Microsphere-Incorporated Hybrid Thermogel for Neuronal Differentiation of Tonsil Derived Mesenchymal Stem Cells.

www.advhealthmat.de www.MaterialsViews.com

Madhumita Patel, Hyo Jung Moon, Bo Kyung Jung, and Byeongmoon Jeong*

FULL PAPER

Microsphere-Incorporated Hybrid Thermogel for Neuronal Differentiation of Tonsil Derived Mesenchymal Stem Cells

osteogenesis, and chondrogenesis.[10] In particular, TMSCs are obtained from tonsil tissue after a tonsillectomy, which is otherwise wasted, and contains 10–100 times higher population density of MSCs than bone marrow.[11] Considering the difficulty in accessibility of stem cells from embryos, bone marrow, and deep brain tissues, TMSCs can be an excellent alternative resource of stem cells. Chemical and biological factors such as basic fibroblast growth factor (bFGF), epidermal growth factor (EGF), neuronal growth factor (NGF), brain derived neurotropic growth factor (BDNF), and retinoic acid (RA) are reported to drive the neuronal differentiation of the stem cells.[12–14] Regulation of neuronal differentiation depends upon the supply of these growth factors. In a traditional 2D culture system by using a polystyrene plate, growth factors were constantly supplied from the culture media. However, the cells are in a 3D environments in a living system. There are many reports on the difference in mRNA and protein expression between 2D and 3D cultures.[15,16] 3D culture systems provide more practical information for the neuronal differentiation of the stem cells. Collagen modified hydrogel as a 3D culture matrix was reported for the neuronal differentiation of MSC by using the combination of growth factors including NGF, BDNF, and retinoic acid.[17] They proved that MSCs differentiated into neurons and glia and expressed neuronal genes of MAP2 and glial fibrillary acidic protein (GFAP) after 14 d of induction. Similarly, adipose tissue derived stem cell (ADSC) were also reported to differentiate into neuronal cells and express GFAP and MAP2 biomarkers in alginate hydrogel.[18] Heparin hydrogel crosslinked with star shaped poly(ethylene glycol) was reported for cell replacement therapies for neurodegenerative diseases.[19] Neuronal progenitor cells (NPCs) expressed mature neuronal cells of astrocytes and oligodendrocytes in PEG-grafted poly(Llysine).[20] All of the above 3D culture systems, neurotropic growth factors were supplied from the medium. Considering the practical application of an injectable tissue engineering system, the growth factors being supplied from the 3D scaffold instead of medium is required. In addition, the concept of controlled growth factor delivery matching the cell cycle is desirable for regenerative medicine or tissue engineering.[21] As a new 3D cell culture matrix, thermogelling polymer aqueous solutions have been suggested.[22,23] The cells and growth factors can be

Neuronal differentiation of tonsil-derived mesenchymal stem cells (TMSCs) is investigated in a 3D hybrid system. The hybrid system is prepared by increasing the temperature of poly(ethylene glycol)-poly(L-alanine) aqueous solution to 37 °C through the heat-induced sol-to-gel transition, in which TMSCs and growth factor releasing microspheres are suspended. The in situ formed gel exhibits a modulus of 800 Pa at 37 °C, similar to that of brain tissue, and it is robust enough to hold the microspheres and cells during the 3D culture of TMSCs. The neuronal growth factors are released over 12–18 d, and the TMSCs in a spherical shape initially undergo multipolar elongation during the 3D culture. Significantly higher expressions of the neuronal biomarkers such as nuclear receptor related protein (Nurr-1), neuron specific enolase, microtubule associated protein-2, neurofilament-M, and glial fibrillary acidic protein are observed in both mRNA level and protein level in the hybrid systems than in the control experiments. This study proves the significance of a controlled drug delivery concept in tissue engineering or regenerative medicine, and a 3D hybrid system with controlled release of growth factors from microspheres in a thermogel can be a very promising tool.

1. Introduction Neurodegenerative injuries or diseases caused by the problems in nerve systems are seriously threatening to the quality of life as the life span of human increases.[1] In addition, the neural tissues have a limited capacity for self-repair after damage.[2] Recently, many efforts bring hope for the functional recovery of the neuronal systems by using stem cells including embryonic stem cells, mesenchymal stem cells, neural stem cells, and induced pluripotent stem cells.[3–8] Tonsil tissue derived mesenchymal stem cells (TMSCs) have recently been reported as a new resource of mesenchymal stem cells (MSCs). Traditionally, MSCs have been isolated from bone marrow. However, the number of stem cells present in bone marrow are limited and their proliferation and differentiation abilities decrease with age.[9] TMSCs showed a higher proliferation rate than bone marrow derived MSCs and have similar differentiation potential for adipogenesis, Dr. M. Patel, H. J. Moon, B. K. Jung, Prof. B. Jeong Department of Chemistry and Nano Science Ewha Womans University 52 Ewhayeodae-gil, Seodaemun-gu Seoul 120-750, South Korea E-mail: [email protected]

DOI: 10.1002/adhm.201500224

Adv. Healthcare Mater. 2015, 4, 1565–1574

© 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

wileyonlinelibrary.com

1565

www.advhealthmat.de

FULL PAPER

www.MaterialsViews.com

Figure 1. Strategy of current research. The neuronal growth factor loaded microspheres were incorporated into a 3D cell culture matrix of PEG-L-PA thermogel during the heat-induced sol-to-gel transition of the PEG-L-PA aqueous solution. Sustained release of neuronal growth factors (orange dots) of BDNF and NGF from the microsphere (blue spheres) directs the neuronal differentiation (multipolar elongated cells) of the TMSCs (green sphere). The protein drug delivery concept is introduced for stem cell differentiation during the 3D cell culture.

incorporated into the 3D matrix during sol-to-gel transition of the aqueous system, which provides a cytocompatible procedure without using any initiators or chemical reactions. However, thermogelling systems also suffer from a high initial burst release of hydrophilic growth factors. In this study, a hybrid 3D cell culture hydrogel system (MP) was designed for neuronal differentiation of TMSCs (Figure 1). Neuronal growth factors of BDNF and NGF were loaded into microspheres, and then the microspheres were incorporated in an in situ formed polypeptide thermogel. BDNF and NGF are involved in the postmitotic processes and the combination of the two factors through the culture period was reported to exhibit a synergistic effect on neuronal differentiation of the stem cells.[24,25] The hybrid system was constructed by heating poly(ethylene glycol)-poly(L-alanine) (PEG-L-PA) aqueous solution suspended with growth factors-loaded microspheres and TMSCs to the cell culture temperature of 37 °C. The modulus of hydrogel was selected to 800 Pa at 37 °C, similar to that of brain tissue with the modulus of 100–1000 Pa.[26] The incorporated microspheres were expected to supply neuronal growth factors in a controlled manner for neuronal differentiation of TMSCs during the 3D culture period of TMSCs. The cell morphologies and neuronal biomarker expression at mRNA as well as protein level were investigated. For comparison, TMSCs were 3D cultured in the absence of neuronal growth factors (P) and in the presence of growth factors (GP) in the PEG-L-PA hydrogel.

2. Results The diblock copolymer of PEG-L-PA was prepared by the polymerization of the N-carboxy anhydrides of L-alanine on

1566


α-amino-ω-methoxy PEG.[27,28] Based on the methyl peak (1.4–1.9 ppm) and PEG peak (3.8–4.2 ppm) in the 1H NMR spectra of the polymer, the polymer molecular weight were calculated to be 1000–795 (Figure S1a, Supporting Information). The gel permeation chromatography exhibited the unimodal distribution of the polymer, where the number average molecular weight and molecular weight distribution calculated against PEG standards were 1, 100, and 1.1, respectively (Figure S1b, Supporting Information). FTIR and circular dichroism (CD) spectra of the PEG-L-PA exhibited characteristic bands at 1626 cm−1 (vC=O stretching; FTIR) and 216 nm (CD), respectively, thus confirming the β-sheet structure of the polypeptide (Figure S1c,d, Supporting Information). The physicochemical properties of the polymer including thermogelation and the sol-to-gel transition mechanism of the polymer aqueous solution were already reported.[27,29] Briefly, the polymer aqueous solution undergoes sol-to-gel transition in a conentration range of 5.0–8.0 wt% as the temperature increases (Figure S2, Supporting Information). The micelle aggregation involving dehydration of PEG and partial changes in β-sheet structure was suggested as the mechanism of the sol-gel transition. In the current study, we focused on the neuronal differentiation of TMSCs in a 3D hybrid hydrogel cell culture system. The neuronal growth factor-loaded alginate microspheres and TMSCs were encapsulated in the PEG-L-PA hydrogel through the heat induced sol-to-gel transition of the polymer aqueous solution by increasing its temperature to 37 °C. The neuronal growth factors released from the microspheres were expected to drive the neuronal differentiation of the TMSCs embedded in the hydrogel. As a control, neuronal differentiation behavior of the TMSCs was compared in a PEG-L-PA hydrogel 3D culture system in the absence of neuronal growth factors (P) and a PEG-L-PA hydrogel 3D culture system in which all of the growth factors were incorporated into the hydrogel (GP). Growth factor (NGF or BDNF) loaded alginate microspheres were prepared by the emulsification method.[30] The size of alginate microspheres was about 1–4 µm in diameter. The morphology of BDNF-loaded and NGF-loaded microspheres was observed by field emission scanning electron microscopy (FE-SEM) (Figure 2a). The spherical microspheres with irregular pores and surfaces were observed. The encapsulation efficiency of the BDNF and NGF into the microspheres was 66.6% ± 7.6% and 84.5% ± 5.4%, respectively. Loading content of the BDNF and NGF of the microsphere was 0.14 ± 0.02 and 0.18 ± 0.03 µg mg−1, respectively. The brain tissue has the modulus of 100–1000 Pa.[24] We selected the PEG-L-PA aqueous system (6.8 wt%) with a similar modulus at 37 °C. The PEGL-PA aqueous solution is a low viscous solution in a sol state. The storage modulus (G′) and loss modulus (G″) were less than 5.0 Pa(s) in the sol state at 4 °C. At 37 °C, the aqueous solution turn into a hydrogel with the G′ of about 800 Pa (Figure 2b). G′ is a measure of an elastic component and G″ is a measure of a viscous component. G′ is related to Young’s modulus (E) by the following equation. E = 2G′ (1 + v).[31] v is the Poisson ratio defined by the lateral contraction of a material divided by the axial stain. The ratio of G′ to G″ is a measure of gel-like behavior of a system. The ratio was 16 for the current PEG-L-PA thermogel at 37 °C. Thermogels developed from poly(L-lactide-co-glycolide)-PEG-poly(L-lactide-co-glycolide)




FULL PAPER

Figure 2. a) SEM images of BDNF-loaded (BDNF-MS) and NGF-loaded (NGF-MS) alginate microspheres. Scale bar = 1 µm. b) Stoarge modulus (G′) and loss modulus (G″) of PEG-L-PA aqueous polymer solution (6.8 wt%) in sol (4 °C) and gel (37 °C) states.

(PLGA-PEG-PLGA; 25 wt%), poly(γ-[2-(2-methoxy)ethyl]-racglutamate) and poly(L-leucine) (3 wt%), and PEG-PAF (4 wt%) aqueous solutions exhibited the G′/G″ about 11, 12, and 17, respectively.[32–34] G′/G″ of polyphosphazene thermogel exhibited about 5, whereas after chemical crosslinking G′/G″ increased to 170.[35,36] The release profiles of BDNF and NGF from the PEG-L-PA hydrogel (BDNF-GP and NGF-GP) and alginate microsphere embedded in the PEG-L-PA hydrogel (BDNF-MP and NGFMP) were compared. In GP systems of BDNF-GP and NGFGP, the growth factors were incorporated into the hydrogel during the thermogelation of the PEG-L-PA aqueous solutions. On the other hand, the growth factor-loaded microspheres were incorporated into the hydrogel in the MP systems of BDNF-MP and NGF-MP during the sol-to-gel transition of PEG-L-PA aqueous solutions. Therefore, the growth factors faced the additional barriers of microspheres in the MP systems compared to the GP systems. The BDNF and NGF were released over 2–3 d from the GP systems, whereas a much slower release of the growth factors over 10–18 d was observed for BDNF-MP and NGF-MP systems (Figure 3). The double barriers of microsphere and hydrogel not only decreased an initial burst release but also slowed down the diffusion rate of the incorporated hydrophilic drug as proven in the low molecular weight drug and protein drug.[37,38] The double barrier system consisting of drug loaded alginate microsphere and poly(lactic acid-co glycolic acid)-poly(ethylene glycol)-poly(lactic


Figure 3. In vitro release of a) NGF and b) BDNF. The release profiles of the growth factors from the thermogel (BDNF-GP and NGF-GP) and the microsphere-loaded thermogel (BDNF-MP and NFG-MP) were compared.

acid-co glycolic acid) hydrogel slowed down the release rate of theophylline and 5-fluorouracil by more than 10 times, where the time for 50% release was 30–40 min from the gel and 300 min for the hybrid system.[37] When bovine serum albumin (BSA) loaded poly(lactic acid-co glycolic acid) microspheres were incorporated into alginate hydrogel, the time for 50% release was several hours from the gel and 30 d from the hybrid system.[38] Currently, in our system, the release rate of the neuronal growth factors decreased from 2–3 d (from the gel) to 10–18 d (from the hybrid system), and thus enabling the system to provide the growth factors over the 3D TMSCs culture period. Due to the recovery of stem cells from the wasting tissue after tonsillectomy as well as their excellent proliferation and differentiation abilities, TMSCs have been suggested as a promising resource of stem cells.[10,11] Recently, TMSCs were reported to undergo hepatogenic (endodermal) and chondrogenic (mesodermal) differentiation during the 3D culture.[29,34] However, neuronal (ectodermal) differentiation, a nonmesenchymal lineage, of the TMSCS has not been reported yet. In the current study, neuronal differentiation of TMSCs were investigated by using a hybrid system of microsphere incorporated hydrogel (MP), where the PEG-L-PA thermogel acted as a 3D matrix and



1567

www.advhealthmat.de

FULL PAPER


1568

biomarkers including MAP2 and GFAP without any induction procedure, however, when the stem cells are treated with neuronal induction media, all markers significantly increase.[42,43] The expression of these biomarkers suggests that the stem cells retain their ability for neuronal differentiation. The expression of neuronal biomarkers at 0th d suggested that the TMSCs had the capability to differentiate into neuron cells and the biomarker expression significantly increased after exposure to growth factors over 7th–28th d. All the biomarkers were significantly higher in the MP system than in the P and GP systems. The neuronal biomarker expression was not statistically significant in GP than in P due to the fact that the neuronal growth factors were washed away over 3 d from the gel in the GP system as demonstrated in the in vitro drug release profile and that the neuronal differentiation of the TMSCs did not occur sufficiently for neuronal mRNAs to be detected. Therefore, the GP system where all the growth factors were incorporated as a single shot did not prove to be an effective tool as an injectable tissue engineering system of TMSCs toward neuronal differentiation. The mRNA expression level of Nurr-1 was significantly higher in the MP system than in the P or GP systems, particularly upregulated in 14 d of culture. The mRNA expression of NSE increased in the MP system after 7 d, compared in the P and GP systems. The mRNA expression of MAP2 was increased in the MP system after 3 d. mRNA of NF-M was highly expressed after 7 d. mRNA of GFAP expression was significantly higher in MP after 3 d than in the P or GP systems. Nurr-1, NSE, and NF-M are mature neuronal markers.[44–46] Higher expression of these neuronal biomarkers in the MP system indicated the presence of mature neurons in MP systems. High mRNA expression of MAP2 also suggested that TMSCs differentiated into mature neuronal cells.[47–49] Presence of glial cells during the cell culture is helpful for the maturation and new generation of neurons.[50] The significantly higher expression of GFAP in the MP system than in the P and GP systems after 7 d confirmed that TMSCs differentiated into astrocyte in the MP system significantly better than in the P and GP systems. In a 2D culture system of TMSCs, relatively high expression of Nurr-1 and NF-M was observed, whereas the expression level of NSE, MAP2, and GFAP were relatively lower than the MP (3D culture) system (Figure S3, Supporting Information). The neuronal biomarker expression at the protein level was examined for MAP2, NF-M, and GFAP by immunofluorescence study. The immunocytochemical staining of the proteins exhibited MAP2 in red, NF-M in red, and GFAP in green (Figure 6a–c). Nuclei of cells were stained in blue by DAPI. Cells cultured in the MP system expressed evidently higher levels of MAP2, NF-M, and GFAP as compared with the P and GP systems. The semiquantitative analysis of the fluorescence images clearly indicated the significantly higher expression of the above neuronal bioFigure 4. a) Cell images of TMSC after 3D culturing 0, 14, and 28 d in the P, GP, and MP sysmarkers at the protein level in the MP system tems. Living cells were stained as green. b) Enlarged images. Scale bar is 100 and 20 µm in (a) and (b), respectively. Cells were 3D cultured in PEG-L-PA thermogel in the absence of growth than in the P and GP systems (Figure 6d). factor (P), PEG-L-PA thermogel incorporating growth factors (GP), and PEG-L-PA thermogel Such a trend in protein expression was well correlated with the mRNA expression. incorporating growth factors-loaded microspheres (MP).

the alginate microsphere supplied the neuronal growth factors in a time controlled manner. For comparison, TMSCs were 3D cultured in PEG-L-PA hydrogel in the absence of neuronal growth factors (P) and PEG-L-PA hydrogel in the presence of growth factors (GP). To use the same amount (20 ng) of growth factors with the control experiment of the GP system, 0.14 mg of BDNF loaded microspheres (loading content: 0.14 µg mg−1) and 0.11 mg of NGF loaded microspheres (loading content: 0.18 µg mg−1) were incorporated per each cell culture system by using the MP formulation. The aqueous solution containing microspheres and TMSCs underwent sol-to-gel transition to form a 3D hybrid matrix as the temperature increased to the cell culture temperature of 37 °C. This protocol simulates a simple method for injectable tissue engineering application of the system. The Live/Dead assay visualized the distribution of live and dead cells after 0, 14, and 28 d of 3D culture in P, GP, and MP systems (Figure 4a,b). The live cells were stained in green due to the intracellular esterase activity for the calcein AM, whereas the dead cells were stained in red due to the binding of ethidium homodimer-1 to the DNA of the dead cell membrane.[39] The cells exhibited a spherical shape in 0 d in all of the 3D culture systems of P, GP, and MP. However, the cells underwent multipolar elongation in their cell morphology in 14 and 28 d. Cell morphology is closely related to the cellular biochemical functions in proliferation and migration. The cytoskeleton controls the morphology of the cells and the fibrous extension of the cytoskeleton is the typical aspect of the neuronal differentiation of stem cells.[40,41] In particular, such a structural change was evident in MP systems, where neuronal growth factors were provided from the microspheres during the long culture period. The biomarker expression related to neuronal differentiation of TMSCs was compared for P, GP, and MP systems. The expression of neuronal biomarkers in mRNA level was assayed by the real time polymerase chain reaction (PCR). The specific neuronal markers including Nurr-1, NSE, MAP2, NF-M, and GFAP were analyzed (Figure 5). All biomarker expressions were normalized by the GAPDH. MSCs constantly express neuronal





FULL PAPER Figure 5. Neuronal mRNA expressions of a) Nurr-1, b) NSE, c) MAP2, d) NF-M, and e) GFAP. The data were normalized with GAPDH. The data were analyzed by one way ANOVA. n = 3, * and ** indicate p < 0.05 and p < 0.01, respectively.

3. Discussion The development of effective treatment methods for neuronal diseases is very important and stem cell therapy can be a solution in the future. For stem cell therapy to be successful, the availability of stem cells in a sufficient amount, supply of differentiation growth factors, and biocompatible scaffolds are required. MSCs are more easily harvested than neural stem


cells. We used TMSCs as a new stem cell source. Compared with bone-marrow derived MSCs, TMSCs have been reported to have several advantages such as recycling of waste tissues, high proliferation rate, and multipotent differentiation potential.[10,11] Recently, TMSCs were proved to be effectively differentiated into chondrocytes (mesodermal lineage) as well as hepatocytes (endodermal lineage) in the 3D culture system.[29,34] In this research, we investigated neuronal differentiation (ectodermal



1569

www.advhealthmat.de

FULL PAPER


Figure 6. Immunofluorescence images of a) NF-M, b) GFAP, and c) MAP2 after 3D culturing 14 d in the P, GP, and MP systems. Nuclei were stained as blue by DAPI. NF-M and MAP2 were stained as red by their corresponding antibodies. GFAP was stained as green by its corresponding antibody. Scale bar = 20 µm. d) Semiquantitative analysis of immuno-reactivity obtained by fluorescence intensity times the number of the stained cells. Results are the mean of different field (n = 3). The data were analyzed by one way ANOVA. * and ** indicate p < 0.05 and p < 0.01, respectively.

lineage) of TMSCs for the first time by using a 3D hybrid culture system. A 3D cell culture system mimicking a living tissue provides more practical information than a traditional 2D culture because the gene expression from cells in a 3D environment is frequently different from that in a 2D environment.[15,16] As a 3D cell culture matrix as well as an injectable tissue engineering scaffold, thermogels can be a promising candidate. Thermogels undergo sol-to-gel transition by increasing temperature, and thus can provide an implantable hydrogel in situ. They have been suggested as minimally invasive drug delivery and tissue engineering applications.[22,23,51–58] The cell and growth factors can be simply incorporated during the heat induced sol-to-gel transition. However, the hydrophilic growth factors such as proteins tend to release in a large amount within a few d from the thermogel. In this research, we designed a microsphere loaded hybrid hydrogel system (MP), where the neuronal growth factors were slowly released during the cell culture period. Various chemicals, growth factors, and cytokines such as retinoic acid, isobutyl methyl xanthine, dibutyl cyclic AMP, EGF, FGF, BDNF, and NGF have been reported to affect neuronal differentiation of MSCs through intercellular communications.[59–62] These biochemicals are messengers that mediate various cellular processes such as differentiation and maturation by paracrine and endocrine interactions.[63–65] Depending on the composition of these biochemicals the expression level of neuronal biomarkers could be affected. In particular, bFGF is a key inducer involved in neurogenesis and BDNF and NGF

1570


promote the neural maturation.[66,67] Therefore, we designed a MP system where the bFGF and EGF are supplied from the gel and BDNF and NGF are supplied from the microsphere in a sustained manner. Such sequential treatments by using a sustained delivery system are expected to trigger the neurogenesis and then promote the neuronal differentiation and maturation of the neuronal cells. The composition of growth factors, cytokines, and chemicals should be screened and optimized for 3D culture and finally for the clinical application of the system in the future. As an ideal system, the time schedule of tissue growth should be matched to that of scaffold degradation. The study in an animal model will prove the efficiency of the MP system as a cell therapy system as well as the biocompatibility at the tissue and cellular level. The biomimetic design of a system with appropriate mechanical and adhesive properties with enhanced cellular interactions are particularly important.[68,69] In the current study, we selected a hydrogel with a modulus of 800 Pa at 37 °C, whereas the modulus of brain tissue is in a range of 100–1000 Pa.[26] Minute control of the hydrogel modulus might affect the neuronal differentiation of the stem cell.[70,71] Investigation of the hydrogel in a broader range of gel modulus covering 100–10 000 Pa will lead to an optimization of the current system for neuronal differentiation. The 3D culture system (GP) which incorporated growth factors and stem cells all together, the initial burst of the growth factors were observed. The GP system could not provide an effective neuronal differentiation system of TMSCs. On the other hand,




4. Conclusions Differentiation of stem cells into neuronal cells is a very important issue for successful stem cell therapy for neuronal defects caused by accidents or diseases. In particular, stem cell differentiation in a 3D cell carrier systems is significant as it resembles the living biological tissue and thus can provide practical information for tissue engineering application. Localization of


the stem cells to the target brain site and their neuronal differentiation are key steps for the cellular treatments of practical therapy. In this regard, the supply of the growth factors directing neuronal differentiation of the stem cells in an injectable scaffold is very important. In this current study, TMSCs were embedded in a PEG-LPA hydrogel, where the neuronal growth factors were provided in a controlled manner from the incorporated microspheres. Cells were viable and developed multipolar elongated structures in the hybrid system of MP. Neuronal biomarkers including Nurr-1, NSE, MAP2, NF-M, and GFAP were highly expressed in the MP system, suggesting enhanced the neuronal differentiation of TMSCs and development of mature neuronal cells. Otherwise, as shown in the GP system, the hydrophilic neuronal growth factors of BDNF and NGF were quickly released from the hydrogel and could not effectively act as a 3D culture matrix for neuronal differentiation of the encapsulated TMSCs. This research also emphasizes that the concept of controlled drug delivery is very important in designing a tissue engineering or regenerative medicine system.[21,81] With the simple fabrication of the 3D matrix by using heat induced sol-to-gel transition, the hybrid system of growth factor releasing microsphere incorporated thermogel can be a promising platform for injectable tissue engineering and regenerative medicine.

FULL PAPER

the TMSCs cultured in the MP system underwent multipolar elongation in their cell morphology which is a typical morphology of neuronal differentiated cells. In addition, the excellent expression of neuronal biomarkers such as Nurr-1, NSE, MAP2, NF-M, and GFAP indicates neuronal cell differentiation of TMSCs and development of mature neuronal cells.[72–74] We proved the hybrid hydrogel system can be a promising 3D culture matrix for neuronal differentiation of TMSCs. Neuronal differentiation of MSCs derived from adipose tissue exhibited a 12 times increase in GFAP and a 5 times increase in MAP2 in a 3D culture system of alginate gel after 10 d culture where the growth factors were supplied from the medium.[18] In our current MP system, a 20 times increase in GFAP and 7 times increase in MAP2 were observed for 14 d of 3D culture. Bone marrow derived MSCs were 3D cultured for neuronal differentiation in the collagen treated aliphatic polyester nanofibers.[75] The neuronal growth factors were supplied from the medium, as well. Multipolar elongation of the cell morphology was observed as a typical neuronal differentiation of the MSCs. Carbon nanotube incorporated collagen hydrogel was used as a 3D cell culture matrix of bone marrow derived MSC toward neuronal differentiation for 12 d.[76] Up to 1.0% incorporation of carbon nanotube with electrical conductivity and nanotopology increased the neuronal biomarker expression by more than 10 times than the control hydrogel system without carbon nanotube. BDNF were blended or immobilized in the chitosan for 3D culture of human umbilical cord MSCs for neuronal differentiation.[77] The physical blend provided the BDNF for 3 d, whereas the BDNF were released over 30 d from the immobilized chitosan. Five times higher expression of the neuronal biomarker (MAP-2) was reported than the control groups, indicating the significance of long term supply of the neuronal growth factors. Recently, Ito et al reported that immobilization of growth factors to hydroxy apatite and titanium oxide surfaces can be effective in controlling stem cell differentiation.[78,79] As an injectable biodegradable hydrogel 3D culture system of MSCs, gelatin hydroxyphenyl propanoic acid was crosslinked by horseradish peroxidase to form an in situ formation of the hydrogel.[80] After three weeks of 3D culture, neuronal biomarkers of MAP2 were more highly expressed in a soft hydrogel with a gel modulus of 281 Pa. In comparison to the previous 3D culture systems of MSCs toward neuronal differentiation, our current system is unique in that the neuronal growth factors of BDNF and NGF were supplied from the incorporated microsphere rather than a medium or chemically conjugated system. This approach not only provides the information of 3D culture but also can be directly used as an injectable tissue engineering system, where one shot injection of MP systems into a target site might lead to neuronal regeneration.

5. Experimental Section Materials: N-carboxy anhydrides of L-alanine (KPX life, Korea) and α-amino-ω-methoxy poly(ethylene glycol) (PEG; M.W. = 1000 Da, IDB Chem, Korea) were used as received. Toluene (Daejung, Korea) was distilled over sodium before use. Alginic acid (Sigma, USA) and span 85 (Sigma, USA), calcium chloride (Fisher Scientific, UK), and isooctane were used as received. Growth factors including BDNF, NGF, EGF, and FGF were purchased from Sigma, and used as received. A Hyclone penicillin-streptomycin solution containing penicillin (10 000 units mL−1), streptomycin (10 000 µg mL−1) in sodium chloride solution (0.85%) was purchased from Life Technology, USA. A Gibco antibiotic-antimitotic solution containing penicillin (10 000 units mL−1), streptomycin (10 000 µg mL−1), and fungizone (amphotericin B) (25 µg mL−1) was also purchased from Life Technology, USA. Synthesis of PEG-L-PA: The diblock copolymer of PEG-L-PA was synthesized by the previously published method.[27,28] N-carboxy anhydrides of L-alanine were polymerized on the α-amino-ω-methoxy PEG. α-amino-ω-methoxy PEG (5.0 g, 5.0 mmole; Mw 1000 Da) and N-carboxy anhydrides of L-alanine (10.2 g, 88.7 mmole) were used as a feed. 1H NMR Spectroscopy: 1H NMR spectra of the polymer (500 MHz NMR spectrometer; Varian, USA) were used to determine the composition and molecular weight (Mn) of the polymer. CF3COOD was used as a solvent. Gel Permeation Chromatography (GPC): The gel permeation chromatography system (Waters 515) with a refractive index detector (Waters 410) was used to obtain the molecular weight and molecular weight distribution of polymers. N,N-dimethyl formamide was used as an eluting solvent. Poly(ethylene glycol)s were used as the molecular weight standards. An OHPAK SB-803QH column (Shodex) was used. Preparation of Alginate Microspheres: Growth factor-loaded alginate microspheres were prepared by the emulsification method described by Lianga et al.[30] Growth factors (BDNF or NGF) were dissolved in alginic acid (Sigma, USA) solution at a final alginate concentration of 2.0 wt%. Span 85 was dispersed in isooctane at the concentration of 5.0 wt% and was mixed by a magnetic stirrer to from an oil phase. The alginate aqueous solution containing growth factors was poured into



1571

www.advhealthmat.de

FULL PAPER


1572

the oil phase. These mixtures were emulsified by sonication (Ultrasonic Processor, Sonics and Materials Inc. USA) after adding Tween 80 aqueous solution. Then calcium chloride aqueous solution (8.0 wt%) was dropped into the emulsion for the cross-linking reaction of alginate. After 15 min of cross-linking reaction, isopropyl alcohol was added to harden the microspheres. Microspheres were collected by centrifugation at 1500g for 5 min, and subsequently washed twice with isopropanol to separate the organic phase, and then washed with sterilized deionized water. Microspheres were then freeze-dried and stored in a refrigerator (4 °C) until use. To calculate the loading content and encapsulation efficiency, 10 mg of microspheres were suspended in 5.0 mL of PBS (pH 7.4). The samples were incubated at 37 °C and shaken for 24 h to release of all of the loaded protein. The samples were centrifuged at 4000 rpm for 10 min and the protein content in the supernatant was analyzed by Nano Orange Protein Quantification Kit (Invitrogen, USA) according to the manufacture’s protocol. Encapsulation efficiency was calculated by the ratio of the mass of loaded protein to the mass of added protein to prepare the microsphere. Loading capacity was calculated by the ratio of the mass of loaded protein to the mass of microsphere. The scanning electron microscopy images of growth factor loaded microspheres were observed by FE-SEM, (S-4700, Hitachi, Japan). Dynamic Mechanical Analysis: The modulus of the polymer aqueous solution (6.8 wt%) was investigated by dynamic rheometry (Rheometer RS 1; Thermo Haake, Germany) at 4 and 37 °C. The aqueous polymer solution was loaded between parallel plates with 25 mm in diameter and a gap of 0.5 mm. Water-soaked cotton was placed inside a chamber to minimize water evaporation. The data were collected under a controlled stress (4.0 dyn cm−2) and frequency of 1.0 rad s−2. In Vitro Release of Growth Factors: The growth factor-loaded microspheres were suspended in PEG-L-PA aqueous solution (0.2 mL, 6.8 wt%) in a 2 mL vial. After incubating the vial at 37 °C for 30 min to form a gel, phosphate buffered saline (1.0 mL, pH 7.4) at 37 °C was added on the gel. The system was placed in a constant shaking bath with 50 rpm at 37 °C. At a predetermined time interval, the released medium (1.0 mL of phosphate buffered saline) was replaced. The concentration of growth factors, BDNF and NGF, was quantified by the Nano Orange Protein Quantification Kit (Invitrogen, USA) according to the manufacture’s protocol. As a control, the release profile of growth factors (BDNF or NFG) from the in situ formed PEG-L-PA thermogel prepared from the PEG-L-PA aqueous solution (6.8 wt%) was compared in the same manner. For the control experiment, 20 ng of BDNF and 20 ng of NFG were mixed with PEG-L-PA aqueous solution (0.2 mL, 6.8 wt%), followed by heating the mixture to 37 °C to form a gel in situ. Phosphate buffered saline (1.0 mL, pH 7.4) at 37 °C was added on the gel and followed the same protocol with the above microsphere incorporating hydrogel. 3D Cell Culture: Human TMSCs were received from Ewha Womans University Medical School. TMSCs were isolated from palatine tonsils of 11 years old female donor (IRB approval code: ETC 11–53–02) at the Ewha Womans University Mokdong Hospital (Seoul, South Korea) following the ethical guidelines of the University.[82] After obtaining the informed consent form from the donor, the tonsils were collected from the patient by tonsillectomy. Cells were 2D cultured on the polystyrene culture plates over phase 5 for proliferation of the cells in high glucose Dulbecco’s modified eagle media (DMEM, Hyclone, USA) supplemented with 10% (v/v) fetal bovine serum (FBS, Hyclone, USA), 1.0% (v/v) Hyclone penicillin/streptomycin solution, and 1.0% (v/v) Gibco antibiotic-antimitotic solution under 5% CO2 atmosphere. Neuronal differentiation was studied by a two-step protocol. First, cells were maintained with serum free DMEM/F12 (Hyclone, USA) supplemented with 1.0% (v/v) Hyclone penicillin/streptomycin solution and 1.0% (v/v) Gibco antibiotic-antimitotic solution for 2 d before neuronal induction. Then, the harvested cells (passage 6, 2.0 × 105 cells) were mixed with PEG-L-PA aqueous solution (6.8 wt%, 0.2 mL), and were incubated at 37 °C in 24 well plate culture plates. Serum free DMEM/F12 media at 37 °C were added on the gels and replaced every other day. The cells were 3D cultured under three different hydrogel systems (0.2 mL/culture system); PEG-L-PA hydrogel systems in the absence of neuronal growth


factors (P), PEG-L-PA hydrogel systems loaded with four different growth factors of EGF, bFGF, BDNF, and NGF of 100 ng mL−1 concentrations each (GP), PEG-L-PA hydrogel systems with two growth factors (EGF and bFGF) of 100 ng mL−1 concentrations each loaded in the hydrogel and the other two growth factor (BDNF and NGF) loaded microspheres being incorporated in the same hydrogel (MP). Therefore, the amount of growth factors per each cell culture system was 20 ng. The last protocol (MP) provided sustained release of the two growth factors from each of the microspheres. Cell Viability and Proliferation: Cell viability in the P, GP, and MP systems was determined by the Live/Dead kit (Life Technologies, USA). Cells were incubated in the solution of 4 × 10−9 M ethidium homodimer-1 (EthD-1) and 2 × 10−9 M calcein acetoxy methyl ester (AM) in phosphate buffered saline. Images of the cells were taken under a Nikon Eclipse E600 microscope using Lucia software. RNA Extraction and qPCR: Total RNA was extracted from the TMSCs encapsulated in hydrogels using TRIZOL, (Invitrogen, USA) by the manufacturer’s protocol. The concentration of RNA was determined by Nano drop 2000 spectrophotometer (Thermoscientific, USA) and cDNA was synthesized by ReverTra Ace qPCR RT kit (Toyobo, Japan). Then real-time PCR was performed with CFX 96 system using the SYBR green super mix. The mRNA expression of different neuronal markers was normalized by glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) (housekeeping gene). The PCR primers used in this study are listed in Table 1. Immunofluorescence Study: To determine protein expression, immunofluorescence was studied with anti-MAP2, anti-NF-M, and anti-GFAP (Abcam, UK) neuronal markers. The samples were fixed in acetone and permeabilized by Triton (0.5%), and then blocked with bovine serum albumin (Sigma, USA). Cells were immunostained with primary antibodies. After washing with phosphate buffered saline, the cells were incubated with corresponding secondary antibody such as Dylight 549 and Dylight 488 (Abcam, UK). Then, the cells were treated with 4′6′-diamidino-2-phenyle indole (DAPI) (Molecular probes, USA) for staining the nucleus. Fluorescence images were taken by the Olympus 1×71 fluorescence microscope with Olympus DP2-DSW software. Statistical Analysis: Data are expressed as means ± standard deviation from the triplicate experiment. The differences in the values were evaluated by the one-way ANOVA with Tukey tests. The significance in differences was expressed by ** (p < 0.05) or * (p < 0.01).

Table 1. Primer sequences. Primera)

Sequence (5′ to 3′)

Product [bp]

Nurr-1

S: GCACAAGTATTACACATCAGA

102

NSE

S: TGAGTCTGCAGTCCCGAGAT

A: CATCAACGGTACATACAACA 197

A: CGCTGTTTGTCTCCATCCCT MAP2

S: GGAACAAGGACGGAGTAA

144

A: GTGCTGAAGAAGAGATAGAAC NF-M

S: CCAATCACAATATCCAGTAAGAT

116

A: GACTTCTCATCCTCCACTT GFAP

S:TGGCAGAGCTTGTTAGTGGTAAAGG

93

A: GTGAGACAGAGGCTGCTGCTTG GAPDH

S: ATGGGGAAGGTGAAGGTCG

70

A: TAAAAGCAGCCCTGGTGACC a)Nurr-1,

NSE, MAP2, NF-M, GFAP, and GAPDH indicate nuclear receptor related protein-1, neuron specific enolase, microtubule associated protein-2, neurofilament-M, glial fibrillary acidic protein, and glyceraldehyde-3-phosphate-dehydrogenase, respectively




Supporting Information is available from the Wiley Online Library or from the author.

Acknowledgements This work was supported by the National Research Foundation of Korea Grant funded by the Korean Government (MSIP: 2012M3A9C6049835 and 2014M3A9B6034223). Received: March 31, 2015 Revised: April 30, 2015 Published online: June 1, 2015

[1] M. S. Forman, J. Q. Trojanowski, V. M. Y. Lee, Nat. Med. 2004, 10, 1055. [2] T. Huang, D. He, G. Kleiner, J. Kuluz, J. Spinal Cord Med. 2007, 30, S35. [3] H. Wichterle, I. Lieberam, J. A. Porter, T. M. Jessell, Cell 2002, 110, 385. [4] S. I. Nishikawa, L. M. Jakt, T. Era, Nat. Rev. Mol. Cell Biol. 2007, 8, 502. [5] T. T. Wang, M. Tio, W. Lee, W. Beerheide, G. Udolph, Biochem. Biophys. Res. Commun. 2007, 357, 1021. [6] T. Zahir, Y. F. Chen, J. F. Macdonald, N. Leipzig, C. H. Tator, M. S. Shoichet, Stem Cells Dev. 2009, 18, 1423. [7] E. Anghileri, S. Marconi, A. Pignatelli, P. Cifelli, M. Galié, A. Sbarbati, M. Krampera, O. Belluzzi, B. Bonetti, Stem Cells Dev. 2008, 17, 916. [8] B. Y. Hu, J. P. Weick, J. Yu, L. X. Ma, X. Q. Zhang, J. A. Thomson, S. C. Zhang, Proc. Natl. Acad. Sci. U.S.A. 2010, 107, 4340. [9] M. S. Rao, M. P. Mattson, Mech. Ageing Dev. 2001, 122, 734. [10] Y. S. Lim, J. C. Lee, Y. S. Lee, B. J. Lee, S. G. Wang, Clin. Exp. Otorhinolaryngol. 2012, 5, 93. [11] K. H. Ryu, K. A. Cho, H. S. Park, J. Y. Kim, S. Y. Woo, I. Jo, Y. H. Choi, Y. M. Park, S. C. Jung, S. M. Chung, B. O. Choi, H. S. Kim, Cytotherapy 2012, 14, 1202. [12] S. Q. Chen, Q. Cai, Y. Y. Shen, X. Y. Cai, H. Y. Lei, Int. J. Dev. Neurosci. 2014, 38, 78. [13] J. Sanchez-Ramos, S. Song, F. Cardozo-Pelaez, Exp. Neurol. 2000, 164, 256. [14] X. Long, M. Olszewski, W. Huang, M. Kletzel, Stem Cells Dev. 2005, 14, 69. [15] B. G. Choi, M. H. Park, S. H. Cho, M. K. Joo, H. J. Oh, E. H. Kim, K. Park, D. K. Han, B. Jeong, Biomaterials 2010, 31, 9272. [16] M. M. Caron, P. J. Emans, M. M. Coolsen, L. Voss, D. A. Surtel, A. Cremers, L. W. Van Rhijn, T. J. Welting, Osteoarthritis Cartilage 2012, 20, 1178. [17] H. Gu, Z. Yue, W. S. Leong, B. Nugraha, L. P. Tan, Regen. Med. 2010, 5, 253. [18] Z. Khosravizadeh, S. Razavi, H. Bahramian, M. Kazemi, J. Biomed. Mater. Res. B Appl. Biomater. 2014, 102, 755. [19] U. Freudenberg, A. Hermann, P. B. Welzel, K. Stirl, S. C. Schwarz, M. Grimmer, A. Zieris, W. Panyanuwat, S. Zschoche, D. Meinhold, A. Storch, C. Werner, Biomaterials 2009, 30, 5060. [20] L. Cai, J. Lu, V. Sheen, S. Wang, Biomacromolecules 2012, 13, 1674. [21] E. R. Lorden, H. M. Levinson, K. W. Leong, Drug Delivery Transl. Res. 2015, 5, 186. [22] M. H. Park, M. K. Joo, B. G. Choi, B. Jeong, Acc. Chem. Res. 2012, 45, 433.


[23] H. J. Moon, D. Y. Ko, M. H. Park, M. K. Joo, B. Jeong, Chem. Soc. Rev. 2012, 4, 4883. [24] M. G. Hanson, S. Shen, A. P. Wiemelt, F. A. McMorris, B. A. Barres, J. Neurosci. 1998, 18, 7371. [25] K. C. Choi, D. S. Yoo, K. S. Cho, P. W. Huh, D. S. Kim, C. K. Park, J. Korean Neurosurg. Soc. 2008, 44, 381. [26] L. A. Flanagan, Y. E. Ju, B. Marg, M. Osterfield, P. A. Janmey, NeuroReport 2002, 13, 2415. [27] Y. Y. Choi, J. H. Jang, M. H. Park, B. G. Choi, B. Chi, B. Jeong, J. Mater. Chem. 2010, 20, 3421. [28] B. Yeon, M. H. Park, H. J. Moon, S. J. Kim, Y. W. Cheon, B. Jeong, Biomacromolecules 2013, 14, 3266. [29] S. J. Kim, M. H. Park, H. J. Moon, J. H. Park, D. Y. Ko, B. Jeong, ACS Appl. Mater. Interfaces 2014, 6, 17043. [30] C. H. Zheng, J. Q. Gao, Y. P. Zhang, W. Q. Liang, Biochem. Biophys. Res. Commun. 2004, 323, 1327. [31] D. W. van Krevelebn, Properties of Polymers, 2nd ed., Elsevier, New York 1980, p 267. [32] L. Yu, Z. Zhang, H. Zhang, J. Ding, Biomacromolecules 2010, 11, 2169. [33] S. Zhang, D. J. Alvarez, M. V. Sofroniew, T. J. Deming, Biomacromolecules 2015, 16, 1331. [34] M. H. Park, Y. Yu, H. J. Moon, D. Y. Ko, H. S. Kim, H. J. Lee, K. H. Ryu, B. Jeong, Adv. Healthcare Mater. 2014, 3, 1782. [35] S. Ahn, E. C. Monge, S. C. Song, Langmuir 2009, 25, 2407. [36] T. Potta, C. Chun, S. C. Song, Macromol. Rapid Commun. 2010, 31, 2133. [37] J. Zhao, B. Guo, P. X. Ma, RSC Adv. 2014, 4, 17742. [38] J. Lee, K. Y. Lee, Macromol. Biosci. 2009, 9, 676. [39] J. Xu, T. M. Filion, F. Prifti, J. Song, Chem. Asian J. 2011, 6, 2730. [40] B. Neuhuber, G. Gallo, L. Howard, L. Kostura, A. Mackay, I. Fischer, J. Neurosci. Res. 2004, 77, 192. [41] M. J. Phillips, D. C. Otteson, Invest. Ophthalmol. Visual Sci. 2011, 52, 1439. [42] T. Tondreau, L. Lagneaux, M. Dejeneffe, M. Massy, C. Mortier, A. Delforge, D. Bron, Differentiation 2004, 72, 326. [43] P. Bossolasco, L. Cova, C. Calzarossa, S. G. Rimoldi, C. Borsotti, G. L. Deliliers, V. Silani, D. Soligo, E. Polli, Exp. Neurol. 2005, 193, 312. [44] D. B. Kaplamadzhiev, H. Hisha, Y. Adachi, S. Ikehara, A. B. Tonchev, N. B. Boneva, I. V. Pyko, M. Kikuchi, M. Nakaya, T. Wakayama, S. Iseki, T. Yamashima, Bioscience Trends 2010, 4, 119. [45] S. C. Odila, Q. H. Juand, W. D. Le, M. P. Smidt, J. J. Cox, F. D. Mayo, J. P. H. Burbach, O. M. Conneely, Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 4013. [46] T. Zahir, Y. F. Chen, J. F. McDonald, N. Leipzig, C. H. Tator, M. S. Shoichet, Stem Cells Dev. 2009, 18, 1423. [47] M. Cristofanilli, S. Thanos, J. Brosius, S. Kindler, H. Tiedge, J. Mol. Biol. 2004, 341, 927. [48] C. B. Johansson, S. Momma, D. L. Clarke, M. Risling, U. Lendahl, J. Frisen, Cell 1999, 96, 25. [49] E. Karaoz, B. N. Dogan, A. Aksoy, G. Gacar, S. Akyuz, S. Ayhan, Z. S. Genc, S. Yuruker, G. Duruksu, P. C. Demircan, A. E. Sariboyaci, Histochem. Cell Biol. 2010, 133, 95. [50] H. Song, C. F. Stevens, F. H. Gage, Nature 2002, 417, 39. [51] L. Yu, J. Ding, Chem. Soc. Rev. 2008, 37, 1473. [52] Q. Q. Dou, S. S. Liow, E. Ye, R. Lakshminarayanan, X. J. Loh, Adv. Healthcare Mater. 2014, 3, 977. [53] X. J. Loh, J. Li, Expert Opin. Ther. Patents 2007, 17, 965. [54] D. Overstreet, D. Dutta, S. E. Stabenfeldt, B. L. Vernon, J. Polym. Sci. Part B: Polym. Phys. 2012, 50, 881. [55] B. H. Lee, Y. M. Lee, Y. S. Sohn, S. C. Song, Macromolecules 2002, 35, 3876. [56] Z. Zhang, Y. Lai, L. Yu, J. Ding, Biomaterials 2010, 31, 7882. [57] G. Chang, T. Ci, L. Yu, J. Ding, J. Controlled Release 2011, 156, 27.



FULL PAPER

Supporting Information

1573

www.advhealthmat.de

FULL PAPER


1574

[58] T. Ci, L. Chen, L. Yu, J. Ding, Sci. Rep. 2014, 4, 5473. [59] J. Sanchez-Ramos, S. Song, F. Cardozo-Pelaez, C. Hazzi, T. Stedeford, A. Willing, T. B. Freeman, S. Saporta, W. Janssen, N. Patel, D. R. Cooper, P. R. Sanberg, Exp. Neuro. 2000, 164, 256. [60] D. Woodbury, E. J. Schwarz, D. J. Prockop, B. Ira, J. Neurosci. Res. 2000, 61, 370. [61] W. Deng, M. Obrocka, I. Fischer, D. J. Prockop, Biochem. Biophys. Res. Commun. 2001, 282, 152. [62] D. X. Qian, H. T. Zhang, M. Xu, X. D. Jiang, R. X. Xu, Neurochem. Res. 2010, 35, 579. [63] S. I. Tazuke, L. C. Giudice, Seminar Reprod. Endocrinol. 1996, 14, 245. [64] D. D. Carson, I. Bagchi, S. K. Dey, Dev. Biol. 2000, 223, 237. [65] H. Ogita, Y. Takai, Int. Rev. Cytol. 2008, 265, 54. [66] T. Osathanon, N. Nowwarote, P. Pavasant, J. Cell Biochem. 2011, 112, 1816. [67] C. Vicario-Abejon, C. Collin, R. D. McKay, M. Segal, J. Neurosci. 1998, 18, 7271. [68] S. Wang, L. Cai, in Biomaterials, ACS Symposium Series, Vol. 1054 (Eds: A. S. Kulshrestha, A. Mahapatro, L. A. Henderson), American Chemical Society, Washington DC 2010, Ch. 3. [69] S. Skelton, M. Bostwick, K. O’Connor, S. Konst, S. Casey, B. P. Lee, Soft Matter 2013, 9, 3825. [70] R. A. Emily, J. L. Kyle, B. B. Kimberly, Neurosci. Res. 2012, 72, 213.


[71] K. Saha, A. J. Keung, E. F. Irwin, Y. Li, L. Little, D. V. Schaffer, K. E. Healy, Biophys. J. 2008, 95, 4426. [72] S. Jang, H. H. Cho, Y. B. Cho, J. S. Park, H. S. Jeong, BMC Cell Biol 2010, 11, 25. [73] P. Tropel, N. Platet, J. C. Platel, D. Noel, M. Albrieux, B. Alim-Louis, F. Berger, Stem Cells 2006, 24, 2876. [74] T. Tondreau, M. Dejeneffe, N. Meuleman, B. Stamatopoulos, A. Delforge, P. Martiat, D. Bron, L. Lagneaux, BMC Genomics 2008, 9, 11. [75] M. P. Prabhakaran, J. R. Venugopal, S. Ramakrishna, Biomaterials 2009, 30, 4996. [76] J. H. Lee, J. Y. Lee, S. H. Yang, E. J. Lee, H. W. Kim, Acta Biomater. 2014, 10, 4425. [77] W. Shi, D. Nie, G. Jin, W. Chen, L. Xia, X. Wu, X. Su, X. Xu, L. Ni, X. Zhang, X. Zhang, J. Chen, Biomaterials 2012, 33, 3119. [78] S. Tada, E. Timucin, T. Kitajima, O. U. Sezerman, Y. Ito, Biomaterials 2014, 35, 3497. [79] J. Kang, S. Tada, M. Sakuragi, H. Abe, R. Ito, J. Ishikawa, S. Kurata, T. Kitajima, T. I. Son, T. Aigaki, Y. Ito, Biomaterials 2013, 34, 9747. [80] L. S. Wang, J. E. Chung, P. P. Y. Chan, M. Kurisawa, Biomaterials 2010, 31, 1148. [81] K. L. Spiller, G. Vunjak-Novakovic, Drug Delivery Transl. Res. 2015, 5, 101. [82] J. Y. Kim, H. S. Kim, K. H. Ryu, S. Y. Woo, Cytokine 2012, 59, 214.



3D culture of tonsil-derived mesenchymal stem cells in poly(ethylene glycol)-poly(L-alanine-co-L-phenyl alanine) thermogel.

Neuronal Differentiation of Human Mesenchymal Stem Cells Using Exosomes Derived from Differentiating Neuronal Cells.

Immune suppressive effects of tonsil-derived mesenchymal stem cells on mouse bone-marrow-derived dendritic cells.

Myogenic differentiation potential of human tonsil-derived mesenchymal stem cells and their potential for use to promote skeletal muscle regeneration.

PEG-Poly(L-alanine) thermogel as a 3D scaffold of bone-marrow-derived mesenchymal stem cells.

Differentiation of tonsil-tissue-derived mesenchymal stem cells controlled by surface-functionalized microspheres in PEG-polypeptide thermogels.

GATA2 regulates differentiation of bone marrow-derived mesenchymal stem cells.

Immunomodulatory effect of tonsil-derived mesenchymal stem cells in a mouse model of allergic rhinitis.

Effects of donor age, long-term passage culture, and cryopreservation on tonsil-derived mesenchymal stem cells.

Therapeutic potential of tonsil-derived mesenchymal stem cells in dextran sulfate sodium-induced experimental murine colitis.

Biomimetic hybrid nanofibrous substrates for mesenchymal stem cells differentiation into osteogenic cells.

Tonsil-derived mesenchymal stem cells ameliorate CCl4-induced liver fibrosis in mice via autophagy activation.

AP2α transcriptional activity is essential for retinoid-induced neuronal differentiation of mesenchymal stem cells.

The effects of secretion factors from umbilical cord derived mesenchymal stem cells on osteogenic differentiation of mesenchymal stem cells.

Interaction between neural stem cells and bone marrow derived-mesenchymal stem cells during differentiation.

bFGF promotes adipocyte differentiation in human mesenchymal stem cells derived from embryonic stem cells.

Minocycline Loaded Hybrid Composites Nanoparticles for Mesenchymal Stem Cells Differentiation into Osteogenesis.

Differentiation and Molecular Properties of Mesenchymal Stem Cells Derived from Murine Induced Pluripotent Stem Cells Derived on Gelatin or Collagen.

Characterization of long-term in vitro culture-related alterations of human tonsil-derived mesenchymal stem cells: role for CCN1 in replicative senescence-associated increase in osteogenic differentiation.

Neural differentiation of bone marrow-derived mesenchymal stem cells: applicability for inner ear therapy.

The canine epiphyseal-derived mesenchymal stem cells are comparable to bone marrow derived-mesenchymal stem cells.

A cocktail method for promoting cardiomyocyte differentiation from bone marrow-derived mesenchymal stem cells.

Differentiation of Bone Marrow: Derived Mesenchymal Stem Cells into Hepatocyte-like Cells.

Differentiation of canine adipose tissue-derived mesenchymal stem cells towards endothelial progenitor cells.