Biochemical and Biophysical Research Communications xxx (2015) 1e6
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1 Bingshou Li*, Lin Liu, Xiaoming Li, Lingtong Wu Department of Surgery, Shandong Provincial Hospital, 4 Duanxingxi Road, Jinan 250022, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 June 2015 Accepted 30 June 2015 Available online xxx
Accumulating evidence indicates that microRNAs function as oncogenes or tumor suppressor genes in human cancer. MiR-503 is deregulated in various human cancers and has been associated with hepatocellular carcinoma (HCC) progression. However, the underlying mechanisms of miR-503 involvement in the development and progression of HCC remains poorly understood. In the present study, we report that miR-503 suppresses cell metastasis in HCC through targeting the protein arginine methyl transferase 1 (PRMT1) mRNA. Notably, we identified that miR-503 was able to target 30 -untranslated region (30 -UTR) of PRMT1 mRNA by luciferase reporter gene assays. Then, we revealed that miR-503 was able to reduce the expression of PRMT1 at the levels of mRNA and protein using RT-PCR and Western blotting analysis. The expression levels of miR-503 were negatively related to those of PRMT1 mRNA in clinical HCC tissues. In terms of function, transwell and wound healing assays demonstrated that the miR-503 remarkably inhibited invasion and migration of HCC cells, which was reversed by overexpressed PRMT1. Furthermore, exogenous expression of miR-503 dramatically suppressed epithelial emesenchymal transition (EMT) via PRMT1 in HCC cells. In conclusion, we denomstrated PRMT1 as a novel target gene of miR-503 and miR-503-mediated PRMT1 could also emerge as a potential important biomarker for HCC. © 2015 Published by Elsevier Inc.
Keywords: miR-503 PRMT1 HCC EMT
1. Introduction Hepatocellular carcinoma (HCC) is one of the most common human malignancies and the third most common cause of cancerrelated mortality worldwide [1,2]. Despite improvements of diagnosis and treatment strategies of HCC, the prognosis of advanced HCC remains poor due to recurrence, early invasion into blood vessels, and intra-hepatic metastases followed by subsequent extra-hepatic metastases [3]. Thus, it is urgent to elucidate the underlying molecular mechanisms of HCC and find new molecular targets for treatment of this disease. MicroRNA (miRNA), an abundant group of endogenous noncoding single strand RNAs with approximately 19e25 nucleotides, regulates the expression of genes at post-transcriptional level by translational repression or degradation of target mRNA. In this manner, miRNAs involve in variety of cellular processes including including cell proliferation, apoptosis, invasion, migration, differentiation and so on [4e7]. Emerging evidence reveals that miRNAs
* Corresponding author. E-mail address: [email protected] (B. Li).
may serve as a novel class of oncogenes or tumor suppressor genes and involve in cancer progression as a result of changes in expression of their target genes in various cancers such as breast cancer, pancreatic cancer, lung cancer, nasopharyngeal carcinoma and Hepatocellular carcinoma [8e13]. It has been reported that miR-503 is downregulated in several tumor types including non-small cell lung cancer [14], oral cancer [15], gastric cancer [16], glioblastoma [17]. In these tumors miR-503 functions as tumor suppressor by repressing oncogene expression. For example, miR-503 acts as a tumor suppressor in osteosarcoma by targeting L1CAM [18]. MicroRNA-503 suppresses proliferation and cell-cycle progression of endometrioid endometrial cancer by negatively regulating cyclin D1 [19]. miR-503 acts as a tumor suppressor in glioblastoma for multiple antitumor effects by targeting IGF-1R [17]. Recently, miR-503 was reported to be downregulated in HCC and involve HCC progression [20]. Xiao et al. revealed that miR-503 suppressed the proliferation of HCC cells by induction of G1 phase arrest through Rb-E2F signaling pathways [20]. Zhou et al. revealed that miRNA-503 inhibits HCC angiogenesis and growth by targeting FGF2 and VEGFA. However, the role of miR-503 on metastasis of HCC remains poorly understood.
http://dx.doi.org/10.1016/j.bbrc.2015.06.169 0006-291X/© 2015 Published by Elsevier Inc.
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
2
B. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e6
In this study, we investigated the role of miR-503 downregulation on metastasis of HCC. We show that PRMT1 function as a novel target gene of miR-503, and miR-503-mediated PRMT1 involve invasion and migration cells through regulating EMT in HCC. Our finding provides fascinating insights into the mechanisms of HCC carcinogenesis mediated by miR-503.
USA). Then, the protein samples were separated by SDS-PAGE (10%) and detected by Western blot using polyclonal (rabbit) anti-PRMT1, anti E-cadherin, anti-N-cadherin and anti-Vimentin antibody (Santa Cruz Bio-technology, Santa Cruz, CA, USA). Goat anti-rabbit IgG (Pierce, Rockford, IL, USA) secondary antibody conjugated to horseradish peroxidase and ECL detection systems (SuperSignal West Femto, Pierce) were used for detection.
2. Materials and methods 2.6. Invasion assay 2.1. Human tissue specimens Twenty clinical HCC tissues and their corresponding noncancerous liver tissues used in this study were obtained from Shandong Provincial Hospital (Shandong, China) after surgical resection. Informed consents were obtained from each patient to approve the use of their tissues for research purposes. The study protocol was approved by the Institute Research Ethics Committee at Shandong University.
The capability of cell invasion was examined by transwell invasion assay. Cells were cultivated to 80% confluence on the 12-well plates. Then, we observed the procedures of cellular growth at 24 h. All the experiments were repeated in triplicate. The transwell migration chambers were used to evaluate cell invasion. Then cells invasing cells across the membrane were counted under a light microscope. 2.7. Wound healing assay
2.2. Cell culture and transfection Human HCC cell line HepG2 was cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (HyClone, Logan, Utah, USA) and 1% penicillin/ streptomycin and incubated in a humidified (37 C, 5% CO2) incubator. The miR-503 mimics, miR-503 inhibitors, negative control molecules, pcDNA-PRMT1 and PRMT1 siRNA were purchased from Dharmacon (Austin, TX, USA). Cell transfection was performed using DharmFECT1 (Dharmacon) until a final concentration of 20 nM. Medium was changed after 6 h. After transfected and cultured for 48 h, cells were collected for Western blot and qRT-PCR analyses. 2.3. Luciferase reporter gene assays The 30 -UTR of PRMT1 containing the putative binding site of miR-503 was amplified and subcloned into pGL3 luciferase promoter vector (Promega, Madison, WI, USA). The vector was cotransfected with miR-503 mimics into HepG2 cells for 48 h. The cells were harvested and relative luciferase activity was detected using a dual-luciferase reporter assay kit (Promega) according to the manufacturer's instructions. All experiments were performed at least three times. 2.4. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from tissues and cell lines using the miRNeasy Mini Kit (Qiagen). The miRNA Q-PCR Detection Kit (GeneCopoeia) was used for quantification of miRNA levels according to the manufacturer's protocol. For quantification of PRMT1 mRNA levels, the RT reactions were conducted with the RevertAid TM H Minus First Strand cDNA Synthesis Kit (Fermentas). qRT-PCR was performed using an ABI 7900 System (Bio-Rad). RNU6B and bactin were used as normalizing controls for miRNA and mRNA quantification, respectively. The 2DDCt method was employed to calculate the relative expression levels. The primers were as follows: miR-503, forward primer: 50 e CCTATTTCCCATGATTCCTTCATA -30 and reverse primer: 50 e GTAATACGGTTATCCACGCG -30 ; hPRMT1, forward primer: 50 e CCTeTCACCTCCCCGTTCTG -30 and reverse primer: 50 e CCAGGGCGTGCACGTAGT -30 . 2.5. Western blotting analysis Whole cell extracts were prepared with a cell lysis reagent (SigmaeAldrich, St. Louis, MO, USA) according to the manual, and then, the protein was quantified by a BCA assay (Pierce, Rockford, IL,
For the wound healing assay, cells were seeded in 12-well plates and grown to 90% confluence. Monolayers in the center of the wells were scraped with pipette tips and washed with PBS. Cell movement into the wound area was monitored and photographed at 0 and 24 h using a light microscope. The migration distance between the leading edge of the migrating cells and the edge of the wound was compared as previous work [21]. 2.8. Statistical analysis Each experiment was repeated at least three times. Data were shown as mean ± s.d and analyzed using SPSS 19.0. Statistical comparisons between groups were analyzed using Student's t-test and a two-tailed p < 0.05 was considered to indicate statistical significance. 3. Results 3.1. miR-503 directly targets PRMT1 in HCC cells PRMT1 expression was shown to be up-regulated in cancers and important for cancer cell proliferation and invasion [22,23]. However, the role and mechanism of PRMT1 in HCC progression and metastasis remains understood. In this study, the miRNA target prediction websites www.microRNA.org and TargetScan were used and identified a conserved miR-503-binding site in the 30 -UTR of PRMT1 mRNA. We then cloned WT or Mut target region sequence of the PRMT1 30 -UTR, which was inserted into a luciferase reporter vector (Fig. 1A). Subsequently, these reporter vectors were cotransfected with miR-503 mimics and mimics control (mimics_con) into the HCC cell line. As shown in Fig. 1A, co-transfection of miR-503 mimics suppressed the luciferase activity of the reporter containing wild-type PRMT1 30 UTR sequence, but failed to inhibit that of mutated PRMT1 by dual-luciferase reporter assay. These data indicate that PRMT1 is one of the direct targets of miR-503 in HCC. To further investigate the effect of miR-503 on PRMT1, we transfected miR-503 mimics (miR-503 mimics group), miR-503 inhibitors (miR-503 inhibitors group), PRMT1 siRNA (PRMT1 siRNA group), pcDNA-PRMT1 (PRMT1 group) or cotransfected miR503 mimics and pcDNA-PRMT1 (miR-503 þ PRMT1 group) into HCC cells. As shown in Fig. 1B, miR-503 mimics markedly increased the expression of miR-503, and miR-503 inhibitors markedly increased the expression of miR-503 expression. Exogenous miR503 was able to decrease the expression of PRMT1 both at mRNA and protein levels in HCCs (Fig. 1C and D). Conversely, the
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
B. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e6
3
Fig. 1. miR-503 directly targeted PRMT1. A, Sequence alignment of miR-503 and 30 UTR of PRMT1 using mirco-RNA.org. Luciferase reporter assay with co-transfection of wild-type or mutant PRMT1 and miR-503 mimics or miRecontrol in HepG2 cells. Error bars represent ±S.E. and *, p < 0.01 versus negative control (NC). B, qRT-PCR analysis revealed the effects of miR-503 mimics (miR-503 mimics group), miR-503 inhibitors (miR-503 inhibitors group), PRMT1 siRNA (PRMT1 siRNA group), pcDNA-PRMT1 (PRMT1 group) or cotransfected miR-503 mimics and pcDNA-PRMT1 (miR-503 þ PRMT1 group) on the expression level of miR-503. C, qRT-PCR analysis and D, Western blot analysis revealed the effects of miR-503 mimics, miR-503 inhibitors, PRMT1 siRNA, pcDNA-PRMT1 or cotransfected miR-503 mimics and pcDNA-PRMT1 on the expression level of PRMT1. Error bars represent ±S.E. and *, p < 0.01 versus negative control (NC).
expression of PRMT1 was elevated in HCC cells when endogenous miR-503 was inhibited by miR-503 inhibitors (Fig. 1C and D), supporting that miR-503 can regulate PRMT1 expression in vitro. In
addition, PRMT1 did not affect miR-503 expression (Fig. 1B). These results demonstrated that PRMT1 is a direct target of miR-503 in HCC cells.
Fig. 2. miR-503 is negatively associated with PRMT1 in clinical HCC tissues. (A) PRMT1 mRNA levels was examined by qRT-PCR in 20 cases of clinical HCC tissues and paired nontumorous tissues. (B) Correlation of miR-503 levels with PRMT1 mRNA levels was examined by qRT-PCR in 20 cases of clinical HCC tissues (Pearson's correlation coefficient, r ¼ 0.6377). Statistically significant differences are indicated: *P < 0.01 versus paired non-tumorous tissues.
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
4
B. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e6
3.2. miR-503 is negatively associated with PRMT1 in clinical HCC tissues Next, we analyzed the PRMT1 expression in 20 paired clinical HCC and adjacent noncancerous liver tissues using qRT-PCR and normalized against an endogenous control (U6 RNA). When compared with their noncancerous counterparts, significant upregulation of PRMT1 was observed in all the 20 HCC samples (Fig. 2A). Then we assessed the correlation between miR-503 and PRMT1. As expected, we found that the levels of miR-503 exhibited a significant negative correlation with the levels of PRMT1 mRNA (Pearson's correlation coefficient of 0.6377, p < 0.01) (Fig. 2B). Overall, our finding indicates that the levels of miR-503 are negatively associated with those of PRMT1 mRNA in clinical HCC tissues. 3.3. MiR-503 suppresses invasion and migration of HCC cells via PRMT1 It has been reported that miR-503 is implicated in HCC progression [20,24]. Therefore, we are interested in whether miR-503 inhibits invasion and migration of HCC cells through PRMT1 (Fig. 3). The transwell invasion assay manifested that cell invasion was decreased when the cells were treated with miR-503, but PRMT1 overexpression could rescue inhibition of cell invasion mediated by miR-503 in the cells treated with both miR-503 and PRMT1, suggesting that miR-503 inhibits the invasion of HCC cells relying on PRMT1 in part (Fig. 3A). Taken a further step to reinforce our conclusion, we performed wound healing assays. Our data revealed that miR-503 could remarkably reduce migration ability of HCC cells and the overexpressed PRMT1 induced migration ability of the cells transfected with miR-503 (Fig. 3B). Collectively, we concluded that miR-503 is able to suppress cell invasion and migration through targeting PRMT1 in HCC. 3.4. MiR-503 suppresses EMT of HCC cells via PRMT1 EMT has been identified as a key role in the invasion of various cancer cells by the transformation of polarized and adherent
epithelial cells into motile and invasive mesenchymal cells. Here, to explore protein regulated by miR-503 in the EMT process, we investigated the expression of three EMT related proteins, E-cadherin, N-cadherin and Vimentin by Western blot. As shown in Fig. 4, the expression of E-cadherin was increased in miR-503 mimics group compared with NC and untransfected groups, which was reversed in miR-503 þ PRMT1 group. Moreover, miR-503 could remarkably reduce the expression of N-cadherin and Vimentin, and the overexpressed PRMT1 resulted in the increase of N-cadherin and Vimentin expression in the cells transfected with miR-503. These indicated that miR-503 represses EMT by targeting PRMT1.
4. Discussion Accumulated studies revealed deregulated miRNAs in various human cancers including HCC. Identifying the miRNAs and their targets that are essential for HCC progression may provide promising therapeutic opportunities. In this study, we demonstrated PRMT1 as a direct target of miR-503 and revealed the mechanism of miR-503-mediated PRMT1 in metastasis of HCC. Protein arginine methyl transferase 1 (PRMT1) is one of the most important types of protein in PRMT family, which play a crucial role in gene transcription regulation, thereby affecting several physiological and pathological processes such as cell growth, DNA repair, signal transduction, and tumorigenesis [25e27]. Recently, PRMT1 was reported to be overexpressed in a variety of cancers, including lung cancer [25], breast cancer [28] and bladder cancer [22]. However, the role and mechanism of PRMT1 in HCC remains unclear. In this study, our data demonstrated that miR-503 was able to directly bind to the 30 UTR of PRMT1 mRNA. It is the first time to identify the miRNA which directly target PRMT1. Then, we further investigated the effect of miR-503 on PRMT1 expression in HCC cells. RT-PCR and Western blotting analysis showed that the miR-503 downregulated the expression of PRMT1 at the levels of mRNA and protein. Furthermore, HCC clinical samples validate the above conclusions that PRMT1 is upregulated in HCC tissues and high levels of PRMT1 were correlated with low levels of miR-503 in clinical HCC samples.
Fig. 3. miR-503 affects the invasion and migration of HCC cells via PRMT1. A, Transwell assays revealed the invasion ability of HepG2 cell transfected with miR-NC, miR-503 or cotransfected with miR-503 and pcDNA-PRMT1. B, In wound migration assay revealed the migration ability of HepG2 cell transfected with miR-NC, miR-503 or cotransfected with miR-503 and pcDNA-PRMT1. Data are the mean ± SD of duplicates from a representative experiment of three independent experiments. *p < 0.01 vs. NC group. **p < 0.01 vs. miR503 group.
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
B. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e6
5
Fig. 4. MiR-503 induces EMT of HCC cells by suppressing PRMT1 expression. HepG2 cells transfected with miR-NC, miR-503 or cotransfected with miR-503 and pcDNA-PRMT1. A, Western bolt analysis revealed the effects of miR-503 and PRMT1 on EMT-relative protein expression. B, The effects of miR-503 and PRMT1 on E-cadherin expression. C, The effects of miR-503 and PRMT1 on N-cadherin expression. D, The effects of miR-503 and PRMT1 on Vimentin expression. Error bars represent ±S.E. and *, p < 0.01 versus control and NC. **, p < 0.01 versus miR-503 group.
It has been reported that miR-503 is implicated in HCC progression [20,24]. In this study, our data demonstrated that miR-503 inhibits invasion and migration of HCC cells through PRMT1. The epithelialemesenchymal transition (EMT) has been associated with the acquisition of migration, invasiveness, and metastasis in cancer [29]. During EMT, the epithelial protein level, such as E-cadherin, are downregulated, while mesenchymal protein such as N-cadherin and vimentin are upregulated [30]. Recent studies showed that PRMT1 is a novel regulator of Epithelial-MesenchymalTransition in non-small cell lung cancer [31]. Silenced PRMT1 significantly inhibited lung cancer cell migration by increasing Ecadherin expression and decreasing N-cadherin expression [25]. Therefore, we are interested in whether miR-503-repressed PRMT1 involves metastasis of HCC cells through EMT. Our data indicated that overexpressed miR-503 suppressed EMT with upregulation of E-cadherin and downregulation of vimentin and N-cadherin, which was reversed by exogenous PRMT1. Taken together, we first time demonstrated that PRMT1 is upregulated in HCC tissues and is a novel target genes of miR-503. Furthermore, we demonstrated the important role of miR-503suppressed PRMT1 and subsequently disarranged EMT on HCC metastasis, providing potential therapeutic pathway in HCC therapy.
Conflicts of interest The authors declare no conflict of interest.
Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2015.06.169.
References [1] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman, Global cancer statistics, CA Cancer J. Clin. 61 (2011) 69e90. [2] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA Cancer J. Clin. 65 (2015) 87e108. [3] L.C. Harlan, H.M. Parsons, C.L. Wiggins, J.L. Stevens, Y.Z. Patt, Treatment of hepatocellular carcinoma in the community: disparities in standard therapy, Liver Cancer 4 (2015) 70e83. [4] Z. Li, H. Lei, M. Luo, Y. Wang, L. Dong, Y. Ma, C. Liu, W. Song, F. Wang, J. Zhang, J. Shen, J. Yu, DNA methylation downregulated mir-10b acts as a tumor suppressor in gastric cancer, Gastric Cancer 18 (2015) 43e54. [5] X. Xiao, C. Tang, S. Xiao, C. Fu, P. Yu, Enhancement of proliferation and invasion by MicroRNA-590-5p via targeting PBRM1 in clear cell renal carcinoma cells, Oncol. Res. 20 (2013) 537e544. [6] W.Z. Yin, F. Li, L. Zhang, X.P. Ren, N. Zhang, J.F. Wen, Down-regulation of microRNA-205 promotes gastric cancer cell proliferation, Eur. Rev. Med. Pharmacol. Sci. 18 (2014) 1027e1032. [7] X. Yang, W. Ni, K. Lei, miR-200b suppresses cell growth, migration and invasion by targeting Notch1 in nasopharyngeal carcinoma, Cell. Physiol. Biochem. 32 (2013) 1288e1298. [8] Z. Liu, C. Mai, H. Yang, Y. Zhen, X. Yu, S. Hua, Q. Wu, Q. Jiang, Y. Zhang, X. Song, W. Fang, Candidate tumour suppressor CCDC19 regulates miR-184 direct targeting of C-Myc thereby suppressing cell growth in non-small cell lung cancers, J. Cell. Mol. Med. 18 (2014) 1667e1679. [9] Q. Yang, Y. Wang, X. Lu, Z. Zhao, L. Zhu, S. Chen, Q. Wu, C. Chen, Z. Wang, MiR125b regulates epithelial-mesenchymal transition via targeting Sema4C in paclitaxel-resistant breast cancer cells, Oncotarget 6 (2015) 3268e3279. [10] B. Gong, H. Hu, J. Chen, S. Cao, J. Yu, J. Xue, F. Chen, Y. Cai, H. He, L. Zhang, Caprin-1 is a novel microRNA-223 target for regulating the proliferation and invasion of human breast cancer cells, Biomed. Pharmacother. 67 (2013) 629e636. [11] J. Wang, M. Raimondo, S. Guha, J. Chen, L. Diao, X. Dong, M.B. Wallace, A.M. Killary, M.L. Frazier, T.A. Woodward, J. Wang, S. Sen, Circulating microRNAs in pancreatic juice as candidate biomarkers of pancreatic cancer, J. Cancer 5 (2014) 696e705. [12] H.F. Duan, X.Q. Li, H.Y. Hu, Y.C. Li, Z. Cai, X.S. Mei, P. Yu, L.P. Nie, W. Zhang, Z.D. Yu, G.H. Nie, Functional elucidation of miR-494 in the tumorigenesis of nasopharyngeal carcinoma, Tumour Biol. (2015). [13] J. Lu, M.L. He, L. Wang, Y. Chen, X. Liu, Q. Dong, Y.C. Chen, Y. Peng, K.T. Yao, H.F. Kung, X.P. Li, MiR-26a inhibits cell growth and tumorigenesis of nasopharyngeal carcinoma through repression of EZH2, Cancer Res. 71 (2011) 225e233. [14] Y. Yang, L. Liu, Y. Zhang, H. Guan, J. Wu, X. Zhu, J. Yuan, M. Li, MiR-503 targets PI3K p85 and IKK-beta and suppresses progression of non-small cell lung cancer, Int. J. Cancer 135 (2014) 1531e1542.
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
6
B. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e6
[15] Y.C. Lu, Y.J. Chen, H.M. Wang, C.Y. Tsai, W.H. Chen, Y.C. Huang, K.H. Fan, C.N. Tsai, S.F. Huang, C.J. Kang, J.T. Chang, A.J. Cheng, Oncogenic function and early detection potential of miRNA-10b in oral cancer as identified by microRNA profiling, Cancer Prev. Res. (Phila) 5 (2012) 665e674. [16] Y. Peng, Y.M. Liu, L.C. Li, L.L. Wang, X.L. Wu, microRNA-503 inhibits gastric cancer cell growth and epithelial-to-mesenchymal transition, Oncol. Lett. 7 (2014) 1233e1238. [17] Y. Zhang, X. Chen, H. Lian, J. Liu, B. Zhou, S. Han, B. Peng, J. Yin, W. Liu, X. He, MicroRNA-503 acts as a tumor suppressor in glioblastoma for multiple antitumor effects by targeting IGF-1R, Oncol. Rep. 31 (2014) 1445e1452. [18] Y. Chong, J. Zhang, X. Guo, G. Li, S. Zhang, C. Li, Z. Jiao, M. Shao, MicroRNA-503 acts as a tumor suppressor in osteosarcoma by targeting L1CAM, PLoS One 9 (2014) e114585. [19] Y.Y. Xu, H.J. Wu, H.D. Ma, L.P. Xu, Y. Huo, L.R. Yin, MicroRNA-503 suppresses proliferation and cell-cycle progression of endometrioid endometrial cancer by negatively regulating cyclin D1, Febs J. 280 (2013) 3768e3779. [20] F. Xiao, W. Zhang, L. Chen, F. Chen, H. Xie, C. Xing, X. Yu, S. Ding, K. Chen, H. Guo, J. Cheng, S. Zheng, L. Zhou, MicroRNA-503 inhibits the G1/S transition by downregulating cyclin D3 and E2F3 in hepatocellular carcinoma, J. Transl. Med. 11 (2013) 195. [21] C.C. Liang, A.Y. Park, J.L. Guan, In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro, Nat. Protoc. 2 (2007) 329e333. [22] M. Yoshimatsu, G. Toyokawa, S. Hayami, M. Unoki, T. Tsunoda, H.I. Field, J.D. Kelly, D.E. Neal, Y. Maehara, B.A. Ponder, Y. Nakamura, R. Hamamoto, Dysregulation of PRMT1 and PRMT6, type I arginine methyltransferases, is involved in various types of human cancers, Int. J. Cancer 128 (2011) 562e573. [23] R.K. Bikkavilli, S. Avasarala, M. Vanscoyk, M. Sechler, N. Kelley, C.C. Malbon, R.A. Winn, Dishevelled3 is a novel arginine methyl transferase substrate, Sci. Rep. 2 (2012) 805.
[24] B. Zhou, R. Ma, W. Si, S. Li, Y. Xu, X. Tu, Q. Wang, MicroRNA-503 targets FGF2 and VEGFA and inhibits tumor angiogenesis and growth, Cancer Lett. 333 (2013) 159e169. [25] T. Zhang, G. Cui, Y.L. Yao, Y. Guo, Q.C. Wang, X.N. Li, W.M. Feng, Inhibition of nonsmall cell lung cancer cell migration by protein arginine methyltransferase 1-small hairpin RNA through inhibiting epithelial-mesenchymal transition, extracellular matrix degradation, and Src phosphorylation, Chin. Med. J. (Engl) 128 (2015) 1202e1208. [26] N. Cheung, L.C. Chan, A. Thompson, M.L. Cleary, C.W. So, Protein argininemethyltransferase-dependent oncogenesis, Nat. Cell. Biol. 9 (2007) 1208e1215. [27] T.C. Osborne, O. Obianyo, X. Zhang, X. Cheng, P.R. Thompson, Protein arginine methyltransferase 1: positively charged residues in substrate peptides distal to the site of methylation are important for substrate binding and catalysis, Biochemistry 46 (2007) 13370e13381. [28] K. Mathioudaki, A. Scorilas, A. Ardavanis, P. Lymberi, E. Tsiambas, M. Devetzi, A. Apostolaki, M. Talieri, Clinical evaluation of PRMT1 gene expression in breast cancer, Tumour Biol. 32 (2011) 575e582. [29] R. Kalluri, R.A. Weinberg, The basics of epithelial-mesenchymal transition, J. Clin. Invest 119 (2009) 1420e1428. [30] J. Yang, S.A. Mani, J.L. Donaher, S. Ramaswamy, R.A. Itzykson, C. Come, P. Savagner, I. Gitelman, A. Richardson, R.A. Weinberg, Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis, Cell 117 (2004) 927e939. [31] S. Avasarala, M. Van Scoyk, M.K. Karuppusamy Rathinam, S. Zerayesus, X. Zhao, W. Zhang, M.R. Pergande, J.A. Borgia, J. DeGregori, J.D. Port, R.A. Winn, R.K. Bikkavilli, PRMT1 Is a novel regulator of epithelial-mesenchymaltransition in non-small cell lung cancer, J. Biol. Chem. 290 (2015) 13479e13489.
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1 Bingshou Li*, Lin Liu, Xiaoming Li, Lingtong Wu Department of Surgery, Shandong Provincial Hospital, 4 Duanxingxi Road, Jinan 250022, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 June 2015 Accepted 30 June 2015 Available online xxx
Accumulating evidence indicates that microRNAs function as oncogenes or tumor suppressor genes in human cancer. MiR-503 is deregulated in various human cancers and has been associated with hepatocellular carcinoma (HCC) progression. However, the underlying mechanisms of miR-503 involvement in the development and progression of HCC remains poorly understood. In the present study, we report that miR-503 suppresses cell metastasis in HCC through targeting the protein arginine methyl transferase 1 (PRMT1) mRNA. Notably, we identified that miR-503 was able to target 30 -untranslated region (30 -UTR) of PRMT1 mRNA by luciferase reporter gene assays. Then, we revealed that miR-503 was able to reduce the expression of PRMT1 at the levels of mRNA and protein using RT-PCR and Western blotting analysis. The expression levels of miR-503 were negatively related to those of PRMT1 mRNA in clinical HCC tissues. In terms of function, transwell and wound healing assays demonstrated that the miR-503 remarkably inhibited invasion and migration of HCC cells, which was reversed by overexpressed PRMT1. Furthermore, exogenous expression of miR-503 dramatically suppressed epithelial emesenchymal transition (EMT) via PRMT1 in HCC cells. In conclusion, we denomstrated PRMT1 as a novel target gene of miR-503 and miR-503-mediated PRMT1 could also emerge as a potential important biomarker for HCC. © 2015 Published by Elsevier Inc.
Keywords: miR-503 PRMT1 HCC EMT
1. Introduction Hepatocellular carcinoma (HCC) is one of the most common human malignancies and the third most common cause of cancerrelated mortality worldwide [1,2]. Despite improvements of diagnosis and treatment strategies of HCC, the prognosis of advanced HCC remains poor due to recurrence, early invasion into blood vessels, and intra-hepatic metastases followed by subsequent extra-hepatic metastases [3]. Thus, it is urgent to elucidate the underlying molecular mechanisms of HCC and find new molecular targets for treatment of this disease. MicroRNA (miRNA), an abundant group of endogenous noncoding single strand RNAs with approximately 19e25 nucleotides, regulates the expression of genes at post-transcriptional level by translational repression or degradation of target mRNA. In this manner, miRNAs involve in variety of cellular processes including including cell proliferation, apoptosis, invasion, migration, differentiation and so on [4e7]. Emerging evidence reveals that miRNAs
* Corresponding author. E-mail address: [email protected] (B. Li).
may serve as a novel class of oncogenes or tumor suppressor genes and involve in cancer progression as a result of changes in expression of their target genes in various cancers such as breast cancer, pancreatic cancer, lung cancer, nasopharyngeal carcinoma and Hepatocellular carcinoma [8e13]. It has been reported that miR-503 is downregulated in several tumor types including non-small cell lung cancer [14], oral cancer [15], gastric cancer [16], glioblastoma [17]. In these tumors miR-503 functions as tumor suppressor by repressing oncogene expression. For example, miR-503 acts as a tumor suppressor in osteosarcoma by targeting L1CAM [18]. MicroRNA-503 suppresses proliferation and cell-cycle progression of endometrioid endometrial cancer by negatively regulating cyclin D1 [19]. miR-503 acts as a tumor suppressor in glioblastoma for multiple antitumor effects by targeting IGF-1R [17]. Recently, miR-503 was reported to be downregulated in HCC and involve HCC progression [20]. Xiao et al. revealed that miR-503 suppressed the proliferation of HCC cells by induction of G1 phase arrest through Rb-E2F signaling pathways [20]. Zhou et al. revealed that miRNA-503 inhibits HCC angiogenesis and growth by targeting FGF2 and VEGFA. However, the role of miR-503 on metastasis of HCC remains poorly understood.
http://dx.doi.org/10.1016/j.bbrc.2015.06.169 0006-291X/© 2015 Published by Elsevier Inc.
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
2
B. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e6
In this study, we investigated the role of miR-503 downregulation on metastasis of HCC. We show that PRMT1 function as a novel target gene of miR-503, and miR-503-mediated PRMT1 involve invasion and migration cells through regulating EMT in HCC. Our finding provides fascinating insights into the mechanisms of HCC carcinogenesis mediated by miR-503.
USA). Then, the protein samples were separated by SDS-PAGE (10%) and detected by Western blot using polyclonal (rabbit) anti-PRMT1, anti E-cadherin, anti-N-cadherin and anti-Vimentin antibody (Santa Cruz Bio-technology, Santa Cruz, CA, USA). Goat anti-rabbit IgG (Pierce, Rockford, IL, USA) secondary antibody conjugated to horseradish peroxidase and ECL detection systems (SuperSignal West Femto, Pierce) were used for detection.
2. Materials and methods 2.6. Invasion assay 2.1. Human tissue specimens Twenty clinical HCC tissues and their corresponding noncancerous liver tissues used in this study were obtained from Shandong Provincial Hospital (Shandong, China) after surgical resection. Informed consents were obtained from each patient to approve the use of their tissues for research purposes. The study protocol was approved by the Institute Research Ethics Committee at Shandong University.
The capability of cell invasion was examined by transwell invasion assay. Cells were cultivated to 80% confluence on the 12-well plates. Then, we observed the procedures of cellular growth at 24 h. All the experiments were repeated in triplicate. The transwell migration chambers were used to evaluate cell invasion. Then cells invasing cells across the membrane were counted under a light microscope. 2.7. Wound healing assay
2.2. Cell culture and transfection Human HCC cell line HepG2 was cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (HyClone, Logan, Utah, USA) and 1% penicillin/ streptomycin and incubated in a humidified (37 C, 5% CO2) incubator. The miR-503 mimics, miR-503 inhibitors, negative control molecules, pcDNA-PRMT1 and PRMT1 siRNA were purchased from Dharmacon (Austin, TX, USA). Cell transfection was performed using DharmFECT1 (Dharmacon) until a final concentration of 20 nM. Medium was changed after 6 h. After transfected and cultured for 48 h, cells were collected for Western blot and qRT-PCR analyses. 2.3. Luciferase reporter gene assays The 30 -UTR of PRMT1 containing the putative binding site of miR-503 was amplified and subcloned into pGL3 luciferase promoter vector (Promega, Madison, WI, USA). The vector was cotransfected with miR-503 mimics into HepG2 cells for 48 h. The cells were harvested and relative luciferase activity was detected using a dual-luciferase reporter assay kit (Promega) according to the manufacturer's instructions. All experiments were performed at least three times. 2.4. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from tissues and cell lines using the miRNeasy Mini Kit (Qiagen). The miRNA Q-PCR Detection Kit (GeneCopoeia) was used for quantification of miRNA levels according to the manufacturer's protocol. For quantification of PRMT1 mRNA levels, the RT reactions were conducted with the RevertAid TM H Minus First Strand cDNA Synthesis Kit (Fermentas). qRT-PCR was performed using an ABI 7900 System (Bio-Rad). RNU6B and bactin were used as normalizing controls for miRNA and mRNA quantification, respectively. The 2DDCt method was employed to calculate the relative expression levels. The primers were as follows: miR-503, forward primer: 50 e CCTATTTCCCATGATTCCTTCATA -30 and reverse primer: 50 e GTAATACGGTTATCCACGCG -30 ; hPRMT1, forward primer: 50 e CCTeTCACCTCCCCGTTCTG -30 and reverse primer: 50 e CCAGGGCGTGCACGTAGT -30 . 2.5. Western blotting analysis Whole cell extracts were prepared with a cell lysis reagent (SigmaeAldrich, St. Louis, MO, USA) according to the manual, and then, the protein was quantified by a BCA assay (Pierce, Rockford, IL,
For the wound healing assay, cells were seeded in 12-well plates and grown to 90% confluence. Monolayers in the center of the wells were scraped with pipette tips and washed with PBS. Cell movement into the wound area was monitored and photographed at 0 and 24 h using a light microscope. The migration distance between the leading edge of the migrating cells and the edge of the wound was compared as previous work [21]. 2.8. Statistical analysis Each experiment was repeated at least three times. Data were shown as mean ± s.d and analyzed using SPSS 19.0. Statistical comparisons between groups were analyzed using Student's t-test and a two-tailed p < 0.05 was considered to indicate statistical significance. 3. Results 3.1. miR-503 directly targets PRMT1 in HCC cells PRMT1 expression was shown to be up-regulated in cancers and important for cancer cell proliferation and invasion [22,23]. However, the role and mechanism of PRMT1 in HCC progression and metastasis remains understood. In this study, the miRNA target prediction websites www.microRNA.org and TargetScan were used and identified a conserved miR-503-binding site in the 30 -UTR of PRMT1 mRNA. We then cloned WT or Mut target region sequence of the PRMT1 30 -UTR, which was inserted into a luciferase reporter vector (Fig. 1A). Subsequently, these reporter vectors were cotransfected with miR-503 mimics and mimics control (mimics_con) into the HCC cell line. As shown in Fig. 1A, co-transfection of miR-503 mimics suppressed the luciferase activity of the reporter containing wild-type PRMT1 30 UTR sequence, but failed to inhibit that of mutated PRMT1 by dual-luciferase reporter assay. These data indicate that PRMT1 is one of the direct targets of miR-503 in HCC. To further investigate the effect of miR-503 on PRMT1, we transfected miR-503 mimics (miR-503 mimics group), miR-503 inhibitors (miR-503 inhibitors group), PRMT1 siRNA (PRMT1 siRNA group), pcDNA-PRMT1 (PRMT1 group) or cotransfected miR503 mimics and pcDNA-PRMT1 (miR-503 þ PRMT1 group) into HCC cells. As shown in Fig. 1B, miR-503 mimics markedly increased the expression of miR-503, and miR-503 inhibitors markedly increased the expression of miR-503 expression. Exogenous miR503 was able to decrease the expression of PRMT1 both at mRNA and protein levels in HCCs (Fig. 1C and D). Conversely, the
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
B. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e6
3
Fig. 1. miR-503 directly targeted PRMT1. A, Sequence alignment of miR-503 and 30 UTR of PRMT1 using mirco-RNA.org. Luciferase reporter assay with co-transfection of wild-type or mutant PRMT1 and miR-503 mimics or miRecontrol in HepG2 cells. Error bars represent ±S.E. and *, p < 0.01 versus negative control (NC). B, qRT-PCR analysis revealed the effects of miR-503 mimics (miR-503 mimics group), miR-503 inhibitors (miR-503 inhibitors group), PRMT1 siRNA (PRMT1 siRNA group), pcDNA-PRMT1 (PRMT1 group) or cotransfected miR-503 mimics and pcDNA-PRMT1 (miR-503 þ PRMT1 group) on the expression level of miR-503. C, qRT-PCR analysis and D, Western blot analysis revealed the effects of miR-503 mimics, miR-503 inhibitors, PRMT1 siRNA, pcDNA-PRMT1 or cotransfected miR-503 mimics and pcDNA-PRMT1 on the expression level of PRMT1. Error bars represent ±S.E. and *, p < 0.01 versus negative control (NC).
expression of PRMT1 was elevated in HCC cells when endogenous miR-503 was inhibited by miR-503 inhibitors (Fig. 1C and D), supporting that miR-503 can regulate PRMT1 expression in vitro. In
addition, PRMT1 did not affect miR-503 expression (Fig. 1B). These results demonstrated that PRMT1 is a direct target of miR-503 in HCC cells.
Fig. 2. miR-503 is negatively associated with PRMT1 in clinical HCC tissues. (A) PRMT1 mRNA levels was examined by qRT-PCR in 20 cases of clinical HCC tissues and paired nontumorous tissues. (B) Correlation of miR-503 levels with PRMT1 mRNA levels was examined by qRT-PCR in 20 cases of clinical HCC tissues (Pearson's correlation coefficient, r ¼ 0.6377). Statistically significant differences are indicated: *P < 0.01 versus paired non-tumorous tissues.
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
4
B. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e6
3.2. miR-503 is negatively associated with PRMT1 in clinical HCC tissues Next, we analyzed the PRMT1 expression in 20 paired clinical HCC and adjacent noncancerous liver tissues using qRT-PCR and normalized against an endogenous control (U6 RNA). When compared with their noncancerous counterparts, significant upregulation of PRMT1 was observed in all the 20 HCC samples (Fig. 2A). Then we assessed the correlation between miR-503 and PRMT1. As expected, we found that the levels of miR-503 exhibited a significant negative correlation with the levels of PRMT1 mRNA (Pearson's correlation coefficient of 0.6377, p < 0.01) (Fig. 2B). Overall, our finding indicates that the levels of miR-503 are negatively associated with those of PRMT1 mRNA in clinical HCC tissues. 3.3. MiR-503 suppresses invasion and migration of HCC cells via PRMT1 It has been reported that miR-503 is implicated in HCC progression [20,24]. Therefore, we are interested in whether miR-503 inhibits invasion and migration of HCC cells through PRMT1 (Fig. 3). The transwell invasion assay manifested that cell invasion was decreased when the cells were treated with miR-503, but PRMT1 overexpression could rescue inhibition of cell invasion mediated by miR-503 in the cells treated with both miR-503 and PRMT1, suggesting that miR-503 inhibits the invasion of HCC cells relying on PRMT1 in part (Fig. 3A). Taken a further step to reinforce our conclusion, we performed wound healing assays. Our data revealed that miR-503 could remarkably reduce migration ability of HCC cells and the overexpressed PRMT1 induced migration ability of the cells transfected with miR-503 (Fig. 3B). Collectively, we concluded that miR-503 is able to suppress cell invasion and migration through targeting PRMT1 in HCC. 3.4. MiR-503 suppresses EMT of HCC cells via PRMT1 EMT has been identified as a key role in the invasion of various cancer cells by the transformation of polarized and adherent
epithelial cells into motile and invasive mesenchymal cells. Here, to explore protein regulated by miR-503 in the EMT process, we investigated the expression of three EMT related proteins, E-cadherin, N-cadherin and Vimentin by Western blot. As shown in Fig. 4, the expression of E-cadherin was increased in miR-503 mimics group compared with NC and untransfected groups, which was reversed in miR-503 þ PRMT1 group. Moreover, miR-503 could remarkably reduce the expression of N-cadherin and Vimentin, and the overexpressed PRMT1 resulted in the increase of N-cadherin and Vimentin expression in the cells transfected with miR-503. These indicated that miR-503 represses EMT by targeting PRMT1.
4. Discussion Accumulated studies revealed deregulated miRNAs in various human cancers including HCC. Identifying the miRNAs and their targets that are essential for HCC progression may provide promising therapeutic opportunities. In this study, we demonstrated PRMT1 as a direct target of miR-503 and revealed the mechanism of miR-503-mediated PRMT1 in metastasis of HCC. Protein arginine methyl transferase 1 (PRMT1) is one of the most important types of protein in PRMT family, which play a crucial role in gene transcription regulation, thereby affecting several physiological and pathological processes such as cell growth, DNA repair, signal transduction, and tumorigenesis [25e27]. Recently, PRMT1 was reported to be overexpressed in a variety of cancers, including lung cancer [25], breast cancer [28] and bladder cancer [22]. However, the role and mechanism of PRMT1 in HCC remains unclear. In this study, our data demonstrated that miR-503 was able to directly bind to the 30 UTR of PRMT1 mRNA. It is the first time to identify the miRNA which directly target PRMT1. Then, we further investigated the effect of miR-503 on PRMT1 expression in HCC cells. RT-PCR and Western blotting analysis showed that the miR-503 downregulated the expression of PRMT1 at the levels of mRNA and protein. Furthermore, HCC clinical samples validate the above conclusions that PRMT1 is upregulated in HCC tissues and high levels of PRMT1 were correlated with low levels of miR-503 in clinical HCC samples.
Fig. 3. miR-503 affects the invasion and migration of HCC cells via PRMT1. A, Transwell assays revealed the invasion ability of HepG2 cell transfected with miR-NC, miR-503 or cotransfected with miR-503 and pcDNA-PRMT1. B, In wound migration assay revealed the migration ability of HepG2 cell transfected with miR-NC, miR-503 or cotransfected with miR-503 and pcDNA-PRMT1. Data are the mean ± SD of duplicates from a representative experiment of three independent experiments. *p < 0.01 vs. NC group. **p < 0.01 vs. miR503 group.
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
B. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e6
5
Fig. 4. MiR-503 induces EMT of HCC cells by suppressing PRMT1 expression. HepG2 cells transfected with miR-NC, miR-503 or cotransfected with miR-503 and pcDNA-PRMT1. A, Western bolt analysis revealed the effects of miR-503 and PRMT1 on EMT-relative protein expression. B, The effects of miR-503 and PRMT1 on E-cadherin expression. C, The effects of miR-503 and PRMT1 on N-cadherin expression. D, The effects of miR-503 and PRMT1 on Vimentin expression. Error bars represent ±S.E. and *, p < 0.01 versus control and NC. **, p < 0.01 versus miR-503 group.
It has been reported that miR-503 is implicated in HCC progression [20,24]. In this study, our data demonstrated that miR-503 inhibits invasion and migration of HCC cells through PRMT1. The epithelialemesenchymal transition (EMT) has been associated with the acquisition of migration, invasiveness, and metastasis in cancer [29]. During EMT, the epithelial protein level, such as E-cadherin, are downregulated, while mesenchymal protein such as N-cadherin and vimentin are upregulated [30]. Recent studies showed that PRMT1 is a novel regulator of Epithelial-MesenchymalTransition in non-small cell lung cancer [31]. Silenced PRMT1 significantly inhibited lung cancer cell migration by increasing Ecadherin expression and decreasing N-cadherin expression [25]. Therefore, we are interested in whether miR-503-repressed PRMT1 involves metastasis of HCC cells through EMT. Our data indicated that overexpressed miR-503 suppressed EMT with upregulation of E-cadherin and downregulation of vimentin and N-cadherin, which was reversed by exogenous PRMT1. Taken together, we first time demonstrated that PRMT1 is upregulated in HCC tissues and is a novel target genes of miR-503. Furthermore, we demonstrated the important role of miR-503suppressed PRMT1 and subsequently disarranged EMT on HCC metastasis, providing potential therapeutic pathway in HCC therapy.
Conflicts of interest The authors declare no conflict of interest.
Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2015.06.169.
References [1] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman, Global cancer statistics, CA Cancer J. Clin. 61 (2011) 69e90. [2] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA Cancer J. Clin. 65 (2015) 87e108. [3] L.C. Harlan, H.M. Parsons, C.L. Wiggins, J.L. Stevens, Y.Z. Patt, Treatment of hepatocellular carcinoma in the community: disparities in standard therapy, Liver Cancer 4 (2015) 70e83. [4] Z. Li, H. Lei, M. Luo, Y. Wang, L. Dong, Y. Ma, C. Liu, W. Song, F. Wang, J. Zhang, J. Shen, J. Yu, DNA methylation downregulated mir-10b acts as a tumor suppressor in gastric cancer, Gastric Cancer 18 (2015) 43e54. [5] X. Xiao, C. Tang, S. Xiao, C. Fu, P. Yu, Enhancement of proliferation and invasion by MicroRNA-590-5p via targeting PBRM1 in clear cell renal carcinoma cells, Oncol. Res. 20 (2013) 537e544. [6] W.Z. Yin, F. Li, L. Zhang, X.P. Ren, N. Zhang, J.F. Wen, Down-regulation of microRNA-205 promotes gastric cancer cell proliferation, Eur. Rev. Med. Pharmacol. Sci. 18 (2014) 1027e1032. [7] X. Yang, W. Ni, K. Lei, miR-200b suppresses cell growth, migration and invasion by targeting Notch1 in nasopharyngeal carcinoma, Cell. Physiol. Biochem. 32 (2013) 1288e1298. [8] Z. Liu, C. Mai, H. Yang, Y. Zhen, X. Yu, S. Hua, Q. Wu, Q. Jiang, Y. Zhang, X. Song, W. Fang, Candidate tumour suppressor CCDC19 regulates miR-184 direct targeting of C-Myc thereby suppressing cell growth in non-small cell lung cancers, J. Cell. Mol. Med. 18 (2014) 1667e1679. [9] Q. Yang, Y. Wang, X. Lu, Z. Zhao, L. Zhu, S. Chen, Q. Wu, C. Chen, Z. Wang, MiR125b regulates epithelial-mesenchymal transition via targeting Sema4C in paclitaxel-resistant breast cancer cells, Oncotarget 6 (2015) 3268e3279. [10] B. Gong, H. Hu, J. Chen, S. Cao, J. Yu, J. Xue, F. Chen, Y. Cai, H. He, L. Zhang, Caprin-1 is a novel microRNA-223 target for regulating the proliferation and invasion of human breast cancer cells, Biomed. Pharmacother. 67 (2013) 629e636. [11] J. Wang, M. Raimondo, S. Guha, J. Chen, L. Diao, X. Dong, M.B. Wallace, A.M. Killary, M.L. Frazier, T.A. Woodward, J. Wang, S. Sen, Circulating microRNAs in pancreatic juice as candidate biomarkers of pancreatic cancer, J. Cancer 5 (2014) 696e705. [12] H.F. Duan, X.Q. Li, H.Y. Hu, Y.C. Li, Z. Cai, X.S. Mei, P. Yu, L.P. Nie, W. Zhang, Z.D. Yu, G.H. Nie, Functional elucidation of miR-494 in the tumorigenesis of nasopharyngeal carcinoma, Tumour Biol. (2015). [13] J. Lu, M.L. He, L. Wang, Y. Chen, X. Liu, Q. Dong, Y.C. Chen, Y. Peng, K.T. Yao, H.F. Kung, X.P. Li, MiR-26a inhibits cell growth and tumorigenesis of nasopharyngeal carcinoma through repression of EZH2, Cancer Res. 71 (2011) 225e233. [14] Y. Yang, L. Liu, Y. Zhang, H. Guan, J. Wu, X. Zhu, J. Yuan, M. Li, MiR-503 targets PI3K p85 and IKK-beta and suppresses progression of non-small cell lung cancer, Int. J. Cancer 135 (2014) 1531e1542.
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
6
B. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e6
[15] Y.C. Lu, Y.J. Chen, H.M. Wang, C.Y. Tsai, W.H. Chen, Y.C. Huang, K.H. Fan, C.N. Tsai, S.F. Huang, C.J. Kang, J.T. Chang, A.J. Cheng, Oncogenic function and early detection potential of miRNA-10b in oral cancer as identified by microRNA profiling, Cancer Prev. Res. (Phila) 5 (2012) 665e674. [16] Y. Peng, Y.M. Liu, L.C. Li, L.L. Wang, X.L. Wu, microRNA-503 inhibits gastric cancer cell growth and epithelial-to-mesenchymal transition, Oncol. Lett. 7 (2014) 1233e1238. [17] Y. Zhang, X. Chen, H. Lian, J. Liu, B. Zhou, S. Han, B. Peng, J. Yin, W. Liu, X. He, MicroRNA-503 acts as a tumor suppressor in glioblastoma for multiple antitumor effects by targeting IGF-1R, Oncol. Rep. 31 (2014) 1445e1452. [18] Y. Chong, J. Zhang, X. Guo, G. Li, S. Zhang, C. Li, Z. Jiao, M. Shao, MicroRNA-503 acts as a tumor suppressor in osteosarcoma by targeting L1CAM, PLoS One 9 (2014) e114585. [19] Y.Y. Xu, H.J. Wu, H.D. Ma, L.P. Xu, Y. Huo, L.R. Yin, MicroRNA-503 suppresses proliferation and cell-cycle progression of endometrioid endometrial cancer by negatively regulating cyclin D1, Febs J. 280 (2013) 3768e3779. [20] F. Xiao, W. Zhang, L. Chen, F. Chen, H. Xie, C. Xing, X. Yu, S. Ding, K. Chen, H. Guo, J. Cheng, S. Zheng, L. Zhou, MicroRNA-503 inhibits the G1/S transition by downregulating cyclin D3 and E2F3 in hepatocellular carcinoma, J. Transl. Med. 11 (2013) 195. [21] C.C. Liang, A.Y. Park, J.L. Guan, In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro, Nat. Protoc. 2 (2007) 329e333. [22] M. Yoshimatsu, G. Toyokawa, S. Hayami, M. Unoki, T. Tsunoda, H.I. Field, J.D. Kelly, D.E. Neal, Y. Maehara, B.A. Ponder, Y. Nakamura, R. Hamamoto, Dysregulation of PRMT1 and PRMT6, type I arginine methyltransferases, is involved in various types of human cancers, Int. J. Cancer 128 (2011) 562e573. [23] R.K. Bikkavilli, S. Avasarala, M. Vanscoyk, M. Sechler, N. Kelley, C.C. Malbon, R.A. Winn, Dishevelled3 is a novel arginine methyl transferase substrate, Sci. Rep. 2 (2012) 805.
[24] B. Zhou, R. Ma, W. Si, S. Li, Y. Xu, X. Tu, Q. Wang, MicroRNA-503 targets FGF2 and VEGFA and inhibits tumor angiogenesis and growth, Cancer Lett. 333 (2013) 159e169. [25] T. Zhang, G. Cui, Y.L. Yao, Y. Guo, Q.C. Wang, X.N. Li, W.M. Feng, Inhibition of nonsmall cell lung cancer cell migration by protein arginine methyltransferase 1-small hairpin RNA through inhibiting epithelial-mesenchymal transition, extracellular matrix degradation, and Src phosphorylation, Chin. Med. J. (Engl) 128 (2015) 1202e1208. [26] N. Cheung, L.C. Chan, A. Thompson, M.L. Cleary, C.W. So, Protein argininemethyltransferase-dependent oncogenesis, Nat. Cell. Biol. 9 (2007) 1208e1215. [27] T.C. Osborne, O. Obianyo, X. Zhang, X. Cheng, P.R. Thompson, Protein arginine methyltransferase 1: positively charged residues in substrate peptides distal to the site of methylation are important for substrate binding and catalysis, Biochemistry 46 (2007) 13370e13381. [28] K. Mathioudaki, A. Scorilas, A. Ardavanis, P. Lymberi, E. Tsiambas, M. Devetzi, A. Apostolaki, M. Talieri, Clinical evaluation of PRMT1 gene expression in breast cancer, Tumour Biol. 32 (2011) 575e582. [29] R. Kalluri, R.A. Weinberg, The basics of epithelial-mesenchymal transition, J. Clin. Invest 119 (2009) 1420e1428. [30] J. Yang, S.A. Mani, J.L. Donaher, S. Ramaswamy, R.A. Itzykson, C. Come, P. Savagner, I. Gitelman, A. Richardson, R.A. Weinberg, Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis, Cell 117 (2004) 927e939. [31] S. Avasarala, M. Van Scoyk, M.K. Karuppusamy Rathinam, S. Zerayesus, X. Zhao, W. Zhang, M.R. Pergande, J.A. Borgia, J. DeGregori, J.D. Port, R.A. Winn, R.K. Bikkavilli, PRMT1 Is a novel regulator of epithelial-mesenchymaltransition in non-small cell lung cancer, J. Biol. Chem. 290 (2015) 13479e13489.
Please cite this article in press as: B. Li, et al., miR-503 suppresses metastasis of hepatocellular carcinoma cell by targeting PRMT1, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.06.169
