurosci. 10, 98. Olguin, P., Oteiza, P., Gamboa, E., Gomez-Skarmeta, J.L., and Kukuljan, M. (2006). RE-1 silencer of transcription/neural restrictive silencer factor modulates ectodermal patterning during Xenopus development. J. Neurosci. 26, 2820–2829. Olsen, P.H. and Ambros, V. (1999). The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev. Biol. 216, 671–680. Papagiannakopoulos, T. and Kosik, K.S. (2009). MicroRNA-124: micromanager of neurogenesis. Cell Stem Cell 4, 375–376. Qureshi, I.A. and Mehler, M.F. (2012). Emerging roles of non-coding RNAs in brain evolution, development, plasticity and disease. Nat. Rev. Neurosci. 13, 528–541.

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM

686      N.F. Díaz et al.: miRNAs and neural development Rabinowits, G., Gercel-Taylor, C., Day, J.M., Taylor, D.D., and Kloecker, G.H. (2009). Exosomal microRNA: a diagnostic marker for lung cancer. Clin. Lung Cancer 10, 42–46. Rajasekharan, S. and Kennedy, T.E. (2009). The netrin protein family. Genome Biol. 10, 239. Raman, M., Earnest, S., Zhang, K., Zhao, Y., and Cobb, M.H. (2007). TAO kinases mediate activation of p38 in response to DNA damage. EMBO J. 26, 2005–2014. Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettinger, J.C., Rougvie, A.E., Horvitz, H.R., and Ruvkun, G. (2000). The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403, 901–906. Rhoades, M.W., Reinhart, B.J., Lim, L.P., Burge, C.B., Bartel, B., and Bartel, D.P. (2002). Prediction of plant microRNA targets. Cell 110, 513–520. Roese-Koerner, B., Stappert, L., Koch, P., Brustle, O., and Borghese, L. (2013). Pluripotent stem cell-derived somatic stem cells as tool to study the role of microRNAs in early human neural development. Curr. Mol. Med. 13, 707–722. Ruby, J.G., Jan, C.H., and Bartel, D.P. (2007). Intronic microRNA precursors that bypass Drosha processing. Nature 448, 83–86. Sarver, A.L., Li, L., and Subramanian, S. (2010). MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration. Cancer Res. 70, 9570–9580. Saurat, N., Andersson, T., Vasistha, N.A., Molnar, Z., and Livesey, F.J. (2013). Dicer is required for neural stem cell multipotency and lineage progression during cerebral cortex development. Neural Dev. 8, 14. Schaefer, A., O’Carroll, D., Tan, C.L., Hillman, D., Sugimori, M., Llinas, R., and Greengard, P. (2007). Cerebellar neurodegeneration in the absence of microRNAs. J. Exp. Med. 204, 1553–1558. Sempere, L.F., Freemantle, S., Pitha-Rowe, I., Moss, E., Dmitrovsky, E., and Ambros, V. (2004). Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 5, R13. Seo, S., Lim, J.W., Yellajoshyula, D., Chang, L.W., and Kroll, K.L. (2007). Neurogenin and NeuroD direct transcriptional targets and their regulatory enhancers. EMBO J. 26, 5093–5108. Smirnova, L., Grafe, A., Seiler, A., Schumacher, S., Nitsch, R., and Wulczyn, F.G. (2005). Regulation of miRNA expression during neural cell specification. Eur. J. Neurosci. 21, 1469–1477. Suter, D.M., Tirefort, D., Julien, S., and Krause, K.H. (2009). A Sox1 to Pax6 switch drives neuroectoderm to radial glia progression during differentiation of mouse embryonic stem cells. Stem Cells 27, 49–58. Takayama, C. and Inoue, Y. (2007). Developmental localization of potassium chloride co-transporter 2 (KCC2) in the Purkinje cells of embryonic mouse cerebellum. Neurosci. Res. 57, 322–325. Taylor, D.D. and Gercel-Taylor, C. (2008). MicroRNA signatures of tumor-derived exosomes as diagnostic biomarkers of ovarian cancer. Gynecol. Oncol. 110, 13–21. Valencia-Sanchez, M.A., Liu, J., Hannon, G.J., and Parker, R. (2006). Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev. 20, 515–524.

Visvanathan, J., Lee, S., Lee, B., Lee, J.W., and Lee, S.K. (2007). The microRNA miR-124 antagonizes the anti-neural REST/SCP1 pathway during embryonic CNS development. Genes Dev. 21, 744–749. Weston, M.D., Pierce, M.L., Rocha-Sanchez, S., Beisel, K.W., and Soukup, G.A. (2006). MicroRNA gene expression in the mouse inner ear. Brain Res. 1111, 95–104. Wienholds, E. and Plasterk, R.H. (2005). MicroRNA function in animal development. FEBS Lett. 579, 5911–5922. Wienholds, E., Kloosterman, W.P., Miska, E., Alvarez-Saavedra, E., Berezikov, E., De Bruijn, E., Horvitz, H.R., Kauppinen, S., and Plasterk, R.H. (2005). MicroRNA expression in zebrafish embryonic development. Science 309, 310–311. Wightman, B., Ha, I., and Ruvkun, G. (1993). Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75, 855–862. Wu, L. and Belasco, J.G. (2005). Micro-RNA regulation of the mammalian lin-28 gene during neuronal differentiation of embryonal carcinoma cells. Mol. Cell. Biol. 25, 9198–9208. Wu, M.F. and Wang, S.G. (2008). Human TAO kinase 1 induces apoptosis in SH-SY5Y cells. Cell. Biol. Int. 32, 151–156. Yang, J.S. and Lai, E.C. (2011). Alternative miRNA biogenesis pathways and the interpretation of core miRNA pathway mutants. Mol. Cell. 43, 892–903. Yang, J.S., Maurin, T., Robine, N., Rasmussen, K.D., Jeffrey, K.L., Chandwani, R., Papapetrou, E.P., Sadelain, M., O’Carroll, D., and Lai, E.C. (2010). Conserved vertebrate mir-451 provides a platform for Dicer-independent, Ago2-mediated microRNA biogenesis. Proc. Natl. Acad. Sci. USA 107, 15163–15168. Yekta, S., Shih, I.H., and Bartel, D.P. (2004). MicroRNA-directed cleavage of HOXB8 mRNA. Science 304, 594–596. Yoo, A.S., Staahl, B.T., Chen, L., and Crabtree, G.R. (2009). MicroRNA-mediated switching of chromatin-remodelling complexes in neural development. Nature 460, 642–646. Yu, J.Y., Chung, K.H., Deo, M., Thompson, R.C., and Turner, D.L. (2008). MicroRNA miR-124 regulates neurite outgrowth during neuronal differentiation. Exp. Cell. Res. 314, 2618–2633. Yu, B., Ma, H., Du, Z., Hong, Y., Sang, M., Liu, Y., and Shi, Y. (2011). Involvement of calmodulin and actin in directed differentiation of rat cortical neural stem cells into neurons. Int. J. Mol. Med. 28, 739–744. Zeng, Y., Wagner, E.J., and Cullen, B.R. (2002). Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Mol. Cell. 9, 1327–1333. Zhang, X., Huang, C.T., Chen, J., Pankratz, M.T., Xi, J., Li, J., Yang, Y., Lavaute, T.M., Li, X.J., Ayala, M., et al. (2010). Pax6 is a human neuroectoderm cell fate determinant. Cell Stem Cell 7, 90–100. Zhang, Z., Li, S., and Cheng, S.Y. (2013). The miR-183 approximately 96 approximately 182 cluster promotes tumorigenesis in a mouse model of medulloblastoma. J. Biomed. Res. 27, 486–494. Zhao, C., Sun, G., Li, S., and Shi, Y. (2009). A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determination. Nat. Struct. Mol. Biol. 16, 365–371.

Brought to you by | Rutgers University Authenticated Download Date | 6/1/15 9:03 PM