Mol Cell Biochem DOI 10.1007/s11010-014-2158-4
MiRNA-26b inhibits the proliferation, migration, and epithelial–mesenchymal transition of lens epithelial cells Ning Dong • Bing Xu • Silvia R. Benya Xin Tang
•
Received: 8 March 2014 / Accepted: 14 July 2014 Ó Springer Science+Business Media New York 2014
Abstract MicroRNAs (miRNAs) are a class of small endogenous gene regulators that play important roles in various developmental and pathological processes. However, little is known about the precise identity and functions of miR-26b in posterior capsule opacification (PCO). In this study, we report that the expression of miR-26b is decreased in human PCO-attached lens epithelial cells (LECs) and SRA01/04 cells in the presence of TGF-b2. Overexpression of miR-26b inhibited the proliferation of LECs based on MTT assays and BrdU incorporation assays. In addition, the overexpression of miR-26b inhibited the migration ability of LECs, as shown by woundhealing and transwell migration assays. The overexpression of miR-26b increased the level of the lens epithelial marker E-cadherin and reduced the levels of mesenchymal-related proteins, such as fibronectin, a-SMA, and type I collagen, in SRA01/04 cells in the presence of TGF-b2. Furthermore, the upregulation of E-cadherin and downregulation of mesenchymal-related proteins were induced in human PCO-attached LECs transfected with miR-26b mimics. We further demonstrated that Smad4 and COX-2 are targets of miR-26b in LECs using luciferase reporter assays. These Ning Dong and Bing Xu have contributed equally to this work. N. Dong B. Xu Department of Ophthalmology, Beijing Shijitan Hospital, Capital Medical University, Beijing, People’s Republic of China S. R. Benya Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX, USA X. Tang (&) Tianjin Eye Hospital, Tianjin Medical University, 4, Gansu Road, Heping District, Tianjin 300020, China e-mail: [email protected]
data reveal that miR-26b can inhibit the proliferation, migration, and EMT of lens epithelial cells, and restoration of miRNA-26b may be a potential, novel therapeutic target for the prevention and treatment of posterior capsule opacification. Keywords MiRNA Posterior capsule opacification Epithelial–mesenchymal transition Smad4 COX-2
Introduction Posterior capsule opacification (PCO) is a common postoperative complication of cataract surgery that produces a burden for patients worldwide and raises concern for surgeons. PCO is the most common postoperative complication of cataract surgery that causes vision loss; its incidence is 30–50 % in adults and 100 % in children [1]. PCO is generally associated with the pathological progression of postoperative residual lens epithelial cells (LECs), including proliferation, migration, and epithelial–mesenchymal transition (EMT) [2]. EMT is a process in which fully differentiated epithelial cells transition to a mesenchymal phenotype, giving rise to fibroblasts and myofibroblasts. Increasing evidence indicates that EMT is characterized by a loss of epithelial cell– cell adhesion by the suppression of molecular hallmarks that compose junctional complexes, such as E-cadherin. In parallel, the cells acquire mesenchymal features, such as the production of matrix proteins (e.g., fibronectin and type I collagen), reorganization of the actin cytoskeleton to activate the motility machinery, and production of metalloproteases, which also facilitate cell migration. Although PCO is known to be associated with wrinkling/contraction of the posterior capsule and pathological
123
Mol Cell Biochem
progression of postoperative residual LECs, including proliferation, migration, and EMT, the mechanism of this process is not yet clearly understood. MicroRNAs (miRNAs) are a class of small, non-coding RNAs that are capable of regulating the post-transcriptional expression of protein-coding mRNAs. Mechanistically, miRNAs function by binding to the 30 untranslated regions (UTRs) of target mRNAs, causing translation to be blocked and/or mRNA degradation [3]. An increasing body of evidence indicates that some miRNAs play a role in regulating lens differentiation [4], cataractogenesis [5, 6], and PCO [7]. Recent findings indicated that miR-26b was downregulated in primary carcinoma, including hepatocellular carcinoma, nasopharyngeal carcinoma, and squamous cell lung carcinoma, and might act as a tumor suppressor by inhibiting cellular growth and EMT [8]. Furthermore, recent studies showed that miR-26b expression was downregulated in human PCO tissues when comparing miRNA profiling in human PCO tissues to that of normal-attached LECs [9]; however, the mechanism for the downregulation of miR-26b that is involved in PCO is not yet clearly understood. So, understanding the role of miR-26b in proliferation, migration, and EMT of LECs could identify new therapeutic targets for anti-PCO.
Medical Sciences (Beijing, China). The cells were routinely cultured in Eagle’s minimum essential medium (GIBCO BRL, Grand Island, NY, USA) with 10 % fetal bovine serum in a 5 % CO2-humidified atmosphere at 37 °C. When the cells were approximately 80 % confluent, they were passaged. Transfection MiR-26b mimics and the scrambled control microRNA were obtained from GenePharma (Shanghai, China). For 1 9 106 cells, 0.4 of nmol microRNA mimics or miR-26b control mimics was mixed with 15 ll GenePORTER transfection reagent (GTS Inc., San Diego, CA) and transfected into the cells. After 6 h, the supernatant was removed, and fresh medium was added. Quantitative reverse transcription PCR (qRT-PCR)
Materials and methods
The qRT-PCR method has been described in detail previously [10, 11]. The primers were as follows: miR-26b sense, 50 -GAGAGGTATGAAGGTTATTCA-30 ; miR-26b antisense, 50 -ATCACCACCTTACGAGCCACC-30 ; a-SMA sense, 50 -GGCATCGTGCTGGACTC-30 ; a-SMA antisense, 50 -TGGCTGGAACAGGGTCTC-30 ; Type I collagen sense, 50 -TTGAGTTGTATCGTGTGGTG-30 ; and Type I collagen antisense, 50 -AGAAGATGAAAATGAGACTG-30 .
Patient lens epithelial cell collection and culture
MTT cell proliferation assay
Fresh PCO tissues were obtained from the Beijing Shijitan Hospital, Capital Medical University (Beijing, China). The study was approved by the Ethics Committee of Beijing Shijitan Hospital, Capital Medical University, Beijing, People’s Republic of China and was performed in accordance with the Declaration of Helsinki. Each subject received a detailed information leaflet and provided informed written consent before participation. Normalattached LEC samples from organ donors were provided by the Eye Bank of Beijing, China (Beijing, China). Lens capsules were spread onto tissue culture dishes, epithelium side up. Then, a single drop of fetal bovine serum was placed on the epithelial surface to allow for adequate adherence of the tissue to the dish. Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 20 % fetal bovine serum was added, and the cells were incubated in a 5 % CO2-humidified atmosphere at 37 °C until further experimentation.
SRA01/04 cells (150 ll/well at a density of 1 9 104 cells/ well) were seeded in 96-well plates and transfected with microRNA mimics or miR-26b control mimics. After 24, 48, and 72 h, 10 ll of 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) (Sigma, St. Louis, MO) solution (5 mg/ml) was added to each well, and the plate was incubated at 37 °C for 4 h. Then, 100 ll of dimethyl sulfoxide was added to each well, and the plate was vortexed for 10 min at 37 °C. Finally, the optical density value of each well was measured at 570 nm with a lQuant Universal Microplate Spectrophotometer (Bio-tek Instruments, Winooski, VT, USA).
SRA01/04 cell culture The human lens epithelial cell line SRA01/04 was obtained from the Cancer Institute & Hospital, Chinese Academy of
123
Cell proliferation detected by 5-bromodeoxyuridine (BrdU) incorporation assay Cells (5 9103) were placed on 96-well plates in 10 % FBS/ DMEM in the presence of miR-26b mimics or scrambled control microRNA. After 24, 48, and 72 h, the culture medium was replaced with fresh medium. The cells were labeled with 10 lM 5-bromo-20 -deoxyuridine (BrdU; Sigma, St. Louis, MO) for 2 h. After the cells were fixed in 0.4 % paraformaldehyde for 20 min and washed with PBS,
Mol Cell Biochem
they were sequentially incubated in 1.5 mol/l HCl for 10 min. Then, the cells were washed with PBS and incubated with mouse anti-BrdU-fluorescein isothiocyanate (Roche, Indianapolis, IN) for 2 h. The cells were washed four times with PBS. Then, the cells were subsequently incubated with the secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) for 1 h and washed with PBS. Finally, the cells were counterstained with 40 , 6-diamino-2-phenylindole (DAPI; 1 lg/ml; Invitrogen), mounted, and examined and counted by fluorescence light microscopy (BX50; Olympus Inc., Tokyo, Japan). Wound-healing assay SRA01/04 cells were seeded in 24-well plates (1 9 105 cells/well). After 24 h of transfection with microRNA mimics or miR-26b control mimics, the cell density of each well reached 90 % confluency, and the confluent monolayers of the SRA01/04 cells were scratched with a sterile, 20 ll pipette tip. Wounded monolayers were washed with PBS to remove detached cells and debris, and fresh medium was added to each well. The wounds in each well were photographed at 0, 12, 24, and 48 h. The length of the remaining wound in each image was measured five times using the ImageJ software (National Institutes of Health, Bethesda, MD, USA). The data were quantified based on the ‘‘average gap’’ (AG, %); the wound at 0 h was considered as 100 % AG. The results were analyzed in triplicate.
CA, USA), and anti-actin (Abcam Biotechnology, Cambridge, UK). Luciferase assay The 30 -UTRs of Smad4 and COX-2 containing the predicted miR-26b binding or mutant sites were amplified by PCR using the following primers: Smad4 sense 50 -CACAACTC GAGAGGCACAAGGATGAACTCTA-30 ; Smad4 antisense, 50 -GGAAAAAAGCGGCCGCGACCTTCTGAGCA AGGCAGT-30 ; COX-2 sense 50 -TAGGCGATCGCTCGAG CTGTTGCGGAGAAAGGAGTC-30 ; COX-2 antisense, 50 AATTCCCGGGCTCGAGTAGTTACTTCTAATGCATC ATGG-30 ; mutant Smad4 sense 50 -TGATGCACTGAATTT TTGGTATAATGTTTACTTGATGT-30 ; mutant Smad4 antisense, 50 -CCAAAAATTCAGTGCATCAAATCAAGT ACAAAAATA-30 ; mutant COX-2 sense 50 -TCCGCGATC TCTCGAGCTGTTGCGCGCAAAGGAGTC-30 ; and mutant COX-2 antisense, 50 -ATTTCCTAGGCTCGAGTAGTTAC TTCTAATTTATCATGG-30 . Fragments were subcloned into the Not I and Xho I sites in the 30 -UTR of Renilla luciferase of the psiCHECK-2 reporter vector. The psiCHECK-2/Smad4 30 -UTR or psiCHECK-2/Smad4 30 -UTR mutant and psiCHECK-2/COX-2 30 -UTR or psiCHECK-2/ COX-2 30 -UTR mutant reporter plasmids (200 ng) were cotransfected with the microRNA mimics or miR-26b control mimics into SRA01/04 cells (60 % confluency). After 48 h, the cells were lysed, and reporter activity was assessed using the dual-luciferase reporter assay system (Promega, USA) in accordance with the manufacturer’s protocols.
Transwell migration assay Statistical analysis SRA01/04 cells were seeded into the inner chamber of tissue culture inserts (Transwell assay system; Corning, High Wycombe, UK) of 24-well plates. Cells transfected with microRNA mimics or miR-26b control mimics at a density of 5 9 105 cells/ml were added to the upper polycarbonate membrane insert and allowed to migrate through the 8 lm pores, and 300 ll of cultured serum-free medium was added to the lower chamber. After 48 h of incubation at 37 °C in 5 % CO2, the membranes were fixed with 10 % formaldehyde and stained with hematoxylin. The cells that had migrated to the bottom of the insert were counted five times in random microscope fields.
All experiments were performed at least three times. Quantitative data are presented as the mean ± SE and were analyzed by one-way analysis of variance (ANOVA) or Student’s t test. A P value of \0.05 was considered statistically significant.
Results Expression of miR-26b is decreased in human PCOattached LECs and SRA01/04 cells in the presence of TGF-b2
Western blot analysis The method used for Western blot analysis has previously been described in detail [12]. The primary antibodies were anti-Smad4, anti-E-cadherin, anti-fibronectin (all of the above were from Cell Signaling Technology, Beverly, MA, USA), anti-COX-2 (Santa Cruz Biotechnology, Santa Cruz,
To investigate the involvement of miR-26b in PCO development, we analyzed the levels of miR-26b in human PCO-attached LECs and normal-attached LECs by qRTPCR. MiR-26b expression was significantly decreased in human PCO-attached LECs compared with normalattached LECs (4.5-fold, P \ 0.05) (Fig. 1a).
123
Mol Cell Biochem
Fig. 1 MiR-26b is relatively downregulated in human PCO-attached LECs and SRA01/04 cells in the presence of TGF-b2. a MiR-26b expression was significantly decreased in human PCO-attached LECs compared with normal-attached LECs (4.5-fold, P \ 0.05) by qRTPCR. b, c Downregulation of E-cadherin and upregulation of fibronectin were detected in human PCO-attached LECs. d MiR26b expression was significantly decreased in a dose-dependent
manner in the SRA01/04 cells in the presence of TGF-b2 compared with control SRA01/04 cells treated with saline. e Upregulation of p-Smad2 was induced by TGF-b2 in the SRA01/04 cells compared with control SRA01/04 cells treated with saline. f Upregulation of Smad4 mRNA was induced by TGF-b2 compared with control SRA01/04 cells treated with saline
The expression of EMT markers was determined in human PCO-attached LECs and normal-attached LECs by qRT-PCR (Fig. 1b, c). Downregulation of E-cadherin and upregulation of fibronectin were detected in human PCOattached LECs. TGF-b has been proposed as the most important factor driving the EMT and pathologic fibrosis of LECs [13]. The TGF-b superfamily consists of a diverse range of proteins that include TGF-b isoforms 1, 2, and 3; TGF-b2 is the major isoform within the eye, most of which is detected in the aqueous humor [14, 15]. To investigate the involvement of miR-26b in PCO development, we analyzed the levels of miR-26b in SRA01/04 cells in the presence or absence of TGF-b2 using qRT-PCR. MiR-26b expression was significantly decreased in a dose-dependent manner in SRA01/04 cells in the presence of TGF-b2 compared with control SRA01/04 cells treated with saline (Fig. 1d). In addition, to investigate the involvement of the TGF-b2/ Smad-dependent pathway in PCO development, we analyzed the levels of p-Smad2 in SRA01/04 cells in the presence or absence of TGF-b2 by Western blot analysis
and analyzed the levels of Smad4 mRNA by qRT-PCR (Fig. 1e, f). As shown in Fig. 1e, f, the upregulation of p-Smad2 and Smad4 was induced by TGF-b2 compared with control SRA01/04 cells treated with saline.
123
MiR-26b inhibits SRA01/04 cell proliferation MiR-26b was downregulated in human PCO-attached LECs and SRA01/04 cells in the presence of TGF-b2, implicating its potential role in the biological properties of LECs. To investigate the effect of miR-26b on LEC proliferation, miR26b mimics were transfected into the SRA01/04 cell line, and the effect of miR-26b on the proliferation of SRA01/04 cells was assessed by MTT and BrdU incorporation assays. MiR26b expression was significantly increased in the SRA01/04 cells transfected with miR-26b mimics compared to those transfected with miR-26b control mimics, as shown by qRTPCR (2230-fold, P \ 0.01) (Fig. 2a). The MTT assay results revealed that overexpression of miR-26b inhibited SRA01/ 04 cell growth at 24, 48, and 72 h after transfection (P \ 0.05, Fig. 2b). In addition, SRA01/04 cells labeled
Mol Cell Biochem Fig. 2 MiR-26b inhibited SRA01/04 cell proliferation. a MiR-26b expression was significantly increased in the SRA01/04 cells transfected with miR-26b mimics compared to the SRA01/04 cells transfected with miR-26b mimics control by qRT-PCR (2230-fold, P \ 0.01). b MTT assay results revealed that the overexpression of miR-26b inhibited SRA01/04 cell growth at 24, 48, and 72 h after transfection. c The SRA01/ 04 cells labeled with BrdU were immunostained for BrdU (red) and counterstained for nuclei (blue). d BrdU assay results revealed that the overexpression of miR-26b inhibited SRA01/04 cell growth at 24, 48, and 72 h after transfection. (Color figure online)
with BrdU were immunostained for BrdU (Fig. 2c, red), and nuclei were stained with 40 , 6-diamino-2-phenylindole (DAPI; Fig. 2c, blue). The BrdU assay results revealed that
the overexpression of miR-26b inhibited SRA01/04 cell growth at 24, 48, and 72 h after transfection (P \ 0.05, Fig. 2c, d).
123
Mol Cell Biochem
Fig. 3 MiR-26b inhibits the migration of SRA01/04 cells. a, b The effects of miR-26b on SRA01/04 cell motility shown by woundhealing assay. The migration ability of SRA01/04 cells transfected with miR-26b mimics after 48 h was significantly decreased compared with that of control cells. The data were quantified based
on the ‘‘average gap’’ (AG, %); the wound at 0 h was considered 100 % AG. c Transwell migration assays were performed and analyzed to investigate the effect of miR-26b on cell migration. The number of migratory miR-26b-overexpressing SRA01/04 cells was decreased compared with that of control cells
Upregulation of miR-26b inhibits the migration of SRA01/04 cells
absence of TGF-b2. As shown in Fig. 4a, downregulation of E-cadherin and upregulation of fibronectin and Smad4 were induced by TGF-b2 in SRA01/04 cells. In miR-26boverexpressing SRA01/04 cells exposed to TGF-b2, the expression of E-cadherin was increased, and the expression of fibronectin and Smad4 was decreased. The levels of a-SMA and type I collagen were analyzed by qRT-PCR to validate the role of miR-26b in the regulation of EMT. As shown in Fig. 4b, upregulation of a-SMA and type I collagen was induced by TGF-b2 in SRA01/04 cells. However, the expression of a-SMA and type I collagen was decreased in miR-26b-overexpressing SRA01/04 cells in the presence of TGF-b2. We used miRanda to search for the 30 -UTR sequences of the mRNAs encoding Smad2, Smad3, and Smad4 and found that only the Smad4 mRNA contained a seed sequence for miR-26b, which suggests that miR-26b binds directly to its 30 -UTR (Fig. 4c). To test that idea, we performed a luciferase reporter assay to verify that miR-26b directly targets Smad4. Smad4 mRNA, including the putative target site, or its mutant in a luciferase reporter plasmid was co-transfected with miR-26b mimics or miR26b control mimics into SRA01/04 cells. Subsequently luciferase activity was measured. The luciferase activity of
To confirm the effects of miR-26b on cell migration, SRA01/04 cells were transfected with miR-26b mimics or miR-26b control mimics. As shown in Fig. 3a, b, miR-26boverexpressing cells moved slower compared with the SRA01/04 cells transfected with miR-26b control mimics, as shown by wound-healing assays. Transwell migration assays were performed and analyzed to investigate the effect of miR-26b on cell migration. After 48 h of incubation, SRA01/04 cells transfected with miR-26b mimics showed decreased migration across the polycarbonate membrane compared with control cells (Fig. 3c). MiR-26b inhibits the EMT of SRA01/04 cells via regulation of Smad4 Lens epithelial and mesenchymal proteins were analyzed to validate the role of miR-26b in the regulation of EMT by Western blot analysis. To determine the potential ability of miR-26b to downregulate fibronectin and upregulate E-cadherin, SRA01/04 cells were transfected with miR-26b mimics or miR-26b control mimics in the presence or
123
Mol Cell Biochem
Fig. 4 MiR-26b inhibits the EMT of SRA01/04 cells via regulation of Smad4. a Western blot analysis detected down-regulated E-cadherin and up-regulated fibronectin and Smad4 in SRA01/04 cells treated with TGF-b2. However, the expression of E-cadherin was increased and the expression of fibronectin and Smad4 was decreased in SRA01/04 cells transfected with miR-26b mimics in the presence of TGF-b2. b The overexpression of miR-26b affected the expression of a-SMA and type I collagen in SRA01/04 cells. QRT-PCR detected that upregulation of a-SMA and type I collagen was induced by TGFb2 in SRA01/04 cells; however, the expression of a-SMA and type I collagen was decreased by overexpression of miR-26b. c The region
of the Smad4 mRNA 30 -UTR predicted to be targeted by miR-26b. d Dual-luciferase report assays were performed on SRA01/04 cells. Smad4 mRNA, including the putative target site, or its mutant into a luciferase reporter plasmid was co-transfected along with miR-26b mimics or miR-26b mimics control into SRA01/04 cells. The luciferase activity of WT reporter transfected with miR-26b mimics was significantly decreased compared with miR-26b mimics control (P \ 0.01). However, the luciferase reporter activity was not inhibited by miR-26b mimics when the seeding sites were mutated (P [ 0.05)
the wild-type (WT) reporter co-transfected with the miR26b mimics was significantly decreased compared with cells transfected with the miR-26b control mimics (P \ 0.01, Fig. 4d). However, the luciferase reporter activity was not inhibited by the miR-26b mimics when the seed sequences were mutated. These results indicate that miR-26b specifically binds to the 30 -UTR of Smad4.
MiR-26b inhibits the EMT of human PCO-attached LECs via regulation of COX-2 To determine the potential ability of miR-26b to downregulate fibronectin and upregulate E-cadherin, human PCO-attached LECs were transfected with miR-26b mimics or miR-26b control mimics. When comparing human
123
Mol Cell Biochem
Fig. 5 MiR-26b inhibits the EMT of human PCO-attached LECs via regulation of COX-2. a Western blot analysis detected downregulated E-cadherin and up-regulated fibronectin and COX-2 in human PCO-attached LECs, comparing with that of normal-attached LECs. However, the expression of E-cadherin was increased and the expression of fibronectin and COX-2 was decreased in human PCOattached LECs transfected with miR-26b mimics. b The overexpression of miR-26b affected the expression of a-SMA and type I collagen in human PCO-attached LECs. QRT-PCR detected the expression of a-SMA, and type I collagen was increased in human PCO-attached LECs; comparing with that of normal-attached LECs, however, the
expression of a-SMA and type I collagen was decreased by overexpression of miR-26b. c The region of the COX-2 mRNA 30 UTR predicted to be targeted by miR-26b. d Dual-luciferase report assays were performed on SRA01/04 cells. COX-2 mRNA, including the putative target site, or its mutant into a luciferase reporter plasmid was co-transfected along with miR-26b mimics or miR-26b mimics control into SRA01/04 cells. The luciferase activity of WT reporter transfected with miR-26b mimics was significantly decreased compared with miR-26b mimics control (P \ 0.01). However, the luciferase reporter activity was not inhibited by miR-26b mimics when the seeding sites were mutated (P [ 0.05)
PCO-attached LECs to normal-attached LECs, the expression of E-cadherin was decreased, and the expression of fibronectin and COX-2 was increased in PCOattached LECs, as shown by Western blot analysis (Fig. 5a). However, downregulation of fibronectin and COX-2 and upregulation of E-cadherin were induced in miR-26b-overexpressing, human PCO-attached LECs. The levels of a-SMA and type I collagen were analyzed by qRT-PCR to validate the role of miR-26b in the regulation of EMT. When comparing human PCO-attached LECs to normal-attached LECs, the expression of a-SMA and type I collagen was increased in human PCO-attached LECs (Fig. 5b). However, downregulation of a-SMA and
type I collagen was induced in miR-26b-overexpressing, human PCO-attached LECs. We used miRanda to search for the 30 -UTR sequence of the mRNA encoding COX-2. As shown in Fig. 5c, a region of the COX-2 mRNA 30 -UTR was predicted to be targeted by miR-26b, which suggests that miR-26b binds directly to the 30 -UTR of COX-2. To test that idea, we performed a luciferase reporter assay to verify that miR-26b directly targets COX-2. The COX-2 mRNA, including the putative target site or its mutant, in a luciferase reporter plasmid was co-transfected with miR-26b mimics or miR-26b control mimics into SRA01/04 cells. Subsequently, luciferase activity was measured. The luciferase activity of the
123
Mol Cell Biochem
WT reporter transfected with miR-26b mimics was significantly decreased compared with the miR-26b control mimics (P \ 0.01, Fig. 5d). However, the luciferase reporter activity was not inhibited by the miR-26b mimics when the seed sequences were mutated (P [ 0.05). These results indicate that miR-26b specifically binds to the 30 UTR of the COX-2 mRNA.
Discussion In this study, we discovered that miRNA-26b was downregulated in human PCO-attached LECs and SRA01/04 cells in the presence of TGF-b2, which implies its potential role in PCO. Given that the identification of miRNA targets is critical to investigate the functions of miRNAs and because the biological significance of miRNA deregulation relies on the target genes, we performed computational predictions of the target genes for miR-26b. This analysis predicted that the 30 -UTR of the human Smad4 mRNA and the 30 -UTR of the COX-2 mRNA were targets of miR-26b, as shown by TargetScan (http://www.targetscan.org/) and miRanda (http:// www.microrna.org/). Our results revealed that miRNA-26b inhibits the proliferation, migration, and EMT of lens epithelial cells via regulation of Smad4 and COX-2. The main molecular pathways involved in the induction of the LEC EMT include the TGF-b2/Smad [10, 13], Wnt/ b-catenin [11], and extracellular matrix/ILK pathways [16]. TGF-b/Smad pathway has been proposed as an important pathway driving the EMT and pathologic fibrosis of LECs [17]. Smads can be divided into three distinct subclasses: receptor-activated Smads (R-Smads), commonpartner Smads (Co-Smads), and inhibitory Smads (antiSmads). Smad4 belongs to the evolutionarily conserved family of Smad proteins, which is the only identified CoSmad in mammals. When TGF-b2 binds to its receptor, Smad2/3 is phosphorylated and binds to Smad4 to form the R-Smad/Smad4 heteromeric complex, and together they are transported into the nucleus and combine with a coactivator or a co-repressor to regulate the translation and expression of a target gene [10, 13]. In this process, Smad4 is a central signaling component of the TGF-b2/Smad signaling pathway. A previous study suggested that the expression of Smad4 in the cell nucleus was increased in a human lens cell line, FHL 124, following TGF-b2 exposure, as shown by immunocytochemistry [18]. In addition, the regulation of fibronectin gene expression appeared to be Smad4-dependent, as fibronectin expression was significantly suppressed in Smad4-knockdown FHL 124 cells in both the presence and absence of TGF-b2 treatment [17]. It is suggested that Smad4 plays a key role in the TGF-b2/ Smad signaling pathway in the EMT and pathologic fibrosis of LECs.
Our study suggested that Smad4 was a possible target of miR-26b. Dual-luciferase reporter assays demonstrated that the downregulation of luciferase activity was mediated by the direct binding of miR-26b to the Smad4 30 -UTR because alteration of this region abolished this effect. In addition, overexpression of miR-26b suppressed Smad4 protein levels in SRA01/04 cells in the presence of TGFb2. In our study, restoration of miRNA-26b inhibited the proliferation, migration, and EMT of lens epithelial cells, which could possibly be due to miR-26b-mediated downregulation of Smad4 expression. COX-2 is an inducible enzyme that catalyzes the conversion of arachidonic acid to prostaglandins and other eicosanoids. COX-2 is usually not detectable but is inducible by bacterial endotoxins, cytokines, growth factors, and tumor promoters [19–21]. COX-2 is involved in tumor development and growth through the enhancement of tumor proliferation and angiogenesis; and it regulates cell proliferation, cell adhesion, inhibition of apoptosis, immune surveillance, and angiogenesis through the synthesis of prostaglandin E2 [22]. A previous study suggested that COX-2 is upregulated in canine cataracts and PCO [23]. Furthermore, inhibiting its enzymatic activity effectively prevented the EMT of LECs in an ex vivo model of PCO [23]. Consistent with previous studies, our study demonstrated that the expression of the COX-2 protein was increased in human PCO-attached LECs compared with that of normal-attached LECs, as shown by Western blot analysis. It is suggested that COX-2 is involved in the EMT and pathologic fibrosis of LECs. Computational predictions of the target genes by miRanda showed that the 30 -UTR of the COX-2 mRNA contained a binding site for miR-26b. To confirm the targeting of COX-2 by miR-26b, we integrated a fragment of the COX-2 mRNA 30 -UTR containing the target sequence or mutated seed sequence into a luciferase reporter vector. Dual-luciferase reporter assays demonstrated that the downregulation of luciferase activity was mediated by the direct binding of miR-26b to the COX-2 30 -UTR because alteration of this region abolished this effect. In addition, overexpression of miR-26b suppressed COX-2 protein levels in human PCO-attached LECs. Consistent with previous studies that showed direct binding of miR-26b to the COX-2 30 -UTR in desferrioxamine (DFOM)-treated carcinoma of nasopharyngeal epithelial (CNE) cells [24] and in breast cancer cells [25], miRNA-26b inhibited the proliferation, migration, and EMT of lens epithelial cells, which could possibly be due to miR-26b-mediated downregulation of COX-2 expression. In summary, the current study provides new insights regarding the ability of miRNA-26b to inhibit the proliferation, migration, and EMT of lens epithelial cells. These data indicate that miR-26b may serve as a PCO suppressor
123
Mol Cell Biochem
gene involved in PCO pathogenesis by directly silencing Smad4 and COX-2. Acknowledgments This work was supported by research Grants from the National Natural Science Foundation for the Young Scholars of Beijing Shijitan Hospital, Capital Medical University (No. 2013-QB01), and the National Natural Science Foundation of China (No. 81270984).
References 1. Findl O, Buehl W, Bauer P et al (2010) Interventions for preventing posterior capsule opacification. Cochrane Database Syst Rev 17(2):CD003738 2. Wormstone IM, Wang L, Liu CS (2009) Posterior capsule opacification. Exp Eye Res 88(2):257–269 3. He L, Hannon GJ (2004) MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet 5(7):522–531 4. Wolf L, Gao CS, Gueta K et al (2013) Identification and characterization of FGF2-dependent mRNA: microRNA networks during lens fiber cell differentiation. G3 (Bethesda) 3(12):2239– 2255 5. Varma SD, Kovtun S, Hegde K et al (2012) Effect of high sugar levels on miRNA expression. Studies with galactosemic mice lenses. Mol Vis 18:1609–1618 6. Varma SD, Kovtun S (2013) Protective effect of caffeine against high sugar-induced transcription of microRNAs and consequent gene silencing: a study using lenses of galactosemic mice. Mol Vis 19:493–500 7. Hoffmann A, Huang Y, Suetsugu-Maki R et al (2012) Implication of the miR-184 and miR-204 competitive RNA network in control of mouse secondary cataract. Mol Med 18:528–538 8. Verghese ET, Drury R, Green CA et al (2013) MiR-26b is downregulated in carcinoma-associated fibroblasts from ER-positive breast cancers leading to enhanced cell migration and invasion. J Pathol 231(3):388–399 9. Wang Y, Li W, Zang X et al (2013) MicroRNA-204-5p regulates epithelial-to-mesenchymal transition during human posterior capsule opacification by targeting SMAD4. Invest Ophthalmol Vis Sci 54(1):323–332 10. Li J, Tang X, Chen X (2011) Comparative effects of TGF-b2/ Smad2 and TGF-b2/Smad3 signaling pathways on proliferation, migration, and extracellular matrix production in a human lens cell line. Exp Eye Res 92(3):173–179
123
11. Bao XL, Song H, Chen Z et al (2012) Wnt3a promotes epithelialmesenchymal transition, migration, and proliferation of lens epithelial cells. Mol Vis 18:1983–1990 12. Dong N, Li X, Xiao L et al (2012) Upregulation of retinal neuronal MCP-1 in the rodent model of diabetic retinopathy and its function in vitro. Invest Ophthalmol Vis Sci 53(12):7567–7575 13. Lee EH, Joo CK (1999) Role of transforming growth factor-beta in transdifferentiation and fibrosis of lens epithelial cells. Invest Ophthalmol Vis Sci 40(9):2025–2032 14. Saika S, Miyamoto T, Kawashima Y et al (2000) Immunolocalization of TGF-beta1, -beta2, and -beta3, and TGF-beta receptors in human lens capsules with lens implants. Graefes Arch Clin Exp Ophthalmol 238(3):283–293 15. Gordon-Thomson C, de Iongh RU, Hales AM et al (1998) Differential cataractogenic potency of TGF-beta1, -beta2, and -beta3 and their expression in the postnatal rat eye. Invest Ophthalmol Vis Sci 39(8):1399–1409 16. Sponer U, Pieh S, Soleiman A et al (2005) Upregulation of alphavbeta6 integrin, a potent TGF-beta1 activator, and posterior capsule opacification. J Cataract Refract Surg 31(3):595–606 17. Dawes LJ, Sleeman MA, Anderson IK et al (2009) TGFbeta/ Smad4-dependent and -independent regulation of human lens epithelial cells. Invest Ophthalmol Vis Sci 50(11):5318–5327 18. Wormstone IM, Tamiya S, Eldred JA et al (2004) Characterisation of TGF-beta2 signalling and function in a human lens cell line. Exp Eye Res 78(3):705–714 19. Stoll SW, Rittie´ L, Johnson JL et al (2012) Heparin-binding EGFlike growth factor promotes epithelial-mesenchymal transition in human keratinocytes. J Invest Dermatol 132(9):2148–2157 20. Kirane A, Toombs JE, Larsen JE et al (2012) Epithelial-mesenchymal transition increases tumor sensitivity to COX-2 inhibition by apricoxib. Carcinogenesis 33(9):1639–1646 21. Vane JR, Bakhle YS, Botting RM (1998) Cyclooxygenases 1 and 2. Annu Rev Pharmacol Toxicol 38:97–120 22. Tilley SL, Coffman TM, Koller BH (2001) Mixed messages: modulation of inflammation and immune responses by prostaglandins and thromboxanes. J Clin Invest 108(1):15–23 23. Chandler HL, Barden CA, Lu P et al (2007) Prevention of posterior capsular opacification through cyclooxygenase-2 inhibition. Mol Vis 13:677–691 24. Ji Y, He Y, Liu L et al (2010) MiRNA-26b regulates the expression of cyclooxygenase-2 in desferrioxamine-treated CNE cells. FEBS Lett 584(5):961–967 25. Li J, Kong X, Zhang J et al (2013) MiRNA-26b inhibits proliferation by targeting PTGS2 in breast cancer. Cancer Cell Int 13(1):7
MiRNA-26b inhibits the proliferation, migration, and epithelial–mesenchymal transition of lens epithelial cells Ning Dong • Bing Xu • Silvia R. Benya Xin Tang
•
Received: 8 March 2014 / Accepted: 14 July 2014 Ó Springer Science+Business Media New York 2014
Abstract MicroRNAs (miRNAs) are a class of small endogenous gene regulators that play important roles in various developmental and pathological processes. However, little is known about the precise identity and functions of miR-26b in posterior capsule opacification (PCO). In this study, we report that the expression of miR-26b is decreased in human PCO-attached lens epithelial cells (LECs) and SRA01/04 cells in the presence of TGF-b2. Overexpression of miR-26b inhibited the proliferation of LECs based on MTT assays and BrdU incorporation assays. In addition, the overexpression of miR-26b inhibited the migration ability of LECs, as shown by woundhealing and transwell migration assays. The overexpression of miR-26b increased the level of the lens epithelial marker E-cadherin and reduced the levels of mesenchymal-related proteins, such as fibronectin, a-SMA, and type I collagen, in SRA01/04 cells in the presence of TGF-b2. Furthermore, the upregulation of E-cadherin and downregulation of mesenchymal-related proteins were induced in human PCO-attached LECs transfected with miR-26b mimics. We further demonstrated that Smad4 and COX-2 are targets of miR-26b in LECs using luciferase reporter assays. These Ning Dong and Bing Xu have contributed equally to this work. N. Dong B. Xu Department of Ophthalmology, Beijing Shijitan Hospital, Capital Medical University, Beijing, People’s Republic of China S. R. Benya Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX, USA X. Tang (&) Tianjin Eye Hospital, Tianjin Medical University, 4, Gansu Road, Heping District, Tianjin 300020, China e-mail: [email protected]
data reveal that miR-26b can inhibit the proliferation, migration, and EMT of lens epithelial cells, and restoration of miRNA-26b may be a potential, novel therapeutic target for the prevention and treatment of posterior capsule opacification. Keywords MiRNA Posterior capsule opacification Epithelial–mesenchymal transition Smad4 COX-2
Introduction Posterior capsule opacification (PCO) is a common postoperative complication of cataract surgery that produces a burden for patients worldwide and raises concern for surgeons. PCO is the most common postoperative complication of cataract surgery that causes vision loss; its incidence is 30–50 % in adults and 100 % in children [1]. PCO is generally associated with the pathological progression of postoperative residual lens epithelial cells (LECs), including proliferation, migration, and epithelial–mesenchymal transition (EMT) [2]. EMT is a process in which fully differentiated epithelial cells transition to a mesenchymal phenotype, giving rise to fibroblasts and myofibroblasts. Increasing evidence indicates that EMT is characterized by a loss of epithelial cell– cell adhesion by the suppression of molecular hallmarks that compose junctional complexes, such as E-cadherin. In parallel, the cells acquire mesenchymal features, such as the production of matrix proteins (e.g., fibronectin and type I collagen), reorganization of the actin cytoskeleton to activate the motility machinery, and production of metalloproteases, which also facilitate cell migration. Although PCO is known to be associated with wrinkling/contraction of the posterior capsule and pathological
123
Mol Cell Biochem
progression of postoperative residual LECs, including proliferation, migration, and EMT, the mechanism of this process is not yet clearly understood. MicroRNAs (miRNAs) are a class of small, non-coding RNAs that are capable of regulating the post-transcriptional expression of protein-coding mRNAs. Mechanistically, miRNAs function by binding to the 30 untranslated regions (UTRs) of target mRNAs, causing translation to be blocked and/or mRNA degradation [3]. An increasing body of evidence indicates that some miRNAs play a role in regulating lens differentiation [4], cataractogenesis [5, 6], and PCO [7]. Recent findings indicated that miR-26b was downregulated in primary carcinoma, including hepatocellular carcinoma, nasopharyngeal carcinoma, and squamous cell lung carcinoma, and might act as a tumor suppressor by inhibiting cellular growth and EMT [8]. Furthermore, recent studies showed that miR-26b expression was downregulated in human PCO tissues when comparing miRNA profiling in human PCO tissues to that of normal-attached LECs [9]; however, the mechanism for the downregulation of miR-26b that is involved in PCO is not yet clearly understood. So, understanding the role of miR-26b in proliferation, migration, and EMT of LECs could identify new therapeutic targets for anti-PCO.
Medical Sciences (Beijing, China). The cells were routinely cultured in Eagle’s minimum essential medium (GIBCO BRL, Grand Island, NY, USA) with 10 % fetal bovine serum in a 5 % CO2-humidified atmosphere at 37 °C. When the cells were approximately 80 % confluent, they were passaged. Transfection MiR-26b mimics and the scrambled control microRNA were obtained from GenePharma (Shanghai, China). For 1 9 106 cells, 0.4 of nmol microRNA mimics or miR-26b control mimics was mixed with 15 ll GenePORTER transfection reagent (GTS Inc., San Diego, CA) and transfected into the cells. After 6 h, the supernatant was removed, and fresh medium was added. Quantitative reverse transcription PCR (qRT-PCR)
Materials and methods
The qRT-PCR method has been described in detail previously [10, 11]. The primers were as follows: miR-26b sense, 50 -GAGAGGTATGAAGGTTATTCA-30 ; miR-26b antisense, 50 -ATCACCACCTTACGAGCCACC-30 ; a-SMA sense, 50 -GGCATCGTGCTGGACTC-30 ; a-SMA antisense, 50 -TGGCTGGAACAGGGTCTC-30 ; Type I collagen sense, 50 -TTGAGTTGTATCGTGTGGTG-30 ; and Type I collagen antisense, 50 -AGAAGATGAAAATGAGACTG-30 .
Patient lens epithelial cell collection and culture
MTT cell proliferation assay
Fresh PCO tissues were obtained from the Beijing Shijitan Hospital, Capital Medical University (Beijing, China). The study was approved by the Ethics Committee of Beijing Shijitan Hospital, Capital Medical University, Beijing, People’s Republic of China and was performed in accordance with the Declaration of Helsinki. Each subject received a detailed information leaflet and provided informed written consent before participation. Normalattached LEC samples from organ donors were provided by the Eye Bank of Beijing, China (Beijing, China). Lens capsules were spread onto tissue culture dishes, epithelium side up. Then, a single drop of fetal bovine serum was placed on the epithelial surface to allow for adequate adherence of the tissue to the dish. Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 20 % fetal bovine serum was added, and the cells were incubated in a 5 % CO2-humidified atmosphere at 37 °C until further experimentation.
SRA01/04 cells (150 ll/well at a density of 1 9 104 cells/ well) were seeded in 96-well plates and transfected with microRNA mimics or miR-26b control mimics. After 24, 48, and 72 h, 10 ll of 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) (Sigma, St. Louis, MO) solution (5 mg/ml) was added to each well, and the plate was incubated at 37 °C for 4 h. Then, 100 ll of dimethyl sulfoxide was added to each well, and the plate was vortexed for 10 min at 37 °C. Finally, the optical density value of each well was measured at 570 nm with a lQuant Universal Microplate Spectrophotometer (Bio-tek Instruments, Winooski, VT, USA).
SRA01/04 cell culture The human lens epithelial cell line SRA01/04 was obtained from the Cancer Institute & Hospital, Chinese Academy of
123
Cell proliferation detected by 5-bromodeoxyuridine (BrdU) incorporation assay Cells (5 9103) were placed on 96-well plates in 10 % FBS/ DMEM in the presence of miR-26b mimics or scrambled control microRNA. After 24, 48, and 72 h, the culture medium was replaced with fresh medium. The cells were labeled with 10 lM 5-bromo-20 -deoxyuridine (BrdU; Sigma, St. Louis, MO) for 2 h. After the cells were fixed in 0.4 % paraformaldehyde for 20 min and washed with PBS,
Mol Cell Biochem
they were sequentially incubated in 1.5 mol/l HCl for 10 min. Then, the cells were washed with PBS and incubated with mouse anti-BrdU-fluorescein isothiocyanate (Roche, Indianapolis, IN) for 2 h. The cells were washed four times with PBS. Then, the cells were subsequently incubated with the secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) for 1 h and washed with PBS. Finally, the cells were counterstained with 40 , 6-diamino-2-phenylindole (DAPI; 1 lg/ml; Invitrogen), mounted, and examined and counted by fluorescence light microscopy (BX50; Olympus Inc., Tokyo, Japan). Wound-healing assay SRA01/04 cells were seeded in 24-well plates (1 9 105 cells/well). After 24 h of transfection with microRNA mimics or miR-26b control mimics, the cell density of each well reached 90 % confluency, and the confluent monolayers of the SRA01/04 cells were scratched with a sterile, 20 ll pipette tip. Wounded monolayers were washed with PBS to remove detached cells and debris, and fresh medium was added to each well. The wounds in each well were photographed at 0, 12, 24, and 48 h. The length of the remaining wound in each image was measured five times using the ImageJ software (National Institutes of Health, Bethesda, MD, USA). The data were quantified based on the ‘‘average gap’’ (AG, %); the wound at 0 h was considered as 100 % AG. The results were analyzed in triplicate.
CA, USA), and anti-actin (Abcam Biotechnology, Cambridge, UK). Luciferase assay The 30 -UTRs of Smad4 and COX-2 containing the predicted miR-26b binding or mutant sites were amplified by PCR using the following primers: Smad4 sense 50 -CACAACTC GAGAGGCACAAGGATGAACTCTA-30 ; Smad4 antisense, 50 -GGAAAAAAGCGGCCGCGACCTTCTGAGCA AGGCAGT-30 ; COX-2 sense 50 -TAGGCGATCGCTCGAG CTGTTGCGGAGAAAGGAGTC-30 ; COX-2 antisense, 50 AATTCCCGGGCTCGAGTAGTTACTTCTAATGCATC ATGG-30 ; mutant Smad4 sense 50 -TGATGCACTGAATTT TTGGTATAATGTTTACTTGATGT-30 ; mutant Smad4 antisense, 50 -CCAAAAATTCAGTGCATCAAATCAAGT ACAAAAATA-30 ; mutant COX-2 sense 50 -TCCGCGATC TCTCGAGCTGTTGCGCGCAAAGGAGTC-30 ; and mutant COX-2 antisense, 50 -ATTTCCTAGGCTCGAGTAGTTAC TTCTAATTTATCATGG-30 . Fragments were subcloned into the Not I and Xho I sites in the 30 -UTR of Renilla luciferase of the psiCHECK-2 reporter vector. The psiCHECK-2/Smad4 30 -UTR or psiCHECK-2/Smad4 30 -UTR mutant and psiCHECK-2/COX-2 30 -UTR or psiCHECK-2/ COX-2 30 -UTR mutant reporter plasmids (200 ng) were cotransfected with the microRNA mimics or miR-26b control mimics into SRA01/04 cells (60 % confluency). After 48 h, the cells were lysed, and reporter activity was assessed using the dual-luciferase reporter assay system (Promega, USA) in accordance with the manufacturer’s protocols.
Transwell migration assay Statistical analysis SRA01/04 cells were seeded into the inner chamber of tissue culture inserts (Transwell assay system; Corning, High Wycombe, UK) of 24-well plates. Cells transfected with microRNA mimics or miR-26b control mimics at a density of 5 9 105 cells/ml were added to the upper polycarbonate membrane insert and allowed to migrate through the 8 lm pores, and 300 ll of cultured serum-free medium was added to the lower chamber. After 48 h of incubation at 37 °C in 5 % CO2, the membranes were fixed with 10 % formaldehyde and stained with hematoxylin. The cells that had migrated to the bottom of the insert were counted five times in random microscope fields.
All experiments were performed at least three times. Quantitative data are presented as the mean ± SE and were analyzed by one-way analysis of variance (ANOVA) or Student’s t test. A P value of \0.05 was considered statistically significant.
Results Expression of miR-26b is decreased in human PCOattached LECs and SRA01/04 cells in the presence of TGF-b2
Western blot analysis The method used for Western blot analysis has previously been described in detail [12]. The primary antibodies were anti-Smad4, anti-E-cadherin, anti-fibronectin (all of the above were from Cell Signaling Technology, Beverly, MA, USA), anti-COX-2 (Santa Cruz Biotechnology, Santa Cruz,
To investigate the involvement of miR-26b in PCO development, we analyzed the levels of miR-26b in human PCO-attached LECs and normal-attached LECs by qRTPCR. MiR-26b expression was significantly decreased in human PCO-attached LECs compared with normalattached LECs (4.5-fold, P \ 0.05) (Fig. 1a).
123
Mol Cell Biochem
Fig. 1 MiR-26b is relatively downregulated in human PCO-attached LECs and SRA01/04 cells in the presence of TGF-b2. a MiR-26b expression was significantly decreased in human PCO-attached LECs compared with normal-attached LECs (4.5-fold, P \ 0.05) by qRTPCR. b, c Downregulation of E-cadherin and upregulation of fibronectin were detected in human PCO-attached LECs. d MiR26b expression was significantly decreased in a dose-dependent
manner in the SRA01/04 cells in the presence of TGF-b2 compared with control SRA01/04 cells treated with saline. e Upregulation of p-Smad2 was induced by TGF-b2 in the SRA01/04 cells compared with control SRA01/04 cells treated with saline. f Upregulation of Smad4 mRNA was induced by TGF-b2 compared with control SRA01/04 cells treated with saline
The expression of EMT markers was determined in human PCO-attached LECs and normal-attached LECs by qRT-PCR (Fig. 1b, c). Downregulation of E-cadherin and upregulation of fibronectin were detected in human PCOattached LECs. TGF-b has been proposed as the most important factor driving the EMT and pathologic fibrosis of LECs [13]. The TGF-b superfamily consists of a diverse range of proteins that include TGF-b isoforms 1, 2, and 3; TGF-b2 is the major isoform within the eye, most of which is detected in the aqueous humor [14, 15]. To investigate the involvement of miR-26b in PCO development, we analyzed the levels of miR-26b in SRA01/04 cells in the presence or absence of TGF-b2 using qRT-PCR. MiR-26b expression was significantly decreased in a dose-dependent manner in SRA01/04 cells in the presence of TGF-b2 compared with control SRA01/04 cells treated with saline (Fig. 1d). In addition, to investigate the involvement of the TGF-b2/ Smad-dependent pathway in PCO development, we analyzed the levels of p-Smad2 in SRA01/04 cells in the presence or absence of TGF-b2 by Western blot analysis
and analyzed the levels of Smad4 mRNA by qRT-PCR (Fig. 1e, f). As shown in Fig. 1e, f, the upregulation of p-Smad2 and Smad4 was induced by TGF-b2 compared with control SRA01/04 cells treated with saline.
123
MiR-26b inhibits SRA01/04 cell proliferation MiR-26b was downregulated in human PCO-attached LECs and SRA01/04 cells in the presence of TGF-b2, implicating its potential role in the biological properties of LECs. To investigate the effect of miR-26b on LEC proliferation, miR26b mimics were transfected into the SRA01/04 cell line, and the effect of miR-26b on the proliferation of SRA01/04 cells was assessed by MTT and BrdU incorporation assays. MiR26b expression was significantly increased in the SRA01/04 cells transfected with miR-26b mimics compared to those transfected with miR-26b control mimics, as shown by qRTPCR (2230-fold, P \ 0.01) (Fig. 2a). The MTT assay results revealed that overexpression of miR-26b inhibited SRA01/ 04 cell growth at 24, 48, and 72 h after transfection (P \ 0.05, Fig. 2b). In addition, SRA01/04 cells labeled
Mol Cell Biochem Fig. 2 MiR-26b inhibited SRA01/04 cell proliferation. a MiR-26b expression was significantly increased in the SRA01/04 cells transfected with miR-26b mimics compared to the SRA01/04 cells transfected with miR-26b mimics control by qRT-PCR (2230-fold, P \ 0.01). b MTT assay results revealed that the overexpression of miR-26b inhibited SRA01/04 cell growth at 24, 48, and 72 h after transfection. c The SRA01/ 04 cells labeled with BrdU were immunostained for BrdU (red) and counterstained for nuclei (blue). d BrdU assay results revealed that the overexpression of miR-26b inhibited SRA01/04 cell growth at 24, 48, and 72 h after transfection. (Color figure online)
with BrdU were immunostained for BrdU (Fig. 2c, red), and nuclei were stained with 40 , 6-diamino-2-phenylindole (DAPI; Fig. 2c, blue). The BrdU assay results revealed that
the overexpression of miR-26b inhibited SRA01/04 cell growth at 24, 48, and 72 h after transfection (P \ 0.05, Fig. 2c, d).
123
Mol Cell Biochem
Fig. 3 MiR-26b inhibits the migration of SRA01/04 cells. a, b The effects of miR-26b on SRA01/04 cell motility shown by woundhealing assay. The migration ability of SRA01/04 cells transfected with miR-26b mimics after 48 h was significantly decreased compared with that of control cells. The data were quantified based
on the ‘‘average gap’’ (AG, %); the wound at 0 h was considered 100 % AG. c Transwell migration assays were performed and analyzed to investigate the effect of miR-26b on cell migration. The number of migratory miR-26b-overexpressing SRA01/04 cells was decreased compared with that of control cells
Upregulation of miR-26b inhibits the migration of SRA01/04 cells
absence of TGF-b2. As shown in Fig. 4a, downregulation of E-cadherin and upregulation of fibronectin and Smad4 were induced by TGF-b2 in SRA01/04 cells. In miR-26boverexpressing SRA01/04 cells exposed to TGF-b2, the expression of E-cadherin was increased, and the expression of fibronectin and Smad4 was decreased. The levels of a-SMA and type I collagen were analyzed by qRT-PCR to validate the role of miR-26b in the regulation of EMT. As shown in Fig. 4b, upregulation of a-SMA and type I collagen was induced by TGF-b2 in SRA01/04 cells. However, the expression of a-SMA and type I collagen was decreased in miR-26b-overexpressing SRA01/04 cells in the presence of TGF-b2. We used miRanda to search for the 30 -UTR sequences of the mRNAs encoding Smad2, Smad3, and Smad4 and found that only the Smad4 mRNA contained a seed sequence for miR-26b, which suggests that miR-26b binds directly to its 30 -UTR (Fig. 4c). To test that idea, we performed a luciferase reporter assay to verify that miR-26b directly targets Smad4. Smad4 mRNA, including the putative target site, or its mutant in a luciferase reporter plasmid was co-transfected with miR-26b mimics or miR26b control mimics into SRA01/04 cells. Subsequently luciferase activity was measured. The luciferase activity of
To confirm the effects of miR-26b on cell migration, SRA01/04 cells were transfected with miR-26b mimics or miR-26b control mimics. As shown in Fig. 3a, b, miR-26boverexpressing cells moved slower compared with the SRA01/04 cells transfected with miR-26b control mimics, as shown by wound-healing assays. Transwell migration assays were performed and analyzed to investigate the effect of miR-26b on cell migration. After 48 h of incubation, SRA01/04 cells transfected with miR-26b mimics showed decreased migration across the polycarbonate membrane compared with control cells (Fig. 3c). MiR-26b inhibits the EMT of SRA01/04 cells via regulation of Smad4 Lens epithelial and mesenchymal proteins were analyzed to validate the role of miR-26b in the regulation of EMT by Western blot analysis. To determine the potential ability of miR-26b to downregulate fibronectin and upregulate E-cadherin, SRA01/04 cells were transfected with miR-26b mimics or miR-26b control mimics in the presence or
123
Mol Cell Biochem
Fig. 4 MiR-26b inhibits the EMT of SRA01/04 cells via regulation of Smad4. a Western blot analysis detected down-regulated E-cadherin and up-regulated fibronectin and Smad4 in SRA01/04 cells treated with TGF-b2. However, the expression of E-cadherin was increased and the expression of fibronectin and Smad4 was decreased in SRA01/04 cells transfected with miR-26b mimics in the presence of TGF-b2. b The overexpression of miR-26b affected the expression of a-SMA and type I collagen in SRA01/04 cells. QRT-PCR detected that upregulation of a-SMA and type I collagen was induced by TGFb2 in SRA01/04 cells; however, the expression of a-SMA and type I collagen was decreased by overexpression of miR-26b. c The region
of the Smad4 mRNA 30 -UTR predicted to be targeted by miR-26b. d Dual-luciferase report assays were performed on SRA01/04 cells. Smad4 mRNA, including the putative target site, or its mutant into a luciferase reporter plasmid was co-transfected along with miR-26b mimics or miR-26b mimics control into SRA01/04 cells. The luciferase activity of WT reporter transfected with miR-26b mimics was significantly decreased compared with miR-26b mimics control (P \ 0.01). However, the luciferase reporter activity was not inhibited by miR-26b mimics when the seeding sites were mutated (P [ 0.05)
the wild-type (WT) reporter co-transfected with the miR26b mimics was significantly decreased compared with cells transfected with the miR-26b control mimics (P \ 0.01, Fig. 4d). However, the luciferase reporter activity was not inhibited by the miR-26b mimics when the seed sequences were mutated. These results indicate that miR-26b specifically binds to the 30 -UTR of Smad4.
MiR-26b inhibits the EMT of human PCO-attached LECs via regulation of COX-2 To determine the potential ability of miR-26b to downregulate fibronectin and upregulate E-cadherin, human PCO-attached LECs were transfected with miR-26b mimics or miR-26b control mimics. When comparing human
123
Mol Cell Biochem
Fig. 5 MiR-26b inhibits the EMT of human PCO-attached LECs via regulation of COX-2. a Western blot analysis detected downregulated E-cadherin and up-regulated fibronectin and COX-2 in human PCO-attached LECs, comparing with that of normal-attached LECs. However, the expression of E-cadherin was increased and the expression of fibronectin and COX-2 was decreased in human PCOattached LECs transfected with miR-26b mimics. b The overexpression of miR-26b affected the expression of a-SMA and type I collagen in human PCO-attached LECs. QRT-PCR detected the expression of a-SMA, and type I collagen was increased in human PCO-attached LECs; comparing with that of normal-attached LECs, however, the
expression of a-SMA and type I collagen was decreased by overexpression of miR-26b. c The region of the COX-2 mRNA 30 UTR predicted to be targeted by miR-26b. d Dual-luciferase report assays were performed on SRA01/04 cells. COX-2 mRNA, including the putative target site, or its mutant into a luciferase reporter plasmid was co-transfected along with miR-26b mimics or miR-26b mimics control into SRA01/04 cells. The luciferase activity of WT reporter transfected with miR-26b mimics was significantly decreased compared with miR-26b mimics control (P \ 0.01). However, the luciferase reporter activity was not inhibited by miR-26b mimics when the seeding sites were mutated (P [ 0.05)
PCO-attached LECs to normal-attached LECs, the expression of E-cadherin was decreased, and the expression of fibronectin and COX-2 was increased in PCOattached LECs, as shown by Western blot analysis (Fig. 5a). However, downregulation of fibronectin and COX-2 and upregulation of E-cadherin were induced in miR-26b-overexpressing, human PCO-attached LECs. The levels of a-SMA and type I collagen were analyzed by qRT-PCR to validate the role of miR-26b in the regulation of EMT. When comparing human PCO-attached LECs to normal-attached LECs, the expression of a-SMA and type I collagen was increased in human PCO-attached LECs (Fig. 5b). However, downregulation of a-SMA and
type I collagen was induced in miR-26b-overexpressing, human PCO-attached LECs. We used miRanda to search for the 30 -UTR sequence of the mRNA encoding COX-2. As shown in Fig. 5c, a region of the COX-2 mRNA 30 -UTR was predicted to be targeted by miR-26b, which suggests that miR-26b binds directly to the 30 -UTR of COX-2. To test that idea, we performed a luciferase reporter assay to verify that miR-26b directly targets COX-2. The COX-2 mRNA, including the putative target site or its mutant, in a luciferase reporter plasmid was co-transfected with miR-26b mimics or miR-26b control mimics into SRA01/04 cells. Subsequently, luciferase activity was measured. The luciferase activity of the
123
Mol Cell Biochem
WT reporter transfected with miR-26b mimics was significantly decreased compared with the miR-26b control mimics (P \ 0.01, Fig. 5d). However, the luciferase reporter activity was not inhibited by the miR-26b mimics when the seed sequences were mutated (P [ 0.05). These results indicate that miR-26b specifically binds to the 30 UTR of the COX-2 mRNA.
Discussion In this study, we discovered that miRNA-26b was downregulated in human PCO-attached LECs and SRA01/04 cells in the presence of TGF-b2, which implies its potential role in PCO. Given that the identification of miRNA targets is critical to investigate the functions of miRNAs and because the biological significance of miRNA deregulation relies on the target genes, we performed computational predictions of the target genes for miR-26b. This analysis predicted that the 30 -UTR of the human Smad4 mRNA and the 30 -UTR of the COX-2 mRNA were targets of miR-26b, as shown by TargetScan (http://www.targetscan.org/) and miRanda (http:// www.microrna.org/). Our results revealed that miRNA-26b inhibits the proliferation, migration, and EMT of lens epithelial cells via regulation of Smad4 and COX-2. The main molecular pathways involved in the induction of the LEC EMT include the TGF-b2/Smad [10, 13], Wnt/ b-catenin [11], and extracellular matrix/ILK pathways [16]. TGF-b/Smad pathway has been proposed as an important pathway driving the EMT and pathologic fibrosis of LECs [17]. Smads can be divided into three distinct subclasses: receptor-activated Smads (R-Smads), commonpartner Smads (Co-Smads), and inhibitory Smads (antiSmads). Smad4 belongs to the evolutionarily conserved family of Smad proteins, which is the only identified CoSmad in mammals. When TGF-b2 binds to its receptor, Smad2/3 is phosphorylated and binds to Smad4 to form the R-Smad/Smad4 heteromeric complex, and together they are transported into the nucleus and combine with a coactivator or a co-repressor to regulate the translation and expression of a target gene [10, 13]. In this process, Smad4 is a central signaling component of the TGF-b2/Smad signaling pathway. A previous study suggested that the expression of Smad4 in the cell nucleus was increased in a human lens cell line, FHL 124, following TGF-b2 exposure, as shown by immunocytochemistry [18]. In addition, the regulation of fibronectin gene expression appeared to be Smad4-dependent, as fibronectin expression was significantly suppressed in Smad4-knockdown FHL 124 cells in both the presence and absence of TGF-b2 treatment [17]. It is suggested that Smad4 plays a key role in the TGF-b2/ Smad signaling pathway in the EMT and pathologic fibrosis of LECs.
Our study suggested that Smad4 was a possible target of miR-26b. Dual-luciferase reporter assays demonstrated that the downregulation of luciferase activity was mediated by the direct binding of miR-26b to the Smad4 30 -UTR because alteration of this region abolished this effect. In addition, overexpression of miR-26b suppressed Smad4 protein levels in SRA01/04 cells in the presence of TGFb2. In our study, restoration of miRNA-26b inhibited the proliferation, migration, and EMT of lens epithelial cells, which could possibly be due to miR-26b-mediated downregulation of Smad4 expression. COX-2 is an inducible enzyme that catalyzes the conversion of arachidonic acid to prostaglandins and other eicosanoids. COX-2 is usually not detectable but is inducible by bacterial endotoxins, cytokines, growth factors, and tumor promoters [19–21]. COX-2 is involved in tumor development and growth through the enhancement of tumor proliferation and angiogenesis; and it regulates cell proliferation, cell adhesion, inhibition of apoptosis, immune surveillance, and angiogenesis through the synthesis of prostaglandin E2 [22]. A previous study suggested that COX-2 is upregulated in canine cataracts and PCO [23]. Furthermore, inhibiting its enzymatic activity effectively prevented the EMT of LECs in an ex vivo model of PCO [23]. Consistent with previous studies, our study demonstrated that the expression of the COX-2 protein was increased in human PCO-attached LECs compared with that of normal-attached LECs, as shown by Western blot analysis. It is suggested that COX-2 is involved in the EMT and pathologic fibrosis of LECs. Computational predictions of the target genes by miRanda showed that the 30 -UTR of the COX-2 mRNA contained a binding site for miR-26b. To confirm the targeting of COX-2 by miR-26b, we integrated a fragment of the COX-2 mRNA 30 -UTR containing the target sequence or mutated seed sequence into a luciferase reporter vector. Dual-luciferase reporter assays demonstrated that the downregulation of luciferase activity was mediated by the direct binding of miR-26b to the COX-2 30 -UTR because alteration of this region abolished this effect. In addition, overexpression of miR-26b suppressed COX-2 protein levels in human PCO-attached LECs. Consistent with previous studies that showed direct binding of miR-26b to the COX-2 30 -UTR in desferrioxamine (DFOM)-treated carcinoma of nasopharyngeal epithelial (CNE) cells [24] and in breast cancer cells [25], miRNA-26b inhibited the proliferation, migration, and EMT of lens epithelial cells, which could possibly be due to miR-26b-mediated downregulation of COX-2 expression. In summary, the current study provides new insights regarding the ability of miRNA-26b to inhibit the proliferation, migration, and EMT of lens epithelial cells. These data indicate that miR-26b may serve as a PCO suppressor
123
Mol Cell Biochem
gene involved in PCO pathogenesis by directly silencing Smad4 and COX-2. Acknowledgments This work was supported by research Grants from the National Natural Science Foundation for the Young Scholars of Beijing Shijitan Hospital, Capital Medical University (No. 2013-QB01), and the National Natural Science Foundation of China (No. 81270984).
References 1. Findl O, Buehl W, Bauer P et al (2010) Interventions for preventing posterior capsule opacification. Cochrane Database Syst Rev 17(2):CD003738 2. Wormstone IM, Wang L, Liu CS (2009) Posterior capsule opacification. Exp Eye Res 88(2):257–269 3. He L, Hannon GJ (2004) MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet 5(7):522–531 4. Wolf L, Gao CS, Gueta K et al (2013) Identification and characterization of FGF2-dependent mRNA: microRNA networks during lens fiber cell differentiation. G3 (Bethesda) 3(12):2239– 2255 5. Varma SD, Kovtun S, Hegde K et al (2012) Effect of high sugar levels on miRNA expression. Studies with galactosemic mice lenses. Mol Vis 18:1609–1618 6. Varma SD, Kovtun S (2013) Protective effect of caffeine against high sugar-induced transcription of microRNAs and consequent gene silencing: a study using lenses of galactosemic mice. Mol Vis 19:493–500 7. Hoffmann A, Huang Y, Suetsugu-Maki R et al (2012) Implication of the miR-184 and miR-204 competitive RNA network in control of mouse secondary cataract. Mol Med 18:528–538 8. Verghese ET, Drury R, Green CA et al (2013) MiR-26b is downregulated in carcinoma-associated fibroblasts from ER-positive breast cancers leading to enhanced cell migration and invasion. J Pathol 231(3):388–399 9. Wang Y, Li W, Zang X et al (2013) MicroRNA-204-5p regulates epithelial-to-mesenchymal transition during human posterior capsule opacification by targeting SMAD4. Invest Ophthalmol Vis Sci 54(1):323–332 10. Li J, Tang X, Chen X (2011) Comparative effects of TGF-b2/ Smad2 and TGF-b2/Smad3 signaling pathways on proliferation, migration, and extracellular matrix production in a human lens cell line. Exp Eye Res 92(3):173–179
123
11. Bao XL, Song H, Chen Z et al (2012) Wnt3a promotes epithelialmesenchymal transition, migration, and proliferation of lens epithelial cells. Mol Vis 18:1983–1990 12. Dong N, Li X, Xiao L et al (2012) Upregulation of retinal neuronal MCP-1 in the rodent model of diabetic retinopathy and its function in vitro. Invest Ophthalmol Vis Sci 53(12):7567–7575 13. Lee EH, Joo CK (1999) Role of transforming growth factor-beta in transdifferentiation and fibrosis of lens epithelial cells. Invest Ophthalmol Vis Sci 40(9):2025–2032 14. Saika S, Miyamoto T, Kawashima Y et al (2000) Immunolocalization of TGF-beta1, -beta2, and -beta3, and TGF-beta receptors in human lens capsules with lens implants. Graefes Arch Clin Exp Ophthalmol 238(3):283–293 15. Gordon-Thomson C, de Iongh RU, Hales AM et al (1998) Differential cataractogenic potency of TGF-beta1, -beta2, and -beta3 and their expression in the postnatal rat eye. Invest Ophthalmol Vis Sci 39(8):1399–1409 16. Sponer U, Pieh S, Soleiman A et al (2005) Upregulation of alphavbeta6 integrin, a potent TGF-beta1 activator, and posterior capsule opacification. J Cataract Refract Surg 31(3):595–606 17. Dawes LJ, Sleeman MA, Anderson IK et al (2009) TGFbeta/ Smad4-dependent and -independent regulation of human lens epithelial cells. Invest Ophthalmol Vis Sci 50(11):5318–5327 18. Wormstone IM, Tamiya S, Eldred JA et al (2004) Characterisation of TGF-beta2 signalling and function in a human lens cell line. Exp Eye Res 78(3):705–714 19. Stoll SW, Rittie´ L, Johnson JL et al (2012) Heparin-binding EGFlike growth factor promotes epithelial-mesenchymal transition in human keratinocytes. J Invest Dermatol 132(9):2148–2157 20. Kirane A, Toombs JE, Larsen JE et al (2012) Epithelial-mesenchymal transition increases tumor sensitivity to COX-2 inhibition by apricoxib. Carcinogenesis 33(9):1639–1646 21. Vane JR, Bakhle YS, Botting RM (1998) Cyclooxygenases 1 and 2. Annu Rev Pharmacol Toxicol 38:97–120 22. Tilley SL, Coffman TM, Koller BH (2001) Mixed messages: modulation of inflammation and immune responses by prostaglandins and thromboxanes. J Clin Invest 108(1):15–23 23. Chandler HL, Barden CA, Lu P et al (2007) Prevention of posterior capsular opacification through cyclooxygenase-2 inhibition. Mol Vis 13:677–691 24. Ji Y, He Y, Liu L et al (2010) MiRNA-26b regulates the expression of cyclooxygenase-2 in desferrioxamine-treated CNE cells. FEBS Lett 584(5):961–967 25. Li J, Kong X, Zhang J et al (2013) MiRNA-26b inhibits proliferation by targeting PTGS2 in breast cancer. Cancer Cell Int 13(1):7
