Biochemical and Biophysical Research Communications xxx (2017) 1e6
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer Suning Zhang*, Zongang Liu, Lin Wu, Yudong Wang Department of Thoracic Surgical, Shengjing Hospital Affiliated with China Medical University, Shenyang 110000, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 August 2017 Accepted 19 August 2017 Available online xxx
Yes-associated protein (YAP) contributes to the development of multiple tumors, but the posttranscription modulation of YAP remains unexplored. Here, we present a new regulatory microRNA of YAP, miR-361, which directly targets YAP to inhibit cell proliferation in lung cancer. We used bioinformatics to predict that miR-361 could target 30 -untranslated region (30 UTR) of YAP mRNA. Luciferase reporter gene assays demonstrated that miR-361 could decrease the luciferase activities of 30 UTR vector of YAP. Furthermore, YAP expression was obviously abated by miR-361 using RT-PCR and immunoblotting in lung cancer A549 cells. In terms of function, MTT and colony formation analysis showed that ectopic miR-361 expression significantly suppressed cell proliferation in lung cancer. Notably, overexpressed YAP accelerated miR-361-bated proliferation of lung cancer cells. MiR-361 inhibitor promoted cell proliferation in lung cancer, but YAP RNA interference reversed miR-361 inhibitor-driven cell proliferation. Interestingly, miR-361 was capable of affecting the cell cycle in lung cancer progression. Finally, the negative correlation of miR-361 with YAP was found in clinical human lung cancer tissues. In conclusion, miR-361 targets 30 UTR of YAP mRNA to depress the proliferation of lung cancer cells. © 2017 Published by Elsevier Inc.
Keywords: miR-361 YAP Proliferation Lung cancer
1. Introduction Hippo-YAP pathway is firstly identified for controlling organ size of Drosophila [1,2]. Deregulation of Hippo-YAP signaling induces tissue overgrowth or induces cancer [3]. The Yes-associated protein (YAP), is a bona fide oncoprotein, and its abundance and activity are frequently increased in many types of cancers [4e15]. YAP is a transcriptional coactivator that partners with the TEAD family of transcription factors to promote the expression of pro-proliferative and antiapoptotic genes [16e24]. Extensive genetic studies that focused primarily on organ size control in Drosophila and mice identified that the Hippo pathway is the canonical regulator of YAP activity [18,25e28]. Multiple factors are able to affect the Hippo pathway, resulting in the alteration of YAP activity [29e33]. Additionally, accumulating evidence indicates that YAP activity can be regulated by noncanonical, Hippo independent mechanisms
Abbreviations: YAP, Yes-associated protein; miRNA, microRNA; STAT6, signal transducer and activator of transcription-6; real time-PCR, real-time polymerase chain reaction; EdU, 5-ethynyl-20 -deoxyuridine. * Corresponding author. Department of Thoracic Surgical, Shengjing Hospital Affiliated with China Medical University, 36 Sanhao Street, Shenyang 110000, China. E-mail address: [email protected] (S. Zhang).
[34e40]. The post-transcription regulation of YAP remains to be further investigated. MicroRNAs (miRNAs) are capable of inhibiting transcription or translation of target genes [41e43]. Previous studies revealed that miRNAs could promote or suppress the development of cancers [44e47]. The inverse relationship between miR-361 and VEGFA are revealed in human cutaneous squamous cell carcinoma [48]. MiR-361 modulates epithelial-to-mesenchymal transition to participate in the development in cervical cancer [49]. MiR-361 is able to target transcription factor STAT6 to inhibit the development of prostate cancer [50]. MiR-361 could restrain the growth or metastasis in colorectal, liver or gastric cancer [51,52]. TCGA miRNA-seq data show that miR-361 and let-7i are reference miRNAs in some tumors [53]. Decreased miR-361 in non-small cell lung cancer is connected with more aggressive progression and poor prognosis [54]. However, whether miR-361 is able to target YAP in lung cancer remains poorly understood. We are interested in whether miR-361 has effect on YAP0 posttranscription regulation in lung cancer. We reveal that miR-361 restrains lung cancer proliferation through directly targeting YAP 30 UTR. We present a novel perspective for understanding how lung cancer development by YAP is modulated.
http://dx.doi.org/10.1016/j.bbrc.2017.08.072 0006-291X/© 2017 Published by Elsevier Inc.
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
2
S. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
2. Materials and methods
2.7. Proliferation assays
2.1. Cell lines
EdU and colony formation assays were used to evaluate cell proliferation ability. A549 cells seeding on 24-well plates were transfected. Post-transfection 48 h, EdU Cell Proliferation Assay Kit (Ribobio, China) was applied to test cell proliferation. For colony formation analysis, post-Forty-eight hours after transfection with miR-361, miR-361 þ YAP, anti-miR-361, anti-miR361þsiYAP-1 or negative control, seeded cells on 6-well plates (1000 cells/well) were cultured for two weeks until visible colonies. The colonies were fixed with 4% paraformaldehyde and stained with methylene blue. Colonies were counted by three observers separately.
10% fetal bovine serum was added into Dulbecco's modified Eagle's medium (Gibco, USA) to culture human lung cancer cell line A549. Cells were contained in a 5% CO2 incubator at 37 C. 2.2. RNA isolation and real-time polymerase chain reaction (PCR) Using TRIzol Reagent (Invitrogen, USA) total RNA of tissues or cells was extracted and SuperScript™ IV Reverse Transcriptase (ThermoFisher Scientific, USA) was utilized to do reverse transcription. To detect miR-361 expression, total RNA was polyadenylated by poly (A) polymerase (Ambion, USA). The qRT-PCR was applied by TransStart Top Green qPCR SuperMix (TransGen Biotech, China). PCR reaction was evaluated using melting curve analysis. Relative transcription alteration was evaluated as 2DDCt. GAPDH was used to normalize YAP. The level of miR-361 was normalized to U6 expression. The primers were listed: YAP forward, 50 -TATCAATCCCAGCACAG-30 , reverse, 50 -GGAATGGCTTCAAGGTAG30 ; GAPDH forward, 50 -AACGGATTTGGTCGTATTG-30 , reverse, 50 GGAAGATGGTGATGGGATT-30 ; miR-361 forward, 50 - ATAAAGTGCTGACAGTGCAGATAGTG-30 , reverse, 50 - TCAAGTACCCACAGTGCGGT30 ; U6 forward, 50 - CTCGCTTCGGCAGCACA-30 , reverse, 50 AACGCTTCACG AATTTGCGT-30 . 2.3. Plasmids construction Full-length YAP was amplified and cloned into pcDNA3.1 vector (primers: forward, 50 -CGGAATTCATGGATCCCGGGCAGCAGCCGC-30 , reverse, 50 - GCGTCGACCTATAACCATGTAAGAAAGCTTTCT-3). Wild type (wt) or mutated (mut) miR-361 targeting site in YAP 30 UTR was cloned into pGL3-control vector (primers: wt forward, 50 GCTCTAGACAAAAATGTTATATCTGATA-30 , reverse, 50 -GGGGGCCGGCC GCTACAACTATTAACAGATT-30 ; mut forward, 50 -GCTCTAGA CAAAAATGTTTGAGGACTAT-30 , reverse, 50 -GGGGGCCGGCC GCTACAACTATTAACAGATT-30 ).
2.8. Flow cytometry analysis MiR-361 (or anti-miR-361 or control miRNA) treated- A549 cells were harvested, fixed and resuspended in propidium iodine (PI) solution. In the dark the cells were incubated at 37 C for half an hour and then were analyzed by a FACScan flow cytometer (BectonDickinson, USA). Flow cytometry analysis was repeated three times. 2.9. Patient samples Shengjing Hospital Affiliated with China Medical University (Shenyang, China) provided thirty lung cancer tissues harvested from lung cancer patients by surgical (Supplementary Table S1). Written consents were banked with tissues and study protocol has been approved by Research Ethics Board. 2.10. Statistical analysis Every experiment was performed in triplicate. Data was recorded as mean ± SD. Student's t-test was utilized to compare different groups' differences. P value less than 0.05 were determined significant. The relationship between miR-361 and YAP expression in lung cancer samples was evaluated by Pearson's correlation coefficient.
2.4. siRNAs, miRNA and miRNA inhibitor transfection 3. Result Transient transfection of cells was performed using Lipofectamine 2000 (Invitrogen, USA). MiR-361, control, inhibitor and siYAP were synthesized by RiboBio (Guangzhou, China). siYAP-1, 50 GACAUCUUCUGGUCAGAGAdTdT-30 ; siYAP-2, 50 -GCUUUGAGUUCUGACAUCCdTdT-30 ; siCtrl, 50 -UUCUCCGAACGUGUCACGUdTdT-30 . 2.5. Luciferase reporter gene assays Seeded cells on 24-well plates were cultured overnight. Lipofectamine 2000 (Invitrogen, USA) was applied to transfect the indicated luciferase reporters and/or miRNA (inhibitor). Renilla luciferase activities were utilized to normalize Firefly luciferase activities. Luciferase activity was analyzed using Dual-Luciferase® Reporter Assay System (Promega, USA) and monitored by a luminometer (Promega, USA). 2.6. Western blot analysis RIPA buffer was used to isolate total protein. After running in 12% SDS-PAGE, all protein was transferred to PVDF membranes (Millipore, USA). 5% skim milk was applied to block the membranes for 2 h and then incubated in primary antibodies: anti-YAP antibody (Proteintech, USA) or anti-b-actin antibody (NeoMarkers, USA) followed by the corresponding secondary antibody.
3.1. MiR-361 directly targets YAP 30 UTR to restrains its expression YAP is frequently overexpressed in multiple tumors [4e15]. Highly expressed YAP participates in the development of many cancers. Here, we want to investigate the YAP0 posttranscription regulation in lung cancer. MiRNA.org was applied to predict the miRNAs which could target YAP. MiR-361 was a potential regulatory miRNA of YAP. To test the effect of miR-361 on YAP, we cloned the wild type (wt) or mutant (mut) 30 UTR of YAP into pGL3-control plasmid (pGL3-YAP-wt and pGL3-YAPmut) (Fig. 1A and B). The pGL3-YAP-wt or pGL3-YAP-mut plasmid combined with miR-361 or inhibitor (anti-miR-361) was transfected into A549 cells. We revealed that ectopic miR-361 expression significantly decreased the luciferase activities of pGL3-YAP-wt in lung cancer A549 cells. However, miR-361 lost the inhibitory effect on pGL3-YAP-mut containing the seed region mutation in cells (Fig. 1C). In addition, miR-361 inhibitor (antimiR-361) was capable of decreasing the miR-361 level to enhance the luciferase activities of the pGL3-YAP-wt. Nevertheless, pGL3-YAP-mut cannot be affected by anti-miR-361 introduction (Fig. 1D). Our data indicates that miR-361 inhibits YAP expression via directly targeting its mRNA 30 UTR in lung cancer cells.
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
S. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
3
Fig. 1. MiR-361 directly targets YAP 30 UTR to restrains its expression. (A) The binding site of miR-361 within YAP 30 UTR is shown. (B) The wild type and mutant 30 UTR of YAP (wt or mut) is cloned into pGL3-control plasmid. (C, D) The effect of miR-361 or inhibitor (anti-miR-361) on rpGL3-YAP-wt or pGL3-YAP-mut was analyzed by luciferase reporter gene analysis in A549 cells. **P < 0.01; NS, not significant; Student's t-test.
3.2. MiR-361 is capable of bating YAP expression in lung cancer cells Then, we tried to evaluate the effect of miR-361 on YAP expression lung cancer cells. We examined YAP expression in miR361 or anti-miR-361-treated cells using RT-PCR and Western blotting. As shown in Fig. 2A, miR-361 decreased the mRNA and protein levels of YAP. Furthermore, the expression of YAP was elevated in miR-361-depleted cells (Fig. 2B). Our data imply that miR-361 is
able to control YAP expression in lung cancer. Meanwhile, miR-361 and anti-miR-361 transfection was evaluated by real time-PCR (Fig. 2A and B). Collectively, our data support that miR-361 is capable of depressing YAP in lung cancer cells. 3.3. MiR-361 suppresses cell proliferation via inhibiting YAP in lung cancer To further evaluate the function of miR-361 targeting YAP in
Fig. 2. MiR-361 is capable of bating YAP expression in lung cancer cells. (A, B) YAP levels were analyzed in miR-361 (or anti-miR-361)-treated A549 cells by RT-PCR assay and Western blotting. The transfection of miR-361 or anti-miR-361 was confirmed by real time-PCR analysis. ***P < 0.001; **P < 0.01; Student's t-test.
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
4
S. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
lung cancer, we performed EdU incorporation assay. The data showed that the miR-361-overexpressed cells exhibited more highly proliferative ability, while ectopic YAP expression was able to recover the miR-361-downregulated cell proliferation. Moreover, anti-miR-361 transfection displayed the inhibitory effect on cell proliferation, but YAP siRNA could breach the acceleration of cell proliferation by anti-miR-361 (Fig. 3A). Taken a further step, colony formation assays showed that the colony numbers were less in miR-361-treated cells compared to that in control group. Anti-miR361 was able to enhance the colony formation in the cells. Notably, YAP siRNA could destroy the anti-miR-361-augmented colony formation in A549 cells (Fig. 3B). YAP RNA interference efficiency was confirmed by Western blotting (Fig. 3C). Interestingly, by using flow cytometry analysis we found that miR-361 was capable of increasing G1 phase cells and decreasing S phase cells. Furthermore, anti-miR-361 was able to decrease G1 phase cells and
increase S phase cells (Fig. 3D). Our data support that miR-361 can bate YAP to restrain cell proliferation in lung cancer. 3.4. Decreased miR-361 is related to overexpressed YAP in clinical lung cancer tissues To explore the relationship of miR-361 and YAP in lung cancer development, we examined the expression of miR-361 and YAP in thirty clinical lung cancer samples. Our data manifested that low level of miR-361 was related to high levels of YAP in clinical lung cancer samples (Pearson' correlation coefficient of 0.7319, p < 0.001) (Fig. 4A). In addition, YAP expression was confirmed in lung cancer samples by real time-PCR assay. Abundant YAP expression in lung cancer tissues was observed (Fig. 4B). Our data hint that deregulated miR-361 is related to upregulated YAP in clinical lung cancer tissues.
Fig. 3. MiR-361 bates cell proliferation via inhibiting YAP in lung cancer. (A, B) Proliferation abilities of miR-361, miR-361/YAP, anti-miR-361, or anti-miR-361/siYAP-1-treated A549 cells were detected by EdU incorporation assay and colony formation analysis. (C) Interference efficiency of siYAP-1 or siYAP-2 was evaluated by Western blotting in A549 cells. (D) The effect of miR-361 (or anti-miR-361) on cell cycle was tested by flow cytometry analysis in A549 cells. ***P < 0.001, **P < 0.01; Student's t-test.
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
S. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
5
Fig. 4. Decreased miR-361 is related to overexpressed YAP in clinical lung cancer tissues. (A) Relationship between miR-361 and YAP was investigated using real time-PCR in 30 clinical lung cancer samples (Pearson's correlation coefficient, R ¼ 7319). (B) In clinical samples YAP level was evaluated by using real time-PCR. ***P < 0.01; Student's t-test.
4. Discussion Lung cancer is master causes of cancer-related death and the most prevalent malignancy in the world. About 80% of are nonsmall cell lung cancer among lung cancer patients [55,56]. YAP as a crucial downstream factor in Hippo pathway take great part in multiple cancers including lung cancer. Multiple factors are able to affect Hippo pathway, resulting in the alteration of YAP activity by modulating the [29e33]. The post-transcription regulation of YAP remains to be further investigated. First, we predicted the miRNAs which might target YAP using microRNA.org. MiR-361 was a potential regulatory miRNA of YAP for its role in multiple cancers, such as hepatocellular carcinoma, cutaneous squamous cell carcinoma, prostate cancer, gastric cancer, cervical cancer, or colorectal cancer. However, whether miR-361 is able to target YAP to regulate its expression in lung cancer is unclear. To explore the regulation of miR-361 on YAP, we cloned the wild type (wt) and mutant (mut) 30 UTR of YAP into pGL3-control plasmid. We showed that ectopic miR-361 expression significantly decreased the luciferase activities of pGL3-YAP-wt in lung cancer A549 cells. In addition, miR-361 inhibitor was capable of decreasing the miR-361 level to enhance the luciferase activities of the pGL3-YAP-wt. It suggests that miR-361 can inhibits YAP expression through directly targeting its mRNA 30 UTR in lung cancer cells. Furthermore, our data manifested that the level of Yap could be decreased by miR-361 using real time-PCR and Western blotting further indicating that miR-361 is able to target YAP. In terms of function, miR-361 owned the ability by which miR-361 targets YAP to bate the cell proliferation in lung cancers in vitro. Previous study revealed that low circulating miR-361 could a blood marker for lung cancer [57]. MiR-361 targeting SH2B1 participates in NSCLC development [58]. Wilms' tumor 1 is one of miR-3610 target in progression inhibition of lung cancer [59]. MiR-361 is able to regulate FOXM1 to suppress lung cancer progression [60]. Our finding that miR-361 can target a key oncoprotein in Hippo pathway YAP provides new evidence for tumor suppressor role of miR-361 in cancers. For the first time we present a novel role of miR-361 in posttranscription regulation of YAP for YAP inhibition, resulting in decreased cell proliferation in lung cancer. We gains novel insight into the mechanism of lung cancer by YAP. Conflict of interests Suning Zhang and Zongang Liu designed the study and wrote
the manuscript. Lin Wu and Yudong Wang performed the study and wrote the manuscript. The authors declare no competing financial interests. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2017.08.072. References [1] C. Badouel, A. Garg, H. McNeill, Herding Hippos: regulating growth in flies and man, Curr. Opin. Cell Biol. 21 (2009) 837e843. [2] V.A. Codelia, K.D. Irvine, Hippo signaling goes long range, Cell 150 (2012) 669e670. [3] F.X. Yu, K.L. Guan, The Hippo pathway: regulators and regulations, Genes Dev. 27 (2013) 355e371. [4] Y. Wang, Q. Dong, Q. Zhang, Z. Li, E. Wang, X. Qiu, Overexpression of yesassociated protein contributes to progression and poor prognosis of nonsmall-cell lung cancer, Cancer Sci. 101 (2010) 1279e1285. [5] C.A. Hall, R. Wang, J. Miao, E. Oliva, X. Shen, T. Wheeler, S.G. Hilsenbeck, S. Orsulic, S. Goode, Hippo pathway effector Yap is an ovarian cancer oncogene, Cancer Res. 70 (2010) 8517e8525. [6] W. Kang, J.H. Tong, A.W. Chan, T.L. Lee, R.W. Lung, P.P. Leung, K.K. So, K. Wu, D. Fan, J. Yu, J.J. Sung, K.F. To, Yes-associated protein 1 exhibits oncogenic property in gastric cancer and its nuclear accumulation associates with poor prognosis, Clin. Cancer Res. 17 (2011) 2130e2139. [7] L. Zhang, D.X. Ye, H.Y. Pan, K.J. Wei, L.Z. Wang, X.D. Wang, G.F. Shen, Z.Y. Zhang, Yes-associated protein promotes cell proliferation by activating Fos Related Activator-1 in oral squamous cell carcinoma, Oral Oncol. 47 (2011) 693e697. [8] Z. Helias-Rodzewicz, G. Perot, F. Chibon, C. Ferreira, P. Lagarde, P. Terrier, J.M. Coindre, A. Aurias, YAP1 and VGLL3, encoding two cofactors of TEAD transcription factors, are amplified and overexpressed in a subset of soft tissue sarcomas, Genes Chromosom. Cancer 49 (2010) 1161e1171. [9] B.A. Orr, H. Bai, Y. Odia, D. Jain, R.A. Anders, C.G. Eberhart, Yes-associated protein 1 is widely expressed in human brain tumors and promotes glioblastoma growth, J. Neuropathol. Exp. Neurol. 70 (2011) 568e577. [10] T. Yokoyama, H. Osada, H. Murakami, Y. Tatematsu, T. Taniguchi, Y. Kondo, Y. Yatabe, Y. Hasegawa, K. Shimokata, Y. Horio, T. Hida, Y. Sekido, YAP1 is involved in mesothelioma development and negatively regulated by Merlin through phosphorylation, Carcinogenesis 29 (2008) 2139e2146. [11] T. Muramatsu, I. Imoto, T. Matsui, K. Kozaki, S. Haruki, M. Sudol, Y. Shimada, H. Tsuda, T. Kawano, J. Inazawa, YAP is a candidate oncogene for esophageal squamous cell carcinoma, Carcinogenesis 32 (2011) 389e398. [12] L. Wang, S. Shi, Z. Guo, X. Zhang, S. Han, A. Yang, W. Wen, Q. Zhu, Overexpression of YAP and TAZ is an independent predictor of prognosis in colorectal cancer and related to the proliferation and metastasis of colon cancer cells, PLoS One 8 (2013) e65539. [13] T. Liu, Y. Liu, H. Gao, F. Meng, S. Yang, G. Lou, Clinical significance of yesassociated protein overexpression in cervical carcinoma: the differential effects based on histotypes, Int. J. Gynecol. Cancer 23 (2013) 735e742. [14] J. Zhang, Z.P. Xu, Y.C. Yang, J.S. Zhu, Z. Zhou, W.X. Chen, Expression of Yesassociated protein in gastric adenocarcinoma and inhibitory effects of its knockdown on gastric cancer cell proliferation and metastasis, Int. J.
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
6
S. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
Immunopathol. Pharmacol. 25 (2012) 583e590. [15] L.L. Su, W.X. Ma, J.F. Yuan, Y. Shao, W. Xiao, S.J. Jiang, Expression of Yesassociated protein in non-small cell lung cancer and its relationship with clinical pathological factors, Chin. Med. J. Engl. 125 (2012) 4003e4008. [16] M. Sudol, P. Bork, A. Einbond, K. Kastury, T. Druck, M. Negrini, K. Huebner, D. Lehman, Characterization of the mammalian YAP (Yes-associated protein) gene and its role in defining a novel protein module, the WW domain, J. Biol. Chem. 270 (1995) 14733e14741. [17] M. Sudol, Yes-associated protein (YAP65) is a proline-rich phosphoprotein that binds to the SH3 domain of the Yes proto-oncogene product, Oncogene 9 (1994) 2145e2152. [18] F. Kanai, P.A. Marignani, D. Sarbassova, R. Yagi, R.A. Hall, M. Donowitz, A. Hisaminato, T. Fujiwara, Y. Ito, L.C. Cantley, M.B. Yaffe, TAZ: a novel transcriptional co-activator regulated by interactions with 14-3-3 and PDZ domain proteins, EMBO J. 19 (2000) 6778e6791. [19] R. Yagi, L.F. Chen, K. Shigesada, Y. Murakami, Y. Ito, A WW domain-containing yes-associated protein (YAP) is a novel transcriptional co-activator, EMBO J. 18 (1999) 2551e2562. [20] A. Vassilev, K.J. Kaneko, H. Shu, Y. Zhao, M.L. DePamphilis, TEAD/TEF transcription factors utilize the activation domain of YAP65, a Src/Yes-associated protein localized in the cytoplasm, Genes Dev. 15 (2001) 1229e1241. [21] K.F. Harvey, C.M. Pfleger, I.K. Hariharan, The Drosophila Mst ortholog, hippo, restricts growth and cell proliferation and promotes apoptosis, Cell 114 (2003) 457e467. [22] S. Wu, J. Huang, J. Dong, D. Pan, Hippo encodes a Ste-20 family protein kinase that restricts cell proliferation and promotes apoptosis in conjunction with salvador and warts, Cell 114 (2003) 445e456. [23] N. Tapon, K.F. Harvey, D.W. Bell, D.C. Wahrer, T.A. Schiripo, D. Haber, I.K. Hariharan, Salvador promotes both cell cycle exit and apoptosis in Drosophila and is mutated in human cancer cell lines, Cell 110 (2002) 467e478. [24] Z.C. Lai, X. Wei, T. Shimizu, E. Ramos, M. Rohrbaugh, N. Nikolaidis, L.L. Ho, Y. Li, Control of cell proliferation and apoptosis by mob as tumor suppressor, mats, Cell 120 (2005) 675e685. [25] J. Dong, G. Feldmann, J. Huang, S. Wu, N. Zhang, S.A. Comerford, M.F. Gayyed, R.A. Anders, A. Maitra, D. Pan, Elucidation of a universal size-control mechanism in Drosophila and mammals, Cell 130 (2007) 1120e1133. [26] B. Zhao, X. Wei, W. Li, R.S. Udan, Q. Yang, J. Kim, J. Xie, T. Ikenoue, J. Yu, L. Li, P. Zheng, K. Ye, A. Chinnaiyan, G. Halder, Z.C. Lai, K.L. Guan, Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control, Genes Dev. 21 (2007) 2747e2761. [27] F.D. Camargo, S. Gokhale, J.B. Johnnidis, D. Fu, G.W. Bell, R. Jaenisch, T.R. Brummelkamp, YAP1 increases organ size and expands undifferentiated progenitor cells, Curr. Biol. 17 (2007) 2054e2060. [28] Q. Zeng, W. Hong, The emerging role of the hippo pathway in cell contact inhibition, organ size control, and cancer development in mammals, Cancer Cell 13 (2008) 188e192. [29] B.V. Reddy, K.D. Irvine, Regulation of Hippo signaling by EGFR-MAPK signaling through Ajuba family proteins, Dev. Cell 24 (2013) 459e471. [30] R. Fan, N.G. Kim, B.M. Gumbiner, Regulation of Hippo pathway by mitogenic growth factors via phosphoinositide 3-kinase and phosphoinositidedependent kinase-1, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 2569e2574. [31] J.S. Mo, F.X. Yu, R. Gong, J.H. Brown, K.L. Guan, Regulation of the Hippo-YAP pathway by protease-activated receptors (PARs), Genes Dev. 26 (2012) 2138e2143. [32] S. Piccolo, M. Cordenonsi, S. Dupont, Molecular pathways: YAP and TAZ take center stage in organ growth and tumorigenesis, Clin. Cancer Res. 19 (2013) 4925e4930. [33] D. Chen, Y. Sun, Y. Wei, P. Zhang, A.H. Rezaeian, J. Teruya-Feldstein, S. Gupta, H. Liang, H.K. Lin, M.C. Hung, L. Ma, LIFR is a breast cancer metastasis suppressor upstream of the Hippo-YAP pathway and a prognostic marker, Nat. Med. 18 (2012) 1511e1517. [34] M.J. Oudhoff, S.A. Freeman, A.L. Couzens, F. Antignano, E. Kuznetsova, P.H. Min, J.P. Northrop, B. Lehnertz, D. Barsyte-Lovejoy, M. Vedadi, C.H. Arrowsmith, H. Nishina, M.R. Gold, F.M. Rossi, A.C. Gingras, C. Zaph, Control of the hippo pathway by Set7-dependent methylation of Yap, Dev. Cell 26 (2013) 188e194. [35] H.B. Nguyen, J.T. Babcock, C.D. Wells, L.A. Quilliam, LKB1 tumor suppressor regulates AMP kinase/mTOR-independent cell growth and proliferation via the phosphorylation of Yap, Oncogene 32 (2013) 4100e4109. [36] J. Wang, J.S. Park, Y. Wei, M. Rajurkar, J.L. Cotton, Q. Fan, B.C. Lewis, H. Ji, J. Mao, TRIB2 acts downstream of Wnt/TCF in liver cancer cells to regulate YAP and C/EBPalpha function, Mol. Cell 51 (2013) 211e225. [37] W.M. Konsavage Jr., S.L. Kyler, S.A. Rennoll, G. Jin, G.S. Yochum, Wnt/betacatenin signaling regulates Yes-associated protein (YAP) gene expression in colorectal carcinoma cells, J. Biol. Chem. 287 (2012) 11730e11739. [38] V. Tomlinson, K. Gudmundsdottir, P. Luong, K.Y. Leung, A. Knebel, S. Basu, JNK
[39]
[40]
[41] [42]
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
[60]
phosphorylates Yes-associated protein (YAP) to regulate apoptosis, Cell Death Dis. 1 (2010) e29. K.K. Lee, S. Yonehara, Identification of a mechanism that couples multisite phosphorylation of Yes-associated protein (YAP) with transcriptional coactivation and regulation of apoptosis, J. Biol. Chem. 291 (2016) 4844e4845. S. Hata, J. Hirayama, H. Kajiho, K. Nakagawa, Y. Hata, T. Katada, M. FurutaniSeiki, H. Nishina, A novel acetylation cycle of transcription co-activator Yesassociated protein that is downstream of Hippo pathway is triggered in response to SN2 alkylating agents, J. Biol. Chem. 287 (2012) 22089e22098. L.A. Yates, C.J. Norbury, R.J. Gilbert, The long and short of microRNA, Cell 153 (2013) 516e519. Y. Wei, A. Schober, C. Weber, Pathogenic arterial remodeling: the good and bad of microRNAs, Am. J. Physiol. Heart Circ. Physiol. 304 (2013) H1050eH1059. Z. Wang, H. Yao, S. Lin, X. Zhu, Z. Shen, G. Lu, W.S. Poon, D. Xie, M.C. Lin, H.F. Kung, Transcriptional and epigenetic regulation of human microRNAs, Cancer Lett. 331 (2013) 1e10. G. Mao, Y. Liu, X. Fang, Y. Liu, L. Fang, L. Lin, X. Liu, N. Wang, Tumor-derived microRNA-494 promotes angiogenesis in non-small cell lung cancer, Angiogenesis 18 (2015) 373e382. K. Danza, S. De Summa, R. Pinto, B. Pilato, O. Palumbo, G. Merla, G. Simone, S. Tommasi, MiR-578 and miR-573 as potential players in BRCA-related breast cancer angiogenesis, Oncotarget 6 (2015) 471e483. G.T. Liu, Y.L. Huang, H.E. Tzeng, C.H. Tsai, S.W. Wang, C.H. Tang, CCL5 promotes vascular endothelial growth factor expression and induces angiogenesis by down-regulating miR-199a in human chondrosarcoma cells, Cancer Lett. 357 (2015) 476e487. D. Yang, Y. Sun, L. Hu, H. Zheng, P. Ji, C.V. Pecot, Y. Zhao, S. Reynolds, H. Cheng, R. Rupaimoole, D. Cogdell, M. Nykter, R. Broaddus, C. Rodriguez-Aguayo, G. Lopez-Berestein, J. Liu, I. Shmulevich, A.K. Sood, K. Chen, W. Zhang, Integrated analyses identify a master microRNA regulatory network for the mesenchymal subtype in serous ovarian cancer, Cancer Cell 23 (2013) 186e199. A. Kanitz, J. Imig, P.J. Dziunycz, A. Primorac, A. Galgano, G.F. Hofbauer, A.P. Gerber, M. Detmar, The expression levels of microRNA-361-5p and its target VEGFA are inversely correlated in human cutaneous squamous cell carcinoma, PLoS One 7 (2012) e49568. X. Wu, X. Xi, Q. Yan, Z. Zhang, B. Cai, W. Lu, X. Wan, MicroRNA-361-5p facilitates cervical cancer progression through mediation of epithelial-tomesenchymal transition, Med. Oncol. 30 (2013) 751. D. Liu, T. Tao, B. Xu, S. Chen, C. Liu, L. Zhang, K. Lu, Y. Huang, L. Jiang, X. Zhang, X. Huang, L. Zhang, C. Han, M. Chen, MiR-361-5p acts as a tumor suppressor in prostate cancer by targeting signal transducer and activator of transcription6(STAT6), Biochem. Biophys. Res. Commun. 445 (2014) 151e156. F. Ma, H. Song, B. Guo, Y. Zhang, Y. Zheng, C. Lin, Y. Wu, G. Guan, R. Sha, Q. Zhou, D. Wang, X. Zhou, J. Li, X. Qiu, MiR-361-5p inhibits colorectal and gastric cancer growth and metastasis by targeting staphylococcal nuclease domain containing-1, Oncotarget 6 (2015) 17404e17416. J.J. Sun, G.Y. Chen, Z.T. Xie, MicroRNA-361-5p inhibits cancer cell growth by targeting CXCR6 in hepatocellular carcinoma, Cell Physiol. Biochem. 38 (2016) 777e785. C. Zhan, L. Yan, L. Wang, W. Jiang, Y. Zhang, J. Xi, L. Chen, Y. Jin, Y. Qiao, Y. Shi, Q. Wang, Identification of reference miRNAs in human tumors by TCGA miRNA-seq data, Biochem. Biophys. Res. Commun. 453 (2014) 375e378. Z.L. Zhuang, F.M. Tian, C.L. Sun, Downregulation of miR-361-5p associates with aggressive clinicopathological features and unfavorable prognosis in non-small cell lung cancer, Eur. Rev. Med. Pharmacol. Sci. 20 (2016) 5132e5136. S.L. Wood, M. Pernemalm, P.A. Crosbie, A.D. Whetton, The role of the tumormicroenvironment in lung cancer-metastasis and its relationship to potential therapeutic targets, Cancer Treat. Rev. 40 (2014) 558e566. S.H. How, T.H. Ng, Y.C. Kuan, A.R. Jamalludin, A.R. Fauzi, Survival of lung cancer patients in a resource-limited country, Asia Pac. J. Clin. Oncol. 11 (2015) 221e227. C. Roth, I. Stuckrath, K. Pantel, J.R. Izbicki, M. Tachezy, H. Schwarzenbach, Low levels of cell-free circulating miR-361-3p and miR-625* as blood-based markers for discriminating malignant from benign lung tumors, PLoS One 7 (2012) e38248. W. Chen, J. Wang, S. Liu, S. Wang, Y. Cheng, W. Zhou, C. Duan, C. Zhang, MicroRNA-361-3p suppresses tumor cell proliferation and metastasis by directly targeting SH2B1 in NSCLC, J. Exp. Clin. Cancer Res. 35 (2016) 76. S. Yang, Y. Zhang, X. Zhao, J. Wang, J. Shang, microRNA-361 targets Wilms' tumor 1 to inhibit the growth, migration and invasion of non-small-cell lung cancer cells, Mol. Med. Rep. 14 (2016) 5415e5421. X.W. Hou, X. Sun, Y. Yu, H.M. Zhao, Z.J. Yang, X. Wang, X.C. Cao, miR-361e5p suppresses lung cancer cell lines progression by targeting FOXM1, Neoplasma 64 (2017).
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer Suning Zhang*, Zongang Liu, Lin Wu, Yudong Wang Department of Thoracic Surgical, Shengjing Hospital Affiliated with China Medical University, Shenyang 110000, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 August 2017 Accepted 19 August 2017 Available online xxx
Yes-associated protein (YAP) contributes to the development of multiple tumors, but the posttranscription modulation of YAP remains unexplored. Here, we present a new regulatory microRNA of YAP, miR-361, which directly targets YAP to inhibit cell proliferation in lung cancer. We used bioinformatics to predict that miR-361 could target 30 -untranslated region (30 UTR) of YAP mRNA. Luciferase reporter gene assays demonstrated that miR-361 could decrease the luciferase activities of 30 UTR vector of YAP. Furthermore, YAP expression was obviously abated by miR-361 using RT-PCR and immunoblotting in lung cancer A549 cells. In terms of function, MTT and colony formation analysis showed that ectopic miR-361 expression significantly suppressed cell proliferation in lung cancer. Notably, overexpressed YAP accelerated miR-361-bated proliferation of lung cancer cells. MiR-361 inhibitor promoted cell proliferation in lung cancer, but YAP RNA interference reversed miR-361 inhibitor-driven cell proliferation. Interestingly, miR-361 was capable of affecting the cell cycle in lung cancer progression. Finally, the negative correlation of miR-361 with YAP was found in clinical human lung cancer tissues. In conclusion, miR-361 targets 30 UTR of YAP mRNA to depress the proliferation of lung cancer cells. © 2017 Published by Elsevier Inc.
Keywords: miR-361 YAP Proliferation Lung cancer
1. Introduction Hippo-YAP pathway is firstly identified for controlling organ size of Drosophila [1,2]. Deregulation of Hippo-YAP signaling induces tissue overgrowth or induces cancer [3]. The Yes-associated protein (YAP), is a bona fide oncoprotein, and its abundance and activity are frequently increased in many types of cancers [4e15]. YAP is a transcriptional coactivator that partners with the TEAD family of transcription factors to promote the expression of pro-proliferative and antiapoptotic genes [16e24]. Extensive genetic studies that focused primarily on organ size control in Drosophila and mice identified that the Hippo pathway is the canonical regulator of YAP activity [18,25e28]. Multiple factors are able to affect the Hippo pathway, resulting in the alteration of YAP activity [29e33]. Additionally, accumulating evidence indicates that YAP activity can be regulated by noncanonical, Hippo independent mechanisms
Abbreviations: YAP, Yes-associated protein; miRNA, microRNA; STAT6, signal transducer and activator of transcription-6; real time-PCR, real-time polymerase chain reaction; EdU, 5-ethynyl-20 -deoxyuridine. * Corresponding author. Department of Thoracic Surgical, Shengjing Hospital Affiliated with China Medical University, 36 Sanhao Street, Shenyang 110000, China. E-mail address: [email protected] (S. Zhang).
[34e40]. The post-transcription regulation of YAP remains to be further investigated. MicroRNAs (miRNAs) are capable of inhibiting transcription or translation of target genes [41e43]. Previous studies revealed that miRNAs could promote or suppress the development of cancers [44e47]. The inverse relationship between miR-361 and VEGFA are revealed in human cutaneous squamous cell carcinoma [48]. MiR-361 modulates epithelial-to-mesenchymal transition to participate in the development in cervical cancer [49]. MiR-361 is able to target transcription factor STAT6 to inhibit the development of prostate cancer [50]. MiR-361 could restrain the growth or metastasis in colorectal, liver or gastric cancer [51,52]. TCGA miRNA-seq data show that miR-361 and let-7i are reference miRNAs in some tumors [53]. Decreased miR-361 in non-small cell lung cancer is connected with more aggressive progression and poor prognosis [54]. However, whether miR-361 is able to target YAP in lung cancer remains poorly understood. We are interested in whether miR-361 has effect on YAP0 posttranscription regulation in lung cancer. We reveal that miR-361 restrains lung cancer proliferation through directly targeting YAP 30 UTR. We present a novel perspective for understanding how lung cancer development by YAP is modulated.
http://dx.doi.org/10.1016/j.bbrc.2017.08.072 0006-291X/© 2017 Published by Elsevier Inc.
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
2
S. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
2. Materials and methods
2.7. Proliferation assays
2.1. Cell lines
EdU and colony formation assays were used to evaluate cell proliferation ability. A549 cells seeding on 24-well plates were transfected. Post-transfection 48 h, EdU Cell Proliferation Assay Kit (Ribobio, China) was applied to test cell proliferation. For colony formation analysis, post-Forty-eight hours after transfection with miR-361, miR-361 þ YAP, anti-miR-361, anti-miR361þsiYAP-1 or negative control, seeded cells on 6-well plates (1000 cells/well) were cultured for two weeks until visible colonies. The colonies were fixed with 4% paraformaldehyde and stained with methylene blue. Colonies were counted by three observers separately.
10% fetal bovine serum was added into Dulbecco's modified Eagle's medium (Gibco, USA) to culture human lung cancer cell line A549. Cells were contained in a 5% CO2 incubator at 37 C. 2.2. RNA isolation and real-time polymerase chain reaction (PCR) Using TRIzol Reagent (Invitrogen, USA) total RNA of tissues or cells was extracted and SuperScript™ IV Reverse Transcriptase (ThermoFisher Scientific, USA) was utilized to do reverse transcription. To detect miR-361 expression, total RNA was polyadenylated by poly (A) polymerase (Ambion, USA). The qRT-PCR was applied by TransStart Top Green qPCR SuperMix (TransGen Biotech, China). PCR reaction was evaluated using melting curve analysis. Relative transcription alteration was evaluated as 2DDCt. GAPDH was used to normalize YAP. The level of miR-361 was normalized to U6 expression. The primers were listed: YAP forward, 50 -TATCAATCCCAGCACAG-30 , reverse, 50 -GGAATGGCTTCAAGGTAG30 ; GAPDH forward, 50 -AACGGATTTGGTCGTATTG-30 , reverse, 50 GGAAGATGGTGATGGGATT-30 ; miR-361 forward, 50 - ATAAAGTGCTGACAGTGCAGATAGTG-30 , reverse, 50 - TCAAGTACCCACAGTGCGGT30 ; U6 forward, 50 - CTCGCTTCGGCAGCACA-30 , reverse, 50 AACGCTTCACG AATTTGCGT-30 . 2.3. Plasmids construction Full-length YAP was amplified and cloned into pcDNA3.1 vector (primers: forward, 50 -CGGAATTCATGGATCCCGGGCAGCAGCCGC-30 , reverse, 50 - GCGTCGACCTATAACCATGTAAGAAAGCTTTCT-3). Wild type (wt) or mutated (mut) miR-361 targeting site in YAP 30 UTR was cloned into pGL3-control vector (primers: wt forward, 50 GCTCTAGACAAAAATGTTATATCTGATA-30 , reverse, 50 -GGGGGCCGGCC GCTACAACTATTAACAGATT-30 ; mut forward, 50 -GCTCTAGA CAAAAATGTTTGAGGACTAT-30 , reverse, 50 -GGGGGCCGGCC GCTACAACTATTAACAGATT-30 ).
2.8. Flow cytometry analysis MiR-361 (or anti-miR-361 or control miRNA) treated- A549 cells were harvested, fixed and resuspended in propidium iodine (PI) solution. In the dark the cells were incubated at 37 C for half an hour and then were analyzed by a FACScan flow cytometer (BectonDickinson, USA). Flow cytometry analysis was repeated three times. 2.9. Patient samples Shengjing Hospital Affiliated with China Medical University (Shenyang, China) provided thirty lung cancer tissues harvested from lung cancer patients by surgical (Supplementary Table S1). Written consents were banked with tissues and study protocol has been approved by Research Ethics Board. 2.10. Statistical analysis Every experiment was performed in triplicate. Data was recorded as mean ± SD. Student's t-test was utilized to compare different groups' differences. P value less than 0.05 were determined significant. The relationship between miR-361 and YAP expression in lung cancer samples was evaluated by Pearson's correlation coefficient.
2.4. siRNAs, miRNA and miRNA inhibitor transfection 3. Result Transient transfection of cells was performed using Lipofectamine 2000 (Invitrogen, USA). MiR-361, control, inhibitor and siYAP were synthesized by RiboBio (Guangzhou, China). siYAP-1, 50 GACAUCUUCUGGUCAGAGAdTdT-30 ; siYAP-2, 50 -GCUUUGAGUUCUGACAUCCdTdT-30 ; siCtrl, 50 -UUCUCCGAACGUGUCACGUdTdT-30 . 2.5. Luciferase reporter gene assays Seeded cells on 24-well plates were cultured overnight. Lipofectamine 2000 (Invitrogen, USA) was applied to transfect the indicated luciferase reporters and/or miRNA (inhibitor). Renilla luciferase activities were utilized to normalize Firefly luciferase activities. Luciferase activity was analyzed using Dual-Luciferase® Reporter Assay System (Promega, USA) and monitored by a luminometer (Promega, USA). 2.6. Western blot analysis RIPA buffer was used to isolate total protein. After running in 12% SDS-PAGE, all protein was transferred to PVDF membranes (Millipore, USA). 5% skim milk was applied to block the membranes for 2 h and then incubated in primary antibodies: anti-YAP antibody (Proteintech, USA) or anti-b-actin antibody (NeoMarkers, USA) followed by the corresponding secondary antibody.
3.1. MiR-361 directly targets YAP 30 UTR to restrains its expression YAP is frequently overexpressed in multiple tumors [4e15]. Highly expressed YAP participates in the development of many cancers. Here, we want to investigate the YAP0 posttranscription regulation in lung cancer. MiRNA.org was applied to predict the miRNAs which could target YAP. MiR-361 was a potential regulatory miRNA of YAP. To test the effect of miR-361 on YAP, we cloned the wild type (wt) or mutant (mut) 30 UTR of YAP into pGL3-control plasmid (pGL3-YAP-wt and pGL3-YAPmut) (Fig. 1A and B). The pGL3-YAP-wt or pGL3-YAP-mut plasmid combined with miR-361 or inhibitor (anti-miR-361) was transfected into A549 cells. We revealed that ectopic miR-361 expression significantly decreased the luciferase activities of pGL3-YAP-wt in lung cancer A549 cells. However, miR-361 lost the inhibitory effect on pGL3-YAP-mut containing the seed region mutation in cells (Fig. 1C). In addition, miR-361 inhibitor (antimiR-361) was capable of decreasing the miR-361 level to enhance the luciferase activities of the pGL3-YAP-wt. Nevertheless, pGL3-YAP-mut cannot be affected by anti-miR-361 introduction (Fig. 1D). Our data indicates that miR-361 inhibits YAP expression via directly targeting its mRNA 30 UTR in lung cancer cells.
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
S. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
3
Fig. 1. MiR-361 directly targets YAP 30 UTR to restrains its expression. (A) The binding site of miR-361 within YAP 30 UTR is shown. (B) The wild type and mutant 30 UTR of YAP (wt or mut) is cloned into pGL3-control plasmid. (C, D) The effect of miR-361 or inhibitor (anti-miR-361) on rpGL3-YAP-wt or pGL3-YAP-mut was analyzed by luciferase reporter gene analysis in A549 cells. **P < 0.01; NS, not significant; Student's t-test.
3.2. MiR-361 is capable of bating YAP expression in lung cancer cells Then, we tried to evaluate the effect of miR-361 on YAP expression lung cancer cells. We examined YAP expression in miR361 or anti-miR-361-treated cells using RT-PCR and Western blotting. As shown in Fig. 2A, miR-361 decreased the mRNA and protein levels of YAP. Furthermore, the expression of YAP was elevated in miR-361-depleted cells (Fig. 2B). Our data imply that miR-361 is
able to control YAP expression in lung cancer. Meanwhile, miR-361 and anti-miR-361 transfection was evaluated by real time-PCR (Fig. 2A and B). Collectively, our data support that miR-361 is capable of depressing YAP in lung cancer cells. 3.3. MiR-361 suppresses cell proliferation via inhibiting YAP in lung cancer To further evaluate the function of miR-361 targeting YAP in
Fig. 2. MiR-361 is capable of bating YAP expression in lung cancer cells. (A, B) YAP levels were analyzed in miR-361 (or anti-miR-361)-treated A549 cells by RT-PCR assay and Western blotting. The transfection of miR-361 or anti-miR-361 was confirmed by real time-PCR analysis. ***P < 0.001; **P < 0.01; Student's t-test.
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
4
S. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
lung cancer, we performed EdU incorporation assay. The data showed that the miR-361-overexpressed cells exhibited more highly proliferative ability, while ectopic YAP expression was able to recover the miR-361-downregulated cell proliferation. Moreover, anti-miR-361 transfection displayed the inhibitory effect on cell proliferation, but YAP siRNA could breach the acceleration of cell proliferation by anti-miR-361 (Fig. 3A). Taken a further step, colony formation assays showed that the colony numbers were less in miR-361-treated cells compared to that in control group. Anti-miR361 was able to enhance the colony formation in the cells. Notably, YAP siRNA could destroy the anti-miR-361-augmented colony formation in A549 cells (Fig. 3B). YAP RNA interference efficiency was confirmed by Western blotting (Fig. 3C). Interestingly, by using flow cytometry analysis we found that miR-361 was capable of increasing G1 phase cells and decreasing S phase cells. Furthermore, anti-miR-361 was able to decrease G1 phase cells and
increase S phase cells (Fig. 3D). Our data support that miR-361 can bate YAP to restrain cell proliferation in lung cancer. 3.4. Decreased miR-361 is related to overexpressed YAP in clinical lung cancer tissues To explore the relationship of miR-361 and YAP in lung cancer development, we examined the expression of miR-361 and YAP in thirty clinical lung cancer samples. Our data manifested that low level of miR-361 was related to high levels of YAP in clinical lung cancer samples (Pearson' correlation coefficient of 0.7319, p < 0.001) (Fig. 4A). In addition, YAP expression was confirmed in lung cancer samples by real time-PCR assay. Abundant YAP expression in lung cancer tissues was observed (Fig. 4B). Our data hint that deregulated miR-361 is related to upregulated YAP in clinical lung cancer tissues.
Fig. 3. MiR-361 bates cell proliferation via inhibiting YAP in lung cancer. (A, B) Proliferation abilities of miR-361, miR-361/YAP, anti-miR-361, or anti-miR-361/siYAP-1-treated A549 cells were detected by EdU incorporation assay and colony formation analysis. (C) Interference efficiency of siYAP-1 or siYAP-2 was evaluated by Western blotting in A549 cells. (D) The effect of miR-361 (or anti-miR-361) on cell cycle was tested by flow cytometry analysis in A549 cells. ***P < 0.001, **P < 0.01; Student's t-test.
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
S. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
5
Fig. 4. Decreased miR-361 is related to overexpressed YAP in clinical lung cancer tissues. (A) Relationship between miR-361 and YAP was investigated using real time-PCR in 30 clinical lung cancer samples (Pearson's correlation coefficient, R ¼ 7319). (B) In clinical samples YAP level was evaluated by using real time-PCR. ***P < 0.01; Student's t-test.
4. Discussion Lung cancer is master causes of cancer-related death and the most prevalent malignancy in the world. About 80% of are nonsmall cell lung cancer among lung cancer patients [55,56]. YAP as a crucial downstream factor in Hippo pathway take great part in multiple cancers including lung cancer. Multiple factors are able to affect Hippo pathway, resulting in the alteration of YAP activity by modulating the [29e33]. The post-transcription regulation of YAP remains to be further investigated. First, we predicted the miRNAs which might target YAP using microRNA.org. MiR-361 was a potential regulatory miRNA of YAP for its role in multiple cancers, such as hepatocellular carcinoma, cutaneous squamous cell carcinoma, prostate cancer, gastric cancer, cervical cancer, or colorectal cancer. However, whether miR-361 is able to target YAP to regulate its expression in lung cancer is unclear. To explore the regulation of miR-361 on YAP, we cloned the wild type (wt) and mutant (mut) 30 UTR of YAP into pGL3-control plasmid. We showed that ectopic miR-361 expression significantly decreased the luciferase activities of pGL3-YAP-wt in lung cancer A549 cells. In addition, miR-361 inhibitor was capable of decreasing the miR-361 level to enhance the luciferase activities of the pGL3-YAP-wt. It suggests that miR-361 can inhibits YAP expression through directly targeting its mRNA 30 UTR in lung cancer cells. Furthermore, our data manifested that the level of Yap could be decreased by miR-361 using real time-PCR and Western blotting further indicating that miR-361 is able to target YAP. In terms of function, miR-361 owned the ability by which miR-361 targets YAP to bate the cell proliferation in lung cancers in vitro. Previous study revealed that low circulating miR-361 could a blood marker for lung cancer [57]. MiR-361 targeting SH2B1 participates in NSCLC development [58]. Wilms' tumor 1 is one of miR-3610 target in progression inhibition of lung cancer [59]. MiR-361 is able to regulate FOXM1 to suppress lung cancer progression [60]. Our finding that miR-361 can target a key oncoprotein in Hippo pathway YAP provides new evidence for tumor suppressor role of miR-361 in cancers. For the first time we present a novel role of miR-361 in posttranscription regulation of YAP for YAP inhibition, resulting in decreased cell proliferation in lung cancer. We gains novel insight into the mechanism of lung cancer by YAP. Conflict of interests Suning Zhang and Zongang Liu designed the study and wrote
the manuscript. Lin Wu and Yudong Wang performed the study and wrote the manuscript. The authors declare no competing financial interests. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2017.08.072. References [1] C. Badouel, A. Garg, H. McNeill, Herding Hippos: regulating growth in flies and man, Curr. Opin. Cell Biol. 21 (2009) 837e843. [2] V.A. Codelia, K.D. Irvine, Hippo signaling goes long range, Cell 150 (2012) 669e670. [3] F.X. Yu, K.L. Guan, The Hippo pathway: regulators and regulations, Genes Dev. 27 (2013) 355e371. [4] Y. Wang, Q. Dong, Q. Zhang, Z. Li, E. Wang, X. Qiu, Overexpression of yesassociated protein contributes to progression and poor prognosis of nonsmall-cell lung cancer, Cancer Sci. 101 (2010) 1279e1285. [5] C.A. Hall, R. Wang, J. Miao, E. Oliva, X. Shen, T. Wheeler, S.G. Hilsenbeck, S. Orsulic, S. Goode, Hippo pathway effector Yap is an ovarian cancer oncogene, Cancer Res. 70 (2010) 8517e8525. [6] W. Kang, J.H. Tong, A.W. Chan, T.L. Lee, R.W. Lung, P.P. Leung, K.K. So, K. Wu, D. Fan, J. Yu, J.J. Sung, K.F. To, Yes-associated protein 1 exhibits oncogenic property in gastric cancer and its nuclear accumulation associates with poor prognosis, Clin. Cancer Res. 17 (2011) 2130e2139. [7] L. Zhang, D.X. Ye, H.Y. Pan, K.J. Wei, L.Z. Wang, X.D. Wang, G.F. Shen, Z.Y. Zhang, Yes-associated protein promotes cell proliferation by activating Fos Related Activator-1 in oral squamous cell carcinoma, Oral Oncol. 47 (2011) 693e697. [8] Z. Helias-Rodzewicz, G. Perot, F. Chibon, C. Ferreira, P. Lagarde, P. Terrier, J.M. Coindre, A. Aurias, YAP1 and VGLL3, encoding two cofactors of TEAD transcription factors, are amplified and overexpressed in a subset of soft tissue sarcomas, Genes Chromosom. Cancer 49 (2010) 1161e1171. [9] B.A. Orr, H. Bai, Y. Odia, D. Jain, R.A. Anders, C.G. Eberhart, Yes-associated protein 1 is widely expressed in human brain tumors and promotes glioblastoma growth, J. Neuropathol. Exp. Neurol. 70 (2011) 568e577. [10] T. Yokoyama, H. Osada, H. Murakami, Y. Tatematsu, T. Taniguchi, Y. Kondo, Y. Yatabe, Y. Hasegawa, K. Shimokata, Y. Horio, T. Hida, Y. Sekido, YAP1 is involved in mesothelioma development and negatively regulated by Merlin through phosphorylation, Carcinogenesis 29 (2008) 2139e2146. [11] T. Muramatsu, I. Imoto, T. Matsui, K. Kozaki, S. Haruki, M. Sudol, Y. Shimada, H. Tsuda, T. Kawano, J. Inazawa, YAP is a candidate oncogene for esophageal squamous cell carcinoma, Carcinogenesis 32 (2011) 389e398. [12] L. Wang, S. Shi, Z. Guo, X. Zhang, S. Han, A. Yang, W. Wen, Q. Zhu, Overexpression of YAP and TAZ is an independent predictor of prognosis in colorectal cancer and related to the proliferation and metastasis of colon cancer cells, PLoS One 8 (2013) e65539. [13] T. Liu, Y. Liu, H. Gao, F. Meng, S. Yang, G. Lou, Clinical significance of yesassociated protein overexpression in cervical carcinoma: the differential effects based on histotypes, Int. J. Gynecol. Cancer 23 (2013) 735e742. [14] J. Zhang, Z.P. Xu, Y.C. Yang, J.S. Zhu, Z. Zhou, W.X. Chen, Expression of Yesassociated protein in gastric adenocarcinoma and inhibitory effects of its knockdown on gastric cancer cell proliferation and metastasis, Int. J.
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
6
S. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
Immunopathol. Pharmacol. 25 (2012) 583e590. [15] L.L. Su, W.X. Ma, J.F. Yuan, Y. Shao, W. Xiao, S.J. Jiang, Expression of Yesassociated protein in non-small cell lung cancer and its relationship with clinical pathological factors, Chin. Med. J. Engl. 125 (2012) 4003e4008. [16] M. Sudol, P. Bork, A. Einbond, K. Kastury, T. Druck, M. Negrini, K. Huebner, D. Lehman, Characterization of the mammalian YAP (Yes-associated protein) gene and its role in defining a novel protein module, the WW domain, J. Biol. Chem. 270 (1995) 14733e14741. [17] M. Sudol, Yes-associated protein (YAP65) is a proline-rich phosphoprotein that binds to the SH3 domain of the Yes proto-oncogene product, Oncogene 9 (1994) 2145e2152. [18] F. Kanai, P.A. Marignani, D. Sarbassova, R. Yagi, R.A. Hall, M. Donowitz, A. Hisaminato, T. Fujiwara, Y. Ito, L.C. Cantley, M.B. Yaffe, TAZ: a novel transcriptional co-activator regulated by interactions with 14-3-3 and PDZ domain proteins, EMBO J. 19 (2000) 6778e6791. [19] R. Yagi, L.F. Chen, K. Shigesada, Y. Murakami, Y. Ito, A WW domain-containing yes-associated protein (YAP) is a novel transcriptional co-activator, EMBO J. 18 (1999) 2551e2562. [20] A. Vassilev, K.J. Kaneko, H. Shu, Y. Zhao, M.L. DePamphilis, TEAD/TEF transcription factors utilize the activation domain of YAP65, a Src/Yes-associated protein localized in the cytoplasm, Genes Dev. 15 (2001) 1229e1241. [21] K.F. Harvey, C.M. Pfleger, I.K. Hariharan, The Drosophila Mst ortholog, hippo, restricts growth and cell proliferation and promotes apoptosis, Cell 114 (2003) 457e467. [22] S. Wu, J. Huang, J. Dong, D. Pan, Hippo encodes a Ste-20 family protein kinase that restricts cell proliferation and promotes apoptosis in conjunction with salvador and warts, Cell 114 (2003) 445e456. [23] N. Tapon, K.F. Harvey, D.W. Bell, D.C. Wahrer, T.A. Schiripo, D. Haber, I.K. Hariharan, Salvador promotes both cell cycle exit and apoptosis in Drosophila and is mutated in human cancer cell lines, Cell 110 (2002) 467e478. [24] Z.C. Lai, X. Wei, T. Shimizu, E. Ramos, M. Rohrbaugh, N. Nikolaidis, L.L. Ho, Y. Li, Control of cell proliferation and apoptosis by mob as tumor suppressor, mats, Cell 120 (2005) 675e685. [25] J. Dong, G. Feldmann, J. Huang, S. Wu, N. Zhang, S.A. Comerford, M.F. Gayyed, R.A. Anders, A. Maitra, D. Pan, Elucidation of a universal size-control mechanism in Drosophila and mammals, Cell 130 (2007) 1120e1133. [26] B. Zhao, X. Wei, W. Li, R.S. Udan, Q. Yang, J. Kim, J. Xie, T. Ikenoue, J. Yu, L. Li, P. Zheng, K. Ye, A. Chinnaiyan, G. Halder, Z.C. Lai, K.L. Guan, Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control, Genes Dev. 21 (2007) 2747e2761. [27] F.D. Camargo, S. Gokhale, J.B. Johnnidis, D. Fu, G.W. Bell, R. Jaenisch, T.R. Brummelkamp, YAP1 increases organ size and expands undifferentiated progenitor cells, Curr. Biol. 17 (2007) 2054e2060. [28] Q. Zeng, W. Hong, The emerging role of the hippo pathway in cell contact inhibition, organ size control, and cancer development in mammals, Cancer Cell 13 (2008) 188e192. [29] B.V. Reddy, K.D. Irvine, Regulation of Hippo signaling by EGFR-MAPK signaling through Ajuba family proteins, Dev. Cell 24 (2013) 459e471. [30] R. Fan, N.G. Kim, B.M. Gumbiner, Regulation of Hippo pathway by mitogenic growth factors via phosphoinositide 3-kinase and phosphoinositidedependent kinase-1, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 2569e2574. [31] J.S. Mo, F.X. Yu, R. Gong, J.H. Brown, K.L. Guan, Regulation of the Hippo-YAP pathway by protease-activated receptors (PARs), Genes Dev. 26 (2012) 2138e2143. [32] S. Piccolo, M. Cordenonsi, S. Dupont, Molecular pathways: YAP and TAZ take center stage in organ growth and tumorigenesis, Clin. Cancer Res. 19 (2013) 4925e4930. [33] D. Chen, Y. Sun, Y. Wei, P. Zhang, A.H. Rezaeian, J. Teruya-Feldstein, S. Gupta, H. Liang, H.K. Lin, M.C. Hung, L. Ma, LIFR is a breast cancer metastasis suppressor upstream of the Hippo-YAP pathway and a prognostic marker, Nat. Med. 18 (2012) 1511e1517. [34] M.J. Oudhoff, S.A. Freeman, A.L. Couzens, F. Antignano, E. Kuznetsova, P.H. Min, J.P. Northrop, B. Lehnertz, D. Barsyte-Lovejoy, M. Vedadi, C.H. Arrowsmith, H. Nishina, M.R. Gold, F.M. Rossi, A.C. Gingras, C. Zaph, Control of the hippo pathway by Set7-dependent methylation of Yap, Dev. Cell 26 (2013) 188e194. [35] H.B. Nguyen, J.T. Babcock, C.D. Wells, L.A. Quilliam, LKB1 tumor suppressor regulates AMP kinase/mTOR-independent cell growth and proliferation via the phosphorylation of Yap, Oncogene 32 (2013) 4100e4109. [36] J. Wang, J.S. Park, Y. Wei, M. Rajurkar, J.L. Cotton, Q. Fan, B.C. Lewis, H. Ji, J. Mao, TRIB2 acts downstream of Wnt/TCF in liver cancer cells to regulate YAP and C/EBPalpha function, Mol. Cell 51 (2013) 211e225. [37] W.M. Konsavage Jr., S.L. Kyler, S.A. Rennoll, G. Jin, G.S. Yochum, Wnt/betacatenin signaling regulates Yes-associated protein (YAP) gene expression in colorectal carcinoma cells, J. Biol. Chem. 287 (2012) 11730e11739. [38] V. Tomlinson, K. Gudmundsdottir, P. Luong, K.Y. Leung, A. Knebel, S. Basu, JNK
[39]
[40]
[41] [42]
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
[60]
phosphorylates Yes-associated protein (YAP) to regulate apoptosis, Cell Death Dis. 1 (2010) e29. K.K. Lee, S. Yonehara, Identification of a mechanism that couples multisite phosphorylation of Yes-associated protein (YAP) with transcriptional coactivation and regulation of apoptosis, J. Biol. Chem. 291 (2016) 4844e4845. S. Hata, J. Hirayama, H. Kajiho, K. Nakagawa, Y. Hata, T. Katada, M. FurutaniSeiki, H. Nishina, A novel acetylation cycle of transcription co-activator Yesassociated protein that is downstream of Hippo pathway is triggered in response to SN2 alkylating agents, J. Biol. Chem. 287 (2012) 22089e22098. L.A. Yates, C.J. Norbury, R.J. Gilbert, The long and short of microRNA, Cell 153 (2013) 516e519. Y. Wei, A. Schober, C. Weber, Pathogenic arterial remodeling: the good and bad of microRNAs, Am. J. Physiol. Heart Circ. Physiol. 304 (2013) H1050eH1059. Z. Wang, H. Yao, S. Lin, X. Zhu, Z. Shen, G. Lu, W.S. Poon, D. Xie, M.C. Lin, H.F. Kung, Transcriptional and epigenetic regulation of human microRNAs, Cancer Lett. 331 (2013) 1e10. G. Mao, Y. Liu, X. Fang, Y. Liu, L. Fang, L. Lin, X. Liu, N. Wang, Tumor-derived microRNA-494 promotes angiogenesis in non-small cell lung cancer, Angiogenesis 18 (2015) 373e382. K. Danza, S. De Summa, R. Pinto, B. Pilato, O. Palumbo, G. Merla, G. Simone, S. Tommasi, MiR-578 and miR-573 as potential players in BRCA-related breast cancer angiogenesis, Oncotarget 6 (2015) 471e483. G.T. Liu, Y.L. Huang, H.E. Tzeng, C.H. Tsai, S.W. Wang, C.H. Tang, CCL5 promotes vascular endothelial growth factor expression and induces angiogenesis by down-regulating miR-199a in human chondrosarcoma cells, Cancer Lett. 357 (2015) 476e487. D. Yang, Y. Sun, L. Hu, H. Zheng, P. Ji, C.V. Pecot, Y. Zhao, S. Reynolds, H. Cheng, R. Rupaimoole, D. Cogdell, M. Nykter, R. Broaddus, C. Rodriguez-Aguayo, G. Lopez-Berestein, J. Liu, I. Shmulevich, A.K. Sood, K. Chen, W. Zhang, Integrated analyses identify a master microRNA regulatory network for the mesenchymal subtype in serous ovarian cancer, Cancer Cell 23 (2013) 186e199. A. Kanitz, J. Imig, P.J. Dziunycz, A. Primorac, A. Galgano, G.F. Hofbauer, A.P. Gerber, M. Detmar, The expression levels of microRNA-361-5p and its target VEGFA are inversely correlated in human cutaneous squamous cell carcinoma, PLoS One 7 (2012) e49568. X. Wu, X. Xi, Q. Yan, Z. Zhang, B. Cai, W. Lu, X. Wan, MicroRNA-361-5p facilitates cervical cancer progression through mediation of epithelial-tomesenchymal transition, Med. Oncol. 30 (2013) 751. D. Liu, T. Tao, B. Xu, S. Chen, C. Liu, L. Zhang, K. Lu, Y. Huang, L. Jiang, X. Zhang, X. Huang, L. Zhang, C. Han, M. Chen, MiR-361-5p acts as a tumor suppressor in prostate cancer by targeting signal transducer and activator of transcription6(STAT6), Biochem. Biophys. Res. Commun. 445 (2014) 151e156. F. Ma, H. Song, B. Guo, Y. Zhang, Y. Zheng, C. Lin, Y. Wu, G. Guan, R. Sha, Q. Zhou, D. Wang, X. Zhou, J. Li, X. Qiu, MiR-361-5p inhibits colorectal and gastric cancer growth and metastasis by targeting staphylococcal nuclease domain containing-1, Oncotarget 6 (2015) 17404e17416. J.J. Sun, G.Y. Chen, Z.T. Xie, MicroRNA-361-5p inhibits cancer cell growth by targeting CXCR6 in hepatocellular carcinoma, Cell Physiol. Biochem. 38 (2016) 777e785. C. Zhan, L. Yan, L. Wang, W. Jiang, Y. Zhang, J. Xi, L. Chen, Y. Jin, Y. Qiao, Y. Shi, Q. Wang, Identification of reference miRNAs in human tumors by TCGA miRNA-seq data, Biochem. Biophys. Res. Commun. 453 (2014) 375e378. Z.L. Zhuang, F.M. Tian, C.L. Sun, Downregulation of miR-361-5p associates with aggressive clinicopathological features and unfavorable prognosis in non-small cell lung cancer, Eur. Rev. Med. Pharmacol. Sci. 20 (2016) 5132e5136. S.L. Wood, M. Pernemalm, P.A. Crosbie, A.D. Whetton, The role of the tumormicroenvironment in lung cancer-metastasis and its relationship to potential therapeutic targets, Cancer Treat. Rev. 40 (2014) 558e566. S.H. How, T.H. Ng, Y.C. Kuan, A.R. Jamalludin, A.R. Fauzi, Survival of lung cancer patients in a resource-limited country, Asia Pac. J. Clin. Oncol. 11 (2015) 221e227. C. Roth, I. Stuckrath, K. Pantel, J.R. Izbicki, M. Tachezy, H. Schwarzenbach, Low levels of cell-free circulating miR-361-3p and miR-625* as blood-based markers for discriminating malignant from benign lung tumors, PLoS One 7 (2012) e38248. W. Chen, J. Wang, S. Liu, S. Wang, Y. Cheng, W. Zhou, C. Duan, C. Zhang, MicroRNA-361-3p suppresses tumor cell proliferation and metastasis by directly targeting SH2B1 in NSCLC, J. Exp. Clin. Cancer Res. 35 (2016) 76. S. Yang, Y. Zhang, X. Zhao, J. Wang, J. Shang, microRNA-361 targets Wilms' tumor 1 to inhibit the growth, migration and invasion of non-small-cell lung cancer cells, Mol. Med. Rep. 14 (2016) 5415e5421. X.W. Hou, X. Sun, Y. Yu, H.M. Zhao, Z.J. Yang, X. Wang, X.C. Cao, miR-361e5p suppresses lung cancer cell lines progression by targeting FOXM1, Neoplasma 64 (2017).
Please cite this article in press as: S. Zhang, et al., MiR-361 targets Yes-associated protein (YAP) mRNA to suppress cell proliferation in lung cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.08.072
