Medical Mycology, 2014, 52, 387–396 doi: 10.1093/mmy/myt033 Advance Access Publication Date: 7 March 2014 Original Article
Original Article
Microsporum aenigmaticum sp. nov. from M. gypseum complex, isolated as a cause of tinea corporis ˇ a´ 3 , Radim Dobia´ sˇ 3 Vit Hubka1,2,∗ , Stanislava Dobia´ sov and Miroslav Kolaˇr´ık1,2 Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
1
Department of Botany, Faculty of Science, Charles University in Prague, Czech Republic, 2 Laboratory of ˇ a´ 1083, 142 20 Praha 4, Fungal Genetics and Metabolism, Institute of Microbiology of the AS CR, V´ıdensk 3 Czech Republic and Laboratory of Clinical Mycology, Institute of Public Health, Ostrava, Czech Republic
*To whom correspondence should be addressed. Vit Hubka, Department of Botany, Faculty of Science, Charles University in Prague, Benatska 2, 128 01 Prague 2, Czech Republic. Tel: (+420) 739663218; Fax: (+420) 29644 2347; E-mail: [email protected] The EMBL (European Molecular Biology Laboratory database) accession numbers for the internal transcribed spacer rDNA, β-tubulin (benA), RNA polymerase II (RPB2),and actin of the ex-holotype strain of the Microsporum aenigmaticum sp. nov. are HG518404, HG518421, HG793055, and HG793060, respectively. The MycoBank (http://www.mycobank.org) accession number for Microsporum aenigmaticum sp. nov. is MB 807060. Received 23 September 2013; Revised 26 November 2013; Accepted 20 December 2013
Abstract An undescribed Microsporum species was isolated from skin scales recovered from a 40-mm large, annular, scaling lesion on the wrist of a 46-year-old woman. The risk factors for dermatophyte infection in the patient were frequent work in the garden, hunting, and contact with dogs and horses. Direct microscopic examination of the scales revealed the presence of dermatophyte hyphae; when the samples were cultured, a morphologically similar fungus grew on all slants in pure culture. Both of these findings strongly suggested that the isolate was the true causal agent of infection. The possible geophilic nature of the species was based on phylogenetic analysis (internal transcribed spacer region of rDNA and β-tubulin gene) that placed it in between species of the M. gypseum complex. However, its divergencies from all other Microsporum species exceeded 4% base pairs. Based on β-tubulin phylogeny, the isolated species is a sister to M. gypseum. The species produces abundant chlamydospores and clumps of hyphae similar to those of ascomatal primordia but no conidia and ascospores. The species was unable to grow at 37◦ C and does not grow on T6 basal medium, which is unlike other Microsporum species; hair perforation and urease tests were positive. The addition of histidine to the T6 medium resulted in rapid growth of the fungus. The phylogenetic evidence, morphology, growth parameters, and physiology justified the proposal that the isolate is a new species, M. aenigmaticum, sp. nov. Key words: Arthroderma, geophilic dermatophytes, keratinophilic fungi, Onygenales, skin infection, sterile fungi.
C The Author 2014. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology.
All rights reserved. For permissions, please e-mail: [email protected]
387
388
Introduction
Case report In May 2012, a 46-year-old Czech female with a skin lesion on her right dorsal wrist was examined at the Dermatology Unit, Hav´ırˇ ov, Czech Republic. The erythematous patch had an annular shape, diameter of 40 mm, was nonitchy, sharply demarcated, plain with scaling at the margin, without exudation and pustules, and red in the center and pink at the margin. The lesion had appeared 4 months prior to visiting a doctor and initially consisted of three 6-mm wide lesions that later merged to form a single circular lesion. The patient was otherwise healthy and was not regularly taking any medications. Before visiting the dermatologist, she regularly applied 1% ciclopirox olamine solution on the lesion, but this did not result in obvious clinical im-
provement. She worked in her garden, took care of horses, hunted, and worked with hunted animals. She owned a dog breeding station and worked as their dealer. The patient also often visited swimming pools and saunas, but she did not remember any previous injuries around the lesion area or have a history of foreign travels. The mycological examination was performed during the first visit (May 2012), and topical Castellani’s solution was administered (once daily). Direct microscopic examination of epithelial scales (10% KOH with Parker ink) revealed the presence of septate, branching hyphae suggestive of dermatophyte infection. Material from scrapings was inoculated onto two slants of Mycosel agar (Becton, Dickinson and Company, Cockeysville, MD, U.S.A.; containing 400 mg/l of cycloheximide) and one slant of Sabouraud glucose agar (SGA) with thiamine hydrochloride (100 mg/l; Thiabene, Ratiopharm, Gmbh, Ulm, Germany); all three tubes were incubated at 26◦ C in the dark. The same species was recovered on all slants in pure culture and tolerated cycloheximide in medium. Improvement appeared after 3 weeks of treatment; 1% clotrimazole cream (twice daily) was administered at the second visit. The patient reported full remission in May 2013 (telephone conversation only). Initially the isolated species was tentatively identified as T. tonsurans/T. equinum based on the frequent occurrence of chlamydospore-like cells in culture, lack of conidial formation, no growth on T6 medium without histidine, and reported contact of the patient with horses in anamnesis. The isolate was sent to the Department of Botany, Charles University, Prague, where further morphological, physiological, and molecular analyses were performed.
Materials and methods Cultivation, morphology, physiology, and preservation The isolates were grown on a set of media including malt extract agar (MEA; Oxoid, Basingstoke, UK), SGA [13], potato dextrose agar (PDA; Roth, Karlsruhe, Germany), and Takashio medium (see below) with 3% NaCl (w/v). A second set of the media that was supplemented by sterilized blond child hairs placed on the medium surface consisted of MEA, Takashio medium (1 g peptone, 2 g glucose, 1 g MgSO4 ·7 H2 O, 1 g KH2 PO4 , 20 g agar, and 1 liter distilled water) and water agar (20 g agar and 1 liter distilled water). The plates were incubated at 25◦ C in the dark and checked weekly for 3 months. Growth at 25, 27, 30, 33, and 37◦ C was evaluated using MEA and assessed after 7 days. Physiological tests with T1–T7 agar media were conducted according to the procedure described previously [14,15]; growth on commercial (HiMedia, Mumbai, India) and laboratory-made media was tested. In vitro hair
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Dermatophytes are among the most investigated microorganisms because they cause infections in a substantial portion of the worldwide human and animals populations. The taxonomy of dermatophytes has never been stable, even for relatively small numbers of medically important species (approximately 20–30 species). Since the advent of molecular methods, many substantial taxonomic changes have been made, but only a limited number of new species has been proposed relative to other groups of pathogenic fungi. The diversity of primary pathogenic species has been exhaustively explored, and the numbers of these species were reduced based on data generated through molecular methods. However, this does not appear to be the situation relative to geophilic dermatophytic species. New, presumably geophilic, species have been isolated from clinical material [1–3], as well as from their natural environment [4]. However, some of these species have never been recovered from their probable natural habitat of the soil and are known only by their isolation from clinical material [1,3]. This is also true for some nondermatophytic members of the family Onygenales, that is, Nannizziopsis, Paranannizziopsis, Ophiodiomyces, Chrysosporium, Onychocola, and Auxarthron [5–11], that are known only from human and animal clinical specimens. During a two-year molecular–epidemiological study that focused on dermatophytes in the Czech Republic (with exception of Trichophyton rubrum) [12], a species with unusual morphological and physiological characteristics was isolated from a case of tinea corporis. This species had a unique fingerprinting pattern and internal transcribed spacer (ITS) rDNA sequence, as well as distinctive morphological, physiological, and molecular features that suggested that it was a previously undescribed species. This species is presented here based on a polyphasic approach.
Medical Mycology, 2014, Vol. 52, No. 4
Hubka et al.
perforation and urease tests were performed according to Ajello and Georg [16] and Philpot [17], respectively. The case isolate of Microsporum was deposited into the Culture Collection of Fungi (CCF), Department of Botany, Charles University, Prague, Czech Republic (CCF 4608), and into the Centraalbureau voor Schimmelcultures (CBS), Utrecht, Netherlands (CBS 134549). A dried culture was deposited into the herbarium of the Mycology Department, National Museum, Prague, Czech Republic (PRM 922698– 922701).
Molecular studies
Results Molecular analysis The fingerprinting pattern of the isolate CCF 4608 ( = CBS 134549) due to amplification with primer M13-core was different from that of other dermatophytes that are com-
monly recovered from clinical material in the Czech Republic (data not shown). The comparison of fingerprinting patterns among species of the M. gypseum complex is shown in Supplementary Fig. 1. Using the BLAST similarity search, the ITS region of strain CCF 4608 (HG518404) showed 94% (449/477 bp) similarity to the ex-type strain of M. fulvum CBS 287.55T (AJ000627), while other species showed similarity equal or lower than 93%. The partial β-tubulin gene sequence of CCF 4608 (HG518421) shared 96% similarity (323/336 bp) with the ex-type strain of M. gypseum CBS 258.61T (HG518420). The partial RPB2 gene was successfully amplified only for several members of the M. gypseum complex (HG793055–HG793059) and therefore was not used for phylogenetic analysis. The RPB2 sequence of CCF 4608 (HG793055) showed 98% (1014/1030) similarity to M. gypseum CBS 118893 (XM003170096). The partial sequence of the actin gene was amplified only for CCF 4608 (HG793060) and showed 95% (142/149) similarity to M. gypseum SM 8377 (AB593407). The isolate CCF 4608 created a well-supported clade in phylogenetic analysis (Fig. 1) together with geophilic species of the M. gypseum complex, namely, M. fulvum, M. gypseum, A. incurvatum, M. duboisii, M. praecox, M. persicolor, and M. nanum. However, the interspecies relationships were not resolved due to low bootstrap branch supports. Microsporum fulvum, M. praecox, and M. gypseum were the most closely related species in pairwise sequence comparison (Table 1). An additional locus encoding β-tubulin (benA) was sequenced for the above-mentioned species related to CCF 4608. Phylogenetic analysis strongly supported the position of CCF 4608 as a sister species to M. gypseum (Fig. 1), with the highest level of sequence similarity in pairwise sequence comparison followed by M. fulvum (Table 2). Low sequence similarity of the ITS region and partial β-tubulin sequences of CCF 4608 to other Microsporum species together with the results of the phylogenetic analysis suggested that the isolate constituted a previously unreported species.
Taxonomy Microsporum aenigmaticum. Hubka, Dobiaˇ ´ sova´ & M. Kolaˇr´ık sp. nov., MB807060, Figs 2 and 3, Supplementary Figs. 2 and 3. Diagnosis: The species shows slower growth parameters on all common media in comparison with the majority of species from M. gypseum complex (Fig. 4, Supplementary Table 1); does not grow at 37◦ C or on T6 basal medium. The reverse of colonies is yellow or orange. Conidia and ascospores were not observed in culture. The species produces abundant chlamydospores, aggregates of hyphae
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
DNA was isolated using ArchivePure DNA yeast and Gram2+ kit (5PRIME Inc., Gaithersburg, MD, USA) as described by Hubka et al. [18]. Polymerase chain reaction (PCR) conditions used for amplification of the ITS region (primers ITS1F and NL4) and partial benA gene (encoding β-tubulin; primers Bt2a and Bt2b) were as described by Hubka et al. [19]. Partial RNA polymerase II gene sequence (RPB2) was amplified using primers fRPB2–5F (5 -GAYGAYMGWGATCAYTTYGG) and fRPB2–7cR (5 - CCCATRGCTTGYTTRCCCAT) and touchdown cycling conditions [20]. A partial actin gene sequence was amplified using primers ACT-512F (5 ATGTGCAAGGCCGGTTTCGC) and ACT-783R (5 TACGAGTCCTTCTGGCCCAT) and an annealing temperature of 60◦ C. PCR product purification and sequencing were performed at Macrogen Europe (Amsterdam, The Netherlands) using the terminal primers for the benA, actin, and RPB2 genes and the ITS1F and ITS4 primers for the ITS region. The sequences were inspected and aligned as described by Hubka and Kolaˇr´ık [20]. Maximum-likelihood (ML) analysis was conducted in MEGA5.2 [21] with 1000 bootstrap replicates. Parameters for ML analysis were estimated in MEGA5.2, which proposed the K2+G+I model as the best fit for both ITS as well as benA datasets. Additional alignment characteristics are listed in the legend of Fig. 1. Sequences were deposited into the EMBL (European Molecular Biology Laboratory) database under accession numbers listed in Fig. 1 in bold font. PCR fingerprinting was performed using the phage M13-core sequence as an oligonucleotide primer; the conditions for amplification were as described by Novakov a´ et al. [22]. ´
389
390
Medical Mycology, 2014, Vol. 52, No. 4
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Figure 1. Maximum-likelihood (ML) trees showing relationships of the case isolate to other Microsporum species. Nodes supported at 95% bootstrap or higher are double-thick; ex-type isolates are designated by a superscript T. Internal transcribed spacer (ITS) alignment: 554 positions, 193 variable, ML tree with the highest log likelihood (–1499.9) is shown; β-tubulin alignment: 357 positions, 118 variable, ML tree with the highest log likelihood (–1212) is shown; Arthroderma melis CBS 669.80T and Trichophyton onychocola CBS 132920T were used as outgroups.
resembling primordia of ascomata, and racquet hyphae. Molecular data (fingerprinting with M13-core primer, sequences of the ITS rDNA region and β-tubulin) clearly distinguish this species from all other Microsporum species. Type: Czech Republic, Ostrava, skin lesion on the wrist of 46-year-old woman, May 2012, Dr Stanislava Dobiaˇ ´ sova, ´
DMF 1545/12 (PRM 922698, a dried herbarium specimen – holotype; PRM 922699–922701 – isotypes; CCF 4608T = CBS 134549T – culture ex-holotype). Description: Colonies on SGA attaining 24–29 mm diam in 14 d at 25◦ C; ochraceous or pale buff; central part of the colony elevated and irregularly furrowed; marginal parts
Hubka et al.
391
Table 1. Pairwise sequence similarity (%) of the internal transcribed spacer rDNA region of Microsporum species related to M. aenigmaticum. Species and isolate number M. aenigmaticum, CCF 4608 M. fulvum, CCF 4684 M. praecox, CBS 288.55 M. gypseum, CBS 258.61 M. duboisii, CBS 349.49 M. persicolor, CCF 4541 A. incurvatum, CBS 174.64 M. nanum, CBS 322.61
CCF 4608
CCF 4684
CBS 288.55
CBS 258.61
CBS 349.49
CCF 4541
CBS 174.64
93.0 92.1 91.9 91.2 89.5 84.1 83.9
93.7 92.4 93.0 90.3 85.9 84.9
91.2 92.1 92.5 85.6 85.9
95.3 92.3 83.8 82.0
93.2 84.1 82.7
82.0 82.0
87.2
Each pair of sequences was aligned using the ClustalW algorithm, with the default setting as implemented in Bioedit 7.2 before sequence similarity was computed. CBS, Centraalbureau voor Schimmelcultures, Utrecht, Netherlands; CCF, Culture Collection of Fungi, Department of Botany, Charles University.
Species and isolate number M. aenigmaticum, CCF 4608 M. gypseum, CBS 258.61 M. fulvum, CCF 4684 A. incurvatum, CBS 174.64 M. duboisii, CBS 349.49 M. persicolor, CCF 4541 M. praecox, CBS 288.55
CCF 4608
CBS 258.61
CCF 4684
CBS 174.64
CBS 349.49
CCF 4541
95.6 92.8 91.2 90.2 87.3 86.3
92.5 90.9 89.4 86.8 86.6
93.4 91.0 91.4 91.7
92.1 89.4 88.3
87.9 86
89.7
Each pair of sequences was aligned using the ClustalW algorithm, with the default setting as implemented in Bioedit 7.2 before sequence similarity was computed. CBS, Centraalbureau voor Schimmelcultures, Utrecht, Netherlands; CCF, Culture Collection of Fungi, Department of Botany, Charles University.
plane; the aerial mycelium forms dense but low layer; reverse orange–yellow. Colonies on MEA attaining 21–34 mm diam in 14 d at 25◦ C; colony plane and whitish, reverse yellow. The growth at 30◦ C on MEA and SGA comparable to that at 25◦ C. No growth at 37◦ C. Colonies on PDA (Supplementary Fig. 2) attaining 27–35 mm diam in 14 d at 25◦ C; cottony, pale buff in the center, white at the margins, reverse intensive yellow to orange in the center. Growth on Takashio medium with 3% NaCl (w/v) slow (< 25 mm after 6 weeks at 25◦ C); colonies color and reverse yellow (Supplementary Fig. 2). Vegetative mycelium consists of hyaline, smooth, septate hyphae, up to 3 μm in diam; racquet hyphae abundantly present, with swollen ends diam up to 6 μm. Conidia and ascospores absent on all media tested, including those supplemented by human hairs and also after prolonged incubation. The hyphae most commonly branching at right angles; lateral branches are sterile, short, often deformed, and terminated by multiple finger-like projections, sometimes reminiscent of favic chandeliers. Swollen hyphae and chlamydospores abundant. Chlamydospores predominantly single, terminal or intercalar, globose, ellipsoidal or irregular and up to 10 μm wide. Globose or elongated mycelial clumps are present in older cultures (markedly after 3 weeks of cultivation), solitary or in clusters, resembling primordia of
the ascomata; 20–200 μm in diam. The species is unable to grow on T6 basal medium (Supplementary Fig. 3) in comparison with other Microsporum species from M. gypseum complex (Table 3). Addition of histidine into T6 medium resulted in rapid growth of the culture. Hair perforation (Fig. 3) and urease tests were were positive. Etymology: From the Latin (“aenigma, -tis”). After the enigmatic morphology (no spores observed) and natural ecology of this species.
Discussion Several geophilic dermatophytes have been described recently. Trichophyton eboreum was isolated from suspected cases of tinea pedis [2] and tinea corporis [23] but without sufficient confirmation of its role as the etiologic agent. Trichophyton onychocola was recovered from a toenail of a suspected case of onychomycosis but again without clear etiological evidence [1]. Microsporum mirabile, which is related to geophilic dermatophytes of the M. cookei clade, was isolated from a human toenail (case report unpublished) and two asymptomatic animals [3]. The geophilic nature of all of these species was predicted by phylogenetic analysis and based on their close phylogenetic relationship with other geophilic species. Legitimacy of this
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Table 2. Pairwise sequence similarity (%) of the β-tubulin gene of Microsporum species related to M. aenigmaticum.
392
Medical Mycology, 2014, Vol. 52, No. 4
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Figure 2. Microsporum aenigmaticum CCF 4608T (Culture Collection of Fungi, Department of Botany, Charles University; = CBS 134549T ) colonies after 3 weeks of cultivation at 25◦ C on Sabouraud glucose agar (A) and reverse (B); on malt extract agar (D) and reverse (C); vegetative hyphae, often deformed and terminated by multiple finger-like projections (E–H, K, L); chlamydospores (I, J); racquet hyphae (M, N); clumps of hyphae reminiscent of ascomatal primordia (O–T); scale bars 5 μm. This Figure is reproduced in color in the online version of Medical Mycology.
hypothesis was confirmed for T. eboreum, which was subsequently isolated from badger and rabbit burrows [4]. Similarly, the case isolate, CCF 4608, is in the clade with geophilic species related to M. gypseum (Fig. 1), and soil is
its probable natural habitat. In general, the geophilic dermatophytes show relatively large mutual phylogenetic distances [3] and this is also fulfilled for M. aenigmaticum (Tables 1 and 2).
Hubka et al.
393
The most important geophilic species in terms of clinical relevance are within the M. gypseum complex. The most widespread members of the complex are M. gypseum, M. fulvum, and M. persicolor; together they are the cause of 5–6% of all dermatophytic infections in the Czech Republic (not including T. rubrum) [24]. Whereas colony morphology and macroconidia can be used to differentiate M. persicolor, M. nanum, M. praecox, and M. duboisii from each other and from the remaining species within the complex, we have no reliable features for differentiation of the closely related heterothallic species M. gypseum, M. fulvum, and A. incurvatum (anamorph of A. incurvatum is referred to as M. gypseum, but represent different species). The species limits between these three taxa were repeatedly demonstrated using mating experiments [25–28], but only a limited number of relatively nonstable or overlapping characteristics were found for each species, that is, colony morphology, peridial hyphae, conidiophores, and macroconidia [26]. In fact, we have no reliable characteristic for the differentiation of the anamorphic states of M. gypseum, M. fulvum, and A. incurvatum [24,27–30], with these species commonly misidentified in the clinical setting when morphological characteristics are used [30,31]. Mating experiments with reference strains remain a reliable but impractical and lengthy procedure.
The DNA-based methods (e.g., sequencing or PCR fingerprinting) are required to validate the classic phenotypicbased identification. Similarly, the differentiation of M. persicolor from granular forms of T. interdigitale (T. mentagrophytes according to the older taxonomy) is also nontrivial and sometimes impossible without molecular methods [32–34]. Microsporum aenigmaticum represents a new addition to the M. gypseum complex. The sequence distances of M. aenigmaticum are comparable to those of other species within the complex (Tables 1 and 2), and the species creates a separate branch in phylogenetic analysis (Fig. 1). Although conidia and ascospores were not observed, their morphology is not useful in the taxonomic differentiation of the closest species within the complex. A much more important feature is the inability of M. aenigmaticum to grow at 37◦ C in contrast to all other species in the complex, with exception of M. praecox (Fig. 4). The colonies of M. aenigmaticum develop relatively slowly (10–15 mm after 7 d at 25◦ C on MEA and 9–12 mm on SGA) in contrast to M. gypseum, M. fulvum, and A. incurvatum, the colonies of which are at least twice as large at all temperatures (Fig. 4) and show different color and texture (probably due to the absence of conidia). Pale buff color, which is typical for M. gypseum complex species, can be seen in
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Figure 3. Positive hair perforation test for Microsporum aenigmaticum CCF 4608T (Culture Collection of Fungi, Department of Botany, Charles University). This Figure is reproduced in color in the online version of Medical Mycology.
394
Medical Mycology, 2014, Vol. 52, No. 4
Table 3. Physiological tests results for Microsporum aenigmaticum and closely related Microsporum species. Growth on media∗ Species
T1
T2
T3
T4
T5
T6
T7
Urease
Hair perforation test
M. aenigmaticum CCF 4608T M. fulvum†‡ M. gypseum† M. praecox† M. duboisii† M. persicolor† M. nanum† Trichophyton tonsurans 496.48§ T. equinum 127.97§ T. schoenleinii† T. verrucosum†
+ + + + + + + + – + –
+ + + + + + + + – + +
+ + + + + + + + – + +
+ + + + + + + + – + +
+ + + + + + + + + + –
– + + + + + + + – + –
+ + + + + + + + – + –
+ + + + + + + + + v –
+ + + – + + + – – – –
The tests were read after 7 and 14 days; see Supplementary Fig. 1. Several Trichophyton species that commonly show sterile phenotype or produce abundant chlamydospores are also included. CCF, Culture Collection of Fungi, Department of Botany, Charles University. ∗ T1 – vitamin-free casamino acid agar, basal medium for agars T2–T5; T2 = T1 + inositol, T3 = T2 + thiamine, T4 = T1 + thiamine, T5 = T1 + nicotinic acid; T6 – vitamin-free ammonium nitrate agar, basal medium for agar T7; T7 = T6 + L-histidine. –, no growth; +, growth; v, variable. † Data published previously by de Hoog et al. [29]; strain numbers were not mentioned. ‡ The isolates of M. gypseum examined in this study (Fig. 1) were able to grow on T1–T7 media, similar to the results of de Hoog et al. [29]. § Data published previously by Graser et al. [15]. ¨
M. aenigmaticum only on PDA medium, but the cottony texture is different from the powdery texture of the majority of the species in the complex. Another important characteristic seems to be its inability to grow on T6 medium (Table 3). For reliable identification of M. aenigmaticum
and species in the M. gypseum complex in general, it is recommended that molecular methods are used. As we observed on a set of reliably identified isolates, the diameter of colonies at 25–33◦ C could be a useful characteristic for differentiation of the common geophilic
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Figure 4. Growth of six species (in millimeters) from Microsporum gypseum complex on malt extract agar at various temperatures after 7 days, presented as mean ± standard deviation. For complete data, see Supplementary Table 1. CBS, Centraalbureau voor Schimmelcultures, Utrecht, Netherlands; CCF, Culture Collection of Fungi, Department of Botany, Charles University. This Figure is reproduced in color in the online version of Medical Mycology.
Hubka et al.
Acknowledgments This research was supported by the Ministry of Education, Youth and Sports (CZ.1.07/2.3.00/20.0055, CZ.1.07/2.3.00/30.0003 and SVV project). Molecular genetic analyses were supported by the project GAUK 607812. We thank Milada Chud´ıcˇ kova´ for isolation of DNA and preparation of the cultivation media.
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and the writing of the paper.
Supplementary material Supplementary material is available at Medical Mycology online. Supplementary Fig. 1. The electrophoretogram resulting from the fingerprinting method with M13-core primer; Microsporum aenigmaticum CCF 4608T (A); M. gypseum CCF 4625 (B); M. gypseum CBS 258.61T (C); M. fulvum CCF 4676 (D); M. fulvum CCF 4624 (E); A. incurvatum CBS 174.64T (F); M. praecox CBS 288.55T (G); M. persicolor CCF 4541 (H); M. persicolor CCF 4538 (I). Supplementary Fig. 2. Microsporum aenigmaticum CCF 4608T ; colonies after six weeks of cultivation at 25 ◦ C on PDA (A, B); on Takashio medium with 3% NaCl (C, D). Supplementary Fig. 3. Physiological tests results for Microsporium aenigmaticum CCF 4608T after 14 days of incubation. The media T1–T7 from the left to the right (for description of the media see Table 3). Supplementary Table 1 Growth of species from Microsporum. gypseum complex on MEA and measured after 7 days of incubation in the dark at different temperatures.
References 1. Hubka V, Cmokova A, Skorepova M, Mikula P, Kolarik M. Trichophyton onychocola sp. nov. isolated from human nail. Med Mycol 2014; 52: doi: 10.1093/mmy/myt010. 2. Brasch J, Graser Y. Trichophyton eboreum sp. nov. isolated from ¨ human skin. J Clin Microbiol 2005; 43: 5230–5237. 3. Choi JS, Graser Y, Walther G et al. Microsporum mirabile and its ¨ teleomorph Arthroderma mirabile, a new dermatophyte species in the M. cookei clade. Med Mycol 2012; 50: 161–169. 4. Campbell CK, Borman AM, Linton CJ, Bridge PD, Johnson EM. Arthroderma olidum, sp. nov. A new addition to the Trichophyton terrestre complex. Med Mycol 2006; 44: 451–459. 5. Sigler L, Hambleton S, Par´e JA. Molecular characterization of reptile pathogens currently known as members of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex and relationship with some human-associated isolates. J Clin Microbiol 2013; 51: 3338–3357. 6. Rajeev S, Sutton D, Wickes B et al. Isolation and characterization of a new fungal species, Chrysosporium ophiodiicola, from a mycotic granuloma of a black rat snake (Elaphe obsoleta obsoleta). J Clin Microbiol 2009; 47: 1264–1268. 7. Abarca M, Castella´ G, Martorell J, Cabanes ˜ F. Chrysosporium guarroi sp. nov. a new emerging pathogen of pet green iguanas (Iguana iguana). Med Mycol 2010; 48: 365–372.
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
pathogen M. gypseum from M. fulvum and A. incurvatum. No overlap between colony diameters of M. gypseum and M. fulvum/A. incurvatum was observed at these temperatures (Fig. 4, Supplementary Table 1). However, a larger number of isolates should be tested to confirm these results. The sterile micromorphology and abundant chlamydospores of M. aenigmaticum CCF 4608 may resemble T. verrucosum; however, the later species can be differentiated by slow growth, white colonies, and chlamydospores arranged in chains. Terminal and intercalar chlamydospores are frequently also produced by T. tonsurans, but this species produces simultaneously large amounts of microconidia. Some microscopic formations of M. aenigmaticum may also resemble chandelier-like structures known in T. schoenleinii. Morphologically similar mycelial clumps present in M. aenigmaticum were observed in T. krajdenii (now synonym for T. interdiditale). At this time, it is not clear whether the isolate CCF 4608T is a typical representative of the new species described here or an atypical isolate that has lost the ability to produce conidia in culture. The isolation of another genetically similar isolate is necessary to answer this question. However, this may take a long time because the species is probably very rare. The natural reservoir of M. gypseum and its relatives is soil, and all species within the M. gypseum complex are considered to be representatives of geophilic dermatophytes [35]. The exception is M. persicolor; in the past, M. persicolor was treated as a zoophilic species [34] and subsequently reclassified as being geophilic [32]. Microsporum gypseum, M. fulvum, M. persicolor, and A. incurvatum are relatively common causes of human and animal infections worldwide, but there are geographical differences in the prevalence of particular species. Infections commonly manifest on the skin of the head, neck, and extremities; less commonly, invasive infections have been described [27,30,31,36–43]. Microsporum praecox and M. duboisii are, in contrast, very rare species. The first species was previously recognized in 29 cases restricted to France, Belgium, and the United States [44]. Microsporum duboisii is, as far we know, represented only by the case isolate [45]. Our case report, which is associated with M. aenigmaticum, fits the description of infections caused by geophillic dermatophytes based on location of the lesion on the upper extremity (a typical location for geophillic species) and the patient’s risk factors (work in the garden, time spent in the woods, hunting). Additionally, when we consider positive microscopy for dermatophytic hyphae and growth of the fungus in pure culture in all slants, we have a number of strong arguments to support the probability that this isolate was the true causal agent of the infection.
395
396
27.
28. 29.
30.
31.
32.
33.
34.
35.
36.
37. 38. 39.
40.
41. 42.
43.
44.
45.
incurvata Stockd., N. gypsea (Nann.) comb. nov., N. fulva sp. nov.). Med Mycol 1964; 3: 114–126. Demange C, Cotet-Audonneau N, Kombila M et al. Microsporum gypseum complex in man and animals. J Med Vet Mycol 1992; 30: 301–308. Ranganathan S, Balajee S. Microsporum gypseum complex in Madras, India. Mycoses 2000; 43: 177–180. de Hoog GS, Guarro J, Gen´e J, Figueras MJ. Atlas of Clinical Fungi, 3rd. CD-ROM ed. Utrecht: CBS-KNAW Fungal Biodiversity Centre, 2009. Nouripour-Sisakht S, Rezaei-Matehkolaei A, Abastabar M et al. Microsporum fulvum, an ignored pathogenic dermatophyte: a new clinical isolation from Iran. Mycopathologia 2013; 176: 157–160. Iwasawa MT, Togawa Y, Akita F et al. Kerion celsi due to Arthroderma incurvatum infection in a Sri Lankan child: species identification and analysis of area-dependent genetic polymorphism. Med Mycol 2012; 50: 690–698. Sharma R, Presber W, Rajak RC, Graser Y. Molecular detec¨ tion of Microsporum persicolor in soil suggesting widespread dispersal in central India. Med Mycol 2008; 46: 67–73. Muller A, Guagu`ere E, Degorce-Rubiales F, Bourdoiseau G. Dermatophytosis due to Microsporum persicolor: a retrospective study of 16 cases. Can Vet J 2011; 52: 385–388. Kane J, Sigler L, Summerbell RC. Improved procedures for differentiating Microsporum persicolor from Trichophyton mentagrophytes. J Clin Microbiol 1987; 25: 2449–2452. Graser Y, Scott J, Summerbell R. The new species concept in ¨ dermatophytes—a polyphasic approach. Mycopathologia 2008; 166: 239–256. Dalton JE, Slaughter JC, Jenkins RE, Phelps S, Hackney VC. Microsporosis due to Microsporum fulvum. J Investig Dermatol 1950; 15: 421–423. Onsberg P. Human infections with Microsporum gypseum in Denmark. Brit J Dermatol 1978; 99: 527–530. Hayashi N, Toshitani S. Human infections with Microsporum gypseum in Japan. Mycoses 1983; 26: 337–345. Porro AM, Yoshioka MC, Kaminski SK et al. Disseminated dermatophytosis caused by Microsporum gypseum in two patients with the acquired immunodeficiency syndrome. Mycopathologia 1997; 137: 9–12. Romano C, Massai L, Gallo A, Fimiani M. Microsporum gypseum infection in the Siena area in 2005–2006. Mycoses 2009; 52: 67–71. Onsberg P. Human infections with Microsporum persicolor in Denmark. Brit J Dermatol 1978; 99: 531–536. Padhye AA, Blank F, Koblenzer PJ, Spatz S, Ajello L. Microsporum persicolor infection in the United States. Arch Dermatol 1973; 108: 561–562. Chen W, Seidl HP, Ring J, Schnopp C. Two pediatric cases of Microsporum persicolor infection. Int J Dermatol 2012; 51: 204–206. Alanio A, Romand S, Penso-Assathiany D, Foulet F, Botterel F. Microsporum praecox: molecular identification of a new case and review of the literature. Mycopathologia 2011; 171: 61–65. Vanbreuseghem R. Description of a new dermatophyte isolated in the Belgian Congo. Sabouraudites (Microsporum) duboisi n. sp. Ann Parasit 1949; 24: 252–258. [in French]
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
8. Stchigel A, Sutton D, Cano-Lira J et al. Phylogeny of chrysosporia infecting reptiles: proposal of the new family Nannizziopsiaceae and five new species. Persoonia 2013; 31: 86–100. 9. Sigler L, Congly H. Toenail infection caused by Onychocola canadensis gen. et sp. nov. J Med Vet Mycol 1990; 28: 405–417. 10. Hubka V, Dobiasova S, Lyskova P et al. Auxarthron ostraviense sp. nov., and A. umbrinum associated with nondermatophytic onychomycosis. Med Mycol 2013; 51: 614–624. 11. Stuchl´ık D, Mencl K, Hubka V, Skoˇrepova´ M. Fungal melanonychia caused by Onychocola canadensis: first records of nail infections due to Onychocola in the Czech Republic. Czech Mycol 2011; 63: 83–91. 12. Hubka V, Skorepova M, Dobiasova S et al. Two undescribed dermatophyte species, Trichophyton and Microsporum, isolated from Czech patients (P361). Mycoses 2013; 56 (Suppl. 3): 162. 13. Atlas RM. Handbook of Microbiological Media, 4th edn. Boca Raton, FL: CRC Press, 2010. 14. Georg LK, Camp LB. Routine nutritional tests for the identification of dermatophytes. J Bacteriol 1957; 74: 113–121. 15. Graser Y, Kuijpers AFA, Presber W, De Hoog GS. Molecular ¨ taxonomy of Trichophyton mentagrophytes and T. tonsurans. Med Mycol 1999; 37: 315–330. 16. Ajello L, Georg LK. In vitro hair cultures for differentiating between atypical isolates of Trichophyton mentagrophytes and Trichophyton rubrum. Mycopathologia 1957; 8: 3–17. 17. Philpot C. The differentiation of Trichophyton mentagrophytes from T. rubrum by a simple urease test. Med Mycol 1967; 5: 189–193. a´ A, Peterson SW. Taxonomi18. Hubka V, Kolaˇr´ık M, Kubatov ´ cal revision of the genus Eurotium and transfer of species to Aspergillus. Mycologia 2013; 105: 912–937. 19. Hubka V, Kubatova A, Mallatova N et al. Rare and new aetiological agents revealed among 178 clinical Aspergillus strains obtained from Czech patients and characterised by molecular sequencing. Med Mycol 2012; 50: 601–610. 20. Hubka V, Kolaˇr´ık M. β-tubulin paralogue tubC is frequently misidentified as the benA gene in Aspergillus section Nigri taxonomy: primer specificity testing and taxonomic consequences. Persoonia 2012; 29: 1–10. 21. Tamura K, Peterson D, Peterson N et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011; 28: 2731–2739. 22. Novakov a´ A, Hubka V, Saiz-Jimenez C, Kolarik M. Aspergillus ´ baeticus sp. nov. and Aspergillus thesauricus sp. nov.: two species in section Usti originating from Spanish caves. Int J Syst Evol Microbiol 2012; 62: 2778–2785. 23. Keller MC, French LE, Hofbauer GFL, Bosshard PP. Erythematous skin macules with isolation of Trichophyton eboreum— infection or colonisation? Mycoses 2013; 56: 373–375. 24. Hubka V, Skorepova M, Kolarik M. One year overview of nonT. rubrum dermatophytes isolated in Czech Republic and identified by molecular methods (P541). Mycoses 2012; 55 (Suppl. 4): 265. 25. Stockdale PM. Nannizzia incurvata gen. nov., sp. nov., a perfect state of Microsporum gypseum (Bodin) Guiart et Grigorakis. Med Mycol 1962; 1: 41–48. 26. Stockdale PM. The Microsporum gypseum complex (Nannizzia
Medical Mycology, 2014, Vol. 52, No. 4
Original Article
Microsporum aenigmaticum sp. nov. from M. gypseum complex, isolated as a cause of tinea corporis ˇ a´ 3 , Radim Dobia´ sˇ 3 Vit Hubka1,2,∗ , Stanislava Dobia´ sov and Miroslav Kolaˇr´ık1,2 Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
1
Department of Botany, Faculty of Science, Charles University in Prague, Czech Republic, 2 Laboratory of ˇ a´ 1083, 142 20 Praha 4, Fungal Genetics and Metabolism, Institute of Microbiology of the AS CR, V´ıdensk 3 Czech Republic and Laboratory of Clinical Mycology, Institute of Public Health, Ostrava, Czech Republic
*To whom correspondence should be addressed. Vit Hubka, Department of Botany, Faculty of Science, Charles University in Prague, Benatska 2, 128 01 Prague 2, Czech Republic. Tel: (+420) 739663218; Fax: (+420) 29644 2347; E-mail: [email protected] The EMBL (European Molecular Biology Laboratory database) accession numbers for the internal transcribed spacer rDNA, β-tubulin (benA), RNA polymerase II (RPB2),and actin of the ex-holotype strain of the Microsporum aenigmaticum sp. nov. are HG518404, HG518421, HG793055, and HG793060, respectively. The MycoBank (http://www.mycobank.org) accession number for Microsporum aenigmaticum sp. nov. is MB 807060. Received 23 September 2013; Revised 26 November 2013; Accepted 20 December 2013
Abstract An undescribed Microsporum species was isolated from skin scales recovered from a 40-mm large, annular, scaling lesion on the wrist of a 46-year-old woman. The risk factors for dermatophyte infection in the patient were frequent work in the garden, hunting, and contact with dogs and horses. Direct microscopic examination of the scales revealed the presence of dermatophyte hyphae; when the samples were cultured, a morphologically similar fungus grew on all slants in pure culture. Both of these findings strongly suggested that the isolate was the true causal agent of infection. The possible geophilic nature of the species was based on phylogenetic analysis (internal transcribed spacer region of rDNA and β-tubulin gene) that placed it in between species of the M. gypseum complex. However, its divergencies from all other Microsporum species exceeded 4% base pairs. Based on β-tubulin phylogeny, the isolated species is a sister to M. gypseum. The species produces abundant chlamydospores and clumps of hyphae similar to those of ascomatal primordia but no conidia and ascospores. The species was unable to grow at 37◦ C and does not grow on T6 basal medium, which is unlike other Microsporum species; hair perforation and urease tests were positive. The addition of histidine to the T6 medium resulted in rapid growth of the fungus. The phylogenetic evidence, morphology, growth parameters, and physiology justified the proposal that the isolate is a new species, M. aenigmaticum, sp. nov. Key words: Arthroderma, geophilic dermatophytes, keratinophilic fungi, Onygenales, skin infection, sterile fungi.
C The Author 2014. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology.
All rights reserved. For permissions, please e-mail: [email protected]
387
388
Introduction
Case report In May 2012, a 46-year-old Czech female with a skin lesion on her right dorsal wrist was examined at the Dermatology Unit, Hav´ırˇ ov, Czech Republic. The erythematous patch had an annular shape, diameter of 40 mm, was nonitchy, sharply demarcated, plain with scaling at the margin, without exudation and pustules, and red in the center and pink at the margin. The lesion had appeared 4 months prior to visiting a doctor and initially consisted of three 6-mm wide lesions that later merged to form a single circular lesion. The patient was otherwise healthy and was not regularly taking any medications. Before visiting the dermatologist, she regularly applied 1% ciclopirox olamine solution on the lesion, but this did not result in obvious clinical im-
provement. She worked in her garden, took care of horses, hunted, and worked with hunted animals. She owned a dog breeding station and worked as their dealer. The patient also often visited swimming pools and saunas, but she did not remember any previous injuries around the lesion area or have a history of foreign travels. The mycological examination was performed during the first visit (May 2012), and topical Castellani’s solution was administered (once daily). Direct microscopic examination of epithelial scales (10% KOH with Parker ink) revealed the presence of septate, branching hyphae suggestive of dermatophyte infection. Material from scrapings was inoculated onto two slants of Mycosel agar (Becton, Dickinson and Company, Cockeysville, MD, U.S.A.; containing 400 mg/l of cycloheximide) and one slant of Sabouraud glucose agar (SGA) with thiamine hydrochloride (100 mg/l; Thiabene, Ratiopharm, Gmbh, Ulm, Germany); all three tubes were incubated at 26◦ C in the dark. The same species was recovered on all slants in pure culture and tolerated cycloheximide in medium. Improvement appeared after 3 weeks of treatment; 1% clotrimazole cream (twice daily) was administered at the second visit. The patient reported full remission in May 2013 (telephone conversation only). Initially the isolated species was tentatively identified as T. tonsurans/T. equinum based on the frequent occurrence of chlamydospore-like cells in culture, lack of conidial formation, no growth on T6 medium without histidine, and reported contact of the patient with horses in anamnesis. The isolate was sent to the Department of Botany, Charles University, Prague, where further morphological, physiological, and molecular analyses were performed.
Materials and methods Cultivation, morphology, physiology, and preservation The isolates were grown on a set of media including malt extract agar (MEA; Oxoid, Basingstoke, UK), SGA [13], potato dextrose agar (PDA; Roth, Karlsruhe, Germany), and Takashio medium (see below) with 3% NaCl (w/v). A second set of the media that was supplemented by sterilized blond child hairs placed on the medium surface consisted of MEA, Takashio medium (1 g peptone, 2 g glucose, 1 g MgSO4 ·7 H2 O, 1 g KH2 PO4 , 20 g agar, and 1 liter distilled water) and water agar (20 g agar and 1 liter distilled water). The plates were incubated at 25◦ C in the dark and checked weekly for 3 months. Growth at 25, 27, 30, 33, and 37◦ C was evaluated using MEA and assessed after 7 days. Physiological tests with T1–T7 agar media were conducted according to the procedure described previously [14,15]; growth on commercial (HiMedia, Mumbai, India) and laboratory-made media was tested. In vitro hair
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Dermatophytes are among the most investigated microorganisms because they cause infections in a substantial portion of the worldwide human and animals populations. The taxonomy of dermatophytes has never been stable, even for relatively small numbers of medically important species (approximately 20–30 species). Since the advent of molecular methods, many substantial taxonomic changes have been made, but only a limited number of new species has been proposed relative to other groups of pathogenic fungi. The diversity of primary pathogenic species has been exhaustively explored, and the numbers of these species were reduced based on data generated through molecular methods. However, this does not appear to be the situation relative to geophilic dermatophytic species. New, presumably geophilic, species have been isolated from clinical material [1–3], as well as from their natural environment [4]. However, some of these species have never been recovered from their probable natural habitat of the soil and are known only by their isolation from clinical material [1,3]. This is also true for some nondermatophytic members of the family Onygenales, that is, Nannizziopsis, Paranannizziopsis, Ophiodiomyces, Chrysosporium, Onychocola, and Auxarthron [5–11], that are known only from human and animal clinical specimens. During a two-year molecular–epidemiological study that focused on dermatophytes in the Czech Republic (with exception of Trichophyton rubrum) [12], a species with unusual morphological and physiological characteristics was isolated from a case of tinea corporis. This species had a unique fingerprinting pattern and internal transcribed spacer (ITS) rDNA sequence, as well as distinctive morphological, physiological, and molecular features that suggested that it was a previously undescribed species. This species is presented here based on a polyphasic approach.
Medical Mycology, 2014, Vol. 52, No. 4
Hubka et al.
perforation and urease tests were performed according to Ajello and Georg [16] and Philpot [17], respectively. The case isolate of Microsporum was deposited into the Culture Collection of Fungi (CCF), Department of Botany, Charles University, Prague, Czech Republic (CCF 4608), and into the Centraalbureau voor Schimmelcultures (CBS), Utrecht, Netherlands (CBS 134549). A dried culture was deposited into the herbarium of the Mycology Department, National Museum, Prague, Czech Republic (PRM 922698– 922701).
Molecular studies
Results Molecular analysis The fingerprinting pattern of the isolate CCF 4608 ( = CBS 134549) due to amplification with primer M13-core was different from that of other dermatophytes that are com-
monly recovered from clinical material in the Czech Republic (data not shown). The comparison of fingerprinting patterns among species of the M. gypseum complex is shown in Supplementary Fig. 1. Using the BLAST similarity search, the ITS region of strain CCF 4608 (HG518404) showed 94% (449/477 bp) similarity to the ex-type strain of M. fulvum CBS 287.55T (AJ000627), while other species showed similarity equal or lower than 93%. The partial β-tubulin gene sequence of CCF 4608 (HG518421) shared 96% similarity (323/336 bp) with the ex-type strain of M. gypseum CBS 258.61T (HG518420). The partial RPB2 gene was successfully amplified only for several members of the M. gypseum complex (HG793055–HG793059) and therefore was not used for phylogenetic analysis. The RPB2 sequence of CCF 4608 (HG793055) showed 98% (1014/1030) similarity to M. gypseum CBS 118893 (XM003170096). The partial sequence of the actin gene was amplified only for CCF 4608 (HG793060) and showed 95% (142/149) similarity to M. gypseum SM 8377 (AB593407). The isolate CCF 4608 created a well-supported clade in phylogenetic analysis (Fig. 1) together with geophilic species of the M. gypseum complex, namely, M. fulvum, M. gypseum, A. incurvatum, M. duboisii, M. praecox, M. persicolor, and M. nanum. However, the interspecies relationships were not resolved due to low bootstrap branch supports. Microsporum fulvum, M. praecox, and M. gypseum were the most closely related species in pairwise sequence comparison (Table 1). An additional locus encoding β-tubulin (benA) was sequenced for the above-mentioned species related to CCF 4608. Phylogenetic analysis strongly supported the position of CCF 4608 as a sister species to M. gypseum (Fig. 1), with the highest level of sequence similarity in pairwise sequence comparison followed by M. fulvum (Table 2). Low sequence similarity of the ITS region and partial β-tubulin sequences of CCF 4608 to other Microsporum species together with the results of the phylogenetic analysis suggested that the isolate constituted a previously unreported species.
Taxonomy Microsporum aenigmaticum. Hubka, Dobiaˇ ´ sova´ & M. Kolaˇr´ık sp. nov., MB807060, Figs 2 and 3, Supplementary Figs. 2 and 3. Diagnosis: The species shows slower growth parameters on all common media in comparison with the majority of species from M. gypseum complex (Fig. 4, Supplementary Table 1); does not grow at 37◦ C or on T6 basal medium. The reverse of colonies is yellow or orange. Conidia and ascospores were not observed in culture. The species produces abundant chlamydospores, aggregates of hyphae
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
DNA was isolated using ArchivePure DNA yeast and Gram2+ kit (5PRIME Inc., Gaithersburg, MD, USA) as described by Hubka et al. [18]. Polymerase chain reaction (PCR) conditions used for amplification of the ITS region (primers ITS1F and NL4) and partial benA gene (encoding β-tubulin; primers Bt2a and Bt2b) were as described by Hubka et al. [19]. Partial RNA polymerase II gene sequence (RPB2) was amplified using primers fRPB2–5F (5 -GAYGAYMGWGATCAYTTYGG) and fRPB2–7cR (5 - CCCATRGCTTGYTTRCCCAT) and touchdown cycling conditions [20]. A partial actin gene sequence was amplified using primers ACT-512F (5 ATGTGCAAGGCCGGTTTCGC) and ACT-783R (5 TACGAGTCCTTCTGGCCCAT) and an annealing temperature of 60◦ C. PCR product purification and sequencing were performed at Macrogen Europe (Amsterdam, The Netherlands) using the terminal primers for the benA, actin, and RPB2 genes and the ITS1F and ITS4 primers for the ITS region. The sequences were inspected and aligned as described by Hubka and Kolaˇr´ık [20]. Maximum-likelihood (ML) analysis was conducted in MEGA5.2 [21] with 1000 bootstrap replicates. Parameters for ML analysis were estimated in MEGA5.2, which proposed the K2+G+I model as the best fit for both ITS as well as benA datasets. Additional alignment characteristics are listed in the legend of Fig. 1. Sequences were deposited into the EMBL (European Molecular Biology Laboratory) database under accession numbers listed in Fig. 1 in bold font. PCR fingerprinting was performed using the phage M13-core sequence as an oligonucleotide primer; the conditions for amplification were as described by Novakov a´ et al. [22]. ´
389
390
Medical Mycology, 2014, Vol. 52, No. 4
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Figure 1. Maximum-likelihood (ML) trees showing relationships of the case isolate to other Microsporum species. Nodes supported at 95% bootstrap or higher are double-thick; ex-type isolates are designated by a superscript T. Internal transcribed spacer (ITS) alignment: 554 positions, 193 variable, ML tree with the highest log likelihood (–1499.9) is shown; β-tubulin alignment: 357 positions, 118 variable, ML tree with the highest log likelihood (–1212) is shown; Arthroderma melis CBS 669.80T and Trichophyton onychocola CBS 132920T were used as outgroups.
resembling primordia of ascomata, and racquet hyphae. Molecular data (fingerprinting with M13-core primer, sequences of the ITS rDNA region and β-tubulin) clearly distinguish this species from all other Microsporum species. Type: Czech Republic, Ostrava, skin lesion on the wrist of 46-year-old woman, May 2012, Dr Stanislava Dobiaˇ ´ sova, ´
DMF 1545/12 (PRM 922698, a dried herbarium specimen – holotype; PRM 922699–922701 – isotypes; CCF 4608T = CBS 134549T – culture ex-holotype). Description: Colonies on SGA attaining 24–29 mm diam in 14 d at 25◦ C; ochraceous or pale buff; central part of the colony elevated and irregularly furrowed; marginal parts
Hubka et al.
391
Table 1. Pairwise sequence similarity (%) of the internal transcribed spacer rDNA region of Microsporum species related to M. aenigmaticum. Species and isolate number M. aenigmaticum, CCF 4608 M. fulvum, CCF 4684 M. praecox, CBS 288.55 M. gypseum, CBS 258.61 M. duboisii, CBS 349.49 M. persicolor, CCF 4541 A. incurvatum, CBS 174.64 M. nanum, CBS 322.61
CCF 4608
CCF 4684
CBS 288.55
CBS 258.61
CBS 349.49
CCF 4541
CBS 174.64
93.0 92.1 91.9 91.2 89.5 84.1 83.9
93.7 92.4 93.0 90.3 85.9 84.9
91.2 92.1 92.5 85.6 85.9
95.3 92.3 83.8 82.0
93.2 84.1 82.7
82.0 82.0
87.2
Each pair of sequences was aligned using the ClustalW algorithm, with the default setting as implemented in Bioedit 7.2 before sequence similarity was computed. CBS, Centraalbureau voor Schimmelcultures, Utrecht, Netherlands; CCF, Culture Collection of Fungi, Department of Botany, Charles University.
Species and isolate number M. aenigmaticum, CCF 4608 M. gypseum, CBS 258.61 M. fulvum, CCF 4684 A. incurvatum, CBS 174.64 M. duboisii, CBS 349.49 M. persicolor, CCF 4541 M. praecox, CBS 288.55
CCF 4608
CBS 258.61
CCF 4684
CBS 174.64
CBS 349.49
CCF 4541
95.6 92.8 91.2 90.2 87.3 86.3
92.5 90.9 89.4 86.8 86.6
93.4 91.0 91.4 91.7
92.1 89.4 88.3
87.9 86
89.7
Each pair of sequences was aligned using the ClustalW algorithm, with the default setting as implemented in Bioedit 7.2 before sequence similarity was computed. CBS, Centraalbureau voor Schimmelcultures, Utrecht, Netherlands; CCF, Culture Collection of Fungi, Department of Botany, Charles University.
plane; the aerial mycelium forms dense but low layer; reverse orange–yellow. Colonies on MEA attaining 21–34 mm diam in 14 d at 25◦ C; colony plane and whitish, reverse yellow. The growth at 30◦ C on MEA and SGA comparable to that at 25◦ C. No growth at 37◦ C. Colonies on PDA (Supplementary Fig. 2) attaining 27–35 mm diam in 14 d at 25◦ C; cottony, pale buff in the center, white at the margins, reverse intensive yellow to orange in the center. Growth on Takashio medium with 3% NaCl (w/v) slow (< 25 mm after 6 weeks at 25◦ C); colonies color and reverse yellow (Supplementary Fig. 2). Vegetative mycelium consists of hyaline, smooth, septate hyphae, up to 3 μm in diam; racquet hyphae abundantly present, with swollen ends diam up to 6 μm. Conidia and ascospores absent on all media tested, including those supplemented by human hairs and also after prolonged incubation. The hyphae most commonly branching at right angles; lateral branches are sterile, short, often deformed, and terminated by multiple finger-like projections, sometimes reminiscent of favic chandeliers. Swollen hyphae and chlamydospores abundant. Chlamydospores predominantly single, terminal or intercalar, globose, ellipsoidal or irregular and up to 10 μm wide. Globose or elongated mycelial clumps are present in older cultures (markedly after 3 weeks of cultivation), solitary or in clusters, resembling primordia of
the ascomata; 20–200 μm in diam. The species is unable to grow on T6 basal medium (Supplementary Fig. 3) in comparison with other Microsporum species from M. gypseum complex (Table 3). Addition of histidine into T6 medium resulted in rapid growth of the culture. Hair perforation (Fig. 3) and urease tests were were positive. Etymology: From the Latin (“aenigma, -tis”). After the enigmatic morphology (no spores observed) and natural ecology of this species.
Discussion Several geophilic dermatophytes have been described recently. Trichophyton eboreum was isolated from suspected cases of tinea pedis [2] and tinea corporis [23] but without sufficient confirmation of its role as the etiologic agent. Trichophyton onychocola was recovered from a toenail of a suspected case of onychomycosis but again without clear etiological evidence [1]. Microsporum mirabile, which is related to geophilic dermatophytes of the M. cookei clade, was isolated from a human toenail (case report unpublished) and two asymptomatic animals [3]. The geophilic nature of all of these species was predicted by phylogenetic analysis and based on their close phylogenetic relationship with other geophilic species. Legitimacy of this
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Table 2. Pairwise sequence similarity (%) of the β-tubulin gene of Microsporum species related to M. aenigmaticum.
392
Medical Mycology, 2014, Vol. 52, No. 4
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Figure 2. Microsporum aenigmaticum CCF 4608T (Culture Collection of Fungi, Department of Botany, Charles University; = CBS 134549T ) colonies after 3 weeks of cultivation at 25◦ C on Sabouraud glucose agar (A) and reverse (B); on malt extract agar (D) and reverse (C); vegetative hyphae, often deformed and terminated by multiple finger-like projections (E–H, K, L); chlamydospores (I, J); racquet hyphae (M, N); clumps of hyphae reminiscent of ascomatal primordia (O–T); scale bars 5 μm. This Figure is reproduced in color in the online version of Medical Mycology.
hypothesis was confirmed for T. eboreum, which was subsequently isolated from badger and rabbit burrows [4]. Similarly, the case isolate, CCF 4608, is in the clade with geophilic species related to M. gypseum (Fig. 1), and soil is
its probable natural habitat. In general, the geophilic dermatophytes show relatively large mutual phylogenetic distances [3] and this is also fulfilled for M. aenigmaticum (Tables 1 and 2).
Hubka et al.
393
The most important geophilic species in terms of clinical relevance are within the M. gypseum complex. The most widespread members of the complex are M. gypseum, M. fulvum, and M. persicolor; together they are the cause of 5–6% of all dermatophytic infections in the Czech Republic (not including T. rubrum) [24]. Whereas colony morphology and macroconidia can be used to differentiate M. persicolor, M. nanum, M. praecox, and M. duboisii from each other and from the remaining species within the complex, we have no reliable features for differentiation of the closely related heterothallic species M. gypseum, M. fulvum, and A. incurvatum (anamorph of A. incurvatum is referred to as M. gypseum, but represent different species). The species limits between these three taxa were repeatedly demonstrated using mating experiments [25–28], but only a limited number of relatively nonstable or overlapping characteristics were found for each species, that is, colony morphology, peridial hyphae, conidiophores, and macroconidia [26]. In fact, we have no reliable characteristic for the differentiation of the anamorphic states of M. gypseum, M. fulvum, and A. incurvatum [24,27–30], with these species commonly misidentified in the clinical setting when morphological characteristics are used [30,31]. Mating experiments with reference strains remain a reliable but impractical and lengthy procedure.
The DNA-based methods (e.g., sequencing or PCR fingerprinting) are required to validate the classic phenotypicbased identification. Similarly, the differentiation of M. persicolor from granular forms of T. interdigitale (T. mentagrophytes according to the older taxonomy) is also nontrivial and sometimes impossible without molecular methods [32–34]. Microsporum aenigmaticum represents a new addition to the M. gypseum complex. The sequence distances of M. aenigmaticum are comparable to those of other species within the complex (Tables 1 and 2), and the species creates a separate branch in phylogenetic analysis (Fig. 1). Although conidia and ascospores were not observed, their morphology is not useful in the taxonomic differentiation of the closest species within the complex. A much more important feature is the inability of M. aenigmaticum to grow at 37◦ C in contrast to all other species in the complex, with exception of M. praecox (Fig. 4). The colonies of M. aenigmaticum develop relatively slowly (10–15 mm after 7 d at 25◦ C on MEA and 9–12 mm on SGA) in contrast to M. gypseum, M. fulvum, and A. incurvatum, the colonies of which are at least twice as large at all temperatures (Fig. 4) and show different color and texture (probably due to the absence of conidia). Pale buff color, which is typical for M. gypseum complex species, can be seen in
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Figure 3. Positive hair perforation test for Microsporum aenigmaticum CCF 4608T (Culture Collection of Fungi, Department of Botany, Charles University). This Figure is reproduced in color in the online version of Medical Mycology.
394
Medical Mycology, 2014, Vol. 52, No. 4
Table 3. Physiological tests results for Microsporum aenigmaticum and closely related Microsporum species. Growth on media∗ Species
T1
T2
T3
T4
T5
T6
T7
Urease
Hair perforation test
M. aenigmaticum CCF 4608T M. fulvum†‡ M. gypseum† M. praecox† M. duboisii† M. persicolor† M. nanum† Trichophyton tonsurans 496.48§ T. equinum 127.97§ T. schoenleinii† T. verrucosum†
+ + + + + + + + – + –
+ + + + + + + + – + +
+ + + + + + + + – + +
+ + + + + + + + – + +
+ + + + + + + + + + –
– + + + + + + + – + –
+ + + + + + + + – + –
+ + + + + + + + + v –
+ + + – + + + – – – –
The tests were read after 7 and 14 days; see Supplementary Fig. 1. Several Trichophyton species that commonly show sterile phenotype or produce abundant chlamydospores are also included. CCF, Culture Collection of Fungi, Department of Botany, Charles University. ∗ T1 – vitamin-free casamino acid agar, basal medium for agars T2–T5; T2 = T1 + inositol, T3 = T2 + thiamine, T4 = T1 + thiamine, T5 = T1 + nicotinic acid; T6 – vitamin-free ammonium nitrate agar, basal medium for agar T7; T7 = T6 + L-histidine. –, no growth; +, growth; v, variable. † Data published previously by de Hoog et al. [29]; strain numbers were not mentioned. ‡ The isolates of M. gypseum examined in this study (Fig. 1) were able to grow on T1–T7 media, similar to the results of de Hoog et al. [29]. § Data published previously by Graser et al. [15]. ¨
M. aenigmaticum only on PDA medium, but the cottony texture is different from the powdery texture of the majority of the species in the complex. Another important characteristic seems to be its inability to grow on T6 medium (Table 3). For reliable identification of M. aenigmaticum
and species in the M. gypseum complex in general, it is recommended that molecular methods are used. As we observed on a set of reliably identified isolates, the diameter of colonies at 25–33◦ C could be a useful characteristic for differentiation of the common geophilic
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
Figure 4. Growth of six species (in millimeters) from Microsporum gypseum complex on malt extract agar at various temperatures after 7 days, presented as mean ± standard deviation. For complete data, see Supplementary Table 1. CBS, Centraalbureau voor Schimmelcultures, Utrecht, Netherlands; CCF, Culture Collection of Fungi, Department of Botany, Charles University. This Figure is reproduced in color in the online version of Medical Mycology.
Hubka et al.
Acknowledgments This research was supported by the Ministry of Education, Youth and Sports (CZ.1.07/2.3.00/20.0055, CZ.1.07/2.3.00/30.0003 and SVV project). Molecular genetic analyses were supported by the project GAUK 607812. We thank Milada Chud´ıcˇ kova´ for isolation of DNA and preparation of the cultivation media.
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and the writing of the paper.
Supplementary material Supplementary material is available at Medical Mycology online. Supplementary Fig. 1. The electrophoretogram resulting from the fingerprinting method with M13-core primer; Microsporum aenigmaticum CCF 4608T (A); M. gypseum CCF 4625 (B); M. gypseum CBS 258.61T (C); M. fulvum CCF 4676 (D); M. fulvum CCF 4624 (E); A. incurvatum CBS 174.64T (F); M. praecox CBS 288.55T (G); M. persicolor CCF 4541 (H); M. persicolor CCF 4538 (I). Supplementary Fig. 2. Microsporum aenigmaticum CCF 4608T ; colonies after six weeks of cultivation at 25 ◦ C on PDA (A, B); on Takashio medium with 3% NaCl (C, D). Supplementary Fig. 3. Physiological tests results for Microsporium aenigmaticum CCF 4608T after 14 days of incubation. The media T1–T7 from the left to the right (for description of the media see Table 3). Supplementary Table 1 Growth of species from Microsporum. gypseum complex on MEA and measured after 7 days of incubation in the dark at different temperatures.
References 1. Hubka V, Cmokova A, Skorepova M, Mikula P, Kolarik M. Trichophyton onychocola sp. nov. isolated from human nail. Med Mycol 2014; 52: doi: 10.1093/mmy/myt010. 2. Brasch J, Graser Y. Trichophyton eboreum sp. nov. isolated from ¨ human skin. J Clin Microbiol 2005; 43: 5230–5237. 3. Choi JS, Graser Y, Walther G et al. Microsporum mirabile and its ¨ teleomorph Arthroderma mirabile, a new dermatophyte species in the M. cookei clade. Med Mycol 2012; 50: 161–169. 4. Campbell CK, Borman AM, Linton CJ, Bridge PD, Johnson EM. Arthroderma olidum, sp. nov. A new addition to the Trichophyton terrestre complex. Med Mycol 2006; 44: 451–459. 5. Sigler L, Hambleton S, Par´e JA. Molecular characterization of reptile pathogens currently known as members of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex and relationship with some human-associated isolates. J Clin Microbiol 2013; 51: 3338–3357. 6. Rajeev S, Sutton D, Wickes B et al. Isolation and characterization of a new fungal species, Chrysosporium ophiodiicola, from a mycotic granuloma of a black rat snake (Elaphe obsoleta obsoleta). J Clin Microbiol 2009; 47: 1264–1268. 7. Abarca M, Castella´ G, Martorell J, Cabanes ˜ F. Chrysosporium guarroi sp. nov. a new emerging pathogen of pet green iguanas (Iguana iguana). Med Mycol 2010; 48: 365–372.
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
pathogen M. gypseum from M. fulvum and A. incurvatum. No overlap between colony diameters of M. gypseum and M. fulvum/A. incurvatum was observed at these temperatures (Fig. 4, Supplementary Table 1). However, a larger number of isolates should be tested to confirm these results. The sterile micromorphology and abundant chlamydospores of M. aenigmaticum CCF 4608 may resemble T. verrucosum; however, the later species can be differentiated by slow growth, white colonies, and chlamydospores arranged in chains. Terminal and intercalar chlamydospores are frequently also produced by T. tonsurans, but this species produces simultaneously large amounts of microconidia. Some microscopic formations of M. aenigmaticum may also resemble chandelier-like structures known in T. schoenleinii. Morphologically similar mycelial clumps present in M. aenigmaticum were observed in T. krajdenii (now synonym for T. interdiditale). At this time, it is not clear whether the isolate CCF 4608T is a typical representative of the new species described here or an atypical isolate that has lost the ability to produce conidia in culture. The isolation of another genetically similar isolate is necessary to answer this question. However, this may take a long time because the species is probably very rare. The natural reservoir of M. gypseum and its relatives is soil, and all species within the M. gypseum complex are considered to be representatives of geophilic dermatophytes [35]. The exception is M. persicolor; in the past, M. persicolor was treated as a zoophilic species [34] and subsequently reclassified as being geophilic [32]. Microsporum gypseum, M. fulvum, M. persicolor, and A. incurvatum are relatively common causes of human and animal infections worldwide, but there are geographical differences in the prevalence of particular species. Infections commonly manifest on the skin of the head, neck, and extremities; less commonly, invasive infections have been described [27,30,31,36–43]. Microsporum praecox and M. duboisii are, in contrast, very rare species. The first species was previously recognized in 29 cases restricted to France, Belgium, and the United States [44]. Microsporum duboisii is, as far we know, represented only by the case isolate [45]. Our case report, which is associated with M. aenigmaticum, fits the description of infections caused by geophillic dermatophytes based on location of the lesion on the upper extremity (a typical location for geophillic species) and the patient’s risk factors (work in the garden, time spent in the woods, hunting). Additionally, when we consider positive microscopy for dermatophytic hyphae and growth of the fungus in pure culture in all slants, we have a number of strong arguments to support the probability that this isolate was the true causal agent of the infection.
395
396
27.
28. 29.
30.
31.
32.
33.
34.
35.
36.
37. 38. 39.
40.
41. 42.
43.
44.
45.
incurvata Stockd., N. gypsea (Nann.) comb. nov., N. fulva sp. nov.). Med Mycol 1964; 3: 114–126. Demange C, Cotet-Audonneau N, Kombila M et al. Microsporum gypseum complex in man and animals. J Med Vet Mycol 1992; 30: 301–308. Ranganathan S, Balajee S. Microsporum gypseum complex in Madras, India. Mycoses 2000; 43: 177–180. de Hoog GS, Guarro J, Gen´e J, Figueras MJ. Atlas of Clinical Fungi, 3rd. CD-ROM ed. Utrecht: CBS-KNAW Fungal Biodiversity Centre, 2009. Nouripour-Sisakht S, Rezaei-Matehkolaei A, Abastabar M et al. Microsporum fulvum, an ignored pathogenic dermatophyte: a new clinical isolation from Iran. Mycopathologia 2013; 176: 157–160. Iwasawa MT, Togawa Y, Akita F et al. Kerion celsi due to Arthroderma incurvatum infection in a Sri Lankan child: species identification and analysis of area-dependent genetic polymorphism. Med Mycol 2012; 50: 690–698. Sharma R, Presber W, Rajak RC, Graser Y. Molecular detec¨ tion of Microsporum persicolor in soil suggesting widespread dispersal in central India. Med Mycol 2008; 46: 67–73. Muller A, Guagu`ere E, Degorce-Rubiales F, Bourdoiseau G. Dermatophytosis due to Microsporum persicolor: a retrospective study of 16 cases. Can Vet J 2011; 52: 385–388. Kane J, Sigler L, Summerbell RC. Improved procedures for differentiating Microsporum persicolor from Trichophyton mentagrophytes. J Clin Microbiol 1987; 25: 2449–2452. Graser Y, Scott J, Summerbell R. The new species concept in ¨ dermatophytes—a polyphasic approach. Mycopathologia 2008; 166: 239–256. Dalton JE, Slaughter JC, Jenkins RE, Phelps S, Hackney VC. Microsporosis due to Microsporum fulvum. J Investig Dermatol 1950; 15: 421–423. Onsberg P. Human infections with Microsporum gypseum in Denmark. Brit J Dermatol 1978; 99: 527–530. Hayashi N, Toshitani S. Human infections with Microsporum gypseum in Japan. Mycoses 1983; 26: 337–345. Porro AM, Yoshioka MC, Kaminski SK et al. Disseminated dermatophytosis caused by Microsporum gypseum in two patients with the acquired immunodeficiency syndrome. Mycopathologia 1997; 137: 9–12. Romano C, Massai L, Gallo A, Fimiani M. Microsporum gypseum infection in the Siena area in 2005–2006. Mycoses 2009; 52: 67–71. Onsberg P. Human infections with Microsporum persicolor in Denmark. Brit J Dermatol 1978; 99: 531–536. Padhye AA, Blank F, Koblenzer PJ, Spatz S, Ajello L. Microsporum persicolor infection in the United States. Arch Dermatol 1973; 108: 561–562. Chen W, Seidl HP, Ring J, Schnopp C. Two pediatric cases of Microsporum persicolor infection. Int J Dermatol 2012; 51: 204–206. Alanio A, Romand S, Penso-Assathiany D, Foulet F, Botterel F. Microsporum praecox: molecular identification of a new case and review of the literature. Mycopathologia 2011; 171: 61–65. Vanbreuseghem R. Description of a new dermatophyte isolated in the Belgian Congo. Sabouraudites (Microsporum) duboisi n. sp. Ann Parasit 1949; 24: 252–258. [in French]
Downloaded from http://mmy.oxfordjournals.org/ at Yale University on September 30, 2014
8. Stchigel A, Sutton D, Cano-Lira J et al. Phylogeny of chrysosporia infecting reptiles: proposal of the new family Nannizziopsiaceae and five new species. Persoonia 2013; 31: 86–100. 9. Sigler L, Congly H. Toenail infection caused by Onychocola canadensis gen. et sp. nov. J Med Vet Mycol 1990; 28: 405–417. 10. Hubka V, Dobiasova S, Lyskova P et al. Auxarthron ostraviense sp. nov., and A. umbrinum associated with nondermatophytic onychomycosis. Med Mycol 2013; 51: 614–624. 11. Stuchl´ık D, Mencl K, Hubka V, Skoˇrepova´ M. Fungal melanonychia caused by Onychocola canadensis: first records of nail infections due to Onychocola in the Czech Republic. Czech Mycol 2011; 63: 83–91. 12. Hubka V, Skorepova M, Dobiasova S et al. Two undescribed dermatophyte species, Trichophyton and Microsporum, isolated from Czech patients (P361). Mycoses 2013; 56 (Suppl. 3): 162. 13. Atlas RM. Handbook of Microbiological Media, 4th edn. Boca Raton, FL: CRC Press, 2010. 14. Georg LK, Camp LB. Routine nutritional tests for the identification of dermatophytes. J Bacteriol 1957; 74: 113–121. 15. Graser Y, Kuijpers AFA, Presber W, De Hoog GS. Molecular ¨ taxonomy of Trichophyton mentagrophytes and T. tonsurans. Med Mycol 1999; 37: 315–330. 16. Ajello L, Georg LK. In vitro hair cultures for differentiating between atypical isolates of Trichophyton mentagrophytes and Trichophyton rubrum. Mycopathologia 1957; 8: 3–17. 17. Philpot C. The differentiation of Trichophyton mentagrophytes from T. rubrum by a simple urease test. Med Mycol 1967; 5: 189–193. a´ A, Peterson SW. Taxonomi18. Hubka V, Kolaˇr´ık M, Kubatov ´ cal revision of the genus Eurotium and transfer of species to Aspergillus. Mycologia 2013; 105: 912–937. 19. Hubka V, Kubatova A, Mallatova N et al. Rare and new aetiological agents revealed among 178 clinical Aspergillus strains obtained from Czech patients and characterised by molecular sequencing. Med Mycol 2012; 50: 601–610. 20. Hubka V, Kolaˇr´ık M. β-tubulin paralogue tubC is frequently misidentified as the benA gene in Aspergillus section Nigri taxonomy: primer specificity testing and taxonomic consequences. Persoonia 2012; 29: 1–10. 21. Tamura K, Peterson D, Peterson N et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011; 28: 2731–2739. 22. Novakov a´ A, Hubka V, Saiz-Jimenez C, Kolarik M. Aspergillus ´ baeticus sp. nov. and Aspergillus thesauricus sp. nov.: two species in section Usti originating from Spanish caves. Int J Syst Evol Microbiol 2012; 62: 2778–2785. 23. Keller MC, French LE, Hofbauer GFL, Bosshard PP. Erythematous skin macules with isolation of Trichophyton eboreum— infection or colonisation? Mycoses 2013; 56: 373–375. 24. Hubka V, Skorepova M, Kolarik M. One year overview of nonT. rubrum dermatophytes isolated in Czech Republic and identified by molecular methods (P541). Mycoses 2012; 55 (Suppl. 4): 265. 25. Stockdale PM. Nannizzia incurvata gen. nov., sp. nov., a perfect state of Microsporum gypseum (Bodin) Guiart et Grigorakis. Med Mycol 1962; 1: 41–48. 26. Stockdale PM. The Microsporum gypseum complex (Nannizzia
Medical Mycology, 2014, Vol. 52, No. 4
