Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

Contents lists available at ScienceDirect

Journal of Molecular and Cellular Cardiology journal homepage: www.elsevier.com/locate/yjmcc

Original article

Mitochondrial DNA damage and repair during ischemia–reperfusion injury of the heart M. Bliksøen a,b, A. Baysa a,b, L. Eide c, M. Bjørås d, R. Suganthan d, J. Vaage e, K.O. Stensløkken a,b,⁎, G. Valen a,b,1 a

Department of Physiology, Institute of Basic Medical Sciences, Norway Center for Heart Failure Research, University of Oslo, Norway Department of Medical Biochemistry, University of Oslo, Norway d Department of Microbiology, University of Oslo and Oslo University Hospital Rikshospitalet, Norway e Department of Emergency Medicine and Intensive Care, University of Oslo and Oslo University Hospital, Ullevål, Oslo, Norway b c

a r t i c l e

i n f o

Article history: Received 10 September 2014 Received in revised form 10 November 2014 Accepted 11 November 2014 Available online 18 November 2014 Keywords: Mitochondrial DNA Ischemia DNA repair 8-Oxoguanine DNA glycosylase

a b s t r a c t Ischemia–reperfusion (IR) injury of the heart generates reactive oxygen species that oxidize macromolecules including mitochondrial DNA (mtDNA). The 8-oxoguanine DNA glycosylase (OGG1) works synergistically with MutY DNA glycosylase (MYH) to maintain mtDNA integrity. Our objective was to study the functional outcome of lacking the repair enzymes OGG1 and MYH after myocardial IR and we hypothesized that OGG1 and MYH are important enzymes to preserve mtDNA and heart function after IR. Ex vivo global ischemia for 30 min followed by 10 min of reperfusion induced mtDNA damage that was removed within 60 min of reperfusion in wild-type mice. After 60 min of reperfusion the ogg1−/− mice demonstrated increased mtDNA copy number and decreased mtDNA damage removal suggesting that OGG1 is responsible for removal of IR-induced mtDNA damage and copy number regulation. mtDNA damage was not detected in the ogg1−/−/myh−/−, inferring that adenine opposite 8-oxoguanine is an abundant mtDNA lesion upon IR. The level and integrity of mtDNA were restored in all genotypes after 35 min of regional ischemia and six week reperfusion with no change in cardiac function. No consistent upregulation of other mitochondrial base excision repair enzymes in any of our knockout models was found. Thus repair of mtDNA oxidative base lesions may not be important for maintenance of cardiac function during IR injury in vivo. This article is part of a Special Issue entitled "Mitochondria: From Basic Mitochondrial Biology to Cardiovascular Disease." © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Ischemia–reperfusion induces generation of reactive oxygen species (ROS) in the heart, possibly with mitochondria as a major source [1]. Oxidative stress causes lipid peroxidation, and may damage cellular membranes, proteins, and DNA [2,3]. Mitochondrial DNA (mtDNA) is situated near the inner mitochondrial membrane and the electron transport system, making it prone to oxidative stress from the electron transport system [4–6]. mtDNA consists of a 16.5 kb double-stranded, circular DNA. It does not contain introns, and encodes for 13 polypeptides for complexes I, III, IV and V in the electron transport system as well as 22tRNAs and 2rRNAs [7–9]. Therefore any damage to mtDNA potentially induces dysfunctional mitochondrial transcripts and reduces oxidative phosphorylation [10]. In addition, oxidative mtDNA damage is more extensive and longer lasting than that of nuclear DNA damage [11–13]. ⁎ Corresponding author at: Department of Physiology, Institute of Basic Medical Sciences, P.O. Box 1103, N-0317 Oslo, Norway. Tel.: +47 97690730. E-mail address: [email protected] (K.O. Stensløkken). 1 Professor Guro Valen passed away on September 26, 2014.

http://dx.doi.org/10.1016/j.yjmcc.2014.11.010 0022-2828/© 2014 Elsevier Ltd. All rights reserved.

Human ischemic hearts have increased mtDNA damage and oxidative phosphorylation deficiency [14]. Increased mtDNA damage is found in the atrial muscle of patients suffering from atrial fibrillation [15]. Mitochondrial dysfunction in association with mtDNA damage appears to play a role in the development of heart failure both in humans and in animal models [16–18]. mtDNA damage and loss of repair may lead to mitochondrial dysfunction and cell death [19]. However, the implications of mtDNA damage and repair during acute ischemia–reperfusion and myocardial infarction are far from fully elucidated. Base excision repair (BER) [6] appears to be the most important pathway of mtDNA repair. BER is initiated by a DNA glycosylase recognizing and removing the modified DNA base. The resulting abasic site is cleaved by endonuclease and/or phosphodiesterases removing the sugar residue, followed by DNA polymerase and DNA ligase, which completes the repair. The DNA glycosylases involved in mammalian DNA repair are 8-oxoguanine glycosylase 1 (OGG1), MutY DNA glycosylase (MYH), uracil-DNA glycosylase 1 (UNG1), endonuclease III homolog 1 (NTH1), N-methylpurine DNA glycosylase (MPG) and nei endonuclease VIII-like 1 and 2 (NEIL1 and NEIL2) [6]. Mitochondrial BER enzymes are encoded by the nuclear DNA, mostly existing as splice variants or as proteins with post-translational modifications [6,19]. One of the most

10

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

abundant lesions formed during oxidative stress is the premutagenic 8oxo-7,8-dihydroguanidine (8-oxoG), an oxidized form of guanine [20]. Guanine is the nucleobase with the lowest oxidation potential and thus the most eligible to oxidative mutations [20]. The main glycosylase recognizing 8-oxoG:C (oxidized Guanine paired with Cytosine) is OGG1 [21]. Ogg1 null mice have a 9–20 fold increase in 8-oxoG levels in the mtDNA compared to wild type mice [22]. Despite these differences, ogg1−/− mice do not exhibit a different phenotype and the electron transport system is not compromised either in the liver or in the heart [23,24]. Mice lacking ogg1 exhibit greater 8oxoG accumulation and behavioral deficits after cerebral stroke, suggesting that OGG1 may have a pivotal role in repairing damaged DNA under ischemic conditions [25]. In the postischemic rat heart enhanced capacity to remove 8-oxoG accumulation was found in the border zone of the infarct area as well as in remote non-ischemic part of the left ventricle [26]. Increased 8-oxoG levels are also found in the human heart failure and after atrial fibrillation [15,27]. By overexpressing hOGG1, Wang et al. recently showed that it is possible to rescue mtDNA from damage and reduce myocardial fibrosis following aortic banding in mice [28]. Taken together, the present knowledge strongly suggests that mtDNA damage and repair might be important in cardiac pathophysiology. 8-oxoG residues escaping repair can miscode at replication and produce 8-oxoG:A mismatches. This triggers intervention by the adenine DNA glycosylase, MutY DNA glycosylase homolog (MYH), which removes the potentially misincorporated adenine [29]. MYH exists in both nuclear and mitochondrial forms and the biological outcome of the combined action of OGG1 and MYH is to prevent the substitution of G:C with T:A (also known as G:C → T:A transversion). Neither OGG1 nor MYH single knockouts have pronounced pathological phenotypes, but the double knockouts are cancer prone [30,31]. We hypothesized that mtDNA would be damaged during ischemia and reperfusion of the heart. As OGG1 is a key BER enzyme which works in concert with MYH to repair oxidative DNA base damage, we tested the effect of lacking OGG1 and OGG1/MYH during ischemia–reperfusion of the heart and hypothesized that ogg1-/- and ogg1−/−/ myh−/− mice would suffer from increased myocardial damage after ischemia–reperfusion injury ex vivo and in vivo.

2. Material and methods The experiments were approved and performed in adherence with the Norwegian Animal Health Authority and the animals received humane care in compliance with the European Convention for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes. Male C57/Bl6 mice (2–3 months), ogg1−/− and ogg1−/−/ myh−/− mice (2–3 months) on C57/Bl6 background backcrossed N 6 generations were used. ogg1−/− mice are generated and kindly provided by Dr. Klungland, University of Oslo [23]. ogg1−/−/myh−/− mice were kindly provided by Dr T. Lindahl (Clare Hall Laboratories Cancer Research UK London Research Institute, South Mimms, Herts, UK) [31]. All animals were bred in accordance with European regulations and C57/Bl6 mice were bred in-house in the same room as knockouts. All animals had conventional microbiological status, with free access to food (RM3 from Scanbur BK AS, Norway) and water. They were kept at a 12 hour light/12 hour darkness cycle in rooms with 23 °C and humidity was 55%–60%. Animals were acclimatized for 7 days if transported for at least 4 days before experiments.

2.1. Animal weight All animals were weighed before experiments and animals used in in vivo ischemia–reperfusion model were weighed at the end of the observation time before hearts were harvested.

2.2. Isolated heart perfusion Mice were anesthetized with 5% sodium pentobarbital (Ås produksjonslab AS, Ås, Norge) (50 mg/kg) and heparinized (500 IU intraperitoneally). The heart was rapidly excised and placed in ice-cold Krebs–Henseleit buffer consisting of (in mmol/l): NaCl 118.5; NaHCO3 25; KCl 4.7; KH2PO4 1.2; MgSO4 1.2; glucose 11.1; and CaCl2 1.8. The aorta was cannulated and the heart mounted on a Langendorff system (AD Instruments, NSW, Australia) for retrograde perfusion with warm (37 °C), oxygenated (95% O2, 5% CO2) Krebs–Henseleit buffer at a constant pressure of 70 mm Hg. The heart temperature was monitored and kept constant at 37 °C during the experiment. A fluid-filled balloontipped pressure catheter was inserted into the left ventricle via the left atrium to measure heart rate (HR) and ventricular pressures. Left ventricular end-diastolic pressure (LVEDP) was set to 5–10 mm Hg at the start of stabilization, and changes in LVEDP as well as left ventricular systolic pressure (LVSP) were measured. Left ventricular developed pressure (LVDP = LVSP − LVEDP) and maximum and minimum derivative of left ventricular pressure development (LVdp/dt max and LVdp/dt min) were calculated. Coronary flow (CF) was measured by timed collections of the coronary effluent. Animals with aortic cannulation time N 3 min, CF N 4 ml/min, LVSP b 80 mm Hg, HR b 220 beats/min during stabilization or more than 20 min of irreversible arrhythmias (asystole or ventricular fibrillation) during reperfusion were excluded from the study. 2.2.1. Experimental groups Group 1 C57/Bl6 wild type mouse hearts were stabilized for 20 min prior to 30 min of global ischemia followed by reperfusion for 10 (n = 7) or 60 min (n = 10). Control hearts were perfused for 40 (n = 7) or 80 min (n = 8) without ischemia. After perfusion hearts were collected for analysis of mtDNA damage and compared to mtDNA damage in unperfused hearts that were harvested and perfused for 1 min to wash out blood (n = 8). Group 2 Hearts from ogg1−/− mice (n = 9) and age-matched C57/Bl6 wild type (n = 10) underwent 20 min stabilization, 30 min global ischemia and 60 min reperfusion. Group 3 Hearts from ogg1−/−/myh−/− mice (n = 8) and age-matched C57/Bl6 wild type (n = 8) underwent 20 min stabilization, 30 min global ischemia and 60 min reperfusion. After perfusion the apex and basis of the left ventricle were collected for analysis of mtDNA damage and BER mRNA expression by qPCR, respectively. The mid-ventricle was collected for infarct size measurements. 2.2.2. Infarct size measurement After reperfusion hearts from groups 2 and 3 were cut in four ventricular slices of 1 mm. The slices were incubated at 37 °C in 1% triphenyltetrazolium chloride (TTC) for 15 min. After incubation the slices were gently pressed between two glass plates and photographed (Nikon Coolpix 5400). The infarct area was measured as percentage of total heart area minus cavities and calculated with Adobe Photoshop by a researcher blinded to the groups. 2.3. In vivo infarction model Mice were anesthetized with 1.5% isoflurane (Baxter Norway) mixed with pure oxygen and intubated. They were placed on a heating plate with temperature kept at 37.5 °C in a slightly rotated supine position under a dissecting microscope. The mice were ventilated at a respiratory rate of 113/min (Ventilator: Model 874 092, B. Braun, Melsungen, Germany). The thoracic region was shaved and the skin incised. The left pectoral muscle was retracted bluntly and the thoracic cavity was opened in the fourth intercostal space. The pericardium

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

11

Table 1 Mouse specific mtDNA primers used for mtDNA damage analysis by PCR. Target

Forward primer (5′ → 3′)

Reverse primer (5′ → 3′)

117 bp 10 kb

CCCAGCTACTACCATCATTCAAGT GAGAGATTTTATGGGTGTAATGCGG

GATGGTTTGGGAGATTGGTTGATGT GCCAGCCTGACCCATAGCCATAATAT

was opened and the heart exposed. Bleeding was controlled using electrocauterization. The left coronary artery was occluded by an 7–0 polypropylene suture (Ethicon, Johnson & Johnson, Lysaker, Norway) 1.5 mm under the tip of the left auricle and left for 35 min before reperfusion. Subsequently the intercostal space, muscles, and skin were reattached using a 6–0 polypropylene suture. The animals were extubated when spontaneous respiration occurred and placed in a post-operative mini-intensive care unit keeping 30 °C and 100% humidity over night. They received 0.5 ml 0.9% NaCl (Sigma, Drammen, Norway) intraperitoneally twice to compensate for the fluid loss and 0.1 mg/kg of buprenorphine (Schering-Plough, Eiksmarka, Norway) subcutaneously for analgesia. Administration of buprenorphine was repeated whenever an animal manifested signs of pain. Echocardiography was performed as described below preoperatively and six weeks post infarction. Six weeks postoperatively all animals were euthanized with intraperitoneal sodium pentobarbital (50 mg/kg). When respiration and reflexes faded, hearts were sampled and quickly rinsed in PBS to remove the remaining blood. 2.3.1. Experimental groups Group 1: ogg1−/− (n = 8) and age-matched C57/Bl6 wild types (n = 7) underwent 35 min of left coronary artery occlusion and reperfusion for six weeks. Group 2: ogg1−/−/myh−/− (n = 6) and age-matched C57/Bl6 wild types (n = 6) underwent 35 min of left coronary artery occlusion and reperfusion for six weeks. Hearts from both groups were sectioned into ischemic area and remote area of the left ventricle before being frozen in liquid nitrogen and stored at − 80 °C for later analysis. Unoperated (only harvested and rinsed in PBS) and operated hearts were further analyzed for mtDNA damage and mtDNA BER mRNA expression by PCR. 2.4. Transthoracic echocardiography Echocardiographic recordings were performed under sedation with 1.5% isoflurane mixed with pure oxygen. Preoperatively and six weeks postoperatively transthoracic echocardiography was performed (Vevo 770 System) using a 13-MHz linear array transducer. Before echocardiography the thoracic region was shaved. The position of the probe was fixed during the procedure and the body temperature was kept at 37 °C. Electrodes integrated in the heating plate registered the electrocardiogram. Two dimensional guided M-mode recordings in sagittal and

frontal axes were obtained; left ventricular internal, septal and posterior wall dimensions were used as end-points. The derived functional parameters of ejection fraction, fractional shortening, left ventricular volume and mass were calculated. All dimensions were analyzed offline by using the EchoPac software analysis program (GE Vingmed Ultrasound, Horten, Norway). 2.5. DNA isolation, mtDNA copy number and mtDNA damage estimation Total DNA was isolated from the apex of ex vivo ischemic reperfused hearts and from the ischemic and remote region of in vivo ischemic reperfused hearts using a DNA extraction kit (DNeasy blood and tissue kit, Qiagen). Total DNA from unperfused and unoperated hearts were used as controls. Total DNA concentration was measured with Nano drop and 20 ng of total DNA was applied in the reaction. mtDNA damage was detected by quantitative PCR according to Santos [32]. Briefly, two fragments (117 bp and 10 kb) are amplified from the mtDNA with primers listed in Table 1. Since lesions are randomly distributed, the amplification of the 10 kb is selectively inhibited. After 20 amplification cycles, the PCR mixture was separated on an agarose gel stained with SYBR Safe DNA gel stain (Invitrogen) and photographed (Gel Logic 200 imaging systems). PCR products were quantified by densitometric analysis using ImageQuant (GE Healthcare). The linearity of the reaction was confirmed by including a control reaction containing 50% template DNA. The ratio between 10 kb and 117 bp gives an estimate of the mtDNA damage, which was normalized to unoperated or unperfused wild type samples (unless otherwise stated). mtDNA copy number was determined by the amplifiable amount of 117 bp fragment. 2.6. mRNA extraction and cDNA synthesis Unperfused control hearts, ex vivo ischemic reperfused left ventricles as well as unoperated control hearts and in vivo ischemic reperfused hearts divided into infarct area and remote area were used for RNA extraction using RNeasy Mini Kit (QIAGEN Inc.) with an additional phenol-chloroform (Sigma) extraction step and in-column DNase treatment (QIAGEN). The quantity of RNA was calculated from adsorption at 260 nm with Nanodrop. Agilent Bioanalyser 2100 (Agilent technologies) was used to assess RNA integrity and RIN values above 8 were accepted. Random hexamers for priming (3 min at 70 °C) were used for reverse transcription of 1 μg of RNA followed by a modified First Strand cDNA Synthesis Protocol with Superscript III (Invitrogen) and RNasin

Table 2 Mouse-specific primer sequences used for real time qPCR. RPL32 was used as a reference gene. Sybr Green was used for detection in ABI prism 7900. Target

Forward primer (5′ → 3′)

Reverse primer (5′ → 3′)

UNG NTH1 OGG1 NEIL1 NEIL2 MYH MPG BNP RPL32

CAGTGTCCAAAGACCAGTTCCA CCGAAGGTGAGGAGGTACCA CTTATCATGGCTTCCCAAACCT AGGATTTTGCTGCCTTTCGA GCCCAGGCTGGTACTCCATT CCGTGTCCGGGCCATT CATTTCTGGGACAGGTTCTTGTC TGTTTCTGCTTTTCCTTTATCTGTCA TCGTCAAAAAGAGGACCAAGAAG

AGGATGAACAAAACCATCGATGT GTTGCATAGCACCTGCTGTGA GGTACCCCAGGCCCAACTT CCGGGATCACCCTGGAA TCACAGGTGGGCTCAATCAC GCTAAGTTCCAGAGGTGATGAGAGA TGCCTCAGTCTCCACAATGC CTCCAGCAGCTTCTGCATCTT CCGCCAGTTTCGCTTAATTT

Uracil-DNA glycosylase 1 (UNG), endonuclease III homolog 1 (NTH1), 8-oxoguanine glycosylase 1 (OGG1), nei endonuclease VIII-like 1 (NEIL1) and 2 (NEIL2), MutY (MYH), Nmethylpurine DNA glycosylase (MPG), brain natriuretic peptide (BNP), L32 ribosomal protein gene (RPL32).

12

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

Fig. 1. A. Body weight of 2.5 month old wild type (wt) mice (n = 23) and ogg1−/− (n = 23) mice. B. Body weight of 2.5 month old wt (n = 15) and ogg1−/−/myh−/− (n = 15). Individual values and median are shown. C and D. Wild type mouse hearts were harvested and perfused retrogradely with global ischemia (30 min) followed by reperfusion for 10 min (I/R 10 min) (n = 7) or 60 min (I/R 60 min) (n = 10). At the end of reperfusion DNA was isolated and amplified with species specific primers for the degree of mtDNA damage (C) and the mtDNA copy number (D). All hearts were normalized to unperfused hearts (n = 8). Values are mean ± SD. Panel E represents a schematic illustration of mtDNA and the 117 bp and 10 kb primers. Panel F illustrates a representative gel with the 117 bp and 10 kb product from unperfused hearts and hearts after ischemia and 10 min of reperfusion (I/R 10 min), each sample on the gel was loaded twice including a control reaction containing 50% template DNA.

(Promega) enzymes (10 min at 25 °C, 50 min at 42 °C and 4 min at 94 °C in a T3 Thermocycler; Biometra). 2.7. Real time quantitative PCR Gene expression of BNP, OGG1, MYH, NEIL1, NEIL 2, NTH1, UNG and MPG was amplified on cDNA using real time PCR. Species-specific oligos overlapping exon–exon junctions were designed with Primer Express 3.0 software and custom made by Eurofins mwg/operon on the basis of published cDNA sequences (Table 2). RPL32 was used as endogenous

control. PCR-reactions took place in 96-well plates using 1 μl of cDNA, 10 μl of SYBR Green Power Master Mix (Applied Biosystems) and primers at a final concentration of 250 nM in a total reaction volume of 20 μl. The PCR reaction had the standard amplification scheme: 1 cycle of 2 min at 50 °C (AmpErase UNG activation), 1 cycle of 10 min at 95 °C (Gold AmpliTaq activation, AmpErase UNG inactivation), followed by 40 cycles of denaturation for 15 sec at 95 °C and annealing/extension for 1 min at 60 °C in a ABI 7900 HT Sequence Detection System (Applied Biosystems). Melting curve analysis indicated a single peak for each set of oligos. Gene expression relative to RPL32 was

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

13

Fig. 2. Infarct size (A and C) in isolated perfused hearts of wild type (wt) (n = 10) and mice deficient of OGG1 (n = 9) or wt (n = 8) and mice deficient of OGG1/MYH (n = 8) exposed to 30 min of global ischemia and 60 min of reperfusion. Left ventricular developed pressure (LVDP) (B and D) was calculated as the difference between left ventricular systolic and end diastolic pressures. Values are individual values with median (A and C) and mean ± SD (B and D).

calculated following the standard formula: 2 − ΔΔCT, where ΔΔCT = (CTtarget_sample − CTrpl32_sample) − (CTtarget_calibrator − CTrpl32_calibrator) according to the comparative CT method (User Bulletin #2; Applied Biosystems).

(Fig. 1D) nor perfusion per se (data not shown) had any effect on mtDNA copy number. 3.3. Lack of OGG1 and MYH does not enhance ex vivo ischemia–reperfusion injury of the heart

2.8. Statistics Data are shown as mean ± SD or individual values and analyzed with GraphPad Prism 6.0. All data were tested for normal distribution by Kolmogorov–Smirnov. When normal distribution was found parametric tests were used, otherwise non-parametric tests were used. Body weight, infarct size after ex vivo ischemia–reperfusion, and mtDNA damage were analyzed with the Mann–Whitney test. Heart function in vivo and ex vivo was compared with repeated measures two-way ANOVA and Bonferroni post-tests. Gene expression was analyzed with one way ANOVA and Bonferroni post-test. 3. Results 3.1. Phenotype/body weight Animals were weighed prior to ex vivo ischemia and reperfusion or before and after in vivo ischemia and reperfusion. ogg1−/− and ogg1−/−/myh−/− mice had lower body weight than age-matched wild type mice (Figs. 1A and B). The difference in body weight vanished 6 weeks after in vivo infarction (data not shown). 3.2. mtDNA damage occurs in the early phase of reperfusion Global ischemia followed by 10 min of reperfusion increased mtDNA damage in isolated hearts compared to unperfused control hearts (Fig. 1C). After 60 min of reperfusion mtDNA damage was similar to controls (Fig. 1C). Control perfusion without ischemia caused no mtDNA damage (data not shown). Neither ischemia and reperfusion

Hearts were isolated from age-matched C57/Bl6 (wild type) and ogg1−/− hearts, perfused, and subjected to global ischemia and reperfusion to test the functional role of OGG1. Ogg1 ablation had no important effect on either infarct size (Fig. 2A) or on LVDP (Fig. 2B). LVSP, LVEDP, HR, CF, dp/dt maximum or dp/dt minimum did not differ between groups (data not shown). Because 8-oxoG damages may induce an 8oxoG:C → G:A mismatch at replication, hearts from ogg1−/−/myh−/− mice might perform worse than hearts from ogg1−/− mice. However, neither infarct size (Fig. 2C) nor LVDP (Fig. 2D) of the ogg1−/−/ myh−/− was different from wild type mice. No other functional parameter was different (data not shown). Preischemic functional values were not different between groups (data not shown). 3.4. There is no compensatory upregulation of other BER in ogg1−/− or ogg1−/−/myh−/− mice in ex vivo ischemia–reperfusion We investigated if isolated, perfused mouse hearts subjected to ischemia and reperfusion had different expressions of BER compared to non-perfused hearts. Wild type and ogg1−/− mice had no significant differences in basal mRNA Expression of MYH (Fig. 3B), UNG (Fig. 3D), MPG (Fig 3F), NTH1 (Fig 3F) and NEIL1 (data not shown). Gene expression of OGG1 decreased after ischemia and reperfusion in wild type (Fig. 3A), and was not expressed in the knockout, confirming gene deficiency. MYH was reduced in both ogg1−/− and wild type after ischemia and reperfusion, with no difference between groups (Fig. 3B). NEIL2 was decreased in unperfused ogg1−/− hearts compared to unperfused wild type hearts, and was reduced after ischemia and reperfusion in both groups (Fig. 3C). No differences between the groups in gene

14

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

Fig. 3. Hearts of wild type (wt) (n = 10) and ogg1−/− (n = 9) were isolated and retrogradely perfused with 30 min of global ischemia and 60 min of reperfusion (I/R). mRNA was extracted from whole hearts and amplified by qPCR using primers for the base excision repair enzymes 8-oxoguanine glycosylase 1 (ogg1), MutY (myh), nei endonuclease VIII-like 2 (neil2), uracilDNA glycosylase 1 (ung), endonuclease III homolog 1 (nth1) and N-methylpurine DNA glycosylase (mpg). Relative gene expression was normalized to RPL32. Hearts from unperfused wt (n = 5) were also compared to unperfused ogg1−/− (n = 5) hearts. Values are mean ± SD.

expression of UNG (Fig. 3D), NTH1 (Fig. 3E), MPG (Fig. 3F) or NEIL1 (data not shown) were found after reperfusion. There were no differences between mRNA expression in the basal state of NEIL2 (Fig 4C), UNG (Fig 4D), MPG (Fig 4E), NTH1 (Fig 4F) or NEIL1 (Data not shown) in hearts from wild type and the ogg1−/−/ myh−/− mice (Figs. 4C–F). OGG1 was not reduced by ischemia and reperfusion in wild type mice, and was not expressed in knockout, confirming the genotype (Fig. 4A). MYH was downregulated after ischemia–reperfusion in wild type, and was not expressed in hearts of knockouts (Fig. 4B). NEIL 2 was reduced in both wild type and ogg1−/−/ myh−/− after reperfusion with no difference between groups (Fig. 4C). UNG expression was downregulated in ischemic-reperfused ogg1−/−/ myh−/− hearts compared to unperfused ogg1−/−/myh−/− hearts and to ischemic-reperfused wild type hearts (Fig. 4D). NTH1 was

downregulated in both groups after ischemia–reperfusion (Fig. 4E). MPG (Fig. 4F) and NEIL1 (not shown) did not differ between unperfused and ischemia reperfused ogg1−/−/myh−/− or wild type hearts. The endogenous control RPL32 was similar in all groups and conditions (data not shown). 3.5. Lack of MYH fails to induce detectable mtDNA damage and increased mtDNA copy number after ischemia–reperfusion To investigate whether ogg1−/− and ogg1−/−/myh−/− are important for mtDNA maintenance, we quantified and compared mtDNA damage in the hearts of ogg1−/− or ogg1−/−/myh−/− with age-matched wild types both at baseline and after ischemia and reperfusion. We found increased mtDNA damage after ischemia–reperfusion in ogg1−/− hearts

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

15

Fig. 4. Hearts of wild type (wt) (n = 8) and ogg1−/−/myh−/− (n = 9) were isolated and retrogradely perfused undergoing 30 min of global ischemia and 60 min of reperfusion (I/R). mRNA was extracted from whole hearts and amplified by qPCR using primers for the base excision repair enzymes 8-oxoguanine glycosylase 1 (ogg1), MutY (myh), nei endonuclease VIII-like 2 (neil2), uracil-DNA glycosylase 1 (ung), endonuclease III homolog 1 (nth1) and N-methylpurine DNA glycosylase (mpg). Relative gene expression was normalized to RPL32. Hearts from unperfused wt (n = 3) were also compared to unperfused ogg1−/−/myh−/− (n = 3) hearts. Values are mean ± SD.

(Fig. 5A). After ischemia–reperfusion ogg1−/−/myh−/− was not different from wild type (Fig. 5B). There was no difference between ogg1−/−, ogg1−/−/myh−/− and wild type hearts at baseline (data not shown). A possible explanation of no compensatory upregulation of other BER enzymes might be that mitochondria compensate lack of mtDNA repair by enhanced replication of undamaged mtDNA molecules. The mtDNA copy number was therefore investigated in unperfused and ischemic-reperfused hearts from ogg1−/− or ogg1−/−/myh−/− and compared to age-matched wild types. ogg1−/− hearts had a higher mtDNA copy number compared to age-matched wild type hearts after ischemia–reperfusion (Fig. 5C). In addition, there was a tendency towards a higher copy number in ogg1−/− at baseline (p = 0.06) (data not shown). In ogg1−/−/myh−/− hearts there were no differences in

mtDNA copy number either at baseline (data not shown) or after ischemia–reperfusion (Fig. 5D). 3.6. The effect of ogg1−/− and ogg1−/−/myh−/− during in vivo ischemia– reperfusion of the heart Base excision repair is a multistep process requiring time, and it is possible that differences could be revealed after a longer observation period. We therefore subjected ogg1−/− and ogg1−/−/myh−/− mice to in vivo ischemia for 35 min followed by six weeks of reperfusion. Functional parameters assessed by echocardiography were performed prior to operation and six weeks postoperatively. Six weeks after ischemia neither ejection fraction (Figs. 6A and C), left ventricular mass (Figs. 6B and D), left ventricular volume (data not shown) nor fractional

16

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

Fig. 5. Hearts of wild type (wt) mice (n = 9) and ogg1−/− or wt (n = 8) mice and ogg1−/−/myh−/− (n = 8) were isolated and retrogradely perfused with global ischemia (30 min) followed by 60 min of reperfusion (I/R). DNA was isolated and amplified with species specific primers for the degree of mtDNA damage (A and B) and mtDNA copy number (C and D). mtDNA damage and mtDNA copy number in knockout hearts are normalized to wt hearts. Values are mean ± SD.

shortening (data not shown) was different between wild type and ogg1−/− or ogg1−/−/myh−/− mice. BNP was increased in the infarcted area and remote area of wild type hearts after six weeks of reperfusion (Fig. 6E). BNP did not increase significantly in either left ventricular region in ogg1−/− hearts (Fig. 6E). BNP increased in the ischemic area of both wild type and in ogg1−/−/myh−/− hearts (Fig. 6F). There was no difference of survival rates between groups (data not shown).

3.7. There is no compensatory upregulation of other BER in ogg1−/− or ogg1−/−/myh−/− mice after in vivo ischemia–reperfusion Six weeks post in vivo infarction the ischemic and the remote areas of the left ventricle were sampled separately from all hearts and gene expression was normalized to that of unoperated wild type hearts. Basal state mRNA expression of NEIL2, UNG, MPG, and NTH1 in the hearts was not different between wild type and ogg1−/− mice (Figs. 7C–F). Six weeks after infarction OGG1 expression was increased in the remote area, but not in the infarcted area of wild type mice (Fig. 7A). There was no difference in MYH between groups (Fig. 7B). In the ischemic area NEIL2 was upregulated in ogg1−/− mice compared wild type (Fig. 7C). UNG expression was lower in the ischemic area than in the remote area wild type hearts (Fig. 7D). The ischemic area of ogg1−/− hearts had lower UNG expression than unoperated hearts (Fig. 7D). MPG (Fig. 7E), NTH1 (Fig. 7F) and NEIL1 (data not shown) did not differ between groups. When comparing wild type and ogg1−/−/myh−/− there were no consistent differences in mRNA expression of NEIL2, UNG, MPG or NTH1 at baseline (Figs. 8C–F). OGG1 decreased in the remote area of the left ventricle, and increased in the ischemic area (Fig. 8A). In wild type hearts expression of MYH (Fig. 8B), NEIL2 (Fig. 8C), MPG (Fig. 8E), and NTH1 (Fig. 8F) was increased in the ischemic area compared to the remote area. UNG did not differ between groups (Fig. 8D). There was no difference in NEIL1 between the groups (data not shown).

3.8. Ogg1−/− and ogg1−/−/myh−/− do not have increased mtDNA damage and mtDNA copy number after in vivo ischemia–reperfusion mtDNA damage was not different between the remote and ischemic region six weeks after coronary artery ligation (data not shown). The data in Fig. 9 represent pooled data from ischemic and remote regions. mtDNA damage was not different in hearts from ogg1−/− (Fig. 9A) or ogg1−/−/myh−/− (Fig. 9B) mice six weeks after infarction compared to age-matched wild type mice. No differences were found at baseline (data not shown). The mtDNA copy number did not differ between groups after in vivo ischemia–reperfusion (Figs. 9C and D) or at baseline (data not shown). 4. Discussion The main findings in the present study were that mtDNA was damaged during early reperfusion of wild type hearts. The damage was enhanced in hearts of mice lacking the BER enzyme Ogg1. However, this did not appear to be important for heart function, since no loss of postischemic function was found in hearts of mice lacking the base excision repair enzymes OGG1 and OGG1/MYH. 4.1. mtDNA is damaged during early reperfusion The increase in mtDNA damage in isolated hearts was not induced by perfusion per se, but occurred during reperfusion after an ischemic insult. This is in agreement with several studies which have shown that cardiac injury causes mtDNA damage and release both in humans [14,27,33] and in animal models [33–36]. ROS release during reperfusion is instantaneous [37,38], and corresponds with our findings that mtDNA is damaged 10 min into reperfusion. However, mtDNA damage returned to baseline values after 60 min of reperfusion ex vivo, and was not different from baseline six weeks after in vivo ischemia–reperfusion. A transient increase of mtDNA damage during reperfusion can be

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

17

Fig. 6. Ejection fraction (A and C) and left ventricular mass (B and D) were calculated from M-mode echocardiographic investigations before (Preop) and six weeks after induced myocardial ischemia (35 min) and reperfusion (6 weeks Postop) in wt (n = 9) and ogg1−/− (n = 9) mice or wt (n = 6) and ogg1−/−/myh−/− (n = 6) mice. Hearts were harvested after six weeks of reperfusion, mRNA was extracted from the infarcted and the remote areas and amplified by qPCR using primers for brain natriuretic peptide (BNP). Relative gene expression was normalized to RPL32. Unoperated wt mice hearts (n = 3–5) were compared to unoperated ogg1−/− (n = 5) (E) or ogg1−/−/myh−/− (n = 3) hearts (F). Values are mean ± SD.

explained by a rapid increase in mtDNA replication, mtDNA degradation or enhanced mtDNA repair. We therefore investigated the mtDNA copy number, represented by the short 117 bp mtDNA fragment. We found no differences in mtDNA copy number between unperfused hearts or ischemic hearts reperfused for 10 or 60 min, or after 6 weeks of reperfusion in vivo. These findings suggest that during this time there was no increased mtDNA replication or enhanced mtDNA degradation. 4.2. mtDNA damage and mtDNA copy number in ogg1−/− and ogg1−/−/ myh−/− mice after ischemia–reperfusion of the heart 8-oxoG base lesions are the most widely studied oxidative DNA lesions, and are often used as a marker for DNA damage. Increased 8oxoG is found in injured human hearts (atrial fibrillation) [15] as well as in animal models of doxorubicin induced cardiac injury [33,34]. Postischemic rat hearts have enhanced levels of 8-oxoG and increased expression of OGG1 [26]. Furthermore, OGG1 appears essential for repair of 8-oxoG lesions in mtDNA isolated from liver [22]. OGG1 and

MYH can repair oxidized guanines and the potentially misincorporated adenine respectively. We tested the effect of OGG1 single or OGG1 and MYH double deficiency during cardiac ischemia and reperfusion on mtDNA damage. After ex vivo induced ischemia and reperfusion mtDNA damage increased in ogg1−/−, but surprisingly not ogg1−/−/ myh−/− hearts. After ischemia–reperfusion mtDNA copy number also increased in ogg1−/− mice compared to the age-matched wild type. This might indicate that enhanced mtDNA replication is one compensatory mechanism in OGG1 deficiency. mtDNA damage was measured by the ability to amplify a long fragment of mtDNA, a process that is stopped when mtDNA is damaged. This could be due to several types of mtDNA lesions including oxidized bases, strand breaks, abasic sites and DNA deletions. Oka et al. found that lack of MYH prevented the generation of abasic sites which further were converted into single strand breaks by endonucleases [39]. They also found that lack of MYH prevented cell death induced by menadione in a mouse embryonic fibroblast cell line, indicating that MYH may induce cell death by induction of single strand breaks. This might explain

18

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

Fig. 7. Wild type (wt) mice (n = 9) and mice deficient of ogg1−/− (n = 9) were subjected to in vivo 35 min of ischemia and six weeks of reperfusion. Hearts were harvested and mRNA was extracted from the infarcted and the remote areas and amplified by qPCR using primers for 8-oxoguanine glycosylase 1 (ogg1), MutY (myh), nei endonuclease VIII-like 2 (neil2), uracilDNA glycosylase 1 (ung), N-methylpurine DNA glycosylase (mpg) and endonuclease III homolog 1 (nth1). Unoperated wt mice hearts (n = 5) were compared to unoperated ogg1−/− (n = 5) Hearts. RPL32 was used as a reference gene. Values are mean ± SD.

the lack of mtDNA damage found in the ogg1−/−/myh−/− mice. Furthermore, in models of ROS-induced mtDNA damage in a colorectal carcinoma cell line, Shokolenko et al. found that ROS induced a rapid increase of

mtDNA damage [40]. However, they detected ten times more combined strand breaks and abasic sites than mutagenic base lesions, implying that the predominant lethal form of ROS-induced mtDNA damage

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

19

Fig. 8. Wild type (wt) mice (n = 6) and mice deficient of ogg1−/−/myh−/− (n = 6) were subjected to in vivo 35 min of ischemia and six weeks of reperfusion. Hearts were harvested, mRNA was extracted from the infarcted and the remote areas and amplified by qPCR using primers for 8-oxoguanine glycosylase 1 (ogg1), MutY (myh), nei endonuclease VIII-like 2 (neil2), uracil-DNA glycosylase 1 (ung), N-methylpurine DNA glycosylase (mpg) and endonuclease III homolog 1 (nth1). Unoperated wt mice hearts (n = 3) were compared to unoperated ogg1−/−/myh−/− (n = 3) hearts. RPL32 was used as a reference gene. Values are mean ± SD.

20

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

Fig. 9. Wild type (wt) mice (n = 9) and mice deficient of ogg1−/− (n = 9) or wt (n = 6) mice and mice deficient ogg1−/−/myh−/− (n = 6) were subjected to in vivo regional myocardial ischemia for 35 min and six weeks of reperfusion (Postop). Hearts were harvested and DNA was isolated and amplified with species specific primers for the degree of mtDNA damage (A and B) and mtDNA copy number (C and D). Ischemic area and remote area are analyzed together. mtDNA damage and mtDNA copy number in knockout hearts are normalized to wt hearts. Values are mean ± SD.

may possibly not be oxidized base lesions. Additionally, Shokolenko et al. showed that mtDNA repair and degradation pathways competed during ROS-induced mtDNA damage in several cell lines. By increasing the damage severity, or by inhibiting base excision repair, mtDNA degradation was enhanced. Consequently, severe mtDNA damage may induce mechanisms of degradation instead of repair and oxidized bases may not be the rate-limiting factor deciding between mtDNA degradation versus repair. We found an early increase of mtDNA damage after ischemia–reperfusion in ogg1−/− mice. This observation was not reproduced after six weeks of reperfusion in vivo. The transient increase in mtDNA damage might be explained by increased mtDNA degradation and replication in ogg1−/− mice. This possibility may be supported by the finding of increased mtDNA copy number after ischemia in the isolated heart model. Moreover, we found no differences in mtDNA damage or mtDNA copy number in the ogg1−/−/myh−/− model compared to agematched wild type hearts after 1 h or six weeks of reperfusion. Similarly, Halsne et al. found little changes in mtDNA damage in the liver, brain or lung from ogg1−/−/myh−/− mice over an observation period from one to six months [41].

4.3. Functional effect of OGG1 or OGG1/MYH ablation after ischemia–reperfusion of the heart Despite the increased mtDNA damage after reperfusion in isolated, perfused ogg1−/− hearts, OGG1 ablation alone or in combination with MYH seemed not to be important for infarct size or the functional outcome after acute cardiac ischemia followed by either short-term or long-term reperfusion. This is in contrast to studies in the brain, where deficiency of OGG1 enhanced infarct area and reduced functional outcome [25]. Furthermore, Wang et al. demonstrated that cardiac overexpression of human Ogg1 was associated with reduced cardiac

fibrosis, improved contractility and reduced mtDNA 8oxoG levels in a mouse model of pressure overload-induced heart failure [28]. Based on pilot studies and expectations of increased damage in the knockout animals, we chose 35 min of ischemia for our invivo model to study long term effects of ischemia and reperfusion. In retrospect this damage was too small to be detected with transthoracic echocardiography as we find no difference in LV ejection fraction. However, measurement of BNP, a surrogate marker of ischemic injury [42] showed an increase in cardiac damage in our in vivo model. Transthoracic echocardiography in small rodent models might be suboptimal to reveal small changes in ejection fractions. Taken together we would argue that lacking mtDNA repair mechanisms has minor chronic effect on cardiac function after ischemic injury, at least after a modest damage. We hypothesized that our knockout models had compensatory upregulation of other mtDNA BER enzymes. The NEIL family primarily excises oxidized purines. NEIL1 localized in mitochondria [43] has overlapping substrate specificity with OGG1 [44,45]. NEIL2 is also implicated in mtDNA repair [41,46]. In addition, NEIL1 and 2 share some of the substrate specificity with NTH1, which normally excises a wide range of pyrimidine lesions, and is mostly localized in the mitochondrion [47]. No consistent upregulation of other mitochondrial BER enzymes in any of our knockout models was found compared to wild type hearts. Consequently, knockout models were not functionally rescued after ischemia–reperfusion injury by altered gene expression of the BER enzymes investigated in this study. Expression of several BER enzymes decreased after ischemia and reperfusion of isolated hearts, while many were upregulated after six weeks reperfusion in vivo. The time frame of observation and the use of ex vivo versus in vivo models may explain this discrepancy. Downregulation of OGG1 gene expression after oxidative stress has been reported earlier. Tsuruya et al. demonstrated a reduction of OGG1 gene expression in the outer medulla of the kidney after ischemia and 3 h of reperfusion and an increase from 3–14 days [48]. The reduced

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

mRNA expression seen during reperfusion in the ex vivo model could be explained by increased protein translation. One hour of reperfusion might be too short to induce transcriptional upregulation as seen in the in vivo model. In accordance with upregulation of BER enzymes after in vivo ischemia in the present study, Yndestad et al. [26] found upregulated expression of OGG1 and NEIL2 in a similar rat model. 5. Conclusion In this study, we found increased mtDNA damage during early reperfusion of the heart. mtDNA damage was increased in mice deficient of OGG1, but not in mice deficient of OGG1 and MYH. Six weeks after reperfusion in vivo, this difference disappeared. OGG1 or OGG1/MYH ablation had no implications on the functional outcome after ischemia– reperfusion injury ex vivo or in vivo. The lack of functional impairment after ischemia–reperfusion injury in our knockout models could not be explained by compensatory upregulation of other potential mitochondrial BER enzymes. Thus, repair of mitochondrial DNA oxidative base lesions may not be important for maintenance of cardiac function during ischemia and reperfusion. Funding This work was supported by the Norwegian Research Council (214557), the Norwegian Health Association, the Novo Nordisk Foundation and the University of Oslo. Marte Bliksøen was supported by a grant from South-Eastern Regional Health Trust (39304) and the Gjensidige Foundation. Disclosure statement None declared. References [1] Kim J-S, Jin Y, Lemasters JJ. Reactive oxygen species, but not Ca2+ overloading, trigger pH- and mitochondrial permeability transition-dependent death of adult rat myocytes after ischemia–reperfusion. Am J Physiol 2006;290:H2024–34. [2] Halestrap AP. Mitochondria and reperfusion injury of the heart—a holey death but not beyond salvation. J Bioenerg Biomembr 2009;41:113–21. [3] Murphy E, Steenbergen C. Mechanisms underlying acute protection from cardiac ischemia–reperfusion injury. Physiol Rev 2008;88:581–609. [4] Albring M, Griffith J, Attardi G. Association of a protein structure of probable membrane derivation with HeLa cell mitochondrial DNA near its origin of replication. Proc Natl Acad Sci U S A 1977;74:1348–52. [5] Costa RAP, Romagna CD, Pereira JL, Souza-Pinto NC. The role of mitochondrial DNA damage in the cytotoxicity of reactive oxygen species. J Bioenerg Biomembr 2011; 43:25–9. [6] Gredilla R, Bohr VA, Stevnsner T. Mitochondrial DNA repair and association with aging—an update. Exp Gerontol 2010;45:478–88. [7] Clayton DA. Transcription of the mammalian mitochondrial genome. Annu Rev Biochem 1984;53:573–94. [8] Falkenberg M, Larsson N-G, Gustafsson CM. DNA replication and transcription in mammalian mitochondria. Annu Rev Biochem 2007;76:679–99. [9] Taanman JW. The mitochondrial genome: structure, transcription, translation and replication. Biochim Biophys Acta 1999;1410:103–23. [10] Ballinger SW, Patterson C, Yan CN, Doan R, Burow DL, Young CG, et al. Hydrogen peroxide- and peroxynitrite-induced mitochondrial DNA damage and dysfunction in vascular endothelial and smooth muscle cells. Circ Res 2000;86:960–6. [11] Giulivi C, Boveris A, Cadenas E. Hydroxyl radical generation during mitochondrial electron transfer and the formation of 8-hydroxydesoxyguanosine in mitochondrial DNA. Arch Biochem Biophys 1995;316:909–16. [12] Richter C, Park JW, Ames BN. Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc Natl Acad Sci U S A 1988;85:6465–7. [13] Yakes FM, Van Houten B. Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc Natl Acad Sci U S A 1997;94:514–9. [14] Corral-Debrinski M, Stepien G, Shoffner JM, Lott MT, Kanter K, Wallace DC. Hypoxemia is associated with mitochondrial DNA damage and gene induction. JAMA 1991;266:1812–6. [15] Lin PH, Lee SH, Su CP, Wei YH. Oxidative damage to mitochondrial DNA in atrial muscle of patients with atrial fibrillation. Free Radic Biol Med 2003;35:1310–8. [16] Corral-Debrinski M, Shoffner JM, Lott MT, Wallace DC. Association of mitochondrial DNA damage with aging and coronary atherosclerotic heart disease. Mutat ResDnaging G 1992;275:169–80.

21

[17] Ide T, Tsutsui H, Hayashidani S, Kang D, Suematsu N, Nakamura K, et al. Mitochondrial DNA damage and dysfunction associated with oxidative stress in failing hearts after myocardial infarction. Circ Res 2001;88:529–35. [18] Ide T, Tsutsui H, Kinugawa S, Utsumi H, Kang D, Hattori N, et al. Mitochondrial electron transport complex I is a potential source of oxygen free radicals in the failing myocardium. Circ Res 1999;85:357–63. [19] Van Houten B, Woshner V, Santos JH. Role of mitochondrial DNA in toxic responses to oxidative stress. DNA Repair (Amst) 2006;5:145–52. [20] Radak Z, Boldogh I. 8-Oxo-7,8-dihydroguanine: links to gene expression, aging, and defense against oxidative stress. Free Radic Biol Med 2010;49:587–96. [21] Bjørås M, Luna L, Johnsen B, Hoff E, Haug T, Rognes T, et al. Opposite base-dependent reactions of a human base excision repair enzyme on DNA containing 7,8-dihydro8-oxoguanine and abasic sites. EMBO J 1997;16:6314–22. [22] de Souza-Pinto NC, Eide L, Hogue BA, Thybo T, Stevnsner T, Seeberg E, et al. Repair of 8-oxodeoxyguanosine lesions in mitochondrial DNA depends on the oxoguanine DNA glycosylase (OGG1) gene and 8-oxoguanine accumulates in the mitochondrial DNA of OGG1-defective mice. Cancer Res 2001;61:5378–81. [23] Klungland A, Rosewell I, Hollenbach S, Larsen E, Daly G, Epe B, et al. Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage. Proc Natl Acad Sci U S A 1999;96:13300–5. [24] Stuart JA, Bourque BM, de Souza-Pinto NC, Bohr VA. No evidence of mitochondrial respiratory dysfunction in OGG1-null mice deficient in removal of 8oxodeoxyguanine from mitochondrial DNA. Free Radic Biol Med 2005;38: 737–45. [25] Liu D, Croteau DL, Souza-Pinto N, Pitta M, Tian J, Wu C, et al. Evidence that OGG1 glycosylase protects neurons against oxidative DNA damage and cell death under ischemic conditions. J Cereb Blood Flow Metab 2010;31(2):680–92. [26] Yndestad A, Neurauter CG, Oie E, Forstrøm RJ, Vinge LE, Eide L, et al. Up-regulation of myocardial DNA base excision repair activities in experimental heart failure. Mutat Res 2009;666:32–8. [27] Karamanlidis G, Nascimben L, Couper GS, Shekar PS, del Monte F, Tian R. Defective DNA replication impairs mitochondrial biogenesis in human failing hearts. Circ Res 2010;106:1541–8. [28] Wang J, Wang Q, Watson LJ, Jones SP, Epstein PN. Cardiac overexpression of 8oxoguanine DNA glycosylase 1 protects mitochondrial DNA and reduces cardiac fibrosis following transaortic constriction. Am J Physiol 2011;301:H2073–80. [29] Michaels ML, Pham L, Nghiem Y, Cruz C, Miller JH. MutY, an adenine glycosylase active on G–A mispairs, has homology to endonuclease III. Nucleic Acids Res 1990;18: 3841–5. [30] Michaels ML, Cruz C, Grollman AP, Miller JH. Evidence that MutY and MutM combine to prevent mutations by an oxidatively damaged form of guanine in DNA. Proc Natl Acad Sci U S A 1992;89:7022–5. [31] Xie Y, Yang H, Cunanan C, Okamoto K, Shibata D, Pan J, et al. Deficiencies in mouse Myh and Ogg1 result in tumor predisposition and G to T mutations in codon 12 of the K-ras oncogene in lung tumors. Cancer Res 2004;64:3096–102. [32] Kovalenko OA, Santos JH. Analysis of oxidative damage by gene‐specific quantitative PCR. Curr Protoc Hum Genet 2009;19:19.1.1–19.1.13. [33] Serrano J, Palmeira CM, Kuehl DW, Wallace KB. Cardioselective and cumulative oxidation of mitochondrial DNA following subchronic doxorubicin administration. Biochim Biophys Acta 1999;1411:201–5. [34] Palmeira CM, Serrano J, Kuehl DW, Wallace KB. Preferential oxidation of cardiac mitochondrial DNA following acute intoxication with doxorubicin. Biochim Biophys Acta 1997;1321:101–6. [35] Lebrecht D, Setzer B, Ketelsen U-P, Haberstroh J, Walker UA. Time-dependent and tissue-specific accumulation of mtDNA and respiratory chain defects in chronic doxorubicin cardiomyopathy. Circulation 2003;108:2423–9. [36] Bliksoen M, Mariero LH, Ohm IK, Haugen F, Yndestad A, Solheim S, et al. Increased circulating mitochondrial DNA after myocardial infarction. Int J Cardiol 2012;158: 132–4. [37] Ambrosio G, Zweier JL, Flaherty JT. The relationship between oxygen radical generation and impairment of myocardial energy metabolism following post-ischemic reperfusion. J Mol Cell Cardiol 1991;23:1359–74. [38] Zweier JL. Measurement of superoxide-derived free radicals in the reperfused heart. Evidence for a free radical mechanism of reperfusion injury. J Biol Chem 1988;263: 1353–7. [39] Oka S, Ohno M, Tsuchimoto D, Sakumi K, Furuichi M, Nakabeppu Y. Two distinct pathways of cell death triggered by oxidative damage to nuclear and mitochondrial DNAs. EMBO J 2008;27:421–32. [40] Shokolenko I, Venediktova N, Bochkareva A, Wilson GL, Alexeyev MF. Oxidative stress induces degradation of mitochondrial DNA. Nucleic Acids Res 2009;37: 2539–48. [41] Halsne R, Esbensen Y, Wang W, Scheffler K, Suganthan R, Bjørås M, et al. Lack of the DNA glycosylases MYH and OGG1 in the cancer prone double mutant mouse does not increase mitochondrial DNA mutagenesis. DNA Repair 2012;11: 278–85. [42] Mayr A, Mair J, Schocke M, Klug G, Pedarnig K, Haubner BJ, et al. Predictive value of NT-pro BNP after acute myocardial infarction: relation with acute and chronic infarct size and myocardial function. Int J Cardiol 2011;147:118–23. [43] Hu J. Repair of formamidopyrimidines in DNA involves different glycosylases: role of the OGG1, NTH1, and NEIL1 enzymes. J Biol Chem 2005;280:40544–51. [44] Muftuoglu M, de Souza-Pinto NC, Dogan A, Aamann M, Stevnsner T, Rybanska I, et al. Cockayne syndrome group B protein stimulates repair of formamidopyrimidines by NEIL1 DNA glycosylase. J Biol Chem 2009;284:9270–9. [45] Vartanian V, Lowell B, Minko IG, Wood TG, Ceci JD, George S, et al. The metabolic syndrome resulting from a knockout of the NEIL1 DNA glycosylase. Proc Natl Acad Sci U S A 2006;103:1864–9.

22

M. Bliksøen et al. / Journal of Molecular and Cellular Cardiology 78 (2015) 9–22

[46] Gredilla R, Garm C, Holm R, Bohr VA, Stevnsner T. Differential age-related changes in mitochondrial DNA repair activities in mouse brain regions. Neurobiol Aging 2010; 31:993–1002. [47] Ikeda S, Kohmoto T, Tabata R, Seki Y. Differential intracellular localization of the human and mouse endonuclease III homologs and analysis of the sorting signals. DNA Repair 2002;1:847–54.

[48] Tsuruya K, Furuichi M, Tominaga Y, Shinozaki M, Tokumoto M, Yoshimitsu T, et al. Accumulation of 8-oxoguanine in the cellular DNA and the alteration of the OGG1 expression during ischemia–reperfusion injury in the rat kidney. DNA Repair 2003;2:211–29.