HHS Public Access Author manuscript Author Manuscript
Biochim Biophys Acta. Author manuscript; available in PMC 2017 February 01. Published in final edited form as: Biochim Biophys Acta. 2016 February ; 1862(2): 252–264. doi:10.1016/j.bbadis.2015.12.005.
Mitochondrial ClpP activity is required for cisplatin resistance in human cells Yang Zhang and Michael R. Maurizi† Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892
Author Manuscript
Abstract
Author Manuscript
In human cells ClpP and ClpX are imported into the mitochondrial matrix, where they interact to form the ATP-dependent protease ClpXP and play a role in the mitochondrial unfolded protein response. We find that reducing the levels of mitochondrial ClpP or ClpX renders human cancer cells more sensitive to cisplatin, a widely used anti-cancer drug. Conversely, overexpression of HClpP desensitizes cells to cisplatin. Overexpression of inactive HClpP-S97A had no effect. Cisplatin resistance correlated with decreased cellular accumulation of cisplatin and decreased levels of diguanosine-cisplatin adducts in both mitochondrial and genomic DNA. In contrast, higher levels of cisplatin-DNA adducts were found in cells in which HClpP had been depleted. Changes in the levels of ClpP had no effect on the levels of CTR1, a copper transporter that contributes to cisplatin uptake. However, the levels of ATP7A and ATP7B, copper efflux pumps that help eliminate cisplatin from cells, were increased when HClpP was overexpressed. HClpP levels were elevated in cervical carcinoma cells (KB-CP) and hepatoma cells (BEL-7404) independently selected for cisplatin resistance. The data indicate that robust HClpXP activity positively affects the ability of cells to efflux cisplatin and suggest that targeting HClpP or HClpX would offer a novel mechanism for sensitizing cancer cells to cisplatin.
Keywords HClpP; HClpXP; mitochondria; ATP7A; copper transport; apoptosis
1. Introduction Author Manuscript
The success of proteasome inhibitors in treating refractory cancers such as multiple myeloma has spurred interest in the development of inhibitors that target other components of the ubiquitin/proteasome system and other protein quality control enzymes in general [1, 2]. Recently inhibitors of p97/VCP used alone or in combination with proteasome inhibitors have been shown to effectively kill cancer cells in vitro [3, 4] and at least one major effort is
†
Address correspondence to: Michael R. Maurizi, Laboratory of Cell Biology, National Cancer Institute, Bldg. 37 Room 2128, 37 Convent Dr. Bethesda, MD 20892-4256; Tel: 301-496-7961; FAX: 301-480-2284;
[email protected]. Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Zhang and Maurizi
Page 2
Author Manuscript Author Manuscript
underway to develop p97 inhibitors for treating cancer [5]. In addition to the cytosolic ubiquitin/ proteasome and protein quality control systems, mammalian cells have three other families of ATP-dependent proteases located within the mitochondria; Lon [6], FtsH [7, 8], and ClpXP [9–12]. These proteases are homologous to bacterial ATP-dependent proteases that perform regulatory protein degradation and maintain protein quality control [13–17]. While numerous targets and functions have now been identified for the eukaryotic Lon and FtsH homologs [18–23], relatively little has been known about the functions of human ClpXP (HClpXP). Recently mutations in human ClpP have been linked to Perrault’s syndrome, an autosomal-recessive condition accompanied by ovarian and neurosensory impairment [24], and knockout mice lacking ClpP have been shown to produce sick offspring with male and female infertility and auditory defects [25]. Interestingly, CLPP−/− mice have elevated levels (1.5-4-fold depending on the tissue) of mitochondrial DNA (MtDNA), although whether that effect underlies the developmental defects or is a compensatory mechanism to restore some degree of function is not yet known. Thus, mitochondrial ClpXP clearly performs important functions and is required for robust growth and development.
Author Manuscript
HClpXP is a bipartite chaperone/protease complex composed of two proteins, a homolog of the E. coli ATP-dependent protein unfoldase, ClpX, and a homolog of the selfcompartmentalized protease, ClpP [11, 12, 26]. Human cells have a single copy of HCLPP located on chromosome 19p13.3 and a single copy of HCLPX located on chromosome 15q22.31 [9, 11]. Both proteins are imported to the mitochondrial matrix. Recombinant HClpX and HClpP are similar in structure and biochemical properties to their E. coli counterparts [12, 26, 27], although HClpP has a proline-rich 28-residue C-terminal extension that is absent in eClpP [26] suggesting that it might have an additional functional interaction either with HClpX or with another cellular factor.
Author Manuscript
Because the Clp proteolytic systems are involved in stress responses in bacterial cells, we investigated the effects of increased or decreased ClpP or ClpX expression on human cell cultures subjected to various stresses. We observed that changing the levels of HClpP in HeLa cells affected their sensitivity to cisplatin (cis-diaminodichloroplatinum II), a commonly used chemotherapeutic agent. Although cisplatin is highly reactive and targets many biological molecules, its effectiveness as a chemotherapeutic agent is undermined by the development of resistant tumors and by toxic side-effects inclduing hearing loss and infertility. Most cisplatin resistance is attributable to decreased uptake or increased efflux of cisplatin, thus increasing the therapeutic dose to levels that are prohibitively toxic to normal cells [28]. Cisplatin accumulates in mitochondria [29], which are thought to be the major target for cisplatin in cancer cells [30]. Among its many targets, cisplatin cross-links to DNA and interferes with transcription and replication. In human malignant melanoma cells, cisplatin preferentially binds to mitochondrial DNA and blocks synthesis of ATP [31]. Alterations in mitochondrial function have been implicated in cancer cell resistance to other chemotherapeutic agents [32, 33], and very recently studies have shown that lowering the copy number of mitochondrial DNA sensitizes cells to cisplatin (Mei et al 2015). Here we report that elevated levels of HClpP result in lower sensitivity to cisplatin-induced apoptosis, and conversely lower levels of HClpP or HClpX lead to increased cisplatin Biochim Biophys Acta. Author manuscript; available in PMC 2017 February 01.
Zhang and Maurizi
Page 3
Author Manuscript
sensitivity. Further, we find that HClpP is elevated in independently selected cisplatinresistant cells derived from KB cervical adenocarcinoma (KB-CPr) and hepatoma BEL-7404-CPr cell lines. We propose that HClpP activity contributes to robust cell growth and protects cells by reducing accumulation of cisplatin thereby reducing damage to nuclear and mitochondrial DNA. While these studies were underway, Dan et al (2015) reported that inhibition of mitochondrial ClpP blocked oxidative phosphorylation and mitochondrial metabolism and kills human AML cells that require elevated levels of ClpP for viability. Our findings that cells with lower HClpP activity are more sensitive to cisplatin suggest that ClpP might be an even more broadly efficacious target for anticancer therapy.
2. Materials and methods 2.1 Reagents and antibodies
Author Manuscript Author Manuscript
The sources for various reagents and kits were: Cisplatin (Sigma, St. Louis, MO); hygromycin B (Mediatech, Inc., Herndon, VA); ECL Western blotting detection reagents (GE Healthcare Bio-Sciences Corp., Piscataway, NJ); fetal bovine serum, DMEM, Lglutamine, penicillin, streptomycin, Lipofectamine Plus reagent, Gibco trypsin-EDTA reagent, PCR primers, and nitrocellulose membranes (Invitrogen, Carlsbad, CA); RIPA buffer (Thermo Scientific, Rockford, IL); Mitochondria Isolation Kit and BCA protein assay kit (Pierce, Rockford, IL); Protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN); TRIzol reagent and methionine-free DMEM (Life Technologies, Grand Island, NY); Wizard Genomic DNA purification kit (Promega, Madison, WI). Sources for antibodies were: antiHsp60, (Chemicon International, Temecula, CA); anti-PARP, anti-cleaved caspase 3 and cleaved caspase 7 (Cell Signaling, Beverly, MA); anti-cisplatin-modified DNA (Abcam, Cambridge, MA); anti-ATP7A, anti-ATP7B, and anti-Ctr1 (Santa Cruz Biotechnology Inc., Santa Cruz, CA). Anti-actin antibody was obtained from Sigma; the antibody recognizes an identical 11-amino acid peptide at the C-terminus of the three major forms, α-, β- and γactin. The proteins have identical mobility on SDS gels, and the band is labeled actin in all blots. 2.2 Growth of HeLa cells and stable transfectants
Author Manuscript
All transfectants used in this study were constructed in a parental HeLa cell line obtained from the American Type Culture Collection (Manassas, VA). For isolation of stable transfectants, the HeLa cells were transfected with empty vector pTRE2 or with pTRE2 into which coding regions expressing wild type or mutated HClpP proteins had been inserted (see below). Transfection was performed in the presence of Lipofectamine Plus reagent according to the manufacturer’s instructions. The single cell clones were maintained in DMEM containing 350 µg/ml of hygromycin. Two transfectants that overexpress HClpP was selected for study and are designated HP7 and HP23. Additional stable transfectants used in this study include: HP17, which expresses wild type HClpP with tandem C-terminal His and HA tags (protein referred to as HP-HA); HP5, which expresses the active site mutant HClpP-S97A with C-terminal His and HA tags; HP4, which expresses wild type HClpP from a doxycycline-inducible promoter.
Biochim Biophys Acta. Author manuscript; available in PMC 2017 February 01.
Zhang and Maurizi
Page 4
2.3 Other cell cultures
Author Manuscript
KB-3-1, KB-CP.5, and KB-CP20 were from Dr. Michael Gottesman in the Laboratory of Cell Biology at the National Cancer Institute. KB-3-1 was originally derived from human KB cervical carcinoma cells (a variant of HeLa) after two subclonings from the parental cells. The cisplatin-resistant KB-CP.5 and KB-CP20 cells were selected for resistance to 0.5 µg/ml and 20 µg/ml cisplatin respectively [58]. KB-CP.5 cells were cultured in DMEM medium containing 0.5 µg/ml cisplatin. KB-CP20 cells were cultured in DMEM containing 5 µg/ml cisplatin. 2.4 Construction of plasmids expressing HClpP and HClpPS97A
Author Manuscript Author Manuscript Author Manuscript
A gene encoding HClpP was amplified by PCR from pVEX11HClpP [12] using the forward primer, 5’AGTCGGATCCACCACCATGTGGCCCGGAATATTG-3’ and the back primer 5’-AGTCACGCGTTCAGGTGCTAGCTGGGAC-3’ creating a BamHI site at the 5’ and an MluI site at the 3’ end of the coding region. The PCR fragment was digested and inserted between BamHI and MluI sites in the plasmid pTRE2 (BD-Biosciences, Clontech, Mountain View, CA), creating pTRE2-HClpP, which expresses HClpP under a mini CMV promoter. Additional clones expressing HClpP variants were constructed in pTRE2 in a similar manner using appropriate PCR products and engineered BamHI and MluI sites. pTRE2HClpP-His encoding His-tagged wild type HClpP was amplified by PCR from pTRE2HClpP using the above forward primer and the back primer 5’AGTCACGCGTTCAATGGTGATGGTGATGGTGATGGTGGGTGCTAGCTGGGAC-3’ which added eight histidine residues to the C-terminus of HClpP. We created pTRE2HClpP-HA expressing tandemly His and HA tagged HClpP by PCR from pTRE2-HClpPHis using the above forward primer and the back primer 5’GCTAGCACGCGTTCATGCATAGTCTGGCACATCGTAAGGGTAGCTGCCATGGTG GGATGGTG GTGGTGGTGGGTGCTAGCTGG-3’. For catalytically inactive HClpP, we used primers 5’-AGTCGGATCCACCACCATGTGGCCCGGAATATTG-3’, 5’CGGCGGCGAGAAGCAGGGAGCCCATGGCGGCGGCCTGGCCCACGCACCAGGTG -3’, 5’CACCTGGTGCGTGGGCCAGGCCGCCGCCATGGGCTCCCTGCTTCTCGCCGCCG-3’ , and 5’AGTCG GATCCACCACCATGTGGCCCGGAATATTG-3’ to change Ser97 to Ala by over lapping PCR. We used 5’AGTCGGATCCACCACCATGTGGCCCGGAATATTG-3’ and 5’-AGT CACGCGTTCAATGGTGATGGTGATGGTGATGGTGGGTGCTAGCTGGGAC3’ to obtain pTRE2-HClpP-SA-His from pTRE2HClpP-SA and primers 5’AGTCGGATCCACCACCATGTGGCCCGGAATATTG-3’ and 5’GCTAGCACGCGTTCATGCATAGTCTGGCACATCGTAAGGGTAGCTGCCATGGTG GTGATGGT GGTGGTGGTGGTGCTAGCTGG-3’ to get pTRE2HClpP-SA-His-HA from pTRE2HClpP-SA-His. For all constructs, DNA sequencing confirmed the presence of the desired coding regions of HClpP variants including its native mitochondrial targeting sequence.
Biochim Biophys Acta. Author manuscript; available in PMC 2017 February 01.
Zhang and Maurizi
Page 5
2.5 Human ClpP and ClpX depletion
Author Manuscript
Human CLPP and human CLPX siRNAs and non-silencing control siRNA (siGenome NoTargeting control #3) were purchased from Thermo Scientific (Lafayette, CO). To completely deplete HClpP, 100 nM of a mixture of four siRNAs or 50 nM individual siRNAs (HCLPP-siRNA#3 or #1) were used. Cultures were treated for 24 h with siRNAs introduced in the Dharmacon siRNA reagent, Fect1 (Thermo Scientific, Lafayette, CO), according to the manufacturer’s instructions. For partial depletion of HClpP, cells were treated with 10 nM HCLPP-siRNA#3 or #1 for 5–8 h and the medium was changed to remove unabsorbed siRNA. Cells were incubated in fresh medium without siRNA for 16–19 h prior to further treatment. Partial depletion of HClpX was obtained using 50 nM of a mixture of siRNAs for 24 h after which the siRNA was removed and replaced with fresh medium.
Author Manuscript
2.6 Western blotting and detection of proteins
Author Manuscript
After removing growth medium and washing the cells with phosphate buffered saline (PBS), cells were detached by treating with Gibco trypsin-EDTA reagent, collected by centrifugation, and washed three times with PBS. Cell lysates were prepared on ice with buffer containing 10 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 0.5% Nonidet P40, 100 mM NaF, 10 mM sodium pyrophosphate, 10 mM sodium orthovanadate, and a protease inhibitor cocktail (Cat No. 11873580001 Roche). The lysates were centrifuged at 700 × g for 30 min at 4 ° C, and the insoluble fraction was discarded. Extracts were mixed with an equal volume of 2× SDS sample buffer (100 mM Tris/HCl, pH 7.5, containing 2 mM EDTA, 4% SDS, 10% β-mercaptoethanol, and 30% glycerol) and heated at 95 °C except for detection of ATP7A, ATP7B, and Ctr1, in which case the samples in SDS were heated at 37 Ç. For 30 min. Protein concentrations were determined using the Pierce xxx assay and equal amounts of proteins (usually 25 or 50 µg) were loaded into the lanes and separated by SDS-PAGE. Proteins were electrophoretically transferred to a 0.2-µ nitrocellulose membrane, and the membranes were blocked with 5% non-fat dry milk in Tris-buffered saline containing 0.1 % Tween-20. The membranes were incubated at room temperature for 2 h or overnight at 4 °C in the same solution to which appropriate antibodies had been added. After incubation, the membrane was washed extensively, and immunoreactive proteins were detected by chemiluminescence after incubation with secondary antibodies conjugated to horseradish peroxidase. To reprobe blots for additional proteins, membranes were treated with Restore Western Blot Stripping Buffer (Pierce, Rockford, IL), blocked, and incubated with fresh antibodies as above.
Author Manuscript
Initially antibodies were added at the dilutions recommended by the supplier; the dilutions were adjusted as needed. A ladder of proteins was applied to lanes of all gels, and blots were aligned with the standards to verify that the sizes of the immunoreactive bands corresponded to the reported sizes of the protein species recognized by the antibodies. 2.7 Isolation and quantification of mRNA Total RNA was isolated from cells using the TRIzol reagent (Invitrogen) according to the supplier’s protocol. For each sample, RNA (1 µg in 50 µl reaction) was converted to cDNA using the TaqMan reverse transcriptase from Applied Biosystems. After diluting the mixture Biochim Biophys Acta. Author manuscript; available in PMC 2017 February 01.
Zhang and Maurizi
Page 6
Author Manuscript Author Manuscript
to 100 µl, 5 µl-aliquots of the cDNA along with 15 nM of each appropriate primer were used for quantitative real-time PCR with the LightCycler RNA Amplification PCR kit with SYBR Green1 (Applied Biosystems, Foster City, CA) as recommended by the supplier. For HCLPP message, the sense primer was 5’-CAGCTCCTCTTCCTGCAATCC-3’ and the anti-sense primer was 5’-CACACCACCAGGGCTGTTG-3’. For HCLPX message, the sense primers 5’-GTCCTAAATGTGGCGACTTGTG-3’ and the anti-sense primer was 5’CACTTGACAAAACGGGTGGAT-3’. Control GAPDH mRNA (1:100 dilution) was amplified with the primers, 5’-ATGGAATCCCATCACCATCTT-3’ and 5’CCAGCATCGCCCCACTT-3’. To validate amplification across the GAPDH concentration range, a standard curve was constructed using the Cp values obtained with a serial dilution of cDNA amplified from 0.005–5 ng mRNA isolated from cells treated with 50 nM control si-RNA for 5 h. For HCLPP and HCLPX, standard curves were constructed amplification of serial dilutions of pTRE2-HClpP or pTRE2-HCLPX mRNA (0.001–10 pg). The relative amounts of mRNA in each sample were determined from the respective standard curves, and the ratio of HCLPP or HCLPX mRNA to GAPDH mRNA was calculated. 2.8 Cisplatin treatment Cisplatin was dissolved in PBS, frozen rapidly, and stored in small aliquots at −80 °C. To test the sensitivity of cells to cisplatin, an aliquot of cisplatin was added directly to culture medium, and cell visibility was measured after 16–48 h. The concentration of cisplatin used and the length of time of exposure are indicated in the figure legends. 2.9 Measurement of apoptosis and cell killing
Author Manuscript Author Manuscript
Several assays were used to assess cell killing or induction of apoptosis as a result of exposure to cisplatin. Cells were collected by trypsinization and stained with trypan blue. Cells were counted using a hemocytometer, and the percentage of non-viable cells was determined as the number of trypan blue-stained cells divided by the total number of cells. Cell viability was also measured using the Cell Counting Kit-8 (Dojindo Laboratories, Gaithersburg, MD) and following the procedure recommended by the manufacturer. About 5000 cells were seeded into each well of a 96-well plate, grown for one day, and treated in triplicate with different concentrations of cisplatin. The percentage of viable cells remaining was indicated by the remaining dehydrogenase activity determined by reduction of a tetrazolium dye. Lethal cell damage was also measured by monitoring the progress of apoptosis using the Annexin V-PE Apoptosis Detection Kit I (BD Biosciences, San Jose, CA). Briefly, after treating cells with cisplatin, both floating and adherent cells released by trypsin were collected and washed twice with cold PBS. Cells were suspended in binding buffer at a concentration of 1 × 106 cells/ml, and 1 × 105 cells were transferred to a 5 ml culture tube, treated with amounts of Annexin V-PE recommended by the manufacturer, and incubated at room temperature in the dark. After 15 min, 400 µl of binding buffer was added and samples were processed by flow cytometry. Data acquisition and analysis were performed using a Becton Dickinson FACScan flow cytometer using the CellQuest software (Becton Dickinson, Mountain View, CA).
Biochim Biophys Acta. Author manuscript; available in PMC 2017 February 01.
Zhang and Maurizi
Page 7
2.10 Cell lysis and western blotting
Author Manuscript Author Manuscript
Harvested cells were washed twice in PBS and suspended in RIPA buffer (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% NP-40, 1% sodium deoxycholate, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM sodium vanadate, 1 µg/ml leupeptin) containing a protease inhibitor cocktail to lyse the cells to give a protein concentration of 1–2 mg/ml. After 30 min on ice, the lysates were centrifuged for 30 min at 4 ° C, and the insoluble fraction was discarded. Extracts were mixed with an equal volume of 2× SDS sample buffer (100 mM Tris/HCl, pH 7.5, containing 2 mM EDTA, 4% SDS, 10% β-mercaptoethanol, and 30% glycerol) and heated at 95 °C. Proteins (25 or 50 µg) were separated by SDS-PAGE, and transferred to a 0.2-micron nitrocellulose membrane. The membranes were blocked with 5% non-fat dry milk in Tris-buffered saline containing with 0.1 % Tween-20 and then incubated overnight at 4 °C with antibody diluted in the same solution. The membrane was washed extensively, and immunoreactive proteins were detected by chemiluminescence after incubation with secondary antibodies conjugated to horseradish peroxidase. To reprobe blots for additional proteins, membranes were treated with Restore Western Blot Stripping Buffer (Pierce, Rockford, IL), blocked, and incubated with fresh antibodies as above. 2.11 Fractionation of mitochondria and cytosol
Author Manuscript
Mitochondria were fractionated according to the manufacturer’s instructions using a Mitochondria Isolation Kit (Pierce Cat. No. 89874). The protease inhibitor cocktail described above was added to all solutions. Briefly, 20 × 107 cells were collected by centrifugation, to which 800 µl of Mitochondria Isolation Reagent A was added. After 2 min of incubation on ice, 10 µl of Mitochondria Isolation Reagent B was added and incubation was continued on ice for 5 min followed by addition of 800 µl of Mitochondria Isolation Reagent C. Nuclei and other large particles were removed by centrifugation at 700g for 10 min at 4°C. The solution was then centrifuged at 12, 000 × g for 15 min at 4°C to separate the mitochondria in the pelleted fraction from the supernatant cytosolic fraction. Mitochondria were suspended in 500 µl Mitochondria Isolation Reagent C and collected again by centrifugation at 12,000 × g for 5 min at 4° C. 2.12 Platinum uptake and incorporation into DNA
Author Manuscript
Uptake and incorporation of platinum was measured by atomic absorption or by immunochemical detection with a specific antibody. For cisplatin uptake, the cells were incubated with different amounts of cisplatin for the indicated times, after which ~106 cells were suspended in 200 µl PBS and 400 µl HNO3 and placed in an ultrasonic bath for 5 min. Platinum was measured by flameless atomic absorption on an PerkinElmer 4100ZL atomic absorption spectrometer. To measure cisplatin uptake into mitochondria, cells were lysed and mitochondria were isolated as described above. Mitochondria were dissolved in 1.5 ml of 5 M nitric acid and incubated for 24 h at room temperature. Platinum was quantitated by inductively coupled plasma mass spectrometry. For measurement of platinum adducts in DNA, the cells were incubated with cisplatin for 5 and 16 h. Genomic DNA was extracted from the cells using the Wizard Genomic DNA Isolation kit as directed by the supplier. For mitochondrial DNA isolation, mitochondria were first prepared using the Mitochondria
Biochim Biophys Acta. Author manuscript; available in PMC 2017 February 01.
Zhang and Maurizi
Page 8
Author Manuscript
Isolation Kit described above and DNA was prepared from the mitochondria using the Wizard kit mentioned above. Equal aliquots of DNA were spotted onto nitrocellulose membranes and cross-linked by UV irradiation. Diguanosine-cisplatin adducts were detected immunochemically with a monoclonal antibody and HRP-conjugated secondary antibodies (Abcam). 2.13 Measurement of mitochondrial DNA
Author Manuscript
The mitochondrial DNA copy number was measured according to the procedure used by Dan et al (2015). HeLa cells were transfected with 10 nM HCLPP-siRNA for 5 hours, cells were transferred to fresh DMEM medium and grown for 16 h, after which they were treated with 2.5 µg/ml cisplatin for 0 or 24 h. The cells were harvested and total DNA was isolated using a Wizard Genomic DNA Purification Kit (Promega, San Luis Obispo, CA). The mitochondrial CYTB and the nuclear β-actin gene copy numbers were measured by quantitative PCR using the SYBR Green CFX96 Real-Time System (Bio-Rad Laboratories, Hercules, CA). Each reaction contained 100 ng DNA for CYTB and 250 ng DNA for actin. PCR amplification was performed under the following condition: denaturation at 95 C for 10 min, followed by 40 two-step cycles (95 C for 15 s and 60 C for 1min). The primers for CYTB were: upper 5’-ACTATCCGCCATCCCATAC-3’; Lower 5’GCAAGAATAGGAGGTGGAG-3’. The primers for β-actin were: Upper 5’ACCTTCTACAATGAGCTGCG-3’; Lower 5’-CCTGGATAGCAACGTACATGG-3’. Three independent cultures of each cell line were grown and duplicate DNA samples from each culture were analyzed. For each sample delta delta Cq measurements were used to obtain the ratio of the CYTB and ACTB copy numbers in the reaction. The average CYTB copy numbers per cell were calculated to obtain mitochondrial DNA copy number. Standard among the six samples from each cell line were