Accepted Manuscript Title: Mitochondrial DNA based identification of forensically important Indian flesh flies (Diptera: Sarcophagidae) Author: Manish Sharma Devinder Singh Ajay Kumar Sharma PII: DOI: Reference:
S0379-0738(14)00482-4 http://dx.doi.org/doi:10.1016/j.forsciint.2014.11.017 FSI 7819
To appear in:
FSI
Received date: Revised date: Accepted date:
28-4-2014 22-10-2014 17-11-2014
Please cite this article as: M. Sharma, D. Singh, A.K. Sharma, Mitochondrial DNA based identification of forensically important Indian flesh flies (Diptera: Sarcophagidae), Forensic Science International (2014), http://dx.doi.org/10.1016/j.forsciint.2014.11.017 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title Page (with authors and addresses)
Mitochondrial DNA based identification of forensically important Indian flesh flies (Diptera: Sarcophagidae) Manish Sharma1, Devinder Singh1 and Ajay Kumar Sharma2 Department of Zoology & Environmental Sciences, Punjabi University, Patiala-147002, India Entomology Division, Defense R&D Establishment (DRDE), Gwalior-474002, India
an
us
cr
2
ip t
1
Ac ce p
te
d
M
Corresponding author: Prof. Devinder Singh Department of Zoology & Environmental Sciences, Punjabi University, Patiala-147002, India Email: [email protected]
Page 1 of 16
*Highlights (for review)
Highlights
Ac ce p
te
d
M
an
us
cr
ip t
30 specimens belonging to 10 forensically important species of flesh flies were collected from north India. All the specimens were morphologically identified. A 465 bp region of mitochondrial COI gene was isolated and used for the identification. The results show the robustness of COI gene as diagnostic marker. For interspecific studies COI gene has potential to distinguish the Indian sarcophagid species.
Page 2 of 16
*Manuscript (without author details)
Mitochondrial DNA based identification of forensically important Indian flesh flies (Diptera: Sarcophagidae)
ip t
Abstract: An absolutely vital prerequisite in the forensic entomology cases is the estimation of post mortem interval (PMI). Due to similar morphological look, identification of the flesh fly fauna associated with the corpse is very difficult for nontaxonomists and needs professional
cr
hand to be dealt with. So, to simplify the identification process the application of 465 bp
us
fragment of COI gene for differentiation of ten forensically significant species of flesh flies is demonstrated in this paper. Percentage nucleotide composition, genetic divergence and substitution rate were calculated by using the Maximum likelihood method. Phylogenetic
an
analysis was done by Neighbor-joining tree constructed by using Tamura-3-parameter given in the MEGA5 software. The results show the robustness of COI gene as diagnostic marker, since
M
its nucleotide variability enables dependable distinction to be drawn between species.
te
1. Introduction
d
Keywords: Forensic entomology, Mitochondrial DNA, Sarcophagidae, Species identification
Insect specimens collected from misdeed scenes can help to approximate the
Ac ce p
minimum postmortem interval (PMI), time of the year of death, presence of toxins, or corpse transport [1]. For correctness, forensic entomologists utilize clues from initial corpse colonizers, which include carrion-breeding species of blow flies (Diptera: Calliphoridae) and flesh flies (Diptera: Sarcophagidae) [2, 3]. Flesh flies can supply precise PMI estimations as they are viviparous, depositing immatures that are ready to start feeding directly on the corpse and take part in its decomposition.
Family-level identification of flesh flies is
somewhat straightforward. The mature adults generally share the common features of grey– black longitudinal stripes on the thorax, a strongly bristled body, and a tessellated abdomen [3, 4, 5]. Larvae have their posterior spiracles in a deep cavity on the last abdominal segment. Species-level identification of adults is tough even for taxonomic professionals, because it requires close examination of subtle morphological features [3, 4, 5] and is extremely troublesome if the specimen is a female. Molecular identification may supplement or even replace correct species-level identification founded solely on morphological attributes. The mitochondrial COI gene has been found to be suitable for the identification of species of family Sarcophagidae [3,6-9, 36].
Page 3 of 16
The COI region, established in the respiratory string of links of the mitochondrial genome, is
very simple to isolate, has a higher exact replicate number than its nuclear equivalent, and has conserved sequence and structure over taxa [10,11]. In numerous studies covering wide geographic regions, various segments of the COI gene, extending from 229 bp to the whole gene, have been sequenced to differentiate forensically significant blow fly species
ip t
[11-22]. A 278-bp COI district is a classical genetic marker that has often been utilized to identify forensically significant fly species [ 11,13, 23-25]. The present investigation has been
cr
undertaken to help identify ten forensically important flesh flies of Indian origin and to make available their COI gene database to GenBank from this part of the world.
an
2.1 Specimen Collection and Identification
us
2. Materials and Methods
Specimens belonging to 10 species of flesh flies were collected from four north Indian states viz., Punjab, Himachal Pradesh, Uttarakhand and Jammu & Kashmir. All the
M
specimens were collected over the pig meat kept as bait with the help of sweep net. Legs and thorax were used for DNA isolation and the remaining portions of the vouchers are kept
d
as pinned material for further quotation. Males were identified using morphological
(27) and Nandi [28].
te
characteristics of the genitalia with the help of keys given by Senior-White et al. [26], Pape
Ac ce p
2.2 DNA extraction
Genomic DNA from individual legs was extracted using the Coen method [29].
The extracted DNA was eluted in 200 μL elution buffer and kept at -20˚C for long term storage. The fraction of extracted DNA was spectrophotometrically quantitated and diluted to 50 ng/μL prior to PCR amplification step. 2.3 PCR amplification
A 465 bp region of the mitochondrial COI gene was amplified by using the
forward
Primer
5’CAGCTACTTTATGATCTTTAGG
3’
and
reverse
primer
5’CATTTCAAGCTGTGTAAGCATC 3’ [30]. The PCR reaction volume was 25 µL, containing 1–5 µL (20–40 ng) of template DNA, 12.5 µL 2× Taq polymerase, 4 µL dNTP (1 mmol/mL) 2.5 μL 10 × buffer (Mg2+1.5 mmol/L), 0.25 to 2.5 µL each primer (10 µM) and Nuclease-Free Water was added to a total volume of 25 μL. PCR amplifications were performed in a thermocycler (Bio-Rad, USA) and programmed with the following parameters: initial step at 94˚C for 3 min then continued for 30 cycles each at 94˚C for 30s; 48˚C for 30s; and 72˚C for 30s. An elongation of PCR products at 72˚C for 5 min completed the reaction. Page 4 of 16
2.4 DNA sequencing Columns-cycle sequencing was performed on both forward and reverse strands using an ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit by ABI PRISM
ip t
3730 (Applied Biosystems, Foster City, U.S.A.) with BigDye terminator v3.1 as the sequencing agent. The sequences obtained have been deposited in GenBank by Sequin
cr
(http://www.ncbi.nlm.nih. gov/Sequin/index.html) and their accession numbers are listed in Table 1. To identify the species, COI sequences were compared with Dipteral sequences
us
on the NCBI website via the BLAST function. Additional COI sequences available for the present species in other parts of the world were retrieved from GenBank for comparison
an
purposes (Table 2).
2.5 Sequence analysis and phylogenetic tree construction
M
The sequence data were aligned by using Clustal X software [31]. Analysis of nucleotide composition, overall transition:transversion ratio (ts:tv), variable and parsimony informative sites and pairwise nucleotide distances were calculated using MEGA5 [32]. The
d
evolutionary history was inferred using the Neighbor-Joining method
[33] with 1000
te
replications in bootstrap test. Codon positions included were First + second + Third + Noncoding. There were a total of 465 positions in the final dataset. Musca autumnalis belonging
Ac ce p
to the family Muscidae was taken as an outgroup for phylogenetic analyses. 3. Results and Discussion
The 465 bp COI fragment was successfully sequenced for all the specimens that were
rightly assigned into ten species with monophyletic separation in the NJ tree (Figure 2). At the species level, the high bootstrap values (100%) provide percentage robust support for the monophyly of all the ten species under study. Parasarcophaga misera showed acceptable bootstrap support of 59-100% with two Malaysian samples (GenBank accession numbers EF405929 and EF405930). All the samples of P. albiceps adjusted with two France samples (GenBank accession numbers JQ582114 and JQ582096) and two samples from Malaysia (GenBank accession numbers EF405931, EF405932) with a bootstrap support of 68-99%. Within Harpagophalla kempi, two specimens clustered together with three Malaysian samples (GenBank accession numbers GU174025, EF405946, EF405947) with a supporting bootstrap of 76-100%. In case of Iranihindia martellata, two specimens clustered together with a supporting bootstrap of 50-100% and showing close relationship
with
the
two
Page 5 of 16 Malaysian samples (GenBank accession numbers FJ440843, FJ440844). In the same
way, P. ruficornis showed close relationship with the two Malaysian samples (GenBank accession numbers EF405940 and EF405941) and one American sample (AF259511) with support value of 64-100%. Two samples of Sarcophaga princeps clustered together with two Malaysian samples ( GenBank accession
numbers EF405948 and EF405949) with
ip t
support value of 79-100%. At the genus level, Boettcherisca peregrina clustered in between P. macroauriculata and P. hirtipes, whereas H. kempi, S. princeps and I.
cr
martellata clustered together indicating the ability of this shorter COI fragment to identify the species from the same genus was not as efficient as that of the longer fragments. More
us
DNA fragments of different lengths and regions should be studied for this purpose. With the high bootstrap value ranging from 93%-99%, sequences obtained from the samples of B. peregrina grouped together with the same species originating from Malaysia
an
(EF405927 and EF405928). Similarly, DNA sequences for species I. martellata and H. kempi from India showed high bootstrap support with the Malaysian samples.
M
Zehner et al. [7] studied twelve species of Sarcophaigidae and showed a bootstrap value of 52-90% in the NJ tree. Song et al. [34] noted ≥94% bootstrap support which strongly supported monophyly of the three clades including the Parasarcophaga clade,
d
Boettcherisca clade and the Liopygia clade and suggested interior relationship of S.
te
albiceps, S. misera and S. sericea for the Parasarcophaga clade. They also showed sister relationships between some of the species (with S. scopariiformis and S. iwuensis; S.
Ac ce p
polystylata and S. hui; S. brevicornis and S. dux). The results are in consonant with Guo et al. [8] who also observed 100% bootstrap support for three species of flesh flies viz., S. similis, S. albiceps and B. peregrina. The present results are also similar to the results of Qing et al. [35] who reported 99% bootstrap support for 7 sarcophagous species from China. Bajpai and Tewari [36] analyzed COI and ND5 gene of five species of Indian flesh flies and showed a bootstrap value of 59% to 94% which indicates sufficient support of the species within the genus Sarcophaga. Jordaens et al. [9] also showed a bootstrap value ranging from 99% to 100% while studying S. misera, S. albiceps, S. peregrina, S. ruficornis and S. kempi (a total 56 species were investigated in their study). Kim et al. (37) also showed a very low intraspecific average sequence distance (0.1%) and interspecific distances of at least 6.4% in the S. peregrina species of Korean origin. The nucleotide composition for 465 bp region was calculated using MEGA5 software. It is clear from the data that A+T composition dominated in all the species studied, which is characteristics of insect DNA. The average nucleotide composition for the ten Page 6 of 16 species was T=37.20%, A=29.19%, C=16.61%, G=17.00%. Overall A+T bias is maximum
in P. ruficornis (67.50%) and lowest in P. hirtipes (64.50%). A+T content observed during the present investigation was found out to be in correspondence to the characteristics of the base composition of the mitochondrial genome of other dipteran insects (ranging from 72.6% to 82.2%) [38].
ip t
The 465 bp region has 342 conserved and 123 variable and parsimony informative positions which showed that COI contains both conserved and highly variable
cr
regions across taxa which are very helpful in the species identification. Our results are in complete agreement with Bajpai and Tewari [36] who studied five sarcophagid species and
us
showed that COI showed 71 variable sites in 296 bp long sequence and only 26 sites were found to be parsimony informative. Song et al. [34] noted 151 variable sites in the 552 bp long fragment of COI gene amplified from the fifteen sarcophagid species from China.
an
They also concluded that out of 151, 129 variable sites were in the third codon position. All the samples belonging to ten species of flesh flies under the present study
M
showed 0.0% intraspecific divergence. Interspecific genetic divergence was in the range of 4% to 14%. It is clear from the data that P. misera showed least genetic divergence of 4.0% with
d
P. albiceps and highest with S. princeps (13.0%). P. sericea showed minimum percent genetic divergence with P. albiceps (4.0%) and maximum with S. princeps and H.
te
kempi (11.0%). P. hirtipes showed least genetic divergence with P. misera (9.0%) and maximum with S. princeps (14.0%). All the sequences of P. albiceps showed least genetic
Ac ce p
divergence with P. misera (5.0%) and highest
with
S. princeps
(11.0%).
P.
macroauriculata showed least genetic divergence with P. ruficornis (7.0%) and highest with S. princeps, H. kempi and P. hirtipes (13.0%); S. princeps showed maximum genetic divergence with P. hirtipes (14.0%) and minimum with P. misera, P. ruficornis and H. kempi (10.0%) (Table 3).
Guo et al. [8] identified seven Chinese sarcophagid species from different
populations on the basis of 272 bp barcode fragment of mitochondrial COI gene. The mean levels of divergence between these seven sarcophagid species ranged from 4% to 8%. The maximum interspecific sequence variation between them was only 8%, which is relatively low when compared to other reports with levels of 12% maximum interspecific variation in the Sarcophagidae [7,39]. They suggested that it could be due to small amplicon size. They also showed intraspecific variation of 2%-4% and indicated that relying solely on this shorter fragment for delimiting species should be prudent, especially for the species of the same genus. Guo et al. [40] showed interspecific variation from 7% to 10%. The Page 7 of 16 maximum and minimum levels of divergence between the four sarcophagid species were
similar, ranging from 7% to 11%. The minimum intraspecific values of the four species were all 0%. They further added that the interspecific variation between species of different genera was higher than that from the same genus, which indicated the efficacy of COI to identify the species from different genera of Sarcophagidae. Furthermore, the interspecific variation
ip t
between S. dux and S. albiceps was more than 5%, which could distinguish these species belonging to the same genus Sarcophaga.
cr
4. Conclusions
It can be concluded that a COI gene identification system would be apt for the
us
identification of sarcophagid species from India. Damaged and immature specimens found in and around the crime scene are significant impediments for the estimation of exact PMI. In this way, a technique that could aid the punctual and unquestionable identification of
an
specimens of all life stages, or fragments thereof, would be enormously beneficial in the application of forensic insect clues. It is foreseeable that DNA barcoding could be effective
M
in the identification of other flesh fly taxa. Future investigations ought confirm this feasibility and set up the reliability of the method for usual application in forensic cases as
te
References
d
well.
[1] E.P. Catts, Problems
in
estimating
the
post-mortem
interval
in
death
Ac ce p
investigations. J. Agric. Entomol. 9 (1992) 245-255. [2] J.H. Byrd, J.L. Castner, Insects of forensic importance. In: Forensic entomology-the utility of arthropods in legal investigations. J.H. Byrd, J.L. Castner, (Eds.), CRC Press, Boca Raton, 2001, pp. 43-80.
[3] K.A. Meiklejohn, J.F. Wallman, M. Dowton, DNA-based identification of forensically important Australian Sarcophagidae (Diptera). Int. J. Legal Med. 125 (2011) 27-32. [4] G . E . Shewell, Sarcophagidae. In: Manual of Nearctic Diptera. J . F . McAlpine, B.V. Peterson, G.E. Shewell, H.J. Teskey, J.R. Vockeroth, D.M. Wood, D.M. (Eds.), Vol. 2. Agriculture Canada Monograph, 1987, pp. 1186. [5] T . Pape, Catalogue of the Sarcophagidae of the world (Insecta: Diptera). Mem. Entomol. Int. 8 (1996) 1-558. [6] J.D. Wells, T. Pape, F.A.H. Sperling, DNA-based identification and molecular systematics of forensically important Sarcophagidae (Diptera). J. Forensic Sci. 46 (2001) 1098-1102. [7] R. Zehner, J. Amendt, S. Schutt, J. Sauer, R. Krettek, D. Povolny, Genetic identification Page 8 of 16 of forensically important flesh flies (Diptera: Sarcophagidae). Int. J. Legal Med. 118 (2004)
245-247. [8] Y.D. Guo, J.F. Cai, X. Li, F. Xiong, R.N. Su, F.L. Chen, Q.L. Liu, X.H. Wang, Y.F. Chang, M. Zhong, X. Wang, J.F. Wen, Identification of the forensically important sarcophagid flies Boettcherisca peregrina, Parasarcophaga albiceps and Parasarcophaga dux (Diptera:
ip t
Sarcophagidae) based on COII gene in China. Trop. Biomed. 27 (2010) 451-460. [9] K. Jordaens, G. Sonet, R. Richet, E. Dupont, Y. Braet, S. Desmyter, Identification of
cr
forensically important Sarcophaga species (Diptera: Sarcophagidae) using the mitochondrial COI gene. Int. J. Legal Med. 127 (2013) 491-504.
us
[10] M.L. Harvey, S. Gaudieri, M.H. Villet, I.R. Dadour, A global study of forensically significant calliphorids: implications for identification. Forensic Sci. Int. 177 (2008) 66-76. [11] Q . L . Liu, J.F. Cai, Y.D. Guo, X.H. Wang, Y. Gu, J.F. Wen, F.M. Meng, W.P. Yi,
an
Identification of forensically significant calliphorids based on mitochondrial DNA cytochrome oxidase I (COI) gene in China. Forensic Sci. Int. 207 (2011) e64-e65.
M
[12] J . F . Wallman, S.C. Donnellan, The utility of mitochondrial DNA sequences for the identification of forensically important blowflies (Diptera: Calliphoridae) in southeastern Australia. Forensic Sci. Int. 120 (2001) 60-67.
d
[13] M.L. Harvey,I.R. Dadour, S. Gaudieri, Mitochondrial DNA cytochrome oxidase I gene:
te
potential for distinction between immature stages of some forensically important fly species (Diptera) in western Australia. Forensic Sci. Int. 131(2003a) 134-139.
Ac ce p
[14] M.L. Harvey, M.W. Mansell, M.H. Villet, I.R. Dadour, Molecular identification of some forensically important blowflies of southern Africa and Australia. Med. Vet. Entomol. 17 (2003b) 363-369.
[15] K. Saigusa, M. Takamiya, Y. Aoki, Species identification of the forensically important flies in Iwate prefecture, Japan based on mitochondrial cytochrome oxidase gene subunit I (COI) sequences. Leg. Med. 7 (2005) 175-178. [16] J.F. Wallman, R. Leys, K. Hogendoorn, Molecular systematics of Australian carrion – breeding blowflies (Diptera: Calliphoridae) based on mitochondrial DNA. Invertebr. Syst. 19 (2005) 1-15. [17] C. Ames, B. Turner, B. Daniel, The use of mitochondrial cytochrome oxidase I gene (COI) to differentiate two UK blowfly species-Calliphora vicina and Calliphora vomitoria. Forensic Sci. Int. 164 (2006) 179-182. [18] A.B. Zhang, D.S. Sikes, C. Muster, S.Q. Li, Inferring species membership using DNA sequences with back-propagation neural networks. Syst. Biol. 57(2008) 202–215. Page 9 of 16 [19] L.M. Caine, F.C. Real, M.I. Salona-Bordas, M.M.D. Pancorbo, G. Lima, T. Magalhaes,
F. Pinheiro, DNA typing of Diptera collected from human corpses in Portugal. Forensic Sci. Int. 184 (2009) 21-23. [20] S. Desmyter, M. Gosselin, COI sequence variability between Chrysomyinae of forensic interest. Forensic Sci. Int. Genet. 3 (2009) 89-95.
ip t
[21] S.H. Park, Y. Zhang, H. Piao, D.H. Yu, H.J. Jeong, G.Y. Yoo, Sequences of the cytochrome c oxidase subunit I (COI) gene are suitable for species identification of Korean
cr
Calliphorinae flies of forensic importance (Diptera: Calliphoridae). J. Forensic Sci. 54 (2009) 1131-1134.
us
[22] S. Reibe, J. Schmitz, B. Madea, Molecular identification of forensically important blowfly species (Diptera: Calliphoridae) from Germany. Parasitol. Res. 106 (2009) 257-261. [23] J.D. Wells, F.A.H. Sperling, Molecular phylogeny of Chrysomya albiceps and C.
an
rufifacies (Diptera: Calliphoridae). J. Med. Entomol. 36 (1999) 222-226. [24] J.F. Cai, M. Liu, Y.B. Wu, B.W. Ying, J.G. Dong, Z.H. Deng, T. Tao, H.F. Pan, H.X.
M
Zhang, H.T. Yan, Z.G. Liao, Sequencing of mitochondrial DNA cytochrome oxidase subunit for identification of sarcosaphagous flies (Diptera) in Chengdu. Acta Entomologica Sinica 48 (2005) 101-106
d
[25] J.D. Wells, R. Wall, J.R. Stevens, Phylogenetic analysis of forensically important
te
Lucilia flies based on cytochrome oxidase I sequence: a cautionary tale for forensic species determination. Int. J. Legal Med. 121 (2007) 229-233.
Ac ce p
[26] R.A. Senior-White, D. Aubertin, J. Smart, Diptera. Family Calliphoridae. The Fauna of British India, including the remainder of the Oriental region. 6.xiii, Taylor & Francis, Ltd., London, 1940, pp. 288.
[27] T. Pape, Catalogue of the Sarcophagidae of the world (Insecta: Diptera). Mem. Entomol. Int. 8 (1996) 1-558.
[28] B.C. Nandi, Fauna of India and the adjacent countries. Diptera, Sarcophagidae. Vol. 10 Director, Zoological Survey of India (Ed.), Kolkata, 2002, pp. 608. [29] E.S. Coen, J.M. Thoday, G. Dover, Rate of turnover of structural variants in the rDNA gene family of Drosophila melanogaster. Nature 295(1982) 564-568. [30] F.A.H. Sperling, G.S. Anderson, D.A. Hickey, A DNA-based approach to the identification of insect species used for postmortem interval estimation. J. Forensic Sci. 39 (1994) 418-427. [31] J.D. Thompson, T.J. Gibson, F. Plewniak,
F. Jeanmougin,
D.G. Higguns, The
CLUSTAL X Windows Interface: Flexible stretegies for Multiple Sequence Alignment aided by Quality analysis tools. Nucleic Acids Res. 24 (1997) 4876-4882.
Page 10 of 16
[32] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol. 28 (2011) 2731-2739. [33] N. Saitou, M. Nei, The neighbor-joining method: a new method for reconstructing
ip t
phylogenetic trees. Mol. Biol. Evol. 4 (1987) 406-425. [34] Z. Song, X. Wang, G. Liang, Species identification of some common necrophagous
cr
flies in Guangdong province, southern China based on the rDNA internal transcribed spacer 2 (ITS2). Forensic Sci. Int. 175 (2008) 17-22
us
[35] C. Qing, B. Jie, L. Li, L. HongBin, T. Hui, Z. Wei, Z. HongZhong, Y. JiangWei, L. YaCheng, H. SingNian, Sequential analysis of mitochondrial COI gene for seven common sarcosaphagous flies (Diptera) in Beijing and the establishment of their DNA barcodes. Acta
an
Entomol. Sin. 52 (2009) 202-209.
[36] N. Bajpai, R.R. Tewari, Mitochondrial DNA sequence-based phylogenetic relationship
M
among flesh flies of the genus Sarcophaga (Sarcophagidae: Diptera). J. Genet. 89 (2010) 51-54.
[37] Y.H. Kim, S.E. Shin, C.S. Ham, S.Y. Kim, K.S. Ko, T.H. Jo, G.H. Son, S.H. Park, J.J.
d
Hwang, Molecular identification of necrophagous Muscidae and Sarcophagidae fly species
World J. 2014 (2014) 1-9.
te
collected in Korea ny mitochondrial cytochrome c oxidase subunit I nucleotide sequences, Sci.
Ac ce p
[38] D.R. Wolstenholme, J.L. MacFarlane, R. Okimoto, D.O. Clary, J.A. Wahleithner, Bizarre tRNAs inferred from DNA sequences of mitochondrial genomes of nematode worms. Proc. Natl. Acad. Sci. USA 84 (1987) 1324-1328. [39] S.W. Tan, M. Rizman-Idid, E. Mohd-Aris, H. Kurahashi, DNA-based characterization and classification of forensically important flesh flies (Diptera: Sarcophagidae) in Malaysia. Forensic Sci. Int. 199 (2010): 43-49. [40] Y. Guo, J. Cai, Y. Chang, X. Li, Q. Liu, X. Wang, M. Zhong, J.F. Wen, J. Wang, Identification of forensically important sarcophagid flies (Diptera: Sarcophagidae) in China, based on COI and 16S rDNA gene sequences. J. Forensic. Sci. 56 (2011) 1534-1540.
Page 11 of 16
Ac ce p
te
d
M
an
us
cr
ip t
Figure
Page 12 of 16
ip t
Table
cr
Table 1 Voucher codes, collection data and accession numbers for the Indian flesh fly species from which DNA was extracted Voucher State
Collection locality
Parasarcophaga misera (Walker)
A123 D64 D201 JK5 A166 D102 D254 JK41
Punjab Uttarakhand Himachal Pradesh Jammu & Kashmir Punjab Uttarakhand Himachal Pradesh Jammu & Kashmir
Harike (31˚09’56.58”N and 74˚56’41.32”E ) Dehradun (30˚19’32.37”N and 77˚54’30.77”E) Andretta (32˚02’14.11”N and 76˚34’12.59”E) Kathua (32˚23’52.48”N and 75˚33’09.51”E) Nawanshehr (31˚07’37.16”N and 76˚07’14.40” E) Dehradun (30˚19’32.37”N and 77˚54’30.77”E) Kangra (32˚05’55.45”N and 76˚25’16.72”E) Kathua (32˚23’52.48”N and 75˚33’09.51”E)
A269 D58 D274 JK3 A51 D115 D392 JK35 D116 D143 A365 A366
Punjab Uttarakhand Himachal Pradesh Jammu & Kashmir Punjab Uttarakhand Himachal Pradesh Jammu & Kashmir Uttarakhand Uttarakhand Punjab Punjab
D160 D161 A342 D26 D384 JK31
Himachal Pradesh Himachal Pradesh Punjab Uttarakhand Himachal Pradesh Jammu & Kashmir
Parasarcophaga albiceps (Meigen)
Ac
Parasarcophaga macroauriculata (Ho) Parasarcophaga ruficornis (Fabricius)
Harpagophalla kempi (Senior-White) Sarcophaga princeps Wiedemann
M an
Hoshiarpur (31˚31’56.18”N and 75˚55’01.99”E) Sahastradhara (30˚23’06.10”N and 78˚07’42.81”E) Parour (32˚06’33.80” N and 76˚07’42.81”E) Kathua (32˚23’52.48”N and 75˚33’09.51”E) Patiala (30˚22’45.94”N and 76˚17’22.89”E) Sahastradhara (30˚23’06.10”N and 78˚07’42.81”E) Palampur 32˚06’33.80”N and 76˚32’13.80”E) Kathua (32˚23’52.48” N and 75˚33’09.51”E) Dehradun (30˚19’32.37”N and 77˚54’30.77”E) Dehradun (30˚19’32.37”N and 77˚54’30.77”E) Patiala (30˚22’45.94”N and 76˚17’22.89”E) Patiala (30˚22’45.94”N and 76˚17’22.89”E)
ed
Parasarcophaga hirtipes (Wiedemann)
ce pt
Parasarcophaga sericea (Walker)
us
Species
Nahan (30˚33’35.76”N and 77˚17’43.74”E) Nahan (30˚33’35.76”N and 77˚17’43.74”E) Roopnagar (30˚12’35.82” N and 73˚59’33.19”E) Mussoorie (30˚27’40.31”N and 78˚03’09.51”E) Manali (32˚15’16.87 N and 77˚09’47.11”E) Kathua (32˚23’52.48”N and 75˚33’09.51”E)
Date of collection July 19, 2009 April 24, 2009 July 12, 2010 July 14, 2011 September 13, 2009 June 25, 2010 July 13, 2010 July 14, 2011 April 12, 2009 April 26, 2009 July 14, 2010 July 14, 2011 April 24, 2010 June 25, 2010 July 21, 2010 July 14, 2011 June 25, 2010 June 25, 2010 September 6, 2010 September 6, 2010 June 28, 2010 June 28, 2010 August 7, 2010 April 25, 2009 July 21, 2010 July 14, 2011
GenBank JX495073 JX495075 JX495078 JX495079 JX495083 JX495085 JX495087 JX495089 JX495070 JX495065 JX495066 JX495068 JX495061 JX495059 JX495057 JX495099 JX495071 JX495072 JX495081 JX495082
JX495052 JX495053 JX495092 JX495095 JX495096 JX495093
Page 13 of 16
ip t
Himachal Pradesh Himachal Pradesh
Bilaspur (31˚20’48.42”N and 76˚44’36.70”E) Bilaspur (31˚20’48.42”N and 76˚44’36.70”E)
July 22, 2010 July 22, 2010
JX495050 JX495051
A304 A364
Punjab Punjab
Patiala (30˚22’45.94”N and 76˚17’22.89”E) Patiala (30˚22’45.94”N and 76˚17’22.89”E)
September 6, 2010 September 6, 2010
JX495054 JX495055
us
cr
D407 D409
Ac
ce pt
ed
M an
Boettcherisca peregrina (RobineauDesvoidy) Iranihindia martellata Nandi
Page 14 of 16
cr
ip t
Table
Country
GPS Latitude Longitude Kuala Lumpur 03°07'51''N 101°39'22''E Kuala Lumpur 03°07'51''N 101°39'22''E Pahang 03°20'32''N 101°53'01''E Kuala Lumpur 03°07'51''N 101°39'22''E Pahang 03°20'32''N 101°53'01''E Cameron Highlands 04°30'50''N 101°2523E Cameron Highlands 04°30'50''N 101°2523E
ed
Malaysia Malaysia Malaysia Malaysia Malaysia Malaysia Malaysia
Locality
Malaysia Malaysia Malaysia Malaysia America Malaysia Malaysia France France Malaysia Malaysia
Kuala Lumpur Kuala Lumpur Kuala Lumpur Kelantan Oahu Kuala Lumpur Sarawak Cameles Cameles Kuala Lumpur Kuala Lumpur
Ac
ce pt
Voucher number Harpagophalla S274 kempi (SeniorS134 White, 1924) S102 Parasarcophaga S9 misera (Walker, ) S107 Boettcherisca S-CH2 peregrina S-CH9 (RobineauDesvoidy) Iranihindia S153 martellata Nandi S155 Parasarcophaga S21 ruficornis SY5 (Fabricius) Parasarcophaga S152 albiceps (Meigen) PA1 MIC/INCC 0472 MIC/INCC 0414 Sarcophaga S71 princeps S25 Wiedemann
M an
Species
us
Table 2 Sequences available worldwide for the species under present investigation
03°07'51''N 03°07'51''N 03°07'51''N 05°58'21''N 03°07'51''N 01°32'48''N 42°38'27''N 42°38'27''N 03°07'51''N 03°07'51''N
101°39'22''E 101°39'22''E 101°39'22''E 102°14'44''E 101°39'22''E 110°20'49''E 02°41'48''E 02°41'48''E 101°39'22''E 101°39'22''E
GenBank
Reference
GU174025 EF405947 Tan et al. (2010) EF405946 EF405930 Tan et al. (2010) EF405929 EF405927 Tan et al. (2010) EF405928
FJ440843 FJ440844 EF405940 EF405941 AF259511 EF405932 EF405931 JQ582114 JQ582096 EF405949 EF405948
Tan et al. (2010) Tan et al. (2010) Tan et al. (2010) Wells et al. (2001) Tan et al. (2010) Tan et al. (2010) Jordaens et al. (2013) Jordaens et al. (2013) Tan et al. (2010)
Page 15 of 16
cr
ip t
Table
us
Table 3 Pairwise genetic divergences (in percent) in the 465 bp region of COI gene in the ten studied species
Ac
ce pt
ed
M an
[ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 ] [ 1] [ 2] 0.0 [ 3] 8.0 8.0 [ 4] 8.0 8.0 0.0 [ 5] 8.0 8.0 0.0 0.0 [ 6] 8.0 8.0 0.0 0.0 0.0 [ 7] 9.0 9.0 4.0 4.0 4.0 4.0 [ 8] 9.0 9.0 4.0 4.0 4.0 4.0 0.0 [ 9] 9.0 9.0 4.0 4.0 4.0 4.0 0.0 0.0 [10] 9.0 9.0 4.0 4.0 4.0 4.0 0.0 0.0 0.0 [11] 8.0 8.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 [12] 8.0 8.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 0.0 [13] 8.0 8.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 0.0 0.0 [14] 8.0 8.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 0.0 0.0 0.0 [15] 9.0 9.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 7.0 7.0 7.0 7.0 [16] 9.0 9.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 7.0 7.0 7.0 7.0 0.0 [17] 13.013.0 9.0 9.0 9.0 9.0 10.010.010.010.012.012.012.012.010.0 10.0 [18] 13.013.0 9.0 9.0 9.0 9.0 10.010.010.010.012.012.012.012.010.0 10.0 0.0 [19] 13.013.0 9.0 9.0 9.0 9.0 10.010.010.010.012.012.012.012.010.0 10.0 0.0 0.0 [20] 13.013.0 9.0 9.0 9.0 9.0 10.010.010.010.012.012.012.012.010.0 10.0 0.0 0.0 0.0 [21] 7.0 7.0 5.0 5.0 5.0 5.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 5.0 5.0 9.0 9.0 9.0 9.0 [22] 7.0 7.0 5.0 5.0 5.0 5.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 5.0 5.0 9.0 9.0 9.0 9.0 0.0 [23] 10.010.0 7.0 7.0 7.0 7.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 12.012.012.012.0 8.0 8.0 [24] 10.010.0 7.0 7.0 7.0 7.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 12.012.012.012.0 8.0 8.0 0.0 [25] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 [26] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 0.00 [27] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 0.10 0.10 [28] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 0.10 0.10 0.00 [29] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 0.10 0.10 0.00 0.00 [30] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 0.10 0.10 0.00 0.00 0.00 S.Nos: 1-2: P. macroauriculata; 3-6: P. misera; 7-10: P. sericea; 11-14: P. albiceps; 15-16: B. peregrina; 17-20: P. hirtipes; 21-22: P. ruficornis; 23-24: I. martellata; 25-26: H. kempi; 27-30: S. princeps
Page 16 of 16
S0379-0738(14)00482-4 http://dx.doi.org/doi:10.1016/j.forsciint.2014.11.017 FSI 7819
To appear in:
FSI
Received date: Revised date: Accepted date:
28-4-2014 22-10-2014 17-11-2014
Please cite this article as: M. Sharma, D. Singh, A.K. Sharma, Mitochondrial DNA based identification of forensically important Indian flesh flies (Diptera: Sarcophagidae), Forensic Science International (2014), http://dx.doi.org/10.1016/j.forsciint.2014.11.017 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title Page (with authors and addresses)
Mitochondrial DNA based identification of forensically important Indian flesh flies (Diptera: Sarcophagidae) Manish Sharma1, Devinder Singh1 and Ajay Kumar Sharma2 Department of Zoology & Environmental Sciences, Punjabi University, Patiala-147002, India Entomology Division, Defense R&D Establishment (DRDE), Gwalior-474002, India
an
us
cr
2
ip t
1
Ac ce p
te
d
M
Corresponding author: Prof. Devinder Singh Department of Zoology & Environmental Sciences, Punjabi University, Patiala-147002, India Email: [email protected]
Page 1 of 16
*Highlights (for review)
Highlights
Ac ce p
te
d
M
an
us
cr
ip t
30 specimens belonging to 10 forensically important species of flesh flies were collected from north India. All the specimens were morphologically identified. A 465 bp region of mitochondrial COI gene was isolated and used for the identification. The results show the robustness of COI gene as diagnostic marker. For interspecific studies COI gene has potential to distinguish the Indian sarcophagid species.
Page 2 of 16
*Manuscript (without author details)
Mitochondrial DNA based identification of forensically important Indian flesh flies (Diptera: Sarcophagidae)
ip t
Abstract: An absolutely vital prerequisite in the forensic entomology cases is the estimation of post mortem interval (PMI). Due to similar morphological look, identification of the flesh fly fauna associated with the corpse is very difficult for nontaxonomists and needs professional
cr
hand to be dealt with. So, to simplify the identification process the application of 465 bp
us
fragment of COI gene for differentiation of ten forensically significant species of flesh flies is demonstrated in this paper. Percentage nucleotide composition, genetic divergence and substitution rate were calculated by using the Maximum likelihood method. Phylogenetic
an
analysis was done by Neighbor-joining tree constructed by using Tamura-3-parameter given in the MEGA5 software. The results show the robustness of COI gene as diagnostic marker, since
M
its nucleotide variability enables dependable distinction to be drawn between species.
te
1. Introduction
d
Keywords: Forensic entomology, Mitochondrial DNA, Sarcophagidae, Species identification
Insect specimens collected from misdeed scenes can help to approximate the
Ac ce p
minimum postmortem interval (PMI), time of the year of death, presence of toxins, or corpse transport [1]. For correctness, forensic entomologists utilize clues from initial corpse colonizers, which include carrion-breeding species of blow flies (Diptera: Calliphoridae) and flesh flies (Diptera: Sarcophagidae) [2, 3]. Flesh flies can supply precise PMI estimations as they are viviparous, depositing immatures that are ready to start feeding directly on the corpse and take part in its decomposition.
Family-level identification of flesh flies is
somewhat straightforward. The mature adults generally share the common features of grey– black longitudinal stripes on the thorax, a strongly bristled body, and a tessellated abdomen [3, 4, 5]. Larvae have their posterior spiracles in a deep cavity on the last abdominal segment. Species-level identification of adults is tough even for taxonomic professionals, because it requires close examination of subtle morphological features [3, 4, 5] and is extremely troublesome if the specimen is a female. Molecular identification may supplement or even replace correct species-level identification founded solely on morphological attributes. The mitochondrial COI gene has been found to be suitable for the identification of species of family Sarcophagidae [3,6-9, 36].
Page 3 of 16
The COI region, established in the respiratory string of links of the mitochondrial genome, is
very simple to isolate, has a higher exact replicate number than its nuclear equivalent, and has conserved sequence and structure over taxa [10,11]. In numerous studies covering wide geographic regions, various segments of the COI gene, extending from 229 bp to the whole gene, have been sequenced to differentiate forensically significant blow fly species
ip t
[11-22]. A 278-bp COI district is a classical genetic marker that has often been utilized to identify forensically significant fly species [ 11,13, 23-25]. The present investigation has been
cr
undertaken to help identify ten forensically important flesh flies of Indian origin and to make available their COI gene database to GenBank from this part of the world.
an
2.1 Specimen Collection and Identification
us
2. Materials and Methods
Specimens belonging to 10 species of flesh flies were collected from four north Indian states viz., Punjab, Himachal Pradesh, Uttarakhand and Jammu & Kashmir. All the
M
specimens were collected over the pig meat kept as bait with the help of sweep net. Legs and thorax were used for DNA isolation and the remaining portions of the vouchers are kept
d
as pinned material for further quotation. Males were identified using morphological
(27) and Nandi [28].
te
characteristics of the genitalia with the help of keys given by Senior-White et al. [26], Pape
Ac ce p
2.2 DNA extraction
Genomic DNA from individual legs was extracted using the Coen method [29].
The extracted DNA was eluted in 200 μL elution buffer and kept at -20˚C for long term storage. The fraction of extracted DNA was spectrophotometrically quantitated and diluted to 50 ng/μL prior to PCR amplification step. 2.3 PCR amplification
A 465 bp region of the mitochondrial COI gene was amplified by using the
forward
Primer
5’CAGCTACTTTATGATCTTTAGG
3’
and
reverse
primer
5’CATTTCAAGCTGTGTAAGCATC 3’ [30]. The PCR reaction volume was 25 µL, containing 1–5 µL (20–40 ng) of template DNA, 12.5 µL 2× Taq polymerase, 4 µL dNTP (1 mmol/mL) 2.5 μL 10 × buffer (Mg2+1.5 mmol/L), 0.25 to 2.5 µL each primer (10 µM) and Nuclease-Free Water was added to a total volume of 25 μL. PCR amplifications were performed in a thermocycler (Bio-Rad, USA) and programmed with the following parameters: initial step at 94˚C for 3 min then continued for 30 cycles each at 94˚C for 30s; 48˚C for 30s; and 72˚C for 30s. An elongation of PCR products at 72˚C for 5 min completed the reaction. Page 4 of 16
2.4 DNA sequencing Columns-cycle sequencing was performed on both forward and reverse strands using an ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit by ABI PRISM
ip t
3730 (Applied Biosystems, Foster City, U.S.A.) with BigDye terminator v3.1 as the sequencing agent. The sequences obtained have been deposited in GenBank by Sequin
cr
(http://www.ncbi.nlm.nih. gov/Sequin/index.html) and their accession numbers are listed in Table 1. To identify the species, COI sequences were compared with Dipteral sequences
us
on the NCBI website via the BLAST function. Additional COI sequences available for the present species in other parts of the world were retrieved from GenBank for comparison
an
purposes (Table 2).
2.5 Sequence analysis and phylogenetic tree construction
M
The sequence data were aligned by using Clustal X software [31]. Analysis of nucleotide composition, overall transition:transversion ratio (ts:tv), variable and parsimony informative sites and pairwise nucleotide distances were calculated using MEGA5 [32]. The
d
evolutionary history was inferred using the Neighbor-Joining method
[33] with 1000
te
replications in bootstrap test. Codon positions included were First + second + Third + Noncoding. There were a total of 465 positions in the final dataset. Musca autumnalis belonging
Ac ce p
to the family Muscidae was taken as an outgroup for phylogenetic analyses. 3. Results and Discussion
The 465 bp COI fragment was successfully sequenced for all the specimens that were
rightly assigned into ten species with monophyletic separation in the NJ tree (Figure 2). At the species level, the high bootstrap values (100%) provide percentage robust support for the monophyly of all the ten species under study. Parasarcophaga misera showed acceptable bootstrap support of 59-100% with two Malaysian samples (GenBank accession numbers EF405929 and EF405930). All the samples of P. albiceps adjusted with two France samples (GenBank accession numbers JQ582114 and JQ582096) and two samples from Malaysia (GenBank accession numbers EF405931, EF405932) with a bootstrap support of 68-99%. Within Harpagophalla kempi, two specimens clustered together with three Malaysian samples (GenBank accession numbers GU174025, EF405946, EF405947) with a supporting bootstrap of 76-100%. In case of Iranihindia martellata, two specimens clustered together with a supporting bootstrap of 50-100% and showing close relationship
with
the
two
Page 5 of 16 Malaysian samples (GenBank accession numbers FJ440843, FJ440844). In the same
way, P. ruficornis showed close relationship with the two Malaysian samples (GenBank accession numbers EF405940 and EF405941) and one American sample (AF259511) with support value of 64-100%. Two samples of Sarcophaga princeps clustered together with two Malaysian samples ( GenBank accession
numbers EF405948 and EF405949) with
ip t
support value of 79-100%. At the genus level, Boettcherisca peregrina clustered in between P. macroauriculata and P. hirtipes, whereas H. kempi, S. princeps and I.
cr
martellata clustered together indicating the ability of this shorter COI fragment to identify the species from the same genus was not as efficient as that of the longer fragments. More
us
DNA fragments of different lengths and regions should be studied for this purpose. With the high bootstrap value ranging from 93%-99%, sequences obtained from the samples of B. peregrina grouped together with the same species originating from Malaysia
an
(EF405927 and EF405928). Similarly, DNA sequences for species I. martellata and H. kempi from India showed high bootstrap support with the Malaysian samples.
M
Zehner et al. [7] studied twelve species of Sarcophaigidae and showed a bootstrap value of 52-90% in the NJ tree. Song et al. [34] noted ≥94% bootstrap support which strongly supported monophyly of the three clades including the Parasarcophaga clade,
d
Boettcherisca clade and the Liopygia clade and suggested interior relationship of S.
te
albiceps, S. misera and S. sericea for the Parasarcophaga clade. They also showed sister relationships between some of the species (with S. scopariiformis and S. iwuensis; S.
Ac ce p
polystylata and S. hui; S. brevicornis and S. dux). The results are in consonant with Guo et al. [8] who also observed 100% bootstrap support for three species of flesh flies viz., S. similis, S. albiceps and B. peregrina. The present results are also similar to the results of Qing et al. [35] who reported 99% bootstrap support for 7 sarcophagous species from China. Bajpai and Tewari [36] analyzed COI and ND5 gene of five species of Indian flesh flies and showed a bootstrap value of 59% to 94% which indicates sufficient support of the species within the genus Sarcophaga. Jordaens et al. [9] also showed a bootstrap value ranging from 99% to 100% while studying S. misera, S. albiceps, S. peregrina, S. ruficornis and S. kempi (a total 56 species were investigated in their study). Kim et al. (37) also showed a very low intraspecific average sequence distance (0.1%) and interspecific distances of at least 6.4% in the S. peregrina species of Korean origin. The nucleotide composition for 465 bp region was calculated using MEGA5 software. It is clear from the data that A+T composition dominated in all the species studied, which is characteristics of insect DNA. The average nucleotide composition for the ten Page 6 of 16 species was T=37.20%, A=29.19%, C=16.61%, G=17.00%. Overall A+T bias is maximum
in P. ruficornis (67.50%) and lowest in P. hirtipes (64.50%). A+T content observed during the present investigation was found out to be in correspondence to the characteristics of the base composition of the mitochondrial genome of other dipteran insects (ranging from 72.6% to 82.2%) [38].
ip t
The 465 bp region has 342 conserved and 123 variable and parsimony informative positions which showed that COI contains both conserved and highly variable
cr
regions across taxa which are very helpful in the species identification. Our results are in complete agreement with Bajpai and Tewari [36] who studied five sarcophagid species and
us
showed that COI showed 71 variable sites in 296 bp long sequence and only 26 sites were found to be parsimony informative. Song et al. [34] noted 151 variable sites in the 552 bp long fragment of COI gene amplified from the fifteen sarcophagid species from China.
an
They also concluded that out of 151, 129 variable sites were in the third codon position. All the samples belonging to ten species of flesh flies under the present study
M
showed 0.0% intraspecific divergence. Interspecific genetic divergence was in the range of 4% to 14%. It is clear from the data that P. misera showed least genetic divergence of 4.0% with
d
P. albiceps and highest with S. princeps (13.0%). P. sericea showed minimum percent genetic divergence with P. albiceps (4.0%) and maximum with S. princeps and H.
te
kempi (11.0%). P. hirtipes showed least genetic divergence with P. misera (9.0%) and maximum with S. princeps (14.0%). All the sequences of P. albiceps showed least genetic
Ac ce p
divergence with P. misera (5.0%) and highest
with
S. princeps
(11.0%).
P.
macroauriculata showed least genetic divergence with P. ruficornis (7.0%) and highest with S. princeps, H. kempi and P. hirtipes (13.0%); S. princeps showed maximum genetic divergence with P. hirtipes (14.0%) and minimum with P. misera, P. ruficornis and H. kempi (10.0%) (Table 3).
Guo et al. [8] identified seven Chinese sarcophagid species from different
populations on the basis of 272 bp barcode fragment of mitochondrial COI gene. The mean levels of divergence between these seven sarcophagid species ranged from 4% to 8%. The maximum interspecific sequence variation between them was only 8%, which is relatively low when compared to other reports with levels of 12% maximum interspecific variation in the Sarcophagidae [7,39]. They suggested that it could be due to small amplicon size. They also showed intraspecific variation of 2%-4% and indicated that relying solely on this shorter fragment for delimiting species should be prudent, especially for the species of the same genus. Guo et al. [40] showed interspecific variation from 7% to 10%. The Page 7 of 16 maximum and minimum levels of divergence between the four sarcophagid species were
similar, ranging from 7% to 11%. The minimum intraspecific values of the four species were all 0%. They further added that the interspecific variation between species of different genera was higher than that from the same genus, which indicated the efficacy of COI to identify the species from different genera of Sarcophagidae. Furthermore, the interspecific variation
ip t
between S. dux and S. albiceps was more than 5%, which could distinguish these species belonging to the same genus Sarcophaga.
cr
4. Conclusions
It can be concluded that a COI gene identification system would be apt for the
us
identification of sarcophagid species from India. Damaged and immature specimens found in and around the crime scene are significant impediments for the estimation of exact PMI. In this way, a technique that could aid the punctual and unquestionable identification of
an
specimens of all life stages, or fragments thereof, would be enormously beneficial in the application of forensic insect clues. It is foreseeable that DNA barcoding could be effective
M
in the identification of other flesh fly taxa. Future investigations ought confirm this feasibility and set up the reliability of the method for usual application in forensic cases as
te
References
d
well.
[1] E.P. Catts, Problems
in
estimating
the
post-mortem
interval
in
death
Ac ce p
investigations. J. Agric. Entomol. 9 (1992) 245-255. [2] J.H. Byrd, J.L. Castner, Insects of forensic importance. In: Forensic entomology-the utility of arthropods in legal investigations. J.H. Byrd, J.L. Castner, (Eds.), CRC Press, Boca Raton, 2001, pp. 43-80.
[3] K.A. Meiklejohn, J.F. Wallman, M. Dowton, DNA-based identification of forensically important Australian Sarcophagidae (Diptera). Int. J. Legal Med. 125 (2011) 27-32. [4] G . E . Shewell, Sarcophagidae. In: Manual of Nearctic Diptera. J . F . McAlpine, B.V. Peterson, G.E. Shewell, H.J. Teskey, J.R. Vockeroth, D.M. Wood, D.M. (Eds.), Vol. 2. Agriculture Canada Monograph, 1987, pp. 1186. [5] T . Pape, Catalogue of the Sarcophagidae of the world (Insecta: Diptera). Mem. Entomol. Int. 8 (1996) 1-558. [6] J.D. Wells, T. Pape, F.A.H. Sperling, DNA-based identification and molecular systematics of forensically important Sarcophagidae (Diptera). J. Forensic Sci. 46 (2001) 1098-1102. [7] R. Zehner, J. Amendt, S. Schutt, J. Sauer, R. Krettek, D. Povolny, Genetic identification Page 8 of 16 of forensically important flesh flies (Diptera: Sarcophagidae). Int. J. Legal Med. 118 (2004)
245-247. [8] Y.D. Guo, J.F. Cai, X. Li, F. Xiong, R.N. Su, F.L. Chen, Q.L. Liu, X.H. Wang, Y.F. Chang, M. Zhong, X. Wang, J.F. Wen, Identification of the forensically important sarcophagid flies Boettcherisca peregrina, Parasarcophaga albiceps and Parasarcophaga dux (Diptera:
ip t
Sarcophagidae) based on COII gene in China. Trop. Biomed. 27 (2010) 451-460. [9] K. Jordaens, G. Sonet, R. Richet, E. Dupont, Y. Braet, S. Desmyter, Identification of
cr
forensically important Sarcophaga species (Diptera: Sarcophagidae) using the mitochondrial COI gene. Int. J. Legal Med. 127 (2013) 491-504.
us
[10] M.L. Harvey, S. Gaudieri, M.H. Villet, I.R. Dadour, A global study of forensically significant calliphorids: implications for identification. Forensic Sci. Int. 177 (2008) 66-76. [11] Q . L . Liu, J.F. Cai, Y.D. Guo, X.H. Wang, Y. Gu, J.F. Wen, F.M. Meng, W.P. Yi,
an
Identification of forensically significant calliphorids based on mitochondrial DNA cytochrome oxidase I (COI) gene in China. Forensic Sci. Int. 207 (2011) e64-e65.
M
[12] J . F . Wallman, S.C. Donnellan, The utility of mitochondrial DNA sequences for the identification of forensically important blowflies (Diptera: Calliphoridae) in southeastern Australia. Forensic Sci. Int. 120 (2001) 60-67.
d
[13] M.L. Harvey,I.R. Dadour, S. Gaudieri, Mitochondrial DNA cytochrome oxidase I gene:
te
potential for distinction between immature stages of some forensically important fly species (Diptera) in western Australia. Forensic Sci. Int. 131(2003a) 134-139.
Ac ce p
[14] M.L. Harvey, M.W. Mansell, M.H. Villet, I.R. Dadour, Molecular identification of some forensically important blowflies of southern Africa and Australia. Med. Vet. Entomol. 17 (2003b) 363-369.
[15] K. Saigusa, M. Takamiya, Y. Aoki, Species identification of the forensically important flies in Iwate prefecture, Japan based on mitochondrial cytochrome oxidase gene subunit I (COI) sequences. Leg. Med. 7 (2005) 175-178. [16] J.F. Wallman, R. Leys, K. Hogendoorn, Molecular systematics of Australian carrion – breeding blowflies (Diptera: Calliphoridae) based on mitochondrial DNA. Invertebr. Syst. 19 (2005) 1-15. [17] C. Ames, B. Turner, B. Daniel, The use of mitochondrial cytochrome oxidase I gene (COI) to differentiate two UK blowfly species-Calliphora vicina and Calliphora vomitoria. Forensic Sci. Int. 164 (2006) 179-182. [18] A.B. Zhang, D.S. Sikes, C. Muster, S.Q. Li, Inferring species membership using DNA sequences with back-propagation neural networks. Syst. Biol. 57(2008) 202–215. Page 9 of 16 [19] L.M. Caine, F.C. Real, M.I. Salona-Bordas, M.M.D. Pancorbo, G. Lima, T. Magalhaes,
F. Pinheiro, DNA typing of Diptera collected from human corpses in Portugal. Forensic Sci. Int. 184 (2009) 21-23. [20] S. Desmyter, M. Gosselin, COI sequence variability between Chrysomyinae of forensic interest. Forensic Sci. Int. Genet. 3 (2009) 89-95.
ip t
[21] S.H. Park, Y. Zhang, H. Piao, D.H. Yu, H.J. Jeong, G.Y. Yoo, Sequences of the cytochrome c oxidase subunit I (COI) gene are suitable for species identification of Korean
cr
Calliphorinae flies of forensic importance (Diptera: Calliphoridae). J. Forensic Sci. 54 (2009) 1131-1134.
us
[22] S. Reibe, J. Schmitz, B. Madea, Molecular identification of forensically important blowfly species (Diptera: Calliphoridae) from Germany. Parasitol. Res. 106 (2009) 257-261. [23] J.D. Wells, F.A.H. Sperling, Molecular phylogeny of Chrysomya albiceps and C.
an
rufifacies (Diptera: Calliphoridae). J. Med. Entomol. 36 (1999) 222-226. [24] J.F. Cai, M. Liu, Y.B. Wu, B.W. Ying, J.G. Dong, Z.H. Deng, T. Tao, H.F. Pan, H.X.
M
Zhang, H.T. Yan, Z.G. Liao, Sequencing of mitochondrial DNA cytochrome oxidase subunit for identification of sarcosaphagous flies (Diptera) in Chengdu. Acta Entomologica Sinica 48 (2005) 101-106
d
[25] J.D. Wells, R. Wall, J.R. Stevens, Phylogenetic analysis of forensically important
te
Lucilia flies based on cytochrome oxidase I sequence: a cautionary tale for forensic species determination. Int. J. Legal Med. 121 (2007) 229-233.
Ac ce p
[26] R.A. Senior-White, D. Aubertin, J. Smart, Diptera. Family Calliphoridae. The Fauna of British India, including the remainder of the Oriental region. 6.xiii, Taylor & Francis, Ltd., London, 1940, pp. 288.
[27] T. Pape, Catalogue of the Sarcophagidae of the world (Insecta: Diptera). Mem. Entomol. Int. 8 (1996) 1-558.
[28] B.C. Nandi, Fauna of India and the adjacent countries. Diptera, Sarcophagidae. Vol. 10 Director, Zoological Survey of India (Ed.), Kolkata, 2002, pp. 608. [29] E.S. Coen, J.M. Thoday, G. Dover, Rate of turnover of structural variants in the rDNA gene family of Drosophila melanogaster. Nature 295(1982) 564-568. [30] F.A.H. Sperling, G.S. Anderson, D.A. Hickey, A DNA-based approach to the identification of insect species used for postmortem interval estimation. J. Forensic Sci. 39 (1994) 418-427. [31] J.D. Thompson, T.J. Gibson, F. Plewniak,
F. Jeanmougin,
D.G. Higguns, The
CLUSTAL X Windows Interface: Flexible stretegies for Multiple Sequence Alignment aided by Quality analysis tools. Nucleic Acids Res. 24 (1997) 4876-4882.
Page 10 of 16
[32] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol. 28 (2011) 2731-2739. [33] N. Saitou, M. Nei, The neighbor-joining method: a new method for reconstructing
ip t
phylogenetic trees. Mol. Biol. Evol. 4 (1987) 406-425. [34] Z. Song, X. Wang, G. Liang, Species identification of some common necrophagous
cr
flies in Guangdong province, southern China based on the rDNA internal transcribed spacer 2 (ITS2). Forensic Sci. Int. 175 (2008) 17-22
us
[35] C. Qing, B. Jie, L. Li, L. HongBin, T. Hui, Z. Wei, Z. HongZhong, Y. JiangWei, L. YaCheng, H. SingNian, Sequential analysis of mitochondrial COI gene for seven common sarcosaphagous flies (Diptera) in Beijing and the establishment of their DNA barcodes. Acta
an
Entomol. Sin. 52 (2009) 202-209.
[36] N. Bajpai, R.R. Tewari, Mitochondrial DNA sequence-based phylogenetic relationship
M
among flesh flies of the genus Sarcophaga (Sarcophagidae: Diptera). J. Genet. 89 (2010) 51-54.
[37] Y.H. Kim, S.E. Shin, C.S. Ham, S.Y. Kim, K.S. Ko, T.H. Jo, G.H. Son, S.H. Park, J.J.
d
Hwang, Molecular identification of necrophagous Muscidae and Sarcophagidae fly species
World J. 2014 (2014) 1-9.
te
collected in Korea ny mitochondrial cytochrome c oxidase subunit I nucleotide sequences, Sci.
Ac ce p
[38] D.R. Wolstenholme, J.L. MacFarlane, R. Okimoto, D.O. Clary, J.A. Wahleithner, Bizarre tRNAs inferred from DNA sequences of mitochondrial genomes of nematode worms. Proc. Natl. Acad. Sci. USA 84 (1987) 1324-1328. [39] S.W. Tan, M. Rizman-Idid, E. Mohd-Aris, H. Kurahashi, DNA-based characterization and classification of forensically important flesh flies (Diptera: Sarcophagidae) in Malaysia. Forensic Sci. Int. 199 (2010): 43-49. [40] Y. Guo, J. Cai, Y. Chang, X. Li, Q. Liu, X. Wang, M. Zhong, J.F. Wen, J. Wang, Identification of forensically important sarcophagid flies (Diptera: Sarcophagidae) in China, based on COI and 16S rDNA gene sequences. J. Forensic. Sci. 56 (2011) 1534-1540.
Page 11 of 16
Ac ce p
te
d
M
an
us
cr
ip t
Figure
Page 12 of 16
ip t
Table
cr
Table 1 Voucher codes, collection data and accession numbers for the Indian flesh fly species from which DNA was extracted Voucher State
Collection locality
Parasarcophaga misera (Walker)
A123 D64 D201 JK5 A166 D102 D254 JK41
Punjab Uttarakhand Himachal Pradesh Jammu & Kashmir Punjab Uttarakhand Himachal Pradesh Jammu & Kashmir
Harike (31˚09’56.58”N and 74˚56’41.32”E ) Dehradun (30˚19’32.37”N and 77˚54’30.77”E) Andretta (32˚02’14.11”N and 76˚34’12.59”E) Kathua (32˚23’52.48”N and 75˚33’09.51”E) Nawanshehr (31˚07’37.16”N and 76˚07’14.40” E) Dehradun (30˚19’32.37”N and 77˚54’30.77”E) Kangra (32˚05’55.45”N and 76˚25’16.72”E) Kathua (32˚23’52.48”N and 75˚33’09.51”E)
A269 D58 D274 JK3 A51 D115 D392 JK35 D116 D143 A365 A366
Punjab Uttarakhand Himachal Pradesh Jammu & Kashmir Punjab Uttarakhand Himachal Pradesh Jammu & Kashmir Uttarakhand Uttarakhand Punjab Punjab
D160 D161 A342 D26 D384 JK31
Himachal Pradesh Himachal Pradesh Punjab Uttarakhand Himachal Pradesh Jammu & Kashmir
Parasarcophaga albiceps (Meigen)
Ac
Parasarcophaga macroauriculata (Ho) Parasarcophaga ruficornis (Fabricius)
Harpagophalla kempi (Senior-White) Sarcophaga princeps Wiedemann
M an
Hoshiarpur (31˚31’56.18”N and 75˚55’01.99”E) Sahastradhara (30˚23’06.10”N and 78˚07’42.81”E) Parour (32˚06’33.80” N and 76˚07’42.81”E) Kathua (32˚23’52.48”N and 75˚33’09.51”E) Patiala (30˚22’45.94”N and 76˚17’22.89”E) Sahastradhara (30˚23’06.10”N and 78˚07’42.81”E) Palampur 32˚06’33.80”N and 76˚32’13.80”E) Kathua (32˚23’52.48” N and 75˚33’09.51”E) Dehradun (30˚19’32.37”N and 77˚54’30.77”E) Dehradun (30˚19’32.37”N and 77˚54’30.77”E) Patiala (30˚22’45.94”N and 76˚17’22.89”E) Patiala (30˚22’45.94”N and 76˚17’22.89”E)
ed
Parasarcophaga hirtipes (Wiedemann)
ce pt
Parasarcophaga sericea (Walker)
us
Species
Nahan (30˚33’35.76”N and 77˚17’43.74”E) Nahan (30˚33’35.76”N and 77˚17’43.74”E) Roopnagar (30˚12’35.82” N and 73˚59’33.19”E) Mussoorie (30˚27’40.31”N and 78˚03’09.51”E) Manali (32˚15’16.87 N and 77˚09’47.11”E) Kathua (32˚23’52.48”N and 75˚33’09.51”E)
Date of collection July 19, 2009 April 24, 2009 July 12, 2010 July 14, 2011 September 13, 2009 June 25, 2010 July 13, 2010 July 14, 2011 April 12, 2009 April 26, 2009 July 14, 2010 July 14, 2011 April 24, 2010 June 25, 2010 July 21, 2010 July 14, 2011 June 25, 2010 June 25, 2010 September 6, 2010 September 6, 2010 June 28, 2010 June 28, 2010 August 7, 2010 April 25, 2009 July 21, 2010 July 14, 2011
GenBank JX495073 JX495075 JX495078 JX495079 JX495083 JX495085 JX495087 JX495089 JX495070 JX495065 JX495066 JX495068 JX495061 JX495059 JX495057 JX495099 JX495071 JX495072 JX495081 JX495082
JX495052 JX495053 JX495092 JX495095 JX495096 JX495093
Page 13 of 16
ip t
Himachal Pradesh Himachal Pradesh
Bilaspur (31˚20’48.42”N and 76˚44’36.70”E) Bilaspur (31˚20’48.42”N and 76˚44’36.70”E)
July 22, 2010 July 22, 2010
JX495050 JX495051
A304 A364
Punjab Punjab
Patiala (30˚22’45.94”N and 76˚17’22.89”E) Patiala (30˚22’45.94”N and 76˚17’22.89”E)
September 6, 2010 September 6, 2010
JX495054 JX495055
us
cr
D407 D409
Ac
ce pt
ed
M an
Boettcherisca peregrina (RobineauDesvoidy) Iranihindia martellata Nandi
Page 14 of 16
cr
ip t
Table
Country
GPS Latitude Longitude Kuala Lumpur 03°07'51''N 101°39'22''E Kuala Lumpur 03°07'51''N 101°39'22''E Pahang 03°20'32''N 101°53'01''E Kuala Lumpur 03°07'51''N 101°39'22''E Pahang 03°20'32''N 101°53'01''E Cameron Highlands 04°30'50''N 101°2523E Cameron Highlands 04°30'50''N 101°2523E
ed
Malaysia Malaysia Malaysia Malaysia Malaysia Malaysia Malaysia
Locality
Malaysia Malaysia Malaysia Malaysia America Malaysia Malaysia France France Malaysia Malaysia
Kuala Lumpur Kuala Lumpur Kuala Lumpur Kelantan Oahu Kuala Lumpur Sarawak Cameles Cameles Kuala Lumpur Kuala Lumpur
Ac
ce pt
Voucher number Harpagophalla S274 kempi (SeniorS134 White, 1924) S102 Parasarcophaga S9 misera (Walker, ) S107 Boettcherisca S-CH2 peregrina S-CH9 (RobineauDesvoidy) Iranihindia S153 martellata Nandi S155 Parasarcophaga S21 ruficornis SY5 (Fabricius) Parasarcophaga S152 albiceps (Meigen) PA1 MIC/INCC 0472 MIC/INCC 0414 Sarcophaga S71 princeps S25 Wiedemann
M an
Species
us
Table 2 Sequences available worldwide for the species under present investigation
03°07'51''N 03°07'51''N 03°07'51''N 05°58'21''N 03°07'51''N 01°32'48''N 42°38'27''N 42°38'27''N 03°07'51''N 03°07'51''N
101°39'22''E 101°39'22''E 101°39'22''E 102°14'44''E 101°39'22''E 110°20'49''E 02°41'48''E 02°41'48''E 101°39'22''E 101°39'22''E
GenBank
Reference
GU174025 EF405947 Tan et al. (2010) EF405946 EF405930 Tan et al. (2010) EF405929 EF405927 Tan et al. (2010) EF405928
FJ440843 FJ440844 EF405940 EF405941 AF259511 EF405932 EF405931 JQ582114 JQ582096 EF405949 EF405948
Tan et al. (2010) Tan et al. (2010) Tan et al. (2010) Wells et al. (2001) Tan et al. (2010) Tan et al. (2010) Jordaens et al. (2013) Jordaens et al. (2013) Tan et al. (2010)
Page 15 of 16
cr
ip t
Table
us
Table 3 Pairwise genetic divergences (in percent) in the 465 bp region of COI gene in the ten studied species
Ac
ce pt
ed
M an
[ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 ] [ 1] [ 2] 0.0 [ 3] 8.0 8.0 [ 4] 8.0 8.0 0.0 [ 5] 8.0 8.0 0.0 0.0 [ 6] 8.0 8.0 0.0 0.0 0.0 [ 7] 9.0 9.0 4.0 4.0 4.0 4.0 [ 8] 9.0 9.0 4.0 4.0 4.0 4.0 0.0 [ 9] 9.0 9.0 4.0 4.0 4.0 4.0 0.0 0.0 [10] 9.0 9.0 4.0 4.0 4.0 4.0 0.0 0.0 0.0 [11] 8.0 8.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 [12] 8.0 8.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 0.0 [13] 8.0 8.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 0.0 0.0 [14] 8.0 8.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 0.0 0.0 0.0 [15] 9.0 9.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 7.0 7.0 7.0 7.0 [16] 9.0 9.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 7.0 7.0 7.0 7.0 0.0 [17] 13.013.0 9.0 9.0 9.0 9.0 10.010.010.010.012.012.012.012.010.0 10.0 [18] 13.013.0 9.0 9.0 9.0 9.0 10.010.010.010.012.012.012.012.010.0 10.0 0.0 [19] 13.013.0 9.0 9.0 9.0 9.0 10.010.010.010.012.012.012.012.010.0 10.0 0.0 0.0 [20] 13.013.0 9.0 9.0 9.0 9.0 10.010.010.010.012.012.012.012.010.0 10.0 0.0 0.0 0.0 [21] 7.0 7.0 5.0 5.0 5.0 5.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 5.0 5.0 9.0 9.0 9.0 9.0 [22] 7.0 7.0 5.0 5.0 5.0 5.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 6.0 5.0 5.0 9.0 9.0 9.0 9.0 0.0 [23] 10.010.0 7.0 7.0 7.0 7.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 12.012.012.012.0 8.0 8.0 [24] 10.010.0 7.0 7.0 7.0 7.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 8.0 12.012.012.012.0 8.0 8.0 0.0 [25] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 [26] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 0.00 [27] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 0.10 0.10 [28] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 0.10 0.10 0.00 [29] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 0.10 0.10 0.00 0.00 [30] 13.013.010.010.010.010.011.0 11.011.011.011.011.011.011.010.010.014.014.014.014.010.010.012.0 12.0 0.10 0.10 0.00 0.00 0.00 S.Nos: 1-2: P. macroauriculata; 3-6: P. misera; 7-10: P. sericea; 11-14: P. albiceps; 15-16: B. peregrina; 17-20: P. hirtipes; 21-22: P. ruficornis; 23-24: I. martellata; 25-26: H. kempi; 27-30: S. princeps
Page 16 of 16
