Oral Oncology 51 (2015) 674–682
Contents lists available at ScienceDirect
Oral Oncology journal homepage: www.elsevier.com/locate/oraloncology
miR-433 inhibits oral squamous cell carcinoma (OSCC) cell growth and metastasis by targeting HDAC6 Xiao-chun Wang, Ying Ma, Pei-song Meng, Jia-long Han, Hai-yan Yu, Liang-jia Bi ⇑ Department of Stomatology, The Fourth College, Harbin Medical University, China
a r t i c l e
i n f o
Article history: Received 25 December 2014 Received in revised form 4 March 2015 Accepted 15 April 2015 Available online 8 May 2015 Keywords: Oral squamous cell carcinoma (OSCC) miR-433 HDAC6 SAS HSC2
s u m m a r y Objectives: The aim of this study was to determine expression levels of miR-433 in oral squamous cell carcinomas (OSCCs) and adjacent normal tissues, and explore its biological functions in OSCCs. Methods: miR-433 level in oral squamous cell carcinomas (OSCCs) and adjacent normal tissues was tested by real-time qPCR. The effect of miR-433 on cell growth was detected by MTT and colony formation assays. The tumorigenicity of miR-433 transfected OSCCs was evaluated in nude mice model. Transwell and wound healing assays were performed to detect the effect of miR-433 on OSCCs cell invasion and migration. Luciferase reporter gene assays were performed to identify the interaction between miR-433 and 30 UTR of HDAC6 mRNA. The protein level of HDAC6, BCL2, CCNE1, MMP1 and MMP9 was determined by Western blotting. Immunohistochemistry analysis was performed to detect the expression of HDAC6 in oral squamous cell carcinomas (OSCCs) and adjacent normal tissues. Results: We found that miR-433 was frequently down-regulated in OSCCs compared with adjacent normal tissues. Restoring miR-433 expression in OSCC cells dramatically suppressed cells growth, invasion and migration. Importantly, our data showed that miR-433 downregulated the expression of HDAC6 through directly targeting its 30 UTR. Conclusion: Our data suggest that miR-433 exerts its tumor suppressor function by targeting HDAC6, leading to the inhibition of OSCC cell growth, invasion and migration, which suggest that miR-433 may be potential target for diagnostic and therapeutic applications in OSCC. Ó 2015 Elsevier Ltd. All rights reserved.
Introduction Oral squamous cell carcinoma (OSCC), the most common head and neck neoplasm, affects 300,000 individuals per year worldwide [1,2]. Local tumor recurrence affects approximately 60% of patients and metastasis develops in 15–25% [3]. The primary treatment for management of OSCC is surgical intervention. Despite considerable advances in the treatment of OSCC over the past two decades, the overall 5-year survival rate of patients has only modestly been improved [4–6], reflecting limited advances in our understanding of the pathogenesis of this disease. Molecular alterations in a number of oncogenes and tumor suppressor genes associated with the development of OSCC may be significant clues with which to address these problems [7,8]. Thus, a better prevention and management of this disease is likely to greatly benefit from the identification and understanding of the molecular mechanism of OSCC pathogenesis [9,10]. ⇑ Corresponding author at: No. 37 Yiyuan Street, Nangang District, Harbin, Heilongjiang Province 150001, China. Tel./fax: +86 0451 82576566. E-mail address: [email protected] (L.-j. Bi). http://dx.doi.org/10.1016/j.oraloncology.2015.04.010 1368-8375/Ó 2015 Elsevier Ltd. All rights reserved.
MicroRNAs (miRNAs) are a class of small non-coding RNAs, which play an important role in regulating gene function through targeting mRNAs for translational repression or degradation [11]. Abnormalities of miRNA have been implicated in the pathogenesis of a variety of human diseases, notably neoplasms [12–14]. Overexpression of oncogenic miRNAs or underexpression of tumor suppressor miRNAs plays a critical role in tumorigenesis [15,16]. miR-433 is encoded by the miR-433-127 locus [17], localized on chromosome 14q32, a region that is often involved in several types of translocations in hematological malignancies and deleted by loss of heterozygosity (LOH) in solid tumors [17]. It has been reported that miR-433 was down-regulated in gastric carcinoma [18,19], hepatocellular carcinoma [20], and involved in osteoblastic differentiation [21] as well as hematopoietic cell differentiation [22]. To date, a cohort of genes related to different cancer pathways has been identified and validated as targeted genes of miR-433, such as GATA3 [23], CREB1 [24], KRAS [19], Azin1 [25], GBP2 [22], Nr3c1 [26]. However, the role of miR-433 in human oral carcinogenesis remains largely unknown. In the present study, miR-433 expression was evaluated by qRT-PCR in 5 OSCC-derived cell lines and 16 OSCC tissues, which
675
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
showed that miR-433 was downregulated in OSCC-derived cell lines and tissues. Our data further demonstrated that miR-433 suppressed OSCC cell growth, invasion and migration through targeting HDAC6, and the expression of HDAC6 was inversely correlated with the expression miR-433 in 25 OSCC tissues.
Materials and methods Patient characteristics
Cell transfection Transfection of cells was performed using Oligofectamine (Invitrogen, Carlsbad, CA) according to the manufacturer0 s protocol. Briefly, cells were seeded in 6-well plates at 30–40% confluence 24 h prior to transfection. miR-433 mimics and miRNA control (30 nM each, GenePharma Inc., Shanghai, China) were used for each transfection. MTT and colony formation assays
A total of 25 patients with OSCC were included in the present study (Table 1). Surgical resection of primary tumors and adjacent normal tissues from all patients was performed at the first affiliated hospital of Harbin Medical University, China, between July 2008 and September 2013. The obtained tissues were frozen immediately in liquid nitrogen and stored at 80 °C for detection of miR-433 or HDAC6. Written informed consent was obtained from all patients and the study was approved by the ethics committees of the first affiliated hospital of Harbin Medical University. Informed consent was obtained from each patient prior to surgical resection.
Cell culture The 5 human OSCC-derived cell lines used in this study were SAS, Ca9-22, KON, HSC2, and HSC4 (Human Science Research Resources Bank, Osaka, Japan). SAS was from male tongue, Ca9-22 from male gingiva, KON from male oral floor, HSC2 from male mouth and HSC4 from male tongue. The cell lines were maintained at 37 °C (humidified atmosphere 5% CO2/95% air) in 150 200 mm tissue culture dishes (Nunc, Roskilde, Denmark) and cultured in Dulbecco0 s modified Eagle0 s medium F-12 HAM (Sigma, St. Louis, MO, USA) with 10% fetal bovine serum (Sigma) plus 50 U/ml penicillin and streptomycin. Two normal oral keratinocyte (NOK1 and NOK2) strains were obtained from two patients who had undergone dental surgery served as the controls, and the patients provided written informed consent prior to the start of the study.
MTT assay was performed daily over a 3-d time course to evaluate cell proliferation. Cell culture was added with 10 lL of 5 mg/mL MTT agent (Sigma, Saint Louis, MO) and incubated for 4 h, followed by addition of 150 lL of DMSO and further 15-min incubation. The plates were then read on a microplate reader using a test wavelength of 570 nm and a reference wavelength of 670 nm. For colony formation assay, cells (5 105 cells per well) were seeded in 6-well plates and transfected with miR-433 mimics or miRNA control for 24 h. The medium was refreshed every 3 days. Surviving colonies (P50 cells per colony) were fixed with methanol, stained with 1.25% crystal violet and counted under a light microscope. After 2 weeks of culture, colonies were photographed and counted under a light microscope. Cell invasion assay Cell invasion assays were performed using Transwell chambers (8.0 lm pore size; Millipore, MA), which were coated with Matrigel (4 dilution; 60 lL/well; BD Bioscience, NJ), in 24-well plates. Chambers were precoated with rat tail tendon collagen type 1 (0.5 mg/mL) on the lower surface. Transfected cells were starved overnight and then seeded in the upper chamber at a density of 2 105 cells/mL in 400 lL of medium containing 0.5% FBS. Medium with 10% FBS (600 lL) was added to the lower chamber. Following a 24 h-incubation at 37 °C with 5% CO2, non-invading cells in the upper chamber were removed with a cotton swab, and invading cells were fixed in 100% methanol and stained with 0.5% crystal violet in 2% ethanol. Photographs were taken randomly
Table 1 Clinical characteristics of OSCC patients. Sample No.
Sex
Age
Site
Pathological staging
Differentiation
Early recurrence
Perineural invasion
Smoking
Heavy alcohol consumption
OSCC-1 OSCC-2 OSCC-3 OSCC-4 OSCC-5 OSCC-6 OSCC-7 OSCC-8 OSCC-9 OSCC-10 OSCC-11 OSCC-12 OSCC-13 OSCC-14 OSCC-15 OSCC-16 OSCC-17 OSCC-18 OSCC-19 OSCC-20 OSCC-21 OSCC-22 OSCC-23 OSCC-24 OSCC-25
M F F F M F F M F M M M M F M M F M M F F M M F M
62 72 52 63 64 66 52 67 72 46 43 65 58 64 73 65 70 37 79 68 66 60 67 52 48
Buccal Alveolus Palate Tongue Alveolus Tongue Alveolus Tongue Tongue Tongue FOM Tongue Retromolar Alveolus FOM Retromolar Tongue FOM Tongue Alveolus Buccal Alveolus FOM Retromolar FOM
T1NxMx T2NxMx T2NxMx T2NxMx T1NxMx T2NxMx T1NxMx T2NxMx T2NxMx T2NxMx T1NxMx T2NxMx T1NxMx T2NxMx T1NxMx T2NxMx T2NxMx T2NxMx T2NxMx T3NxMx T2NxMx T3NxMx T2NxMx T2NxMx T3NxMx
Moderate Moderate Moderate Poor Well/moderate Moderate Poor/moderate Poor Moderate Well/moderate Moderate Poor/moderate Well Poor Well/moderate Poor/moderate Moderate Well Well Moderate Moderate Poor Moderate Well Moderate
No No No No No No No No Yes No No No No No No No No No No No No Yes No No No
No No No No No No No No No No No No No No No No No No No No No No No No No
Smoker None None None Smoker None Smoker Smoker Smoker Smoker None Smoker None Smoker Smoker Smoker Smoker Smoker None Smoker Smoker Smoker Smoker Smoker Smoker
No No No Yes No No No No No Yes No No Yes No No Yes No No Yes Yes No Yes Yes No No
676
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
for at least four fields of each membrane. The number of invading cells was expressed as the average number of cells per microscopic field over four fields. Wound assay to assess cell migration Cells were transfected for 24 h and then isolated and plated in twelve-well plates (3 105/well) for 24 h. When the cells reached 90% confluence, sterile pipette tip was used to scratch the wound uniformly. Cell motility was assessed by measuring the movement of cells into a scraped wound. The speed of wound closure was monitored after 72 h by measuring the distance of the wound from 0 h. Each experiment was conducted in triplicate. RNA extraction and reverse transcription quantitative real-time PCR (RT-qPCR)
old) were randomly divided into two groups. SAS cells stably transfected with pre-miR-433 mimics and pre-miR-Control were inoculated bilaterally and subcutaneously into the flanks of nude mice. Bidimensional tumor measurements were taken with vernier calipers every seven days, and the mice were euthanized after four weeks. The volume of the implanted tumor was calculated using the formula: volume = (width2 length)/2. Statistical analysis All the experiments were similarly done at least three times. All statistical analyses were performed using the SPSS statistical package (11.5, Chicago, IL, USA). P < 0.05 was considered to be statistically significant. Unless indicated, the results shown in the figures are representatives. Results
Total RNA with miRNA was isolated from tissues or cultured cells using TRIzol (Takara Inc., Dalian, P.R. China) according to the protocols supplied by the manufacturers. The RNA concentration and purity were determined spectrophotometrically using the NanoDrop ND-1000 (NanoDrop Technologies, DE). Briefly, cDNAs were generated from total RNA using gene-specific primers using the PrimeScriptÒ RT reagent Kit (Takara Co., Ltd, Dalian, China) in a 20 lL final reaction volume containing 500 ng of RNA, 0.5 lL PrimeScriptÒ RT Enzyme Mix, 4 lL 5 PrimeScriptÒ Buffer, and 1 lL RT primer. Realtime quantitative PCR assay was performed to evaluate miR-433 expression using the SYBR Premix Ex TaqTM II (Takara Co., Ltd, Dalian, China) on an ABI 7300 Real-Time PCR System (Applied Biosystems) according to the instructions of manufacturer. According to the 2DDCt method [18], miR-433 expression was normalized to small nuclear RNA (snRNA) U6 to calculate the relative amount of RNA present in each sample. Each sample was run in triplicate. The primer sequences were presented as follows:
miR-433 is downregulated in OSCCs To identify the role of miR-433 in oral carcinogenesis, the relative expression of miR-433 in 5 human OSCC-derived cell lines (SAS, Ca9-22, KON, HSC2, and HSC4) and 2 normal oral keratinocyte strains (NOK1 and NOK2) was detected using qRT-PCR. As shown in Fig. 1A, the expression of miR-433 in the 5 OSCC-derived cell lines was significantly down-regulated compared with NOK1 cells, whereas the expression of which between NOK1 and NOK2 cells had no significant difference. Furthermore, we analyzed the expression levels of miR-433 in a cohort of OSCCs and adjacent normal tissues by qRT-PCR. As shown in Fig. 1, miR-433 expression was generally decreased in OSCCs compared with adjacent normal tissues. These observations suggest that miR-433 may be an oncosuppressor in this cancer.
miR-433 RT primer: GTCGTATCCAGTGCAGGGTCCGAGGTGCAC TGGATAC GACGAATAATG Forward primer: TGCGGTACGGTGAGCCTGTC Reverse primer: CCAGTGCAGGGTCCGAGGT Western blot analysis The transfected cells were washed twice with cold PBS and total cellular protein was extracted using a modified RIPA buffer with 0.5% sodium dodecyl sulfate (SDS) in the presence of proteinase inhibitor cocktail (Complete mini, Roche). The protein concentration was then determined by a protein assay kit (Bio-Rad) and equal amounts of protein lysates were separated on SDS–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA, USA). The membranes were blocked with 5% non-fat milk, followed by incubation with antibodies against BCL2, CCNE1, MMP1, MMP9, HDAC6, GAPDH (the antibodies were all from Abcam). As a secondary antibody, horseradish peroxidase (HRP) conjugated secondary antibody was used, then visualized with enhanced chemiluminescence (ECL) reagents (Amersham Pharmacia) according to the manufacturer0 s protocol. b-actin was used as an internal control. Tumorigenicity in vivo The lentiviral vector that overexpresses pre-miR-433 and the control lentiviral packaging plasmid was purchased from Genechem (Genechem, Shanghai, China). A total of sixteen nude mice (BALB/c nude mice, Vital- river, Nanjing, China; 4 weeks
Fig. 1. miR-433 expression in OSCC tissues and cells. (A) qRT-PCR was performed to detect the expression of miR-433 in 5 human OSCC-derived cell lines (SAS, Ca9-22, KON, HSC2, and HSC4) and 2 normal oral keratinocyte strains (NOK1 and NOK2); (B) Expression of miR-433 in OSCC tissues and adjacent normal tissue samples was detected by qRT-PCR. (⁄p < 0.05).
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
MiR-433 inhibits OSCC cell growth To detect the effect of miR-433 on OSCC cell growth, miR-433 mimics were used to transfect human OSCC cell lines SAS and
677
HSC2. Increased expression of miR-433 upon transfection was confirmed by qRT-PCR (Fig. 2A). As demonstrated by MTT assays, miR-433 restoration dramatically inhibited OSCC cell proliferation (Fig. 2B). The inhibitory effect of miR-433 on OSCC cell growth was
Fig. 2. Influences of miR-433 overexpression on OSCC cells growth. (A) miR-433 mimics were transfected in SAS and HSC2 cells and qRT-PCR was used to detect its expression; (B) MTT assay of SAS and HSC2 cells transfected with miR-433 mimics to investigate the effect of miR-433 on cell growth; (C) Colony formation assay of SAS and HSC2 cells transfected with miR-433 mimics to investigate the effect of miR-433 on the cell long-term proliferation; (D) Western blot was used to detect the BCL2 and CCNE1 protein when cells transfected with miR-433 mimics in SAS and HSC2 cells; (E) In vivo experiment showed that tumor volume and weight remarkably decreased after miR433 mimics administration compared to the control group. (⁄p < 0.05).
678
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
further confirmed by colony formation assays. Compared to cells transfected with mimics control, the number of colonies was significantly decreased in cells transfected with miR-433 mimics (Fig. 2C). Then cell cycle promoting protein CCNE1 and anti-apoptosis protein BCL2 were analyzed. Western blot confirmed that miR-433 decreased the protein expression of CCNE1 and BCL2 (Fig. 2D). Furthermore, in vivo study verified that in mice overexpression of miR-433 mimics, the tumor volume and weight were decreased significantly. Taken together, miR-433 exhibits the growth inhibitory ability in SAS and HSC2 cells and acts as a potential tumor suppressor. miR-433 inhibits OSCC cell invasion and migration As OSCC is a type of highly malignant tumor with a potent capacity to invade locally and distant metastasis, we next attempted to explore the effect of miR-433 restoration on OSCC cell invasion and migration. As shown in Fig. 3A, the transwell invasion assays showed that the number of cells that passed through Matrigel-coated membrane into the lower chamber was significantly reduced in the miR-433-transfected cells compared with the mimics control-transfected cells. Furthermore, we used wound healing assay to detect the function of miR-433 on cell migration. As shown in Fig. 3B, the open wound was significantly reduced in miR-433-transfected SAS and HSC2 cells compared with mimics control transfected cells. Since MMP1 and MMP9 play a vital role to facilitate the invasion and migration of OSCC cells, Western blot was performed to detect the two proteins expression. As shown in Fig. 3C, the expression of MMP1 and MMP9 was significantly reduced in miR-433-transfected SAS and HSC2 cells compared with
mimics control transfected cells. These results suggest that miR-433 can inhibit the invasion and migration potential of OSCC cells. miR-433 directly targets HDAC6 We then investigated the potential mechanism of the miR-433 on OSCC cells growth, invasion and migration. Based on the bioinfomatic analysis by three computational algorithms, TargetScan, miRDB and miRanda, HDAC6, was predicted as a potential target of miR-433. Then the effect of miR-433 on the expression of HDAC6 protein was evaluated in SAS and HSC2 cells transfected with miR-433 mimics. Compared with the control group, transfection with miR-433 mimics leads to a marked reduction of HDAC6 expression compared with mimics control transfected cells (Fig. 4B). Furthermore, a 30 UTR luciferase reporter assay was used to verify whether miR-433 can directly target HDAC6. As shown in Fig. 4C, miR-433 mimics dramatically suppressed the luciferase activity of the wild-type HDAC6 30 -UTR, whereas the profound inhibition was abolished when the seed sequences of the miR-433 target sequences were mutated in the HDAC6 30 -UTR vector. These results provide evidence that miR-433 inhibits HDAC6 protein expression through directly targeting the 30 UTR of HDAC6. HDAC6 is inversely correlated with miR-433 expression To further identify the expression of HDAC6 in oral carcinogenesis, the relative expression of HDAC6 in OSCC tissues was analyzed. Immunohistochemistry assay confirmed that the expression of HDAC6 was significantly upregulated in OSCC tissues (Fig. 5A). The
Fig. 3. (A) The effect of miR-433 mimics transfection on the invasion of SAS and HSC2 cells detected by transwell assay; (B) Wound healing assay was used to evaluate the effect of miR-433 mimics transfection on SAS and HSC2 cells migration capacity. (C) Western blot was used to measure the MMP1 and MMP9 protein levels 48 h after SAS and HSC2 cells transfecting by miR-433 mimics. GAPDH was used as loading/transfer controls and for normalization of values. (⁄p < 0.05).
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
679
Fig. 4. HDAC6 is a direct target of miR-433. (A) The complementary sequences of the miR-335 binding site in c-Met 30 UTR and the mutated form of HDAC6 30 UTR; (B) The protein level of HDAC6 was detected using Western blot when the SAS and HSC2 cells were transfected with miR-433 mimics, GAPDH served as an internal control; (C) The effect of miR-335 on luciferase intensity controlled by the wild type or mutant 30 UTR of HDAC6 was determined by luciferase assay. (⁄p < 0.05).
Fig. 5. The expression of HDAC6 was inversely correlated with miR-433 expression. (A) Immunohistochemistry assay was performed to detect the expression of HDAC6 in OSCC and adjacent normal tissues; (B) qRT-PCR was performed to detect the expression of miR-433 in 5 human OSCC-derived cell lines (SAS, Ca9-22, KON, HSC2, and HSC4) and 2 normal oral keratinocyte strains (NOK1 and NOK2); (C) The expression of HDAC6 was inversely correlated with miR-433 expression in 25 OSCC tissues. (⁄p < 0.05).
expression of miR-433 in the 5 OSCC-derived cell lines (SAS, Ca9-22, KON, HSC2, and HSC4) was significantly upregulated compared with NOK1 cells, whereas the expression of which between NOK1 and
NOK2 cells had no significant difference (Fig. 5B). Furthermore, we confirmed that the expression of HDAC6 was inversely correlated with miR-433 expression in 25 OSCC tissues (Fig. 5C).
680
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
Overexpression of HDAC6 can rescue miR-433 induced OSCC cells growth inhibition
Overexpression of HDAC6 can rescue miR-433 induced OSCC cells invasion and migration inhibition
To explore whether miR-433-induced OSCC cells growth inhibition was mediated by HDAC6, an overexpression plasmid of HDAC6 was co-transfected in miR-433 transfected SAS or HSC2 cells. As shown in Fig. 6A, the expression of miR-433 was not affected by the overexpression of HDAC6. Western blot analysis confirmed that transfection of HDAC6/pcMV6.0 rescued miR-433 induced HDAC6 reduction (Fig. 6B). As shown in Fig. 5C and D, MTT and colony formation assays showed that the inhibition effect in cell growth caused by miR-433 was partly abrogated by the overexpression of HDAC6. These results suggested that miR-433-induced OSCC cell growth inhibition was mediated by down-regulation of HDAC6.
To demonstrate that miR-433 induced OSCC cells invasion and migration were relevant with its downstream targets of HDAC6, we transfected HDAC6 into miR-433-transfected SAS and HSC2 cells. As shown in Fig. 7A, transfection of HDAC6/pcMV6.0 was sufficient to rescue the miR-433 induced invasion inhibition with transwell assay. Then wound healing analysis confirmed that restoration of HDAC6 rescued miR-433 mimics induced cell migration inhibition (Fig. 7B). These data demonstrate that the HDAC6 functions downstream of miR-433 to modulate OSCC cells invasion and migration.
Fig. 6. HDAC6 mediated miR-433-induced OSCC cells growth inhibition. (A) The expression of miR-433 was detected by qRT-PCR analysis in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection; (B) The expression of HDAC6 was detected by Western blot analysis in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection. (C) MTT assay was performed in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection; (D) Colony formation assay was performed in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection. (⁄p < 0.05).
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
681
Fig. 7. HDAC6 mediated miR-433-induced OSCC cells invasion and migration inhibition. (A) Transwell assay was performed in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection; (B) Wound healing assay was performed in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection. (⁄p < 0.05).
Discussion Recently, the study of miRNAs has demonstrated that they can play critical roles in the regulation of cell proliferation, invasion and migration, and that miRNA dysregulation is causally involved in the initiation and progression of cancer [12–14]. However, to the best of our knowledge no previous reports have identified the miR-433 involvement in oral carcinogenesis. In the present study, we attempt to investigate miR-433 expression in OSCCs and adjacent normal tissues, and explore its biological function in oral carcinogenesis. Our data show that compared with adjacent normal tissues, miR-433 expression in OSCCs is significantly downregulated. Furthermore, the relative expression of miR-433 in 5 human OSCC-derived cell lines (SAS, Ca9-22, KON, HSC2, and HSC4) was significantly down-regulated compared with NOK1 cells, suggesting that miR-433 is a candidate tumor suppressor in the pathogenesis of OSCC. Further studies are required to clarify the function of miR-433 in the development and progression of OSCC cells. We thus test the putative tumor suppressor function of miR-433 in OSCC cell lines, SAS and HSC2. miR-433 restoration in SAS and HSC2 cells shows significant growth-suppressing effect by inhibiting cell proliferation and colony formation. Cyclin E1 (CCNE1) belongs to the cyclin family which, through association with cyclin-dependent kinase 2, controls the progression of the cell cycle by driving cells from the G1 to the S phase. Previous studies have shown that CCNE1 is aberrantly expressed and may function as an oncogene in many types of human cancers, including OSCC [14,27]. Bcl-2 is a critical anti-apoptosis molecule, which has been shown to have inhibitory effects on the cell apoptosis [28]. In this study, we
showed that miR-433 repressed the cell cycle promoting protein CCNE1 and anti-apoptosis protein BCL2. Furthermore, in vivo study confirmed that the tumor volume and weight were decreased significantly in the mice with miR-433 overexpression. Notably, we find that miR-433 inhibits OSCC cell invasion and migration in the present study. Previously we observed that the MMP1 and MMP9 are up-regulated in OSCC, both of which belong to the MMP family and are responsible for the degradation of extracellular matrix components to promote cell metastasis [29–31]. Our study verified that miR-433 significantly suppressed the protein expression of MMP1 and MMP9. These data suggest that miR-433 exhibits the growth, invasion and migration inhibitory ability in SAS and HSC2 cells and acts as a potential tumor suppressor in OSCC pathogenesis. Although the evidences have highlighted the importance of miR-433 as an oncosuppressor in OSCCs, the precise molecular mechanisms remain largely unclear. To better understand the tumor suppressive effect of miR-433 in oral tumorigenesis, bioinformatics analysis was used and identified HDAC6 as a potential target of miR-433. With the 30 UTR luciferase reporter assay, HDAC6 was identified as the direct target of miR-1228. The increase in miR-433 expression is accompanied by down-regulation of HDAC6 expression. HDAC6 is a subtype of the HDAC family that deacetylates a-tubulin and increases cell proliferation and motility. HDAC6 mRNA and protein expression were commonly up-regulated in OSCC cell lines compared with the NOKs. High frequencies of HDAC6 up-regulation were evident in both mRNA and protein levels of primary tumors [32], which were generally inversely correlated with the expression of miR-433 in the present study. To
682
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
further investigate the relationship of HDAC6 in miR-43 3-mediated inhibition of cell growth, invasion and migration, HDAC6 was overexpressed together with miR-433 in SAS and HSC2 cells. We observed that overexpression of HDAC6 could rescue miR-433 induced HDAC6 downregulation. Furthermore, miR-433 induced cell growth, invasion and migration inhibition were reversed by the restoration of HDAC6. In summary, our data show that miR-433 is significantly downregulated in OSCCs compared with adjacent normal tissues. To our knowledge, the present study is the first to demonstrate that miR-433 inhibits OSCC cell growth, invasion and migration by targeting HDAC6. As this unique feature of miR-433 as a tumor suppressor in OSCC, miR-433 may thus prove to be a potential biomarker for OSCC diagnosis and serves as a new target for OSCC therapy. Conflict of interest statement None declared. Acknowledgment This work was supported by Science Foundation of Heilongjiang Province, China (No. H201427). References [1] Tang H, Wu Z, Zhang J, Su B. Salivary lncRNA as a potential marker for oral squamous cell carcinoma diagnosis. Mol Med Rep 2013;7:761–6. [2] Perno Goldie M. Oral and oropharyngeal cancer. Int J Dental Hygiene 2007;5:247–8. [3] Genden EM, Ferlito A, Bradley PJ, Rinaldo A, Scully C. Neck disease and distant metastases. Oral Oncol 2003;39:207–12. [4] Scully C, Bagan JV. Recent advances in oral oncology 2008; squamous cell carcinoma imaging, treatment, prognostication and treatment outcomes. Oral Oncol 2009;45:e25–30. [5] de Araujo Jr RF, Barboza CA, Clebis NK, de Moura SA, Lopes Costa Ade L. Prognostic significance of the anatomical location and TNM clinical classification in oral squamous cell carcinoma. Medicina oral, patologia oral y cirugia bucal 2008;13:E344–7. [6] Scully C, Bagan J. Oral squamous cell carcinoma overview. Oral Oncol 2009;45:301–8. [7] Choi S, Myers JN. Molecular pathogenesis of oral squamous cell carcinoma: implications for therapy. J Dent Res 2008;87:14–32. [8] Pitiyage G, Tilakaratne WM, Tavassoli M, Warnakulasuriya S. Molecular markers in oral epithelial dysplasia: review. J oral Pathol Med: Official Publication Int Assoc Oral Pathol Am Acad Oral Pathol 2009;38:737–52. [9] Hsu DS, Chang SY, Liu CJ, Tzeng CH, Wu KJ, Kao JY, et al. Identification of increased NBS1 expression as a prognostic marker of squamous cell carcinoma of the oral cavity. Cancer Sci 2010;101:1029–37.
[10] Sabichi AL, Demierre MF, Hawk ET, Lerman CE, Lippman SM. Frontiers in cancer prevention research. Cancer Res 2003;63:5649–55. [11] Wu BH, Xiong XP, Jia J, Zhang WF. MicroRNAs: new actors in the oral cancer scene. Oral Oncol 2011;47:314–9. [12] Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer 2006;6:857–66. [13] Esquela-Kerscher A, Slack FJ. Oncomirs – microRNAs with a role in cancer. Nat Rev Cancer 2006;6:259–69. [14] Kent OA, Mendell JT. A small piece in the cancer puzzle: microRNAs as tumor suppressors and oncogenes. Oncogene 2006;25:6188–96. [15] Huang J, Zhang SY, Gao YM, Liu YF, Liu YB, Zhao ZG, et al. MicroRNAs as oncogenes or tumour suppressors in oesophageal cancer: potential biomarkers and therapeutic targets. Cell Prolif 2014;47:277–86. [16] Melo SA, Kalluri R. Molecular pathways: microRNAs as cancer therapeutics. Clin Cancer Res: Official J Am Assoc Cancer Res 2012;18:4234–9. [17] Song G, Wang L. A conserved gene structure and expression regulation of miR433 and miR-127 in mammals. PLoS ONE 2009;4:e7829. [18] Yang O, Huang J, Lin S. Regulatory effects of miRNA on gastric cancer cells. Oncol Lett 2014;8:651–6. [19] Guo LH, Li H, Wang F, Yu J, He JS. The tumor suppressor roles of miR-433 and miR-127 in gastric cancer. Int J Mol Sci 2013;14:14171–84. [20] Wang W, Zhao LJ, Tan YX, Ren H, Qi ZT. Identification of deregulated miRNAs and their targets in hepatitis B virus-associated hepatocellular carcinoma. World J Gastroenterol: WJG 2012;18:5442–53. [21] Kim EJ, Kang IH, Lee JW, Jang WG, Koh JT. MiR-433 mediates ERRgammasuppressed osteoblast differentiation via direct targeting to Runx2 mRNA in C3H10T1/2 cells. Life Sci 2013;92:562–8. [22] Lin X, Rice KL, Buzzai M, Hexner E, Costa FF, Kilpivaara O, et al. MiR-433 is aberrantly expressed in myeloproliferative neoplasms and suppresses hematopoietic cell growth and differentiation. Leukemia 2013;27:344–52. [23] Li D, Ji L, Liu L, Liu Y, Hou H, Yu K, et al. Characterization of circulating MicroRNA Expression in patients with a ventricular septal defect. PLoS ONE 2014;9:e106318. [24] Yang Z, Tsuchiya H, Zhang Y, Hartnett ME, Wang L. MicroRNA-433 inhibits liver cancer cell migration by repressing the protein expression and function of cAMP response element-binding protein. J Biol Chem 2013;288:28893–9. [25] Li R, Chung AC, Dong Y, Yang W, Zhong X, Lan HY. The microRNA miR-433 promotes renal fibrosis by amplifying the TGF-beta/Smad3-Azin1 pathway. Kidney Int 2013;84:1129–44. [26] Riester A, Issler O, Spyroglou A, Rodrig SH, Chen A, Beuschlein F. ACTHdependent regulation of microRNA as endogenous modulators of glucocorticoid receptor expression in the adrenal gland. Endocrinology 2012;153:212–22. [27] Freier K, Knoepfle K, Flechtenmacher C, Pungs S, Devens F, Toedt G, et al. Recurrent copy number gain of transcription factor SOX2 and corresponding high protein expression in oral squamous cell carcinoma. Genes Chromosom Cancer 2010;49:9–16. [28] Xiong S, Mu T, Wang G, Jiang X. Mitochondria-mediated apoptosis in mammals. Protein Cell 2014. [29] Ko WC, Sugahara K, Sakuma T, Yen CY, Liu SY, Liaw GA, et al. Copy number changes of CRISP3 in oral squamous cell carcinoma. Oncol Lett 2012;3:75–81. [30] Brinckerhoff CE, Matrisian LM. Matrix metalloproteinases: a tail of a frog that became a prince. Nat Rev Mol Cell Biol 2002;3:207–14. [31] Ala-aho R, Kahari VM. Collagenases in cancer. Biochimie 2005;87:273–86. [32] Sakuma T, Uzawa K, Onda T, Shiiba M, Yokoe H, Shibahara T, et al. Aberrant expression of histone deacetylase 6 in oral squamous cell carcinoma. Int J Oncol 2006;29:117–24.
Contents lists available at ScienceDirect
Oral Oncology journal homepage: www.elsevier.com/locate/oraloncology
miR-433 inhibits oral squamous cell carcinoma (OSCC) cell growth and metastasis by targeting HDAC6 Xiao-chun Wang, Ying Ma, Pei-song Meng, Jia-long Han, Hai-yan Yu, Liang-jia Bi ⇑ Department of Stomatology, The Fourth College, Harbin Medical University, China
a r t i c l e
i n f o
Article history: Received 25 December 2014 Received in revised form 4 March 2015 Accepted 15 April 2015 Available online 8 May 2015 Keywords: Oral squamous cell carcinoma (OSCC) miR-433 HDAC6 SAS HSC2
s u m m a r y Objectives: The aim of this study was to determine expression levels of miR-433 in oral squamous cell carcinomas (OSCCs) and adjacent normal tissues, and explore its biological functions in OSCCs. Methods: miR-433 level in oral squamous cell carcinomas (OSCCs) and adjacent normal tissues was tested by real-time qPCR. The effect of miR-433 on cell growth was detected by MTT and colony formation assays. The tumorigenicity of miR-433 transfected OSCCs was evaluated in nude mice model. Transwell and wound healing assays were performed to detect the effect of miR-433 on OSCCs cell invasion and migration. Luciferase reporter gene assays were performed to identify the interaction between miR-433 and 30 UTR of HDAC6 mRNA. The protein level of HDAC6, BCL2, CCNE1, MMP1 and MMP9 was determined by Western blotting. Immunohistochemistry analysis was performed to detect the expression of HDAC6 in oral squamous cell carcinomas (OSCCs) and adjacent normal tissues. Results: We found that miR-433 was frequently down-regulated in OSCCs compared with adjacent normal tissues. Restoring miR-433 expression in OSCC cells dramatically suppressed cells growth, invasion and migration. Importantly, our data showed that miR-433 downregulated the expression of HDAC6 through directly targeting its 30 UTR. Conclusion: Our data suggest that miR-433 exerts its tumor suppressor function by targeting HDAC6, leading to the inhibition of OSCC cell growth, invasion and migration, which suggest that miR-433 may be potential target for diagnostic and therapeutic applications in OSCC. Ó 2015 Elsevier Ltd. All rights reserved.
Introduction Oral squamous cell carcinoma (OSCC), the most common head and neck neoplasm, affects 300,000 individuals per year worldwide [1,2]. Local tumor recurrence affects approximately 60% of patients and metastasis develops in 15–25% [3]. The primary treatment for management of OSCC is surgical intervention. Despite considerable advances in the treatment of OSCC over the past two decades, the overall 5-year survival rate of patients has only modestly been improved [4–6], reflecting limited advances in our understanding of the pathogenesis of this disease. Molecular alterations in a number of oncogenes and tumor suppressor genes associated with the development of OSCC may be significant clues with which to address these problems [7,8]. Thus, a better prevention and management of this disease is likely to greatly benefit from the identification and understanding of the molecular mechanism of OSCC pathogenesis [9,10]. ⇑ Corresponding author at: No. 37 Yiyuan Street, Nangang District, Harbin, Heilongjiang Province 150001, China. Tel./fax: +86 0451 82576566. E-mail address: [email protected] (L.-j. Bi). http://dx.doi.org/10.1016/j.oraloncology.2015.04.010 1368-8375/Ó 2015 Elsevier Ltd. All rights reserved.
MicroRNAs (miRNAs) are a class of small non-coding RNAs, which play an important role in regulating gene function through targeting mRNAs for translational repression or degradation [11]. Abnormalities of miRNA have been implicated in the pathogenesis of a variety of human diseases, notably neoplasms [12–14]. Overexpression of oncogenic miRNAs or underexpression of tumor suppressor miRNAs plays a critical role in tumorigenesis [15,16]. miR-433 is encoded by the miR-433-127 locus [17], localized on chromosome 14q32, a region that is often involved in several types of translocations in hematological malignancies and deleted by loss of heterozygosity (LOH) in solid tumors [17]. It has been reported that miR-433 was down-regulated in gastric carcinoma [18,19], hepatocellular carcinoma [20], and involved in osteoblastic differentiation [21] as well as hematopoietic cell differentiation [22]. To date, a cohort of genes related to different cancer pathways has been identified and validated as targeted genes of miR-433, such as GATA3 [23], CREB1 [24], KRAS [19], Azin1 [25], GBP2 [22], Nr3c1 [26]. However, the role of miR-433 in human oral carcinogenesis remains largely unknown. In the present study, miR-433 expression was evaluated by qRT-PCR in 5 OSCC-derived cell lines and 16 OSCC tissues, which
675
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
showed that miR-433 was downregulated in OSCC-derived cell lines and tissues. Our data further demonstrated that miR-433 suppressed OSCC cell growth, invasion and migration through targeting HDAC6, and the expression of HDAC6 was inversely correlated with the expression miR-433 in 25 OSCC tissues.
Materials and methods Patient characteristics
Cell transfection Transfection of cells was performed using Oligofectamine (Invitrogen, Carlsbad, CA) according to the manufacturer0 s protocol. Briefly, cells were seeded in 6-well plates at 30–40% confluence 24 h prior to transfection. miR-433 mimics and miRNA control (30 nM each, GenePharma Inc., Shanghai, China) were used for each transfection. MTT and colony formation assays
A total of 25 patients with OSCC were included in the present study (Table 1). Surgical resection of primary tumors and adjacent normal tissues from all patients was performed at the first affiliated hospital of Harbin Medical University, China, between July 2008 and September 2013. The obtained tissues were frozen immediately in liquid nitrogen and stored at 80 °C for detection of miR-433 or HDAC6. Written informed consent was obtained from all patients and the study was approved by the ethics committees of the first affiliated hospital of Harbin Medical University. Informed consent was obtained from each patient prior to surgical resection.
Cell culture The 5 human OSCC-derived cell lines used in this study were SAS, Ca9-22, KON, HSC2, and HSC4 (Human Science Research Resources Bank, Osaka, Japan). SAS was from male tongue, Ca9-22 from male gingiva, KON from male oral floor, HSC2 from male mouth and HSC4 from male tongue. The cell lines were maintained at 37 °C (humidified atmosphere 5% CO2/95% air) in 150 200 mm tissue culture dishes (Nunc, Roskilde, Denmark) and cultured in Dulbecco0 s modified Eagle0 s medium F-12 HAM (Sigma, St. Louis, MO, USA) with 10% fetal bovine serum (Sigma) plus 50 U/ml penicillin and streptomycin. Two normal oral keratinocyte (NOK1 and NOK2) strains were obtained from two patients who had undergone dental surgery served as the controls, and the patients provided written informed consent prior to the start of the study.
MTT assay was performed daily over a 3-d time course to evaluate cell proliferation. Cell culture was added with 10 lL of 5 mg/mL MTT agent (Sigma, Saint Louis, MO) and incubated for 4 h, followed by addition of 150 lL of DMSO and further 15-min incubation. The plates were then read on a microplate reader using a test wavelength of 570 nm and a reference wavelength of 670 nm. For colony formation assay, cells (5 105 cells per well) were seeded in 6-well plates and transfected with miR-433 mimics or miRNA control for 24 h. The medium was refreshed every 3 days. Surviving colonies (P50 cells per colony) were fixed with methanol, stained with 1.25% crystal violet and counted under a light microscope. After 2 weeks of culture, colonies were photographed and counted under a light microscope. Cell invasion assay Cell invasion assays were performed using Transwell chambers (8.0 lm pore size; Millipore, MA), which were coated with Matrigel (4 dilution; 60 lL/well; BD Bioscience, NJ), in 24-well plates. Chambers were precoated with rat tail tendon collagen type 1 (0.5 mg/mL) on the lower surface. Transfected cells were starved overnight and then seeded in the upper chamber at a density of 2 105 cells/mL in 400 lL of medium containing 0.5% FBS. Medium with 10% FBS (600 lL) was added to the lower chamber. Following a 24 h-incubation at 37 °C with 5% CO2, non-invading cells in the upper chamber were removed with a cotton swab, and invading cells were fixed in 100% methanol and stained with 0.5% crystal violet in 2% ethanol. Photographs were taken randomly
Table 1 Clinical characteristics of OSCC patients. Sample No.
Sex
Age
Site
Pathological staging
Differentiation
Early recurrence
Perineural invasion
Smoking
Heavy alcohol consumption
OSCC-1 OSCC-2 OSCC-3 OSCC-4 OSCC-5 OSCC-6 OSCC-7 OSCC-8 OSCC-9 OSCC-10 OSCC-11 OSCC-12 OSCC-13 OSCC-14 OSCC-15 OSCC-16 OSCC-17 OSCC-18 OSCC-19 OSCC-20 OSCC-21 OSCC-22 OSCC-23 OSCC-24 OSCC-25
M F F F M F F M F M M M M F M M F M M F F M M F M
62 72 52 63 64 66 52 67 72 46 43 65 58 64 73 65 70 37 79 68 66 60 67 52 48
Buccal Alveolus Palate Tongue Alveolus Tongue Alveolus Tongue Tongue Tongue FOM Tongue Retromolar Alveolus FOM Retromolar Tongue FOM Tongue Alveolus Buccal Alveolus FOM Retromolar FOM
T1NxMx T2NxMx T2NxMx T2NxMx T1NxMx T2NxMx T1NxMx T2NxMx T2NxMx T2NxMx T1NxMx T2NxMx T1NxMx T2NxMx T1NxMx T2NxMx T2NxMx T2NxMx T2NxMx T3NxMx T2NxMx T3NxMx T2NxMx T2NxMx T3NxMx
Moderate Moderate Moderate Poor Well/moderate Moderate Poor/moderate Poor Moderate Well/moderate Moderate Poor/moderate Well Poor Well/moderate Poor/moderate Moderate Well Well Moderate Moderate Poor Moderate Well Moderate
No No No No No No No No Yes No No No No No No No No No No No No Yes No No No
No No No No No No No No No No No No No No No No No No No No No No No No No
Smoker None None None Smoker None Smoker Smoker Smoker Smoker None Smoker None Smoker Smoker Smoker Smoker Smoker None Smoker Smoker Smoker Smoker Smoker Smoker
No No No Yes No No No No No Yes No No Yes No No Yes No No Yes Yes No Yes Yes No No
676
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
for at least four fields of each membrane. The number of invading cells was expressed as the average number of cells per microscopic field over four fields. Wound assay to assess cell migration Cells were transfected for 24 h and then isolated and plated in twelve-well plates (3 105/well) for 24 h. When the cells reached 90% confluence, sterile pipette tip was used to scratch the wound uniformly. Cell motility was assessed by measuring the movement of cells into a scraped wound. The speed of wound closure was monitored after 72 h by measuring the distance of the wound from 0 h. Each experiment was conducted in triplicate. RNA extraction and reverse transcription quantitative real-time PCR (RT-qPCR)
old) were randomly divided into two groups. SAS cells stably transfected with pre-miR-433 mimics and pre-miR-Control were inoculated bilaterally and subcutaneously into the flanks of nude mice. Bidimensional tumor measurements were taken with vernier calipers every seven days, and the mice were euthanized after four weeks. The volume of the implanted tumor was calculated using the formula: volume = (width2 length)/2. Statistical analysis All the experiments were similarly done at least three times. All statistical analyses were performed using the SPSS statistical package (11.5, Chicago, IL, USA). P < 0.05 was considered to be statistically significant. Unless indicated, the results shown in the figures are representatives. Results
Total RNA with miRNA was isolated from tissues or cultured cells using TRIzol (Takara Inc., Dalian, P.R. China) according to the protocols supplied by the manufacturers. The RNA concentration and purity were determined spectrophotometrically using the NanoDrop ND-1000 (NanoDrop Technologies, DE). Briefly, cDNAs were generated from total RNA using gene-specific primers using the PrimeScriptÒ RT reagent Kit (Takara Co., Ltd, Dalian, China) in a 20 lL final reaction volume containing 500 ng of RNA, 0.5 lL PrimeScriptÒ RT Enzyme Mix, 4 lL 5 PrimeScriptÒ Buffer, and 1 lL RT primer. Realtime quantitative PCR assay was performed to evaluate miR-433 expression using the SYBR Premix Ex TaqTM II (Takara Co., Ltd, Dalian, China) on an ABI 7300 Real-Time PCR System (Applied Biosystems) according to the instructions of manufacturer. According to the 2DDCt method [18], miR-433 expression was normalized to small nuclear RNA (snRNA) U6 to calculate the relative amount of RNA present in each sample. Each sample was run in triplicate. The primer sequences were presented as follows:
miR-433 is downregulated in OSCCs To identify the role of miR-433 in oral carcinogenesis, the relative expression of miR-433 in 5 human OSCC-derived cell lines (SAS, Ca9-22, KON, HSC2, and HSC4) and 2 normal oral keratinocyte strains (NOK1 and NOK2) was detected using qRT-PCR. As shown in Fig. 1A, the expression of miR-433 in the 5 OSCC-derived cell lines was significantly down-regulated compared with NOK1 cells, whereas the expression of which between NOK1 and NOK2 cells had no significant difference. Furthermore, we analyzed the expression levels of miR-433 in a cohort of OSCCs and adjacent normal tissues by qRT-PCR. As shown in Fig. 1, miR-433 expression was generally decreased in OSCCs compared with adjacent normal tissues. These observations suggest that miR-433 may be an oncosuppressor in this cancer.
miR-433 RT primer: GTCGTATCCAGTGCAGGGTCCGAGGTGCAC TGGATAC GACGAATAATG Forward primer: TGCGGTACGGTGAGCCTGTC Reverse primer: CCAGTGCAGGGTCCGAGGT Western blot analysis The transfected cells were washed twice with cold PBS and total cellular protein was extracted using a modified RIPA buffer with 0.5% sodium dodecyl sulfate (SDS) in the presence of proteinase inhibitor cocktail (Complete mini, Roche). The protein concentration was then determined by a protein assay kit (Bio-Rad) and equal amounts of protein lysates were separated on SDS–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA, USA). The membranes were blocked with 5% non-fat milk, followed by incubation with antibodies against BCL2, CCNE1, MMP1, MMP9, HDAC6, GAPDH (the antibodies were all from Abcam). As a secondary antibody, horseradish peroxidase (HRP) conjugated secondary antibody was used, then visualized with enhanced chemiluminescence (ECL) reagents (Amersham Pharmacia) according to the manufacturer0 s protocol. b-actin was used as an internal control. Tumorigenicity in vivo The lentiviral vector that overexpresses pre-miR-433 and the control lentiviral packaging plasmid was purchased from Genechem (Genechem, Shanghai, China). A total of sixteen nude mice (BALB/c nude mice, Vital- river, Nanjing, China; 4 weeks
Fig. 1. miR-433 expression in OSCC tissues and cells. (A) qRT-PCR was performed to detect the expression of miR-433 in 5 human OSCC-derived cell lines (SAS, Ca9-22, KON, HSC2, and HSC4) and 2 normal oral keratinocyte strains (NOK1 and NOK2); (B) Expression of miR-433 in OSCC tissues and adjacent normal tissue samples was detected by qRT-PCR. (⁄p < 0.05).
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
MiR-433 inhibits OSCC cell growth To detect the effect of miR-433 on OSCC cell growth, miR-433 mimics were used to transfect human OSCC cell lines SAS and
677
HSC2. Increased expression of miR-433 upon transfection was confirmed by qRT-PCR (Fig. 2A). As demonstrated by MTT assays, miR-433 restoration dramatically inhibited OSCC cell proliferation (Fig. 2B). The inhibitory effect of miR-433 on OSCC cell growth was
Fig. 2. Influences of miR-433 overexpression on OSCC cells growth. (A) miR-433 mimics were transfected in SAS and HSC2 cells and qRT-PCR was used to detect its expression; (B) MTT assay of SAS and HSC2 cells transfected with miR-433 mimics to investigate the effect of miR-433 on cell growth; (C) Colony formation assay of SAS and HSC2 cells transfected with miR-433 mimics to investigate the effect of miR-433 on the cell long-term proliferation; (D) Western blot was used to detect the BCL2 and CCNE1 protein when cells transfected with miR-433 mimics in SAS and HSC2 cells; (E) In vivo experiment showed that tumor volume and weight remarkably decreased after miR433 mimics administration compared to the control group. (⁄p < 0.05).
678
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
further confirmed by colony formation assays. Compared to cells transfected with mimics control, the number of colonies was significantly decreased in cells transfected with miR-433 mimics (Fig. 2C). Then cell cycle promoting protein CCNE1 and anti-apoptosis protein BCL2 were analyzed. Western blot confirmed that miR-433 decreased the protein expression of CCNE1 and BCL2 (Fig. 2D). Furthermore, in vivo study verified that in mice overexpression of miR-433 mimics, the tumor volume and weight were decreased significantly. Taken together, miR-433 exhibits the growth inhibitory ability in SAS and HSC2 cells and acts as a potential tumor suppressor. miR-433 inhibits OSCC cell invasion and migration As OSCC is a type of highly malignant tumor with a potent capacity to invade locally and distant metastasis, we next attempted to explore the effect of miR-433 restoration on OSCC cell invasion and migration. As shown in Fig. 3A, the transwell invasion assays showed that the number of cells that passed through Matrigel-coated membrane into the lower chamber was significantly reduced in the miR-433-transfected cells compared with the mimics control-transfected cells. Furthermore, we used wound healing assay to detect the function of miR-433 on cell migration. As shown in Fig. 3B, the open wound was significantly reduced in miR-433-transfected SAS and HSC2 cells compared with mimics control transfected cells. Since MMP1 and MMP9 play a vital role to facilitate the invasion and migration of OSCC cells, Western blot was performed to detect the two proteins expression. As shown in Fig. 3C, the expression of MMP1 and MMP9 was significantly reduced in miR-433-transfected SAS and HSC2 cells compared with
mimics control transfected cells. These results suggest that miR-433 can inhibit the invasion and migration potential of OSCC cells. miR-433 directly targets HDAC6 We then investigated the potential mechanism of the miR-433 on OSCC cells growth, invasion and migration. Based on the bioinfomatic analysis by three computational algorithms, TargetScan, miRDB and miRanda, HDAC6, was predicted as a potential target of miR-433. Then the effect of miR-433 on the expression of HDAC6 protein was evaluated in SAS and HSC2 cells transfected with miR-433 mimics. Compared with the control group, transfection with miR-433 mimics leads to a marked reduction of HDAC6 expression compared with mimics control transfected cells (Fig. 4B). Furthermore, a 30 UTR luciferase reporter assay was used to verify whether miR-433 can directly target HDAC6. As shown in Fig. 4C, miR-433 mimics dramatically suppressed the luciferase activity of the wild-type HDAC6 30 -UTR, whereas the profound inhibition was abolished when the seed sequences of the miR-433 target sequences were mutated in the HDAC6 30 -UTR vector. These results provide evidence that miR-433 inhibits HDAC6 protein expression through directly targeting the 30 UTR of HDAC6. HDAC6 is inversely correlated with miR-433 expression To further identify the expression of HDAC6 in oral carcinogenesis, the relative expression of HDAC6 in OSCC tissues was analyzed. Immunohistochemistry assay confirmed that the expression of HDAC6 was significantly upregulated in OSCC tissues (Fig. 5A). The
Fig. 3. (A) The effect of miR-433 mimics transfection on the invasion of SAS and HSC2 cells detected by transwell assay; (B) Wound healing assay was used to evaluate the effect of miR-433 mimics transfection on SAS and HSC2 cells migration capacity. (C) Western blot was used to measure the MMP1 and MMP9 protein levels 48 h after SAS and HSC2 cells transfecting by miR-433 mimics. GAPDH was used as loading/transfer controls and for normalization of values. (⁄p < 0.05).
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
679
Fig. 4. HDAC6 is a direct target of miR-433. (A) The complementary sequences of the miR-335 binding site in c-Met 30 UTR and the mutated form of HDAC6 30 UTR; (B) The protein level of HDAC6 was detected using Western blot when the SAS and HSC2 cells were transfected with miR-433 mimics, GAPDH served as an internal control; (C) The effect of miR-335 on luciferase intensity controlled by the wild type or mutant 30 UTR of HDAC6 was determined by luciferase assay. (⁄p < 0.05).
Fig. 5. The expression of HDAC6 was inversely correlated with miR-433 expression. (A) Immunohistochemistry assay was performed to detect the expression of HDAC6 in OSCC and adjacent normal tissues; (B) qRT-PCR was performed to detect the expression of miR-433 in 5 human OSCC-derived cell lines (SAS, Ca9-22, KON, HSC2, and HSC4) and 2 normal oral keratinocyte strains (NOK1 and NOK2); (C) The expression of HDAC6 was inversely correlated with miR-433 expression in 25 OSCC tissues. (⁄p < 0.05).
expression of miR-433 in the 5 OSCC-derived cell lines (SAS, Ca9-22, KON, HSC2, and HSC4) was significantly upregulated compared with NOK1 cells, whereas the expression of which between NOK1 and
NOK2 cells had no significant difference (Fig. 5B). Furthermore, we confirmed that the expression of HDAC6 was inversely correlated with miR-433 expression in 25 OSCC tissues (Fig. 5C).
680
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
Overexpression of HDAC6 can rescue miR-433 induced OSCC cells growth inhibition
Overexpression of HDAC6 can rescue miR-433 induced OSCC cells invasion and migration inhibition
To explore whether miR-433-induced OSCC cells growth inhibition was mediated by HDAC6, an overexpression plasmid of HDAC6 was co-transfected in miR-433 transfected SAS or HSC2 cells. As shown in Fig. 6A, the expression of miR-433 was not affected by the overexpression of HDAC6. Western blot analysis confirmed that transfection of HDAC6/pcMV6.0 rescued miR-433 induced HDAC6 reduction (Fig. 6B). As shown in Fig. 5C and D, MTT and colony formation assays showed that the inhibition effect in cell growth caused by miR-433 was partly abrogated by the overexpression of HDAC6. These results suggested that miR-433-induced OSCC cell growth inhibition was mediated by down-regulation of HDAC6.
To demonstrate that miR-433 induced OSCC cells invasion and migration were relevant with its downstream targets of HDAC6, we transfected HDAC6 into miR-433-transfected SAS and HSC2 cells. As shown in Fig. 7A, transfection of HDAC6/pcMV6.0 was sufficient to rescue the miR-433 induced invasion inhibition with transwell assay. Then wound healing analysis confirmed that restoration of HDAC6 rescued miR-433 mimics induced cell migration inhibition (Fig. 7B). These data demonstrate that the HDAC6 functions downstream of miR-433 to modulate OSCC cells invasion and migration.
Fig. 6. HDAC6 mediated miR-433-induced OSCC cells growth inhibition. (A) The expression of miR-433 was detected by qRT-PCR analysis in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection; (B) The expression of HDAC6 was detected by Western blot analysis in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection. (C) MTT assay was performed in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection; (D) Colony formation assay was performed in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection. (⁄p < 0.05).
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
681
Fig. 7. HDAC6 mediated miR-433-induced OSCC cells invasion and migration inhibition. (A) Transwell assay was performed in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection; (B) Wound healing assay was performed in miR-433 transfected SAS and HSC2 cells with or without HDAC6 cotransfection. (⁄p < 0.05).
Discussion Recently, the study of miRNAs has demonstrated that they can play critical roles in the regulation of cell proliferation, invasion and migration, and that miRNA dysregulation is causally involved in the initiation and progression of cancer [12–14]. However, to the best of our knowledge no previous reports have identified the miR-433 involvement in oral carcinogenesis. In the present study, we attempt to investigate miR-433 expression in OSCCs and adjacent normal tissues, and explore its biological function in oral carcinogenesis. Our data show that compared with adjacent normal tissues, miR-433 expression in OSCCs is significantly downregulated. Furthermore, the relative expression of miR-433 in 5 human OSCC-derived cell lines (SAS, Ca9-22, KON, HSC2, and HSC4) was significantly down-regulated compared with NOK1 cells, suggesting that miR-433 is a candidate tumor suppressor in the pathogenesis of OSCC. Further studies are required to clarify the function of miR-433 in the development and progression of OSCC cells. We thus test the putative tumor suppressor function of miR-433 in OSCC cell lines, SAS and HSC2. miR-433 restoration in SAS and HSC2 cells shows significant growth-suppressing effect by inhibiting cell proliferation and colony formation. Cyclin E1 (CCNE1) belongs to the cyclin family which, through association with cyclin-dependent kinase 2, controls the progression of the cell cycle by driving cells from the G1 to the S phase. Previous studies have shown that CCNE1 is aberrantly expressed and may function as an oncogene in many types of human cancers, including OSCC [14,27]. Bcl-2 is a critical anti-apoptosis molecule, which has been shown to have inhibitory effects on the cell apoptosis [28]. In this study, we
showed that miR-433 repressed the cell cycle promoting protein CCNE1 and anti-apoptosis protein BCL2. Furthermore, in vivo study confirmed that the tumor volume and weight were decreased significantly in the mice with miR-433 overexpression. Notably, we find that miR-433 inhibits OSCC cell invasion and migration in the present study. Previously we observed that the MMP1 and MMP9 are up-regulated in OSCC, both of which belong to the MMP family and are responsible for the degradation of extracellular matrix components to promote cell metastasis [29–31]. Our study verified that miR-433 significantly suppressed the protein expression of MMP1 and MMP9. These data suggest that miR-433 exhibits the growth, invasion and migration inhibitory ability in SAS and HSC2 cells and acts as a potential tumor suppressor in OSCC pathogenesis. Although the evidences have highlighted the importance of miR-433 as an oncosuppressor in OSCCs, the precise molecular mechanisms remain largely unclear. To better understand the tumor suppressive effect of miR-433 in oral tumorigenesis, bioinformatics analysis was used and identified HDAC6 as a potential target of miR-433. With the 30 UTR luciferase reporter assay, HDAC6 was identified as the direct target of miR-1228. The increase in miR-433 expression is accompanied by down-regulation of HDAC6 expression. HDAC6 is a subtype of the HDAC family that deacetylates a-tubulin and increases cell proliferation and motility. HDAC6 mRNA and protein expression were commonly up-regulated in OSCC cell lines compared with the NOKs. High frequencies of HDAC6 up-regulation were evident in both mRNA and protein levels of primary tumors [32], which were generally inversely correlated with the expression of miR-433 in the present study. To
682
X.-c. Wang et al. / Oral Oncology 51 (2015) 674–682
further investigate the relationship of HDAC6 in miR-43 3-mediated inhibition of cell growth, invasion and migration, HDAC6 was overexpressed together with miR-433 in SAS and HSC2 cells. We observed that overexpression of HDAC6 could rescue miR-433 induced HDAC6 downregulation. Furthermore, miR-433 induced cell growth, invasion and migration inhibition were reversed by the restoration of HDAC6. In summary, our data show that miR-433 is significantly downregulated in OSCCs compared with adjacent normal tissues. To our knowledge, the present study is the first to demonstrate that miR-433 inhibits OSCC cell growth, invasion and migration by targeting HDAC6. As this unique feature of miR-433 as a tumor suppressor in OSCC, miR-433 may thus prove to be a potential biomarker for OSCC diagnosis and serves as a new target for OSCC therapy. Conflict of interest statement None declared. Acknowledgment This work was supported by Science Foundation of Heilongjiang Province, China (No. H201427). References [1] Tang H, Wu Z, Zhang J, Su B. Salivary lncRNA as a potential marker for oral squamous cell carcinoma diagnosis. Mol Med Rep 2013;7:761–6. [2] Perno Goldie M. Oral and oropharyngeal cancer. Int J Dental Hygiene 2007;5:247–8. [3] Genden EM, Ferlito A, Bradley PJ, Rinaldo A, Scully C. Neck disease and distant metastases. Oral Oncol 2003;39:207–12. [4] Scully C, Bagan JV. Recent advances in oral oncology 2008; squamous cell carcinoma imaging, treatment, prognostication and treatment outcomes. Oral Oncol 2009;45:e25–30. [5] de Araujo Jr RF, Barboza CA, Clebis NK, de Moura SA, Lopes Costa Ade L. Prognostic significance of the anatomical location and TNM clinical classification in oral squamous cell carcinoma. Medicina oral, patologia oral y cirugia bucal 2008;13:E344–7. [6] Scully C, Bagan J. Oral squamous cell carcinoma overview. Oral Oncol 2009;45:301–8. [7] Choi S, Myers JN. Molecular pathogenesis of oral squamous cell carcinoma: implications for therapy. J Dent Res 2008;87:14–32. [8] Pitiyage G, Tilakaratne WM, Tavassoli M, Warnakulasuriya S. Molecular markers in oral epithelial dysplasia: review. J oral Pathol Med: Official Publication Int Assoc Oral Pathol Am Acad Oral Pathol 2009;38:737–52. [9] Hsu DS, Chang SY, Liu CJ, Tzeng CH, Wu KJ, Kao JY, et al. Identification of increased NBS1 expression as a prognostic marker of squamous cell carcinoma of the oral cavity. Cancer Sci 2010;101:1029–37.
[10] Sabichi AL, Demierre MF, Hawk ET, Lerman CE, Lippman SM. Frontiers in cancer prevention research. Cancer Res 2003;63:5649–55. [11] Wu BH, Xiong XP, Jia J, Zhang WF. MicroRNAs: new actors in the oral cancer scene. Oral Oncol 2011;47:314–9. [12] Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer 2006;6:857–66. [13] Esquela-Kerscher A, Slack FJ. Oncomirs – microRNAs with a role in cancer. Nat Rev Cancer 2006;6:259–69. [14] Kent OA, Mendell JT. A small piece in the cancer puzzle: microRNAs as tumor suppressors and oncogenes. Oncogene 2006;25:6188–96. [15] Huang J, Zhang SY, Gao YM, Liu YF, Liu YB, Zhao ZG, et al. MicroRNAs as oncogenes or tumour suppressors in oesophageal cancer: potential biomarkers and therapeutic targets. Cell Prolif 2014;47:277–86. [16] Melo SA, Kalluri R. Molecular pathways: microRNAs as cancer therapeutics. Clin Cancer Res: Official J Am Assoc Cancer Res 2012;18:4234–9. [17] Song G, Wang L. A conserved gene structure and expression regulation of miR433 and miR-127 in mammals. PLoS ONE 2009;4:e7829. [18] Yang O, Huang J, Lin S. Regulatory effects of miRNA on gastric cancer cells. Oncol Lett 2014;8:651–6. [19] Guo LH, Li H, Wang F, Yu J, He JS. The tumor suppressor roles of miR-433 and miR-127 in gastric cancer. Int J Mol Sci 2013;14:14171–84. [20] Wang W, Zhao LJ, Tan YX, Ren H, Qi ZT. Identification of deregulated miRNAs and their targets in hepatitis B virus-associated hepatocellular carcinoma. World J Gastroenterol: WJG 2012;18:5442–53. [21] Kim EJ, Kang IH, Lee JW, Jang WG, Koh JT. MiR-433 mediates ERRgammasuppressed osteoblast differentiation via direct targeting to Runx2 mRNA in C3H10T1/2 cells. Life Sci 2013;92:562–8. [22] Lin X, Rice KL, Buzzai M, Hexner E, Costa FF, Kilpivaara O, et al. MiR-433 is aberrantly expressed in myeloproliferative neoplasms and suppresses hematopoietic cell growth and differentiation. Leukemia 2013;27:344–52. [23] Li D, Ji L, Liu L, Liu Y, Hou H, Yu K, et al. Characterization of circulating MicroRNA Expression in patients with a ventricular septal defect. PLoS ONE 2014;9:e106318. [24] Yang Z, Tsuchiya H, Zhang Y, Hartnett ME, Wang L. MicroRNA-433 inhibits liver cancer cell migration by repressing the protein expression and function of cAMP response element-binding protein. J Biol Chem 2013;288:28893–9. [25] Li R, Chung AC, Dong Y, Yang W, Zhong X, Lan HY. The microRNA miR-433 promotes renal fibrosis by amplifying the TGF-beta/Smad3-Azin1 pathway. Kidney Int 2013;84:1129–44. [26] Riester A, Issler O, Spyroglou A, Rodrig SH, Chen A, Beuschlein F. ACTHdependent regulation of microRNA as endogenous modulators of glucocorticoid receptor expression in the adrenal gland. Endocrinology 2012;153:212–22. [27] Freier K, Knoepfle K, Flechtenmacher C, Pungs S, Devens F, Toedt G, et al. Recurrent copy number gain of transcription factor SOX2 and corresponding high protein expression in oral squamous cell carcinoma. Genes Chromosom Cancer 2010;49:9–16. [28] Xiong S, Mu T, Wang G, Jiang X. Mitochondria-mediated apoptosis in mammals. Protein Cell 2014. [29] Ko WC, Sugahara K, Sakuma T, Yen CY, Liu SY, Liaw GA, et al. Copy number changes of CRISP3 in oral squamous cell carcinoma. Oncol Lett 2012;3:75–81. [30] Brinckerhoff CE, Matrisian LM. Matrix metalloproteinases: a tail of a frog that became a prince. Nat Rev Mol Cell Biol 2002;3:207–14. [31] Ala-aho R, Kahari VM. Collagenases in cancer. Biochimie 2005;87:273–86. [32] Sakuma T, Uzawa K, Onda T, Shiiba M, Yokoe H, Shibahara T, et al. Aberrant expression of histone deacetylase 6 in oral squamous cell carcinoma. Int J Oncol 2006;29:117–24.
