Mol Cell Biochem (2014) 386:223–231 DOI 10.1007/s11010-013-1860-y
miR-185 is an independent prognosis factor and suppresses tumor metastasis in gastric cancer Zhiqin Tan • Hao Jiang • Youhua Wu • Liming Xie • Wenxiang Dai • Hailin Tang Sanyuan Tang
•
Received: 23 July 2013 / Accepted: 9 October 2013 / Published online: 25 October 2013 Ó Springer Science+Business Media New York 2013
Abstract miR-185 has been identified as an important factor in several cancers such as breast cancer, ovarial cancer, and prostate cancer. However, its effect and prognostic value in gastric cancer are still poorly known. In this study, we found that the expression levels of miR-185 were strongly downregulated in gastric cancer and associated with clinical stage and the presence of lymph node metastases. Moreover, miR-185 might independently predict OS and RFS in gastric cancer. We further found that upregulation of miR-185 inhibited the proliferation and metastasis of gastric cancer cells in vitro and in vivo. Taken together, our findings demonstrate that the miR-185 is important for gastric cancer initiation and progression and holds promise as a prognostic biomarker to predict survival and relapse in gastric cancer. It is also a potential
Z. Tan H. Jiang Y. Wu L. Xie W. Dai S. Tang (&) Center for Gastric Cancer Research of Human Province, The First Affiliated Hospital, University of South China, 69 Chuanshan Road, Hengyang 421001, People’s Republic of China e-mail: [email protected] Z. Tan Department of Gynaecology and Obstetrics, The 169th Hospital of PLA, 369 South Dongfeng Road, Hengyang 421002, People’s Republic of China e-mail: [email protected] H. Tang (&) State Key Laboratory of Oncology in South China, Sun Yat-Sen University Cancer Center, 651 East Dongfeng Road, Guangzhou 510060, People’s Republic of China e-mail: [email protected]
therapeutic tool to improve clinical outcomes in the above disease. Keywords Gastric cancer miR-185 Prognostic significance
Introduction Gastric cancer is one of the most common malignancies and is the second leading cause of cancer mortality worldwide [1]. Nearly half of gastric cancer occurs in China with an overall 5-year survival rate of approximately 20 % [2], most of which are diagnosed in advanced stages and thus have lost the opportunity for radical surgery. Lack of early detection and limited treatment options contribute to its bad prognosis. Therefore, the identification of novel mediators of invasion and metastasis, in addition to novel biomarkers of gastric cancer progression, is crucial to improve the patient outcome. miRNA expression has firmly established that miRNAs regulate various key cellular processes, such as proliferation, apoptosis, differentiation, development [3], and are implicated in human diseases, including cancer [4]. An increasing number of studies have demonstrated that miRNAs can function as oncogenes or tumor suppressors and are often dysregulated in tumors [5]. Accumulating evidence suggests that there are correlations between miRNA expression and clinical recurrence, development of metastases, and/or survival [6]. Due to their tissue- and disease-specific expression patterns and regulatory potentials, miRNAs are being assessed as potential biomarkers for diagnosis and prognosis of human malignancies [7]. miR-185, located on chromosome 22q11.21, is one of the
123
224
characterized tumor suppressor miRNAs. miR-185 has been reported to be downregulated in a variety of cancers, including colorectal cancer [8, 9], hepatocellular carcinoma [10], epithelial ovarian cancer [11], breast cancer [12], and prostate cancer [13]. We have previously reported that miR-185 is strongly downregulated and suppresses tumor proliferation and invasion by directly targeting DNMT1, RhoA, and CDC42 in glioma. Until now, the role of miR185 in gastric cancer remains undefined [14, 15]. Thus, we aimed to investigate the effect of the miR-185 on the carcinogenesis and progression of gastric cancer and their prognostic significance. In the present study, we found miR-185 expression is downregulated in 36 stomach tumor specimens, as well as gastric cell lines, by means of quantitative RT-PCR analysis. miR-185 expression was detected by in situ hybridization on tissue microarrays (TMAs), and the associations between miR-185 levels and clinicopathologic factors and prognosis were analyzed: the results indicated that decreased miR-185 correlates with advanced clinical stage, lymph node metastases, and poor clinical outcomes. In addition, we observed that miR-185 suppresses gastric cancer growth and metastasis in vitro and vivo.
Materials and methods Cell culture The gastric epithelial cell line GES-1 was purchased from the Beijing Institute for Cancer Research (Beijing, China). The gastric cancer cell lines MGC-803, BGC-823, MKN-28, SGC-7901, HGC-27, AGS, and MKN-45 were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). These cells were maintained at 37 °C in an atmosphere of 5 % CO2 in RPMI-1640 medium supplemented with 10 % fetal bovine serum, penicillin, and streptomycin (Gibco BRL, NY, USA). All transfections were performed using Lipofectamine 2,000 (Invitrogen, Carlsbad, USA). Clinical samples All tissue samples used in the present study were collected from the Hunan Provincial Tumour Hospital (Changsha, Hunan, China). Written informed consent was obtained from all study participants. This study was approved by the Ethics Committee of the University of South China Health Authority. The collection and use of tissues followed the procedures that are in accordance with the ethical standards as formulated in the Helsinki Declaration. Tissue samples from 36 gastric cancer patients (20 male and 16 female; median age 57.5 years; range 40–79 years) were used for quantitative
123
Mol Cell Biochem (2014) 386:223–231
real-time PCR (qRT-PCR) analysis. Resected cancerous tissues (tumor) and paired matched normal gastric tissues (normal) were immediately cut and stored in RNAlater (Ambion). The TMAs consisted of 126 cases of gastric carcinoma and 41 cases of normal stomach mucosa used for in situ hybridization analysis. The median age of the gastric cancer patients at diagnosis was 57 years (range 31–82). All data, including age, sex, histological grade, tumor size, invasion depth (T stage), and lymph node metastasis were obtained from clinical and pathological records.
Quantitative RT-PCR analysis (qRT-PCR) Total RNA was extracted from cells using TRIzol reagent (Invitrogen, Carlsbad, USA). Reverse transcription and qRT-PCR reactions were performed by means of a qSYBR-green PCR kit (Qiagen, Germantown, USA). Fold change was determined as 2-ddCt. The Ct is the fractional cycle number at which the fluorescence of each sample passes the fixed threshold. The dCt was calculated by subtracting the Ct of snRNA U6 from the Ct of the miRNA of interest. The ddCt was calculated by subtracting the dCt of the reference sample (paired nontumorous tissue for surgical samples and GES-1 cell for six gastric cancer cell lines) from the dCt of each sample. The sequences of the specific primers for miR-185 and U6 snRNA were 50 TGGAGAGAAAGGCAGTTCCTGA-30 and 50 -ATTGGAACGATACAGAGAAGATT-30 , respectively.
In situ hybridization Tissue microarray slides were deparaffinized and rehydrated. The miR-185 miRCURYTM LNA custom detection probe (Exiqon, Vedbaek, Denmark) was used for in situ hybridization (ISH). The sequence 50 -30 (enhanced with LNA) was tcaggaactgcctttctctcca with digoxigenin at the 50 and 30 ends. Hybridization, washing, and scanning were carried out according to the manuals and protocols provided by the Exiqon life science department. The intensity of staining was scored from 0 to 4, and the extent of staining was scored from 0 to 100 %. Relative expression was obtained by multiplying the two scores. The slides were analyzed by two independent pathologists. Cell proliferation assay Cells were plated on 12-well plates at the desired cell concentrations. Cell counts were estimated by trypsinizing the cells and performing analysis using a Coulter Counter (Beckman Coulter, Fullerton, USA) at the indicated time points in triplicate.
Mol Cell Biochem (2014) 386:223–231
Cell migration and invasion assays Cell migration was examined using wound-healing assays. An artificial ‘‘wound’’ was created on a confluent cell monolayer, scratching assay was treated by 10 lg/mL mitomycin C for 2 h, and photographs were taken using an inverted microscope (Olympus, Tokyo, Japan) at 24 h. For cell invasion assay, cells were seeded onto the basement membrane matrix present in the insert of a 24-well culture plate (EC matrix, Chemicon, Temecula, CA, USA), and fetal bovine serum was added to the lower chamber as a chemoattractant. After a further 48 h, the noninvading cells and EC matrix were gently removed with a cotton swab. Invasive cells located on the lower side of the chamber were stained with Crystal Violet, counted, and imaged. Apoptosis analysis The apoptotic cells were evaluated by Annexin V-FITC and propidium iodine staining (BD, USA) and analyzed with a FACS Calibur instrument (BD, USA). The collected data were analyzed using FlowJosoftware.
225
miR-185 or scramble viruses were injected into the tail vein of nude mice (eight in each group). After 45 days, necropsies were performed. Numbers of micrometastases in lung per HE-stained section in individual mice were analyzed by morphology observation. All animal procedures were performed in accordance with institutional guidelines. Statistical analysis Comparisons between groups were analyzed by the t test and x2 test. Overall survival curves and relapse-free curves were plotted using the Kaplan–Meier method, with the logrank test applied for comparison. Survival was measured from the day of surgery. Variables with a value of P \ 0.05 according to the univariate analysis were used in subsequent multivariate analysis based on the Cox proportional hazards model. All differences were statistically significant at the level of P B 0.05. Statistical analyses were performed using SPSS16.0 software.
Results Detection of mitochondrial membrane potential (MMP, Dwm) using JC-1 To measure the mitochondrial membrane potential (Dwm), 5,50 ,6,60 -tetrachloro-1,10 ,3,30 -tetraethylbenzimidazolylcarbocyanine iodide (JC-1), which is a sensitive fluorescent probe kit for Dwm, was used (Biyuntian Biochemistry Limited Company, China). Treated or untreated cells were cultured in 24-well plates for 24 h, washed with PBS, and incubated with a JC-1 working solution for 20 min at 37 °C. The cells were rinsed twice with PBS, stained with 1 mL 10 % RPMI-1640 medium containing 5 lmol/L JC-1, resuspended in 1 mL ice-cooled PBS, washed with PBS, and resuspended in 500 lL PBS. The stained cells were analyzed using a fluorescence microscope to determine a change in the florescence from red to green [16]. Mouse xenograft model The gastric cancer model in nude mice was constructed as described [17]. 2 9 106 SGC-7901 cells infected with miR-185 or scramble viruses were propagated and inoculated subcutaneously into the dorsal flanks of nude mice (5 in each group). Tumor size was measured every 4 days. After 28 days, the mice were killed, necropsies were performed, and the tumors were weighed. Tumor volumes were determined according to the following formula: A 9 B2/2, where A is the largest diameter, and B is the diameter perpendicular to A. To assay miR-185’s effect on tumor metastasis, 1 9 106 SGC-7901 cells infected with
miR-185 is down-regulated in gastric cancer First, a series of human gastric cancer cell lines was analyzed to assess the expression profile of miR-185 in gastric cancer using qRT-PCR (Fig. 1a). Compared with the nonmalignant gastric cell line GES-1, seven of the gastric cancer cell lines showed reduced miR-185 expression, especially the SGC-7901 (\18.8 % of means of GES-1 cells). We also assessed the expression of miR-185 in a series of 36 pairs of gastric cancer tissues and their matched adjacent tissues. Among the 36 patients with gastric cancer, approximately 86.1 % (P \ 0.0001, 31 of 36 patients) of tumors revealed a large reduction of miR-185 levels (2.1-fold) relative to adjacent nontumor tissues (Fig. 1b). To further verify the results concerning the biological role of miR-185 in gastric cancer, we employed in situ hybridization to evaluate miR-185 levels in 126 gastric tumors and 41 normal stomach tissues in a TMA. The results revealed that miR-185 was strongly downregulated in stomach tumors compared with normal tissues (Fig. 1c). These data indicate that miR-185 was downregulated in gastric cancer. Decreased miR-185 correlates with advanced clinical stage, lymph node metastases, and poor clinical outcomes We next investigated the association of miR-185 expression with the clinical outcome in a cohort of 126 primary gastric
123
226
Mol Cell Biochem (2014) 386:223–231
Fig. 1 miR-185 expression level was frequently downregulated in human gastric cancer. a Relative expressions of miR-185 in seven cell lines derived from gastric cancer and one nonmalignant gastric cell line (GES-1) was determined by qRT-PCR. b miR-185 expression was detected in 36 gastric cancer patients by qRT-PCR. c miR-185 expression was analyzed in normal stomach mucosa (normal) and
gastric cancer (tumor) samples on the tissue microarray by in situ hybridization. Expression scores are shown as box plots. The vertical bars represent the range of the data. d and e Low levels of miR-185 correlate with shorter survival. OS and RFS curves for all patients with high or low miR-185 expression
cancers with annotated clinical history. Of note, the miR-185 level inversely correlated with clinical stage and lymph node metastasis (P = 0.001 and P = 0.003, respectively) (Table 1). However, neither of the miR-185 levels in gastric cancer patients correlated with age, gender, tumor size, cell differentiation, or invasion depth. Our results suggest that miR-185 could play critical roles in carcinogenesis and progression of gastric cancer. To further analyze the significance of miR-185 in terms of clinical prognosis, Kaplan– Meier survival analysis was performed using patient’s overall survival and relapse-free survival. The results demonstrated that patients with low miR-185 expression had shorter mean months of OS and RFS than did patients with high miR-185 expression (P \ 0.0001 for OS, P \ 0.0001 for RFS) (Fig. 1d). Then, we used Cox proportional-hazards regression to evaluate the association between miR-185 expression and prognosis further. In univariate analysis, the levels of miR-185 were significantly associated with prognosis (Tables 2, 3). The final multivariate model revealed that reduced miR-185 levels in tumors were independent
predictors of shorter survival (Tables 2, 3). TNM stage was an independent significant prognostic factor as well (Tables 2, 3) (P \ 0.05). A similar trend was found for lymph-node metastasis (P \ 0.1) (Tables 2, 3).
123
miR-185 inhibited gastric cancer cell proliferation, migration, invasion, and induced cell apoptosis in vitro Because miR-185 levels were downregulated in gastric cancer and were associated with the clinical stage, lymph node metastasis, and clinical outcome, we evaluated the effect of miR-185 overexpression on gastric cancer cell phenotype. SGC-7901 with relatively low basal expression of miR-185 (Fig. 1a) was infected with either miR-185 or control lentivirus and selected with 5 mg/L puromycin for 2 weeks. qRT-PCR and western blot [11, 14] analysis showed that the transfection was successful (Fig. 2a). The proliferation assay showed that ectopic expression of miR185 in SGC-7901 markedly attenuated cell proliferation compared with control cells (Fig. 2b). Moreover,
Mol Cell Biochem (2014) 386:223–231
227
Table 1 Analysis of the correlation between expression of miR-185 in primary gastric cancer and its clinicopathological parameters Viable
Cases
miR-185
Dwm) in SGC-7901 cells by the JC-1 method. As shown in Fig. 3b, we found that the MMP was low and JC-1 predominantly appeared as green fluorescence in control cells. These data demonstrate that the miR-185 functions as a tumor suppressor in gastric cancer.
Low
High
P value
0.400
miR-185 suppresses gastric cancer growth and metastasis in vivo
0.453
Next, we tested to determine whether miR-185 could play a role in tumorigenesis by using nude mice xenograft models. At 28 days, the mean volume and weight of the tumors generated overexpression of miR-185 in SGC-7901 cells, which significantly suppressed tumor growth in nude mice (Fig. 4a, b). Then, SGC-7901 cells infected with miR-185 or mock lentivirus were injected into the tail vein of nude mice to examine lung metastasis. As shown Fig. 4c, a significantly lower number of macroscopic lung metastases could be observed for miR-185 overexpressing cells than control cells (Fig. 4c). These results indicate that miR-185 may repress gastric cancer growth and metastasis.
Age (years) \60
73
44
29
C60 Gender
53
34
19
Male
70
46
27
Female
56
32
21
Well and moderate
32
24
8
Poor and other
94
54
40
T1-T2
71
40
31
T3-T4
55
38
17
Histological gradea 0.058
T stage 0.100
TNM stage I–II
51
23
28
III–IV
75
55
20
Present
88
62
26
Absent
38
16
22
0.001
Lymph node metastasis 0.003
a
Discussion
expression of miR-185 significantly inhibited the capacity of cells for migration and invasion (Fig. 2c, d). We then performed cell apoptosis analysis that revealed that miR185 overexpression in SGC-7901 induced the cell apoptosis (Fig. 3a). Meanwhile, we detected the effect of the miR-185 on the mitochondrial membrane potential (MMP,
In this study, we used qRT-PCR and ISH to show that miR185 was frequently downregulated in human gastric cancer and that the downregulated miR-185 was significantly associated with advanced clinical stage and lymph nodemetastasis. Further studies showed that overexpression of miR-185 suppressed the gastric cancer cell migration and invasion in vitro and metastasis in vivo. Kaplan–Meier survival analyses revealed that patients whose primary
Well-differentiated adenocarcinoma (well), moderately differentiated adenocarcinoma (moderate), poorly differentiated adenocarcinoma (poor), other histological type (other)
Table 2 Univariate and multivariable Cox regression analysis of OS (Cox proportional hazards regression model) Viable
TNM stage (I–II vs. III–IV)
Univariate analysis
Multivariate analysis
RR
95 % CI
P value
RR
95 % CI
P value
3.71
2.29–6.03
0.000
3.26
1.99–5.35
0.000
Lymph node metastasis (absent vs. present)
3.08
1.78–5.34
0.000
2.04
1.14–3.63
0.016
miR-185 (low vs. high)
0.39
0.25–0.63
0.000
0.49
0.30–0.79
0.004
RR relative risk, CI confidence interval Table 3 Univariate and multivariable Cox regression analysis of RFS (Cox proportional hazards regression model) Viable
Univariate analysis
Multivariate analysis
RR
95 % CI
P value
RR
95 % CI
P value
TNM stage (I–II vs. III–IV)
2.93
1.91–4.49
0.000
2.15
1.37–3.38
0.001
Lymph node metastasis (absent vs. present)
3.42
2.06–5.68
0.000
2.55
1.49–4.35
0.001
miR-185 (low vs. high)
0.49
0.32–0.75
0.001
0.61
0.39–0.93
0.023
Univariate analysis
123
228
Mol Cell Biochem (2014) 386:223–231
Fig. 2 miR-185 inhibited cell proliferation, migration, and invasion in gastric cancer. a SGC-7901 cells transfected with miR-185 or scramble mimics (upper panel). The effect of miR-185 mimics on the protein expression of DNMT1 by western blot. b-actin was used as a loading control (down panel). b The growth of SGC7901 cells infected with miR185 lentivirus or scramble lentivirus was assayed. c The wound-healing assay of SGC7901 cells infected with miR185 lentivirus or scramble lentivirus. d The invasion assay of SGC-7901 cells infected with miR-185 lentivirus or scramble lentivirus. The invasion assay was measured by way of Transwell assays with Matrigel
tumors displayed low expression of miR-185 had a shorter OS and RFS in gastric cancer. In addition, multivariate analysis showed that reduced miR-185 in tumors was strong and independent predictors of shorter OS and RFS. Based on array data, it was previously reported that a combination of several miRNAs may be useful as prognostic markers in gastric cancer [18, 19]. Moreover, a single-miRNA, such as miR-218 can be a prognostic factor [20]. However, these miRNAs have been investigated in just a few gastric cancer patients. The data from the current study suggests that the miR-185 is important for gastric cancer initiation and progression and holds promise as a novel metastasis suppressor in gastric cancer and that downregulated miR-185
123
contributes to lymph node-metastasis and tumor progression in gastric cancer patients. It is also a potential prognostic biomarker to predict survival and relapse in gastric. Downregulation of miR-185 is a frequent event in various cancers [8–10, 12, 15], suggesting that miR-185 may play an important role in tumorigenesis and tumor progression. In this study, we also found that miR-185 was frequently downregulated in gastric cancer, and 86.1 % (31 of 36) of the gastric cancer had 2.1-fold reduced expression of miR-185 compared with their corresponding nontumorous tissues. Intriguingly, we found that lower expression of miR-185 tended to have more advanced TNM stage (stage I/II vs. stage III/IV, P = 0.001), suggesting that low
Mol Cell Biochem (2014) 386:223–231
229
Fig. 3 miR-185 induced the cell apoptosis in gastric cancer. a SGC7901 cells were infected with miR-185 lentivirus or scramble lentivirus. The apoptotic cells were evaluated by Annexin V-FITC and propidium iodine staining and analyzed with FACS. A representative result is shown, and summarized data are presented. Data are
presented as mean ± s.e.m from at least three separate experiments. b miR-185 regulates cell mitochondrial membrane potential (MMP, Dwm); overexpression of miR-185 resulted in reduced MMP and increased green fluorescence in SGC-7901 cells
Fig. 4 miR-185 inhibited gastric cancer cell growth and metastasis in vivo. a Tumor growth in mouse xenograft models. SGC-7901 cells infected with miR-185 lentivirus or scramble were injected subcutaneously into nude mice. Tumor volume was measured every 4 days. After 28 days, the mice were killed, necropsies were performed, and tumors were weighed. All data are shown as mean ± s.e.m. b Tumor
metastasis in mouse xenograft models. SGC-7901 cells with overexpression of miR-185 or scramble were injected into the tail vein of nude mice. After 60 days, the mice were killed. Micrometastases in lung per HE-stained section in individual mice were calculated. Each group had eight mice. Original magnification, 9100. All data are shown as mean ± s.e.m
123
230
Mol Cell Biochem (2014) 386:223–231
expression of miR-185 is associated with gastric cancer progression. Lymph node-metastasis is an initial step of gastric cancer metastasis, and is a crucial factor in the determination of the clinical staging, prognosis, and survival of gastric cancer patients [21, 22]. Recent studies document that miRNAs play important roles in gastric cancer initiation and progression [23, 24]. It is intriguing that miRNAs are associated with lymph node-metastasis of gastric cancer, such as miR-148a [22], miR-370 [25], miR146a [26], miR-107 [27], and miR-429 [28], which may provide new insights for designing better therapeutic strategies to treat gastric cancer patients with lymph nodemetastasis. In accordance with our results, the overexpression of miR-185 in gastric cancer cells impaired the migration, invasion and metastasis of gastric cancer, further supporting the correlation between miR-185 levels and clinicopathologic factors, such as lymph node metastasis and TNM stage. The data from the current study suggest that miR-185 acts as a novel metastasis suppressor in gastric cancer, and that downregulated miR-185 contributes to lymph node-metastasis and tumor progression in gastric cancer patients. Various studies have shown that DNMT1 [11, 14], CDC42, and RhoA [9, 15], SIX1[12], CDK6 [15, 29], androgen receptor [13], and c-Myc [30] are potential downstream target genes of miR-185. It is possible that the discrepancies in the functions of miR-185 in different types of cancer may reflect differences in target genes. In addition, when overexpressed, miR-185 directly targeted DNMT1 gene, which resulted in marked reduction of the expression of DNA methyltransferases DNMT1 at the protein level. This effect, in turn, led to a decrease in global DNA methylation and reexpression of p16, RASS1A1, and E-cadherin via promoter DNA hypomethylation [31]. However, the molecular mechanisms of miR-185 and the target genes in gastric cancer should be further investigated. In summary, we observed downregulation of miR-185 in gastric cancer cells and tissues and demonstrated that miR185 may act as an independent predictor of OS and RFS. We further found that miR-185 as an important antimetastatic miRNA is associated with lymph node-metastasis in gastric cancer. Enforced expression of miR-185 suppresses gastric cancer cell invasion and metastasis. Taken together, our findings demonstrate that the miR-185 is important for gastric initiation and progression and holds promise as a prognostic biomarker to predict survival and relapse in gastric cancer and potential therapeutic to suppress gastric cancer metastasis. Acknowledgments This study was supported by the Nature Scientific Foundation of China (31100935). Conflict of interest
123
No potential conflicts of interest are disclosed.
References 1. Hartgrink HH, Jansen EP, van Grieken NC, van de Velde CJ (2009) Gastric cancer. Lancet 374:477–490. doi:10.1016/S01406736(09)60617-6 2. Kamangar F, Dores GM, Anderson WF (2006) Patterns of cancer incidence, mortality, and prevalence across five continents: defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol 24:2137–2150. doi:10. 1200/JCO.2005.05.2308 3. Schickel R, Boyerinas B, Park SM, Peter ME (2008) MicroRNAs: key players in the immune system, differentiation, tumorigenesis and cell death. Oncogene 27:5959–5974. doi:10.1038/ onc.2008.274 4. Ventura A, Jacks T (2009) MicroRNAs and cancer: short RNAs go a long way. Cell 136:586–591. doi:10.1016/j.cell.2009.02.005 5. Slack FJ, Weidhaas JB (2008) MicroRNA in cancer prognosis. N Engl J Med 359:2720–2722. doi:10.1056/NEJMe0808667 6. Hurst DR, Edmonds MD, Welch DR (2009) Metastamir: the field of metastasis-regulatory microRNA is spreading. Cancer Res 69:7495–7498. doi:10.1158/0008-5472.CAN-09-2111 7. Bartels CL, Tsongalis GJ (2009) MicroRNAs: novel biomarkers for human cancer. Clin Chem 55:623–631. doi:10.1373/clinchem. 2008.112805 8. Akcakaya P, Ekelund S, Kolosenko I, Caramuta S, Ozata DM, Xie H, Lindforss U, Olivecrona H, Lui WO (2011) miR-185 and miR-133b deregulation is associated with overall survival and metastasis in colorectal cancer. Int J Oncol 39:311–318. doi:10. 3892/ijo.2011.1043 9. Liu M, Lang N, Chen X, Tang Q, Liu S, Huang J, Zheng Y, Bi F (2011) miR-185 targets RhoA and Cdc42 expression and inhibits the proliferation potential of human colorectal cells. Cancer Lett 301:151–160. doi:10.1016/j.canlet.2010.11.009 10. Zhi Q, Zhu J, Guo X, He S, Xue X, Zhou J, Hu B, Li H, Chen S, Zhao H, Kuang Y (2013) Metastasis-related miR-185 is a potential prognostic biomarker for hepatocellular carcinoma in early stage. Biomed Pharmacother 67:393–398. doi:10.1016/j. biopha.2013.03.022 11. Xiang Y, Ma N, Wang D, Zhang Y, Zhou J, Wu G, Zhao R, Huang H, Wang X, Qiao Y, Li F, Han D, Wang L, Zhang G, Gao X (2013) MiR-152 and miR-185 co-contribute to ovarian cancer cells cisplatin sensitivity by targeting DNMT1 directly: a novel epigenetic therapy independent of decitabine. Oncogene. doi:10. 1038/onc.2012.575 12. Imam JS, Buddavarapu K, Lee-Chang JS, Ganapathy S, Camosy C, Chen Y, Rao MK (2010) MicroRNA-185 suppresses tumor growth and progression by targeting the Six1 oncogene in human cancers. Oncogene 29:4971–4979. doi:10.1038/onc.2010.233 13. Qu F, Cui X, Hong Y, Wang J, Li Y, Chen L, Liu Y, Gao Y, Xu D, Wang Q (2013) MicroRNA-185 suppresses proliferation, invasion, migration, and tumorigenicity of human prostate cancer cells through targeting androgen receptor. Mol Cell Biochem 377:121–130. doi:10.1007/s11010-013-1576-z 14. Zhang Z, Tang H, Wang Z, Zhang B, Liu W, Lu H, Xiao L, Liu X, Wang R, Li X, Wu M, Li G (2011) MiR-185 targets the DNA methyltransferases 1 and regulates global DNA methylation in human glioma. Mol Cancer 10:124. doi:10.1186/1476-4598-10124 15. Tang H, Wang Z, Liu X, Liu Q, Xu G, Li G, Wu M (2012) LRRC4 inhibits glioma cell growth and invasion through a miR-185dependent pathway. Curr Cancer Drug Targets 12:1032–1042 16. Tang H, Bian Y, Tu C, Wang Z, Yu Z, Liu Q, Xu G, Wu M, Li G (2013) The miR-183/96/182 cluster regulates oxidative apoptosis and sensitizes cells to chemotherapy in gliomas. Curr Cancer Drug Targets 13:221–231
Mol Cell Biochem (2014) 386:223–231 17. Deng M, Ye Q, Qin Z, Zheng Y, He W, Tang H, Zhou Y, Xiong W, Zhou M, Li X, Yan Q, Ma J, Li G (2013) miR-214 promotes tumorigenesis by targeting lactotransferrin in nasopharyngeal carcinoma. Tumour Biol 34:1793–1800. doi:10.1007/s13277013-0718-y 18. Li X, Zhang Y, Zhang Y, Ding J, Wu K, Fan D (2010) Survival prediction of gastric cancer by a seven-microRNA signature. Gut 59:579–585. doi:10.1136/gut.2008.175497 19. Ueda T, Volinia S, Okumura H, Shimizu M, Taccioli C, Rossi S, Alder H, Liu CG, Oue N, Yasui W, Yoshida K, Sasaki H, Nomura S, Seto Y, Kaminishi M, Calin GA, Croce CM (2010) Relation between microRNA expression and progression and prognosis of gastric cancer: a microRNA expression analysis. Lancet Oncol 11:136–146. doi:10.1016/S1470-2045(09)70343-2 20. Tie J, Pan Y, Zhao L, Wu K, Liu J, Sun S, Guo X, Wang B, Gang Y, Zhang Y, Li Q, Qiao T, Zhao Q, Nie Y, Fan D (2010) MiR218 inhibits invasion and metastasis of gastric cancer by targeting the Robo1 receptor. PLoS Genet 6:e1000879. doi:10.1371/ journal.pgen.1000879 21. Coburn NG (2009) Lymph nodes and gastric cancer. J Surg Oncol 99:199–206. doi:10.1002/jso.21224 22. Zheng B, Liang L, Wang C, Huang S, Cao X, Zha R, Liu L, Jia D, Tian Q, Wu J, Ye Y, Wang Q, Long Z, Zhou Y, Du C, He X, Shi Y (2011) MicroRNA-148a suppresses tumor cell invasion and metastasis by downregulating ROCK1 in gastric cancer. Clin Cancer Res 17:7574–7583. doi:10.1158/1078-0432.CCR-111714 23. Oh HK, Tan AL, Das K, Ooi CH, Deng NT, Tan IB, Beillard E, Lee J, Ramnarayanan K, Rha SY, Palanisamy N, Voorhoeve PM, Tan P (2011) Genomic loss of miR-486 regulates tumor progression and the OLFM4 antiapoptotic factor in gastric cancer. Clin Cancer Res 17:2657–2667. doi:10.1158/1078-0432.CCR-103152 24. Nishida N, Mimori K, Fabbri M, Yokobori T, Sudo T, Tanaka F, Shibata K, Ishii H, Doki Y, Mori M (2011) MicroRNA-125a-5p
231
25.
26.
27.
28.
29.
30.
31.
is an independent prognostic factor in gastric cancer and inhibits the proliferation of human gastric cancer cells in combination with trastuzumab. Clin Cancer Res 17:2725–2733. doi:10.1158/ 1078-0432.CCR-10-2132 Lo SS, Hung PS, Chen JH, Tu HF, Fang WL, Chen CY, Chen WT, Gong NR, Wu CW (2012) Overexpression of miR-370 and downregulation of its novel target TGFbeta-RII contribute to the progression of gastric carcinoma. Oncogene 31:226–237. doi:10. 1038/onc.2011.226 Kogo R, Mimori K, Tanaka F, Komune S, Mori M (2011) Clinical significance of miR-146a in gastric cancer cases. Clin Cancer Res 17:4277–4284. doi:10.1158/1078-0432.CCR-102866 Li X, Zhang Y, Shi Y, Dong G, Liang J, Han Y, Wang X, Zhao Q, Ding J, Wu K, Fan D (2011) MicroRNA-107, an oncogene microRNA that regulates tumour invasion and metastasis by targeting DICER1 in gastric cancer. J Cell Mol Med 15:1887–1895. doi:10.1111/j.1582-4934.2010.01194.x Sun T, Wang C, Xing J, Wu D (2011) miR-429 modulates the expression of c-myc in human gastric carcinoma cells. Eur J Cancer 47:2552–2559. doi:10.1016/j.ejca.2011.05.021 Takahashi Y, Forrest AR, Maeno E, Hashimoto T, Daub CO, Yasuda J (2009) MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS ONE 4:e6677. doi:10.1371/journal.pone.0006677 Liao JM, Lu H (2011) Autoregulatory suppression of c-Myc by miR-185-3p. J Biol Chem 286:33901–33909. doi:10.1074/jbc. M111.262030 Tang H, Deng M, Tang Y, Xie X, Guo J, Kong Y, Ye F, Su Q, Xie X (2013) miR-200b and miR-200c as prognostic factors and mediators of gastric cancer cell progression. Clin Cancer Res. doi:10.1158/1078-0432.CCR-13-1326
123
miR-185 is an independent prognosis factor and suppresses tumor metastasis in gastric cancer Zhiqin Tan • Hao Jiang • Youhua Wu • Liming Xie • Wenxiang Dai • Hailin Tang Sanyuan Tang
•
Received: 23 July 2013 / Accepted: 9 October 2013 / Published online: 25 October 2013 Ó Springer Science+Business Media New York 2013
Abstract miR-185 has been identified as an important factor in several cancers such as breast cancer, ovarial cancer, and prostate cancer. However, its effect and prognostic value in gastric cancer are still poorly known. In this study, we found that the expression levels of miR-185 were strongly downregulated in gastric cancer and associated with clinical stage and the presence of lymph node metastases. Moreover, miR-185 might independently predict OS and RFS in gastric cancer. We further found that upregulation of miR-185 inhibited the proliferation and metastasis of gastric cancer cells in vitro and in vivo. Taken together, our findings demonstrate that the miR-185 is important for gastric cancer initiation and progression and holds promise as a prognostic biomarker to predict survival and relapse in gastric cancer. It is also a potential
Z. Tan H. Jiang Y. Wu L. Xie W. Dai S. Tang (&) Center for Gastric Cancer Research of Human Province, The First Affiliated Hospital, University of South China, 69 Chuanshan Road, Hengyang 421001, People’s Republic of China e-mail: [email protected] Z. Tan Department of Gynaecology and Obstetrics, The 169th Hospital of PLA, 369 South Dongfeng Road, Hengyang 421002, People’s Republic of China e-mail: [email protected] H. Tang (&) State Key Laboratory of Oncology in South China, Sun Yat-Sen University Cancer Center, 651 East Dongfeng Road, Guangzhou 510060, People’s Republic of China e-mail: [email protected]
therapeutic tool to improve clinical outcomes in the above disease. Keywords Gastric cancer miR-185 Prognostic significance
Introduction Gastric cancer is one of the most common malignancies and is the second leading cause of cancer mortality worldwide [1]. Nearly half of gastric cancer occurs in China with an overall 5-year survival rate of approximately 20 % [2], most of which are diagnosed in advanced stages and thus have lost the opportunity for radical surgery. Lack of early detection and limited treatment options contribute to its bad prognosis. Therefore, the identification of novel mediators of invasion and metastasis, in addition to novel biomarkers of gastric cancer progression, is crucial to improve the patient outcome. miRNA expression has firmly established that miRNAs regulate various key cellular processes, such as proliferation, apoptosis, differentiation, development [3], and are implicated in human diseases, including cancer [4]. An increasing number of studies have demonstrated that miRNAs can function as oncogenes or tumor suppressors and are often dysregulated in tumors [5]. Accumulating evidence suggests that there are correlations between miRNA expression and clinical recurrence, development of metastases, and/or survival [6]. Due to their tissue- and disease-specific expression patterns and regulatory potentials, miRNAs are being assessed as potential biomarkers for diagnosis and prognosis of human malignancies [7]. miR-185, located on chromosome 22q11.21, is one of the
123
224
characterized tumor suppressor miRNAs. miR-185 has been reported to be downregulated in a variety of cancers, including colorectal cancer [8, 9], hepatocellular carcinoma [10], epithelial ovarian cancer [11], breast cancer [12], and prostate cancer [13]. We have previously reported that miR-185 is strongly downregulated and suppresses tumor proliferation and invasion by directly targeting DNMT1, RhoA, and CDC42 in glioma. Until now, the role of miR185 in gastric cancer remains undefined [14, 15]. Thus, we aimed to investigate the effect of the miR-185 on the carcinogenesis and progression of gastric cancer and their prognostic significance. In the present study, we found miR-185 expression is downregulated in 36 stomach tumor specimens, as well as gastric cell lines, by means of quantitative RT-PCR analysis. miR-185 expression was detected by in situ hybridization on tissue microarrays (TMAs), and the associations between miR-185 levels and clinicopathologic factors and prognosis were analyzed: the results indicated that decreased miR-185 correlates with advanced clinical stage, lymph node metastases, and poor clinical outcomes. In addition, we observed that miR-185 suppresses gastric cancer growth and metastasis in vitro and vivo.
Materials and methods Cell culture The gastric epithelial cell line GES-1 was purchased from the Beijing Institute for Cancer Research (Beijing, China). The gastric cancer cell lines MGC-803, BGC-823, MKN-28, SGC-7901, HGC-27, AGS, and MKN-45 were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). These cells were maintained at 37 °C in an atmosphere of 5 % CO2 in RPMI-1640 medium supplemented with 10 % fetal bovine serum, penicillin, and streptomycin (Gibco BRL, NY, USA). All transfections were performed using Lipofectamine 2,000 (Invitrogen, Carlsbad, USA). Clinical samples All tissue samples used in the present study were collected from the Hunan Provincial Tumour Hospital (Changsha, Hunan, China). Written informed consent was obtained from all study participants. This study was approved by the Ethics Committee of the University of South China Health Authority. The collection and use of tissues followed the procedures that are in accordance with the ethical standards as formulated in the Helsinki Declaration. Tissue samples from 36 gastric cancer patients (20 male and 16 female; median age 57.5 years; range 40–79 years) were used for quantitative
123
Mol Cell Biochem (2014) 386:223–231
real-time PCR (qRT-PCR) analysis. Resected cancerous tissues (tumor) and paired matched normal gastric tissues (normal) were immediately cut and stored in RNAlater (Ambion). The TMAs consisted of 126 cases of gastric carcinoma and 41 cases of normal stomach mucosa used for in situ hybridization analysis. The median age of the gastric cancer patients at diagnosis was 57 years (range 31–82). All data, including age, sex, histological grade, tumor size, invasion depth (T stage), and lymph node metastasis were obtained from clinical and pathological records.
Quantitative RT-PCR analysis (qRT-PCR) Total RNA was extracted from cells using TRIzol reagent (Invitrogen, Carlsbad, USA). Reverse transcription and qRT-PCR reactions were performed by means of a qSYBR-green PCR kit (Qiagen, Germantown, USA). Fold change was determined as 2-ddCt. The Ct is the fractional cycle number at which the fluorescence of each sample passes the fixed threshold. The dCt was calculated by subtracting the Ct of snRNA U6 from the Ct of the miRNA of interest. The ddCt was calculated by subtracting the dCt of the reference sample (paired nontumorous tissue for surgical samples and GES-1 cell for six gastric cancer cell lines) from the dCt of each sample. The sequences of the specific primers for miR-185 and U6 snRNA were 50 TGGAGAGAAAGGCAGTTCCTGA-30 and 50 -ATTGGAACGATACAGAGAAGATT-30 , respectively.
In situ hybridization Tissue microarray slides were deparaffinized and rehydrated. The miR-185 miRCURYTM LNA custom detection probe (Exiqon, Vedbaek, Denmark) was used for in situ hybridization (ISH). The sequence 50 -30 (enhanced with LNA) was tcaggaactgcctttctctcca with digoxigenin at the 50 and 30 ends. Hybridization, washing, and scanning were carried out according to the manuals and protocols provided by the Exiqon life science department. The intensity of staining was scored from 0 to 4, and the extent of staining was scored from 0 to 100 %. Relative expression was obtained by multiplying the two scores. The slides were analyzed by two independent pathologists. Cell proliferation assay Cells were plated on 12-well plates at the desired cell concentrations. Cell counts were estimated by trypsinizing the cells and performing analysis using a Coulter Counter (Beckman Coulter, Fullerton, USA) at the indicated time points in triplicate.
Mol Cell Biochem (2014) 386:223–231
Cell migration and invasion assays Cell migration was examined using wound-healing assays. An artificial ‘‘wound’’ was created on a confluent cell monolayer, scratching assay was treated by 10 lg/mL mitomycin C for 2 h, and photographs were taken using an inverted microscope (Olympus, Tokyo, Japan) at 24 h. For cell invasion assay, cells were seeded onto the basement membrane matrix present in the insert of a 24-well culture plate (EC matrix, Chemicon, Temecula, CA, USA), and fetal bovine serum was added to the lower chamber as a chemoattractant. After a further 48 h, the noninvading cells and EC matrix were gently removed with a cotton swab. Invasive cells located on the lower side of the chamber were stained with Crystal Violet, counted, and imaged. Apoptosis analysis The apoptotic cells were evaluated by Annexin V-FITC and propidium iodine staining (BD, USA) and analyzed with a FACS Calibur instrument (BD, USA). The collected data were analyzed using FlowJosoftware.
225
miR-185 or scramble viruses were injected into the tail vein of nude mice (eight in each group). After 45 days, necropsies were performed. Numbers of micrometastases in lung per HE-stained section in individual mice were analyzed by morphology observation. All animal procedures were performed in accordance with institutional guidelines. Statistical analysis Comparisons between groups were analyzed by the t test and x2 test. Overall survival curves and relapse-free curves were plotted using the Kaplan–Meier method, with the logrank test applied for comparison. Survival was measured from the day of surgery. Variables with a value of P \ 0.05 according to the univariate analysis were used in subsequent multivariate analysis based on the Cox proportional hazards model. All differences were statistically significant at the level of P B 0.05. Statistical analyses were performed using SPSS16.0 software.
Results Detection of mitochondrial membrane potential (MMP, Dwm) using JC-1 To measure the mitochondrial membrane potential (Dwm), 5,50 ,6,60 -tetrachloro-1,10 ,3,30 -tetraethylbenzimidazolylcarbocyanine iodide (JC-1), which is a sensitive fluorescent probe kit for Dwm, was used (Biyuntian Biochemistry Limited Company, China). Treated or untreated cells were cultured in 24-well plates for 24 h, washed with PBS, and incubated with a JC-1 working solution for 20 min at 37 °C. The cells were rinsed twice with PBS, stained with 1 mL 10 % RPMI-1640 medium containing 5 lmol/L JC-1, resuspended in 1 mL ice-cooled PBS, washed with PBS, and resuspended in 500 lL PBS. The stained cells were analyzed using a fluorescence microscope to determine a change in the florescence from red to green [16]. Mouse xenograft model The gastric cancer model in nude mice was constructed as described [17]. 2 9 106 SGC-7901 cells infected with miR-185 or scramble viruses were propagated and inoculated subcutaneously into the dorsal flanks of nude mice (5 in each group). Tumor size was measured every 4 days. After 28 days, the mice were killed, necropsies were performed, and the tumors were weighed. Tumor volumes were determined according to the following formula: A 9 B2/2, where A is the largest diameter, and B is the diameter perpendicular to A. To assay miR-185’s effect on tumor metastasis, 1 9 106 SGC-7901 cells infected with
miR-185 is down-regulated in gastric cancer First, a series of human gastric cancer cell lines was analyzed to assess the expression profile of miR-185 in gastric cancer using qRT-PCR (Fig. 1a). Compared with the nonmalignant gastric cell line GES-1, seven of the gastric cancer cell lines showed reduced miR-185 expression, especially the SGC-7901 (\18.8 % of means of GES-1 cells). We also assessed the expression of miR-185 in a series of 36 pairs of gastric cancer tissues and their matched adjacent tissues. Among the 36 patients with gastric cancer, approximately 86.1 % (P \ 0.0001, 31 of 36 patients) of tumors revealed a large reduction of miR-185 levels (2.1-fold) relative to adjacent nontumor tissues (Fig. 1b). To further verify the results concerning the biological role of miR-185 in gastric cancer, we employed in situ hybridization to evaluate miR-185 levels in 126 gastric tumors and 41 normal stomach tissues in a TMA. The results revealed that miR-185 was strongly downregulated in stomach tumors compared with normal tissues (Fig. 1c). These data indicate that miR-185 was downregulated in gastric cancer. Decreased miR-185 correlates with advanced clinical stage, lymph node metastases, and poor clinical outcomes We next investigated the association of miR-185 expression with the clinical outcome in a cohort of 126 primary gastric
123
226
Mol Cell Biochem (2014) 386:223–231
Fig. 1 miR-185 expression level was frequently downregulated in human gastric cancer. a Relative expressions of miR-185 in seven cell lines derived from gastric cancer and one nonmalignant gastric cell line (GES-1) was determined by qRT-PCR. b miR-185 expression was detected in 36 gastric cancer patients by qRT-PCR. c miR-185 expression was analyzed in normal stomach mucosa (normal) and
gastric cancer (tumor) samples on the tissue microarray by in situ hybridization. Expression scores are shown as box plots. The vertical bars represent the range of the data. d and e Low levels of miR-185 correlate with shorter survival. OS and RFS curves for all patients with high or low miR-185 expression
cancers with annotated clinical history. Of note, the miR-185 level inversely correlated with clinical stage and lymph node metastasis (P = 0.001 and P = 0.003, respectively) (Table 1). However, neither of the miR-185 levels in gastric cancer patients correlated with age, gender, tumor size, cell differentiation, or invasion depth. Our results suggest that miR-185 could play critical roles in carcinogenesis and progression of gastric cancer. To further analyze the significance of miR-185 in terms of clinical prognosis, Kaplan– Meier survival analysis was performed using patient’s overall survival and relapse-free survival. The results demonstrated that patients with low miR-185 expression had shorter mean months of OS and RFS than did patients with high miR-185 expression (P \ 0.0001 for OS, P \ 0.0001 for RFS) (Fig. 1d). Then, we used Cox proportional-hazards regression to evaluate the association between miR-185 expression and prognosis further. In univariate analysis, the levels of miR-185 were significantly associated with prognosis (Tables 2, 3). The final multivariate model revealed that reduced miR-185 levels in tumors were independent
predictors of shorter survival (Tables 2, 3). TNM stage was an independent significant prognostic factor as well (Tables 2, 3) (P \ 0.05). A similar trend was found for lymph-node metastasis (P \ 0.1) (Tables 2, 3).
123
miR-185 inhibited gastric cancer cell proliferation, migration, invasion, and induced cell apoptosis in vitro Because miR-185 levels were downregulated in gastric cancer and were associated with the clinical stage, lymph node metastasis, and clinical outcome, we evaluated the effect of miR-185 overexpression on gastric cancer cell phenotype. SGC-7901 with relatively low basal expression of miR-185 (Fig. 1a) was infected with either miR-185 or control lentivirus and selected with 5 mg/L puromycin for 2 weeks. qRT-PCR and western blot [11, 14] analysis showed that the transfection was successful (Fig. 2a). The proliferation assay showed that ectopic expression of miR185 in SGC-7901 markedly attenuated cell proliferation compared with control cells (Fig. 2b). Moreover,
Mol Cell Biochem (2014) 386:223–231
227
Table 1 Analysis of the correlation between expression of miR-185 in primary gastric cancer and its clinicopathological parameters Viable
Cases
miR-185
Dwm) in SGC-7901 cells by the JC-1 method. As shown in Fig. 3b, we found that the MMP was low and JC-1 predominantly appeared as green fluorescence in control cells. These data demonstrate that the miR-185 functions as a tumor suppressor in gastric cancer.
Low
High
P value
0.400
miR-185 suppresses gastric cancer growth and metastasis in vivo
0.453
Next, we tested to determine whether miR-185 could play a role in tumorigenesis by using nude mice xenograft models. At 28 days, the mean volume and weight of the tumors generated overexpression of miR-185 in SGC-7901 cells, which significantly suppressed tumor growth in nude mice (Fig. 4a, b). Then, SGC-7901 cells infected with miR-185 or mock lentivirus were injected into the tail vein of nude mice to examine lung metastasis. As shown Fig. 4c, a significantly lower number of macroscopic lung metastases could be observed for miR-185 overexpressing cells than control cells (Fig. 4c). These results indicate that miR-185 may repress gastric cancer growth and metastasis.
Age (years) \60
73
44
29
C60 Gender
53
34
19
Male
70
46
27
Female
56
32
21
Well and moderate
32
24
8
Poor and other
94
54
40
T1-T2
71
40
31
T3-T4
55
38
17
Histological gradea 0.058
T stage 0.100
TNM stage I–II
51
23
28
III–IV
75
55
20
Present
88
62
26
Absent
38
16
22
0.001
Lymph node metastasis 0.003
a
Discussion
expression of miR-185 significantly inhibited the capacity of cells for migration and invasion (Fig. 2c, d). We then performed cell apoptosis analysis that revealed that miR185 overexpression in SGC-7901 induced the cell apoptosis (Fig. 3a). Meanwhile, we detected the effect of the miR-185 on the mitochondrial membrane potential (MMP,
In this study, we used qRT-PCR and ISH to show that miR185 was frequently downregulated in human gastric cancer and that the downregulated miR-185 was significantly associated with advanced clinical stage and lymph nodemetastasis. Further studies showed that overexpression of miR-185 suppressed the gastric cancer cell migration and invasion in vitro and metastasis in vivo. Kaplan–Meier survival analyses revealed that patients whose primary
Well-differentiated adenocarcinoma (well), moderately differentiated adenocarcinoma (moderate), poorly differentiated adenocarcinoma (poor), other histological type (other)
Table 2 Univariate and multivariable Cox regression analysis of OS (Cox proportional hazards regression model) Viable
TNM stage (I–II vs. III–IV)
Univariate analysis
Multivariate analysis
RR
95 % CI
P value
RR
95 % CI
P value
3.71
2.29–6.03
0.000
3.26
1.99–5.35
0.000
Lymph node metastasis (absent vs. present)
3.08
1.78–5.34
0.000
2.04
1.14–3.63
0.016
miR-185 (low vs. high)
0.39
0.25–0.63
0.000
0.49
0.30–0.79
0.004
RR relative risk, CI confidence interval Table 3 Univariate and multivariable Cox regression analysis of RFS (Cox proportional hazards regression model) Viable
Univariate analysis
Multivariate analysis
RR
95 % CI
P value
RR
95 % CI
P value
TNM stage (I–II vs. III–IV)
2.93
1.91–4.49
0.000
2.15
1.37–3.38
0.001
Lymph node metastasis (absent vs. present)
3.42
2.06–5.68
0.000
2.55
1.49–4.35
0.001
miR-185 (low vs. high)
0.49
0.32–0.75
0.001
0.61
0.39–0.93
0.023
Univariate analysis
123
228
Mol Cell Biochem (2014) 386:223–231
Fig. 2 miR-185 inhibited cell proliferation, migration, and invasion in gastric cancer. a SGC-7901 cells transfected with miR-185 or scramble mimics (upper panel). The effect of miR-185 mimics on the protein expression of DNMT1 by western blot. b-actin was used as a loading control (down panel). b The growth of SGC7901 cells infected with miR185 lentivirus or scramble lentivirus was assayed. c The wound-healing assay of SGC7901 cells infected with miR185 lentivirus or scramble lentivirus. d The invasion assay of SGC-7901 cells infected with miR-185 lentivirus or scramble lentivirus. The invasion assay was measured by way of Transwell assays with Matrigel
tumors displayed low expression of miR-185 had a shorter OS and RFS in gastric cancer. In addition, multivariate analysis showed that reduced miR-185 in tumors was strong and independent predictors of shorter OS and RFS. Based on array data, it was previously reported that a combination of several miRNAs may be useful as prognostic markers in gastric cancer [18, 19]. Moreover, a single-miRNA, such as miR-218 can be a prognostic factor [20]. However, these miRNAs have been investigated in just a few gastric cancer patients. The data from the current study suggests that the miR-185 is important for gastric cancer initiation and progression and holds promise as a novel metastasis suppressor in gastric cancer and that downregulated miR-185
123
contributes to lymph node-metastasis and tumor progression in gastric cancer patients. It is also a potential prognostic biomarker to predict survival and relapse in gastric. Downregulation of miR-185 is a frequent event in various cancers [8–10, 12, 15], suggesting that miR-185 may play an important role in tumorigenesis and tumor progression. In this study, we also found that miR-185 was frequently downregulated in gastric cancer, and 86.1 % (31 of 36) of the gastric cancer had 2.1-fold reduced expression of miR-185 compared with their corresponding nontumorous tissues. Intriguingly, we found that lower expression of miR-185 tended to have more advanced TNM stage (stage I/II vs. stage III/IV, P = 0.001), suggesting that low
Mol Cell Biochem (2014) 386:223–231
229
Fig. 3 miR-185 induced the cell apoptosis in gastric cancer. a SGC7901 cells were infected with miR-185 lentivirus or scramble lentivirus. The apoptotic cells were evaluated by Annexin V-FITC and propidium iodine staining and analyzed with FACS. A representative result is shown, and summarized data are presented. Data are
presented as mean ± s.e.m from at least three separate experiments. b miR-185 regulates cell mitochondrial membrane potential (MMP, Dwm); overexpression of miR-185 resulted in reduced MMP and increased green fluorescence in SGC-7901 cells
Fig. 4 miR-185 inhibited gastric cancer cell growth and metastasis in vivo. a Tumor growth in mouse xenograft models. SGC-7901 cells infected with miR-185 lentivirus or scramble were injected subcutaneously into nude mice. Tumor volume was measured every 4 days. After 28 days, the mice were killed, necropsies were performed, and tumors were weighed. All data are shown as mean ± s.e.m. b Tumor
metastasis in mouse xenograft models. SGC-7901 cells with overexpression of miR-185 or scramble were injected into the tail vein of nude mice. After 60 days, the mice were killed. Micrometastases in lung per HE-stained section in individual mice were calculated. Each group had eight mice. Original magnification, 9100. All data are shown as mean ± s.e.m
123
230
Mol Cell Biochem (2014) 386:223–231
expression of miR-185 is associated with gastric cancer progression. Lymph node-metastasis is an initial step of gastric cancer metastasis, and is a crucial factor in the determination of the clinical staging, prognosis, and survival of gastric cancer patients [21, 22]. Recent studies document that miRNAs play important roles in gastric cancer initiation and progression [23, 24]. It is intriguing that miRNAs are associated with lymph node-metastasis of gastric cancer, such as miR-148a [22], miR-370 [25], miR146a [26], miR-107 [27], and miR-429 [28], which may provide new insights for designing better therapeutic strategies to treat gastric cancer patients with lymph nodemetastasis. In accordance with our results, the overexpression of miR-185 in gastric cancer cells impaired the migration, invasion and metastasis of gastric cancer, further supporting the correlation between miR-185 levels and clinicopathologic factors, such as lymph node metastasis and TNM stage. The data from the current study suggest that miR-185 acts as a novel metastasis suppressor in gastric cancer, and that downregulated miR-185 contributes to lymph node-metastasis and tumor progression in gastric cancer patients. Various studies have shown that DNMT1 [11, 14], CDC42, and RhoA [9, 15], SIX1[12], CDK6 [15, 29], androgen receptor [13], and c-Myc [30] are potential downstream target genes of miR-185. It is possible that the discrepancies in the functions of miR-185 in different types of cancer may reflect differences in target genes. In addition, when overexpressed, miR-185 directly targeted DNMT1 gene, which resulted in marked reduction of the expression of DNA methyltransferases DNMT1 at the protein level. This effect, in turn, led to a decrease in global DNA methylation and reexpression of p16, RASS1A1, and E-cadherin via promoter DNA hypomethylation [31]. However, the molecular mechanisms of miR-185 and the target genes in gastric cancer should be further investigated. In summary, we observed downregulation of miR-185 in gastric cancer cells and tissues and demonstrated that miR185 may act as an independent predictor of OS and RFS. We further found that miR-185 as an important antimetastatic miRNA is associated with lymph node-metastasis in gastric cancer. Enforced expression of miR-185 suppresses gastric cancer cell invasion and metastasis. Taken together, our findings demonstrate that the miR-185 is important for gastric initiation and progression and holds promise as a prognostic biomarker to predict survival and relapse in gastric cancer and potential therapeutic to suppress gastric cancer metastasis. Acknowledgments This study was supported by the Nature Scientific Foundation of China (31100935). Conflict of interest
123
No potential conflicts of interest are disclosed.
References 1. Hartgrink HH, Jansen EP, van Grieken NC, van de Velde CJ (2009) Gastric cancer. Lancet 374:477–490. doi:10.1016/S01406736(09)60617-6 2. Kamangar F, Dores GM, Anderson WF (2006) Patterns of cancer incidence, mortality, and prevalence across five continents: defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol 24:2137–2150. doi:10. 1200/JCO.2005.05.2308 3. Schickel R, Boyerinas B, Park SM, Peter ME (2008) MicroRNAs: key players in the immune system, differentiation, tumorigenesis and cell death. Oncogene 27:5959–5974. doi:10.1038/ onc.2008.274 4. Ventura A, Jacks T (2009) MicroRNAs and cancer: short RNAs go a long way. Cell 136:586–591. doi:10.1016/j.cell.2009.02.005 5. Slack FJ, Weidhaas JB (2008) MicroRNA in cancer prognosis. N Engl J Med 359:2720–2722. doi:10.1056/NEJMe0808667 6. Hurst DR, Edmonds MD, Welch DR (2009) Metastamir: the field of metastasis-regulatory microRNA is spreading. Cancer Res 69:7495–7498. doi:10.1158/0008-5472.CAN-09-2111 7. Bartels CL, Tsongalis GJ (2009) MicroRNAs: novel biomarkers for human cancer. Clin Chem 55:623–631. doi:10.1373/clinchem. 2008.112805 8. Akcakaya P, Ekelund S, Kolosenko I, Caramuta S, Ozata DM, Xie H, Lindforss U, Olivecrona H, Lui WO (2011) miR-185 and miR-133b deregulation is associated with overall survival and metastasis in colorectal cancer. Int J Oncol 39:311–318. doi:10. 3892/ijo.2011.1043 9. Liu M, Lang N, Chen X, Tang Q, Liu S, Huang J, Zheng Y, Bi F (2011) miR-185 targets RhoA and Cdc42 expression and inhibits the proliferation potential of human colorectal cells. Cancer Lett 301:151–160. doi:10.1016/j.canlet.2010.11.009 10. Zhi Q, Zhu J, Guo X, He S, Xue X, Zhou J, Hu B, Li H, Chen S, Zhao H, Kuang Y (2013) Metastasis-related miR-185 is a potential prognostic biomarker for hepatocellular carcinoma in early stage. Biomed Pharmacother 67:393–398. doi:10.1016/j. biopha.2013.03.022 11. Xiang Y, Ma N, Wang D, Zhang Y, Zhou J, Wu G, Zhao R, Huang H, Wang X, Qiao Y, Li F, Han D, Wang L, Zhang G, Gao X (2013) MiR-152 and miR-185 co-contribute to ovarian cancer cells cisplatin sensitivity by targeting DNMT1 directly: a novel epigenetic therapy independent of decitabine. Oncogene. doi:10. 1038/onc.2012.575 12. Imam JS, Buddavarapu K, Lee-Chang JS, Ganapathy S, Camosy C, Chen Y, Rao MK (2010) MicroRNA-185 suppresses tumor growth and progression by targeting the Six1 oncogene in human cancers. Oncogene 29:4971–4979. doi:10.1038/onc.2010.233 13. Qu F, Cui X, Hong Y, Wang J, Li Y, Chen L, Liu Y, Gao Y, Xu D, Wang Q (2013) MicroRNA-185 suppresses proliferation, invasion, migration, and tumorigenicity of human prostate cancer cells through targeting androgen receptor. Mol Cell Biochem 377:121–130. doi:10.1007/s11010-013-1576-z 14. Zhang Z, Tang H, Wang Z, Zhang B, Liu W, Lu H, Xiao L, Liu X, Wang R, Li X, Wu M, Li G (2011) MiR-185 targets the DNA methyltransferases 1 and regulates global DNA methylation in human glioma. Mol Cancer 10:124. doi:10.1186/1476-4598-10124 15. Tang H, Wang Z, Liu X, Liu Q, Xu G, Li G, Wu M (2012) LRRC4 inhibits glioma cell growth and invasion through a miR-185dependent pathway. Curr Cancer Drug Targets 12:1032–1042 16. Tang H, Bian Y, Tu C, Wang Z, Yu Z, Liu Q, Xu G, Wu M, Li G (2013) The miR-183/96/182 cluster regulates oxidative apoptosis and sensitizes cells to chemotherapy in gliomas. Curr Cancer Drug Targets 13:221–231
Mol Cell Biochem (2014) 386:223–231 17. Deng M, Ye Q, Qin Z, Zheng Y, He W, Tang H, Zhou Y, Xiong W, Zhou M, Li X, Yan Q, Ma J, Li G (2013) miR-214 promotes tumorigenesis by targeting lactotransferrin in nasopharyngeal carcinoma. Tumour Biol 34:1793–1800. doi:10.1007/s13277013-0718-y 18. Li X, Zhang Y, Zhang Y, Ding J, Wu K, Fan D (2010) Survival prediction of gastric cancer by a seven-microRNA signature. Gut 59:579–585. doi:10.1136/gut.2008.175497 19. Ueda T, Volinia S, Okumura H, Shimizu M, Taccioli C, Rossi S, Alder H, Liu CG, Oue N, Yasui W, Yoshida K, Sasaki H, Nomura S, Seto Y, Kaminishi M, Calin GA, Croce CM (2010) Relation between microRNA expression and progression and prognosis of gastric cancer: a microRNA expression analysis. Lancet Oncol 11:136–146. doi:10.1016/S1470-2045(09)70343-2 20. Tie J, Pan Y, Zhao L, Wu K, Liu J, Sun S, Guo X, Wang B, Gang Y, Zhang Y, Li Q, Qiao T, Zhao Q, Nie Y, Fan D (2010) MiR218 inhibits invasion and metastasis of gastric cancer by targeting the Robo1 receptor. PLoS Genet 6:e1000879. doi:10.1371/ journal.pgen.1000879 21. Coburn NG (2009) Lymph nodes and gastric cancer. J Surg Oncol 99:199–206. doi:10.1002/jso.21224 22. Zheng B, Liang L, Wang C, Huang S, Cao X, Zha R, Liu L, Jia D, Tian Q, Wu J, Ye Y, Wang Q, Long Z, Zhou Y, Du C, He X, Shi Y (2011) MicroRNA-148a suppresses tumor cell invasion and metastasis by downregulating ROCK1 in gastric cancer. Clin Cancer Res 17:7574–7583. doi:10.1158/1078-0432.CCR-111714 23. Oh HK, Tan AL, Das K, Ooi CH, Deng NT, Tan IB, Beillard E, Lee J, Ramnarayanan K, Rha SY, Palanisamy N, Voorhoeve PM, Tan P (2011) Genomic loss of miR-486 regulates tumor progression and the OLFM4 antiapoptotic factor in gastric cancer. Clin Cancer Res 17:2657–2667. doi:10.1158/1078-0432.CCR-103152 24. Nishida N, Mimori K, Fabbri M, Yokobori T, Sudo T, Tanaka F, Shibata K, Ishii H, Doki Y, Mori M (2011) MicroRNA-125a-5p
231
25.
26.
27.
28.
29.
30.
31.
is an independent prognostic factor in gastric cancer and inhibits the proliferation of human gastric cancer cells in combination with trastuzumab. Clin Cancer Res 17:2725–2733. doi:10.1158/ 1078-0432.CCR-10-2132 Lo SS, Hung PS, Chen JH, Tu HF, Fang WL, Chen CY, Chen WT, Gong NR, Wu CW (2012) Overexpression of miR-370 and downregulation of its novel target TGFbeta-RII contribute to the progression of gastric carcinoma. Oncogene 31:226–237. doi:10. 1038/onc.2011.226 Kogo R, Mimori K, Tanaka F, Komune S, Mori M (2011) Clinical significance of miR-146a in gastric cancer cases. Clin Cancer Res 17:4277–4284. doi:10.1158/1078-0432.CCR-102866 Li X, Zhang Y, Shi Y, Dong G, Liang J, Han Y, Wang X, Zhao Q, Ding J, Wu K, Fan D (2011) MicroRNA-107, an oncogene microRNA that regulates tumour invasion and metastasis by targeting DICER1 in gastric cancer. J Cell Mol Med 15:1887–1895. doi:10.1111/j.1582-4934.2010.01194.x Sun T, Wang C, Xing J, Wu D (2011) miR-429 modulates the expression of c-myc in human gastric carcinoma cells. Eur J Cancer 47:2552–2559. doi:10.1016/j.ejca.2011.05.021 Takahashi Y, Forrest AR, Maeno E, Hashimoto T, Daub CO, Yasuda J (2009) MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS ONE 4:e6677. doi:10.1371/journal.pone.0006677 Liao JM, Lu H (2011) Autoregulatory suppression of c-Myc by miR-185-3p. J Biol Chem 286:33901–33909. doi:10.1074/jbc. M111.262030 Tang H, Deng M, Tang Y, Xie X, Guo J, Kong Y, Ye F, Su Q, Xie X (2013) miR-200b and miR-200c as prognostic factors and mediators of gastric cancer cell progression. Clin Cancer Res. doi:10.1158/1078-0432.CCR-13-1326
123
