Vol.
182,
No.
February
3, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
Pages
14, 1992
DNA in the
Mitochondrial determination
detection spermatozoa
Arbacia Carla De Giorgi
Dipartimento
and of
1454-1459
COPY number the
sea
urchin
lixula
, Alessandro D’ Alessandro and Cecilia Saccone
di Biochimica
e Biologia
Molecolare,
Universita’
di Bari,
Via
Amendola 165/A, 70126 Bari, Italy Centro di Studio sui Mitocondri Received
December
22,
e Metabolism0 Energetic0 (CNR), Italy
1991
Summary: The Polymerase Chain reaction technique has been used in order to detect and amplify a specific region of mtDNA, in a total DNA pre aration extracted from the sperm of the sea urchin Arbacia Zixula. The amplified ff a exit is the D-loo region which hybridizes with the homologous region extra&e r from the egg mt 8 NA. The results demonstrate that mtDNA is present in sperm cell, and, since the replication origin is present it is potentially able to replicate in the zygote. Furthermore, the tecnique used allowed us to estimate mtDNA copy number in sea urchin sperm, which has never been done before. Cur results are that sea urchin sperm cell contains between 4 and 28 mtDNA molecules. 0 1992
Academic
Press,
Inc.
The availability of the new techniques of cloning and sequencing has allowed impressive progress to be made in the study of mitochondrial DNA (mtDNA) in recent years. The knowledge of the sequences of the entire mt genomes of organisms fkom many different phyla, has revealed the mt gene content, the gene organization,
as well as the mechanisms of gene expression Cl].
Moreover, the
use of the polymerase chain reaction (PCR) has made possible the amplification and the sequencing of specific fragments of many different organisms from the same species or from closely related species, making the mtDNA a powerful tool for the studies of evolution, population genetics and biogeography [23. It should be stressed that the use of mtDNA lies on several peculiar features of this genome: the compact gene organization, maternal inheritance.
the high rate of nucleotide substitution
and the
Maternal inheritance is associated with the inheritance of the mitochondrial genome solely from the female parent. Using maternal and paternal mitochomhia with different restriction fragment patterns, the paternal contribution in the
0006-291x/92 $1.50 Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
1454
Vol.
182,
No.
3, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
hybrid progeny has never been detected in a large variety of examples ranging from Xenopus laevis [31 to different mammalian species, including the horse and donkey [41, the rat [5,6,71, the mouse 181 and the human [91. However recent studies have shown that in experimental population of Drosophila, three strains out of 331 lines showed a complete replacement of paternal mtDNA within 10 generations [lo] . Paternal mtDNA contribution has also been described in heteroplamic individuals from Mytilys [ll]. Very recently [121, the use of PCR has made it possible to demonstrate that mtDNA can be paternally inherited in interspecific crosses. In mice, paternally inherited mtDNA have been detected at a frequency of 10m4 relative to the maternal contribution. Although the absolute leakage of paternal molecules appears to be small, it is clear that the few paternal mitochondrial molecules transferred into the egg must be replication competents. Very little is known about the quantitative estimate of mtDNA in the sperm. In the litterature data regarding the copy number of mtDNA in gamete cells have been reported only in the case of mammals [13,141. The results reported here demonstrate that mtDNA is present in sea urchin sperm. The existence of the control region of mtDNA strongly suggests that this molecule is replication competent. Besides, this paper represents the first attempt to measure the mtDNA content in sperm cells of lower eukariotes. MATERIALS
AND
METHODS
Agarose gel electrophoresis and Southern hybridization were performed as described by Maniatis et al [15]. Sperm was collected from the sea urchin Arbacia ZixuZa by injecting about 0.5 ml of 0.5 M KC1 and it was collected in 0.01 M Tris pH 8 and O.lM EDTA The sperm count was determined in a he ycytometer and routinely checked by measurement of turbidity at 500 run (4x10 cells/~=O.18 A units). The total DNA used as template was prepared by collecting a known amount of spermatozoa in lysis buffer containin 10 mM Tris-HCl (pH 81, 2mM EDTA, 1OmM NaCl, l%SDS (w/v), 8 mg/ml dithiot~eitol, 0.4 mg/ml proteinase K Lysis was carried out at 37 O for 1 hour. Then the DNA was extracted with 1OmM Tris- HCl saturated phenol, with chloroform!isoam lalcohol24:l (v/v) and ethanol recipitated in the presence of 0.3M Na Acetate. T Ke DNA was recovered and disso Pved in water. mtDNA fragments were amplified b 35 amplification cycles each consisting of denaturation at 94 O for 1 min, annea %‘ng at 49 o for 1 min and extension at 72 O for 2 min. After amplification 10% of the mixture were electrophoresed in 2% agarose gel and stained with ethidium bromide. The filter was transferred onto nitrocellulose paper and hybridized as described [15]. Total DNA and amplified mtDNA, were analyzed by agarose gel electrophoresis with ethidium bromide. A known amount of DNA was run on the same gel. After electrophoresis the el was photographed on transmitted UV light, using Polaroid Type 665 films. 5 he negatives of the fotographs were scanned in a laser densitometer Ultroscan XL, LKB, and the amount of DNA was measured in comparison with the known sample. RESULTS The aim of this work was to assess not only the presence of the mtDNA molecule in the sea urchin sperm, but also the competence of this molecule to replicate. We 1455
Vol.
182,
No.
3, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
decided therefore to search for the existence region of the molecule which
the i.e. particularly
the replication
origin,
which
RESEARCH
COMMUNICATIONS
of the most crucial part of the mtDNA, contains the control elements and has been called D-loop [161. In the egg
mtDNA this region is very well characterized, and the nucleotide three different sea urchin mtDNAs has been published. [17,18,19,1. We selected
the region 306 bp long flanked
by two tRNA
sequence
from
genes, the tyrosine
and
the glicine tRNAs [17] which were used as primers. We decided to design the primers for PCR by using these sequences, because the tRNA sequences are the most conserved regions of the mtDNA of tyrosine tR.NA and glicine tRNA hairpin
structures
regions
of the mtDNA
molecule [20]. Furthermore, do not give rise to strong
and they show virtually
no homology
(about 9,800 bp) ofA.ZixuZu.
(Table
A specific mtDNA fragment derived from egg mtDNA, the D-loop, region was used as a control. In fig 1 the ethidium
stained
with
the sequences inter-molecular
the other sequenced
1)
2280 bp long and spanning
agarose gel is shown.
It can be seen that a band
of the size corresponding at about 300 bp is present either when egg mtDNA or sperm mtDNA were used as templates. This demonstrates that in sperm mtDNA the amplified fragment
fragment
does exist
has the expected in both types
size and thus
of gametes.
clearly
Moreover,
we tried
mtDNA sample derived from very few spermatozoa, between the product of these experiments was analyzed by agarose did not yield fragments mtDNA indicate
were
any relevant transferred
amplification
product.
from the gel to the filter
indicates
to amplify
1 and 10 cells. When gel electrophoresis, it
However,
when
and hybridized
the mtDNA with
probe, the 306 bp band was present (Fig 2). These results that even when the PCR reaction was stopped before a visible
mt DNA was synthesized, In order to estimate
a fragment the amount
that this
the egg
detinitely amount of
was detected by hybridization. of mtDNA
used as template,
the egg mtDNA
segment was used as an internal control. This was added in known amounts series of reactions and amplified in parallel with sea urchin sperm total DNA
Table 1. Synthetic oligonucleotides employed as Primers in Polymerase Chain Reaction L
736
5’- TCGAAAGTCAATAGCACAGA
-3’
H 1040
5’- GGTTCGATCCCCGTCTCC’M’
3’
L and H refer to the light and heavy strands, respectively and the numbers refer to the 5 sition of the oligonucleotide in A. Exula sequenced mtDNA [l 7l? 1456
to a The
Vol.
182, No. 3, 1992
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
23 kD form was alsopresentin the cytosol and waslabelled with [3H]-mevalonate (Figure 3B). Triton X-114 phase separation of cytosol showed that, whereas the 24 kD band partitions almostexclusively in the aqueousphase,the 23 kD band partitions equally in both phases(Figure 3C) . We have alsodetected the presenceof a 24 kD band in the membrane fraction (Figure 3A) . This band was not labeled with [3H]-mevalonate (Figure 3B) but, interestingly, partitioned mostly in the detergentphase(Figure 3D). The minor forms of 24 and 23 kD bands(membrane-boundand cytosolic, respectively) were more abundantat late stageof infection, but could be detectedfrom the very beginning of the viral cycle (data not shown).
Discussion Rab6p expressedin the baculovirus/insectcells systemexists under two major forms: a 24 kD cytosolic form which partitions in the aqueousphaseof Triton X-114 and a 23 kD membrane-boundform which partitions in the detergent phase.The cytosolic 24 kD form which displays the same electrophoretic mobility as rab6p expressed in E. coli likely represents the unprocessed, hydrophilic precursor form of the protein. This form is undetectable in mammalian cells, except during short pulse experiments (Yang et al., unpublishedresults).Its presencein baculovirus-infectedinsectcells may reflect a saturation of membraneattachmentprocessdue to overexpressionof rab6p. The membrane-bound23 kD form is isoprenylated and preliminary data indicate it is also carboxyl-methylated. The lipid moiety present on rab6p is presumably a geranyl-geranyl group since it has been recently shownthat rab6p can be geranylgeranylatedin virt-o. (19) Rab6p terminateswith C-S-C and proteolytic cleavageof the carboxyl-end during processing (asoccursfor ras in which three amino acidsareremoved to leave a cysteine at the very end) is unlikely sincethesecysteinesare targets for geranyl-geranylation (18, 19). The migration of rab6p at 23 kD may then solely reflect isoprenylation.This is supportedby the fact that the minor cytoplasmic form of rab6p which migrates at 23 kD is isoprenylated as well. In mammaliancells, the cytoplasmic form of rab6p, which representsabout 30% of the total protein at the steady state, also migrates at 23 kD. The present data suggest that the cytoplasmic form of mammalian rab6p is in fact isoprenylated and we are currently addressingthis question. It may seemsurprising that an isoprenylated protein stays in the cytoplasm or doesnot partition totally in the detergentphaseof Triton X-l 14 (Figure 3 and unpublishedresultsconcerningmammaliancytosolic rab6p). A possibleinterpretation is that the part of the 23 kD cytoplasmic form of rab6p interactswith a protein which masksthe lipid moiety. This could be the role of a GDI-like protein which inhibits both the dissociationof GDP and membrane binding, as recently shown by Takai and co-workers for smg p25A (rab3A) (32). The fact that an isoprenylated cytoplasmic form of rab6p is also detected in insect cells could indicate the presenceof a GDI-like protein in thesecells. In any case,the 23 kD cytoplasmic form likely representsa pool in equilibrium with the membrane-boundform, both in insectand mammaliancells. 1503
Vol.
182, No. 3, 1992
BIOCHEMICAL
AND BIOPHYSICAL RESEARCH COMMUNICATIONS
DISCUSSION The experiments
reported here demonstrate the presence of the mtDNA control
region in sea urchin sperm, strongly suggesting that this mtDNA is competent in the replication. Deletions in mtDNA
molecules have been described recently in mitochondrial
diseases. In most cases mtDNA shows deletions of different length, from one single base up to a region of 5 kb. All the deletions, however, are in regions of the mitochondrial genome containing structural components of the respiratory chain [21]. It has been demonstrated that mutated DNA is still replication competent if a specific region the LSP promotor, having a key role in mtDNA replication by directing synthesis of an RNA primer, is present in the D-loop control region [221. In the case of sea urchin, such a detailed analisys has yet to be carried out, though the region that we detected and amplified corresponds to the control region of mammalian mtDNA and therefore we can assume that sperm mtDNA is not impaired per se in the replication.
It is still possible that, although the overall
length of this region is exactly that of the egg mtDNA, the base sequence of this region is different from the corresponding egg mtDNA sequence. However, since the size is identical
and the P32 hybridization
was carried out under stringent
conditions, the possibility that large base rearrengments
destroying the ability to
replicate, have occurred, remains unlike. It is interesting to note that by using this technique the number of molecules present in a given biological source can be easily quantitated.
The average number
of D-loop fragments we obtained in each sperm cell was between 4 and 28; it is very probable that these figures coincide with the copy number of the entire mtDNA molecules because, as a rule, each mtDNA contains only a single D-loop region, and only a few exceptions have been reported [23,24]. It is known for many years that the midpiece of the sea urchin sperm is composed by a single, large, ring-shaped mitochondrion. During spermatogenesis, mitochodria aggregate, reduce in number and increase in size to give rise to the single mitochondria in mature sperm [251. On the other hand, mammalian mature sperm contain approximately 75 mitochondria [141. During spermatogenesis the number of mt genomes decreases 8-10 fold resulting of one copy of mtDNA /mitochondrion 1131. Since the sea urchin sperm cells we used were all at the same developmental stage, the number we report is an average number of mature sperm cell. Whether such a number is developmentally regulated or not, we cannot say at the moment.
ACKNOWLEDGMENTS The authors thank Dr. Graxiano Pesole for his critical reading of the manuscript. This work was supported in part by a grant from Ministero della Universita e della Ricerca Scientifica. 1458
Vol.
182,
No.
3, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
REFERENCES
De Giorgi, C., and Saccone, C. (1988) Cell Bio ys. 14,67-78. Kocher, T.D.,Thomas, V.K., Meyer, A., Edwar x s, S.V., Paabo, S., Villablanca, F.X., and Wilson, A.C. (1989) Proc.Natl.Acad.Sci USA 86,6196-6200.
10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20.
21. 22. 23. 24. 25.
Dawid., LB., and Blacker, A.W. (1972) Dev. Biol. 29,152-161. Hutchison III, C.A., Newbold, J.E., Potter, S.S., and Edge& M.H. (1974). Nature 251,536~538. Francisco, J., and Simpson, M.V. (1977) FEBS Lett. 79,291-294. Kroon, A.M., deVos, W.M., and Bakker, H. (1978) B&him. Biophys. Acta 519269-273. Hayasm, J., Yanekawa, H., Gotoh, O., Watanabe, J., and Tagashira, Y. (1978). Biochem. Biophys. Res. Commun. 83: 1032-1038. Avise, J.C., Lansman, R.A., and Shade, R.O. (1979) Genetics 92,279-295. Giles, R.E., Blanc, H., Cann, H.M., and Wallace, D.C. (1980) Proc.Natl.Acad. Sci. USA 77,6715-6719. Kondo, R., Satta, Y., Matsuura, E.T., Ishiwa, H., Takahata, N., and CIngusa, S.I. (1990) Genetics 126,657-663. Hoeh, W.R., Blakley, KH., and Brown, W.M. (1991) Science 241,1488-1490. Gyllensten, U., Wharton, D., Josefsson, A., and Wilson, AC. (1991) Nature 352,255-257. Hecht, N., Liem, H., Kleene, KC., Distel, R.J., and Ho, S. (1984) Dev. Bio. 102,452-461. Michaels, G.S., Hauswirth, W.W., and Laipis, P.J. (1982) Dev. Bio. 94, 246-251. Maniatis, T., Fritsch, E.F.,and Sambrook, J. (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Jacobs, H.T., Herbert, E.R. and Rankine, J. (1989) Nut. Acids Res. 17, 8949-8965. De Giorgi, C., Lanave, C., Musci, M.D., and Saccone, C. (1991) Mol. Biol. and Evol. 8,55-529. Jacobs, H.T., Elliot, D., Veerabhadracharya, B.M., and Farquharson, A. (1988) J. Mol. Biol. 202,185-217. Cantatore, P., Roberti, M., RainaIdi, G., Gadaleta, M-N., and Saccone, C. (1989) J. Biol.Chem. 264,10965-10975. Saccone, C., Attimonelh, M., De Giorgi, C., Lanave, C., and Sbisa’, E. (1990) In Structure , function and biogenesis of energy transfer systems (Quagliariello, Papa, Pahnieri, Saccone eds), 93-96. Elsevier Science Publishers. Schon, E., Rizzuto, A., Moraes, C.T., Nakase, H., Zeviani, M., and Di Mauro, S. (1989) Science 244,346-349. Moraes, C.T., Andreetta, F., Bonilla, E., Shanske, S., Di Mauro, S., and Schon, E.A. (1991) Mol. Cell. Biol. 11,1631-1637. Moritz, C., and Brown, W.M. (1987) Science 223,1425-1427. Snyder, M., Fraser, A.R., Laroche, J., Gratner- Kepkay, KD., and Zouros, E. (1987) Proc. Natl. Acad. S&USA 84,7595-7599. Stearns, L.W. Sea urchin development: Cellular and molecular aspect. (1974). Dowden, Hutchinson & Ross, Inc. Stroudsburg Pennsylvania.
1459
182,
No.
February
3, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
Pages
14, 1992
DNA in the
Mitochondrial determination
detection spermatozoa
Arbacia Carla De Giorgi
Dipartimento
and of
1454-1459
COPY number the
sea
urchin
lixula
, Alessandro D’ Alessandro and Cecilia Saccone
di Biochimica
e Biologia
Molecolare,
Universita’
di Bari,
Via
Amendola 165/A, 70126 Bari, Italy Centro di Studio sui Mitocondri Received
December
22,
e Metabolism0 Energetic0 (CNR), Italy
1991
Summary: The Polymerase Chain reaction technique has been used in order to detect and amplify a specific region of mtDNA, in a total DNA pre aration extracted from the sperm of the sea urchin Arbacia Zixula. The amplified ff a exit is the D-loo region which hybridizes with the homologous region extra&e r from the egg mt 8 NA. The results demonstrate that mtDNA is present in sperm cell, and, since the replication origin is present it is potentially able to replicate in the zygote. Furthermore, the tecnique used allowed us to estimate mtDNA copy number in sea urchin sperm, which has never been done before. Cur results are that sea urchin sperm cell contains between 4 and 28 mtDNA molecules. 0 1992
Academic
Press,
Inc.
The availability of the new techniques of cloning and sequencing has allowed impressive progress to be made in the study of mitochondrial DNA (mtDNA) in recent years. The knowledge of the sequences of the entire mt genomes of organisms fkom many different phyla, has revealed the mt gene content, the gene organization,
as well as the mechanisms of gene expression Cl].
Moreover, the
use of the polymerase chain reaction (PCR) has made possible the amplification and the sequencing of specific fragments of many different organisms from the same species or from closely related species, making the mtDNA a powerful tool for the studies of evolution, population genetics and biogeography [23. It should be stressed that the use of mtDNA lies on several peculiar features of this genome: the compact gene organization, maternal inheritance.
the high rate of nucleotide substitution
and the
Maternal inheritance is associated with the inheritance of the mitochondrial genome solely from the female parent. Using maternal and paternal mitochomhia with different restriction fragment patterns, the paternal contribution in the
0006-291x/92 $1.50 Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
1454
Vol.
182,
No.
3, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
hybrid progeny has never been detected in a large variety of examples ranging from Xenopus laevis [31 to different mammalian species, including the horse and donkey [41, the rat [5,6,71, the mouse 181 and the human [91. However recent studies have shown that in experimental population of Drosophila, three strains out of 331 lines showed a complete replacement of paternal mtDNA within 10 generations [lo] . Paternal mtDNA contribution has also been described in heteroplamic individuals from Mytilys [ll]. Very recently [121, the use of PCR has made it possible to demonstrate that mtDNA can be paternally inherited in interspecific crosses. In mice, paternally inherited mtDNA have been detected at a frequency of 10m4 relative to the maternal contribution. Although the absolute leakage of paternal molecules appears to be small, it is clear that the few paternal mitochondrial molecules transferred into the egg must be replication competents. Very little is known about the quantitative estimate of mtDNA in the sperm. In the litterature data regarding the copy number of mtDNA in gamete cells have been reported only in the case of mammals [13,141. The results reported here demonstrate that mtDNA is present in sea urchin sperm. The existence of the control region of mtDNA strongly suggests that this molecule is replication competent. Besides, this paper represents the first attempt to measure the mtDNA content in sperm cells of lower eukariotes. MATERIALS
AND
METHODS
Agarose gel electrophoresis and Southern hybridization were performed as described by Maniatis et al [15]. Sperm was collected from the sea urchin Arbacia ZixuZa by injecting about 0.5 ml of 0.5 M KC1 and it was collected in 0.01 M Tris pH 8 and O.lM EDTA The sperm count was determined in a he ycytometer and routinely checked by measurement of turbidity at 500 run (4x10 cells/~=O.18 A units). The total DNA used as template was prepared by collecting a known amount of spermatozoa in lysis buffer containin 10 mM Tris-HCl (pH 81, 2mM EDTA, 1OmM NaCl, l%SDS (w/v), 8 mg/ml dithiot~eitol, 0.4 mg/ml proteinase K Lysis was carried out at 37 O for 1 hour. Then the DNA was extracted with 1OmM Tris- HCl saturated phenol, with chloroform!isoam lalcohol24:l (v/v) and ethanol recipitated in the presence of 0.3M Na Acetate. T Ke DNA was recovered and disso Pved in water. mtDNA fragments were amplified b 35 amplification cycles each consisting of denaturation at 94 O for 1 min, annea %‘ng at 49 o for 1 min and extension at 72 O for 2 min. After amplification 10% of the mixture were electrophoresed in 2% agarose gel and stained with ethidium bromide. The filter was transferred onto nitrocellulose paper and hybridized as described [15]. Total DNA and amplified mtDNA, were analyzed by agarose gel electrophoresis with ethidium bromide. A known amount of DNA was run on the same gel. After electrophoresis the el was photographed on transmitted UV light, using Polaroid Type 665 films. 5 he negatives of the fotographs were scanned in a laser densitometer Ultroscan XL, LKB, and the amount of DNA was measured in comparison with the known sample. RESULTS The aim of this work was to assess not only the presence of the mtDNA molecule in the sea urchin sperm, but also the competence of this molecule to replicate. We 1455
Vol.
182,
No.
3, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
decided therefore to search for the existence region of the molecule which
the i.e. particularly
the replication
origin,
which
RESEARCH
COMMUNICATIONS
of the most crucial part of the mtDNA, contains the control elements and has been called D-loop [161. In the egg
mtDNA this region is very well characterized, and the nucleotide three different sea urchin mtDNAs has been published. [17,18,19,1. We selected
the region 306 bp long flanked
by two tRNA
sequence
from
genes, the tyrosine
and
the glicine tRNAs [17] which were used as primers. We decided to design the primers for PCR by using these sequences, because the tRNA sequences are the most conserved regions of the mtDNA of tyrosine tR.NA and glicine tRNA hairpin
structures
regions
of the mtDNA
molecule [20]. Furthermore, do not give rise to strong
and they show virtually
no homology
(about 9,800 bp) ofA.ZixuZu.
(Table
A specific mtDNA fragment derived from egg mtDNA, the D-loop, region was used as a control. In fig 1 the ethidium
stained
with
the sequences inter-molecular
the other sequenced
1)
2280 bp long and spanning
agarose gel is shown.
It can be seen that a band
of the size corresponding at about 300 bp is present either when egg mtDNA or sperm mtDNA were used as templates. This demonstrates that in sperm mtDNA the amplified fragment
fragment
does exist
has the expected in both types
size and thus
of gametes.
clearly
Moreover,
we tried
mtDNA sample derived from very few spermatozoa, between the product of these experiments was analyzed by agarose did not yield fragments mtDNA indicate
were
any relevant transferred
amplification
product.
from the gel to the filter
indicates
to amplify
1 and 10 cells. When gel electrophoresis, it
However,
when
and hybridized
the mtDNA with
probe, the 306 bp band was present (Fig 2). These results that even when the PCR reaction was stopped before a visible
mt DNA was synthesized, In order to estimate
a fragment the amount
that this
the egg
detinitely amount of
was detected by hybridization. of mtDNA
used as template,
the egg mtDNA
segment was used as an internal control. This was added in known amounts series of reactions and amplified in parallel with sea urchin sperm total DNA
Table 1. Synthetic oligonucleotides employed as Primers in Polymerase Chain Reaction L
736
5’- TCGAAAGTCAATAGCACAGA
-3’
H 1040
5’- GGTTCGATCCCCGTCTCC’M’
3’
L and H refer to the light and heavy strands, respectively and the numbers refer to the 5 sition of the oligonucleotide in A. Exula sequenced mtDNA [l 7l? 1456
to a The
Vol.
182, No. 3, 1992
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
23 kD form was alsopresentin the cytosol and waslabelled with [3H]-mevalonate (Figure 3B). Triton X-114 phase separation of cytosol showed that, whereas the 24 kD band partitions almostexclusively in the aqueousphase,the 23 kD band partitions equally in both phases(Figure 3C) . We have alsodetected the presenceof a 24 kD band in the membrane fraction (Figure 3A) . This band was not labeled with [3H]-mevalonate (Figure 3B) but, interestingly, partitioned mostly in the detergentphase(Figure 3D). The minor forms of 24 and 23 kD bands(membrane-boundand cytosolic, respectively) were more abundantat late stageof infection, but could be detectedfrom the very beginning of the viral cycle (data not shown).
Discussion Rab6p expressedin the baculovirus/insectcells systemexists under two major forms: a 24 kD cytosolic form which partitions in the aqueousphaseof Triton X-114 and a 23 kD membrane-boundform which partitions in the detergent phase.The cytosolic 24 kD form which displays the same electrophoretic mobility as rab6p expressed in E. coli likely represents the unprocessed, hydrophilic precursor form of the protein. This form is undetectable in mammalian cells, except during short pulse experiments (Yang et al., unpublishedresults).Its presencein baculovirus-infectedinsectcells may reflect a saturation of membraneattachmentprocessdue to overexpressionof rab6p. The membrane-bound23 kD form is isoprenylated and preliminary data indicate it is also carboxyl-methylated. The lipid moiety present on rab6p is presumably a geranyl-geranyl group since it has been recently shownthat rab6p can be geranylgeranylatedin virt-o. (19) Rab6p terminateswith C-S-C and proteolytic cleavageof the carboxyl-end during processing (asoccursfor ras in which three amino acidsareremoved to leave a cysteine at the very end) is unlikely sincethesecysteinesare targets for geranyl-geranylation (18, 19). The migration of rab6p at 23 kD may then solely reflect isoprenylation.This is supportedby the fact that the minor cytoplasmic form of rab6p which migrates at 23 kD is isoprenylated as well. In mammaliancells, the cytoplasmic form of rab6p, which representsabout 30% of the total protein at the steady state, also migrates at 23 kD. The present data suggest that the cytoplasmic form of mammalian rab6p is in fact isoprenylated and we are currently addressingthis question. It may seemsurprising that an isoprenylated protein stays in the cytoplasm or doesnot partition totally in the detergentphaseof Triton X-l 14 (Figure 3 and unpublishedresultsconcerningmammaliancytosolic rab6p). A possibleinterpretation is that the part of the 23 kD cytoplasmic form of rab6p interactswith a protein which masksthe lipid moiety. This could be the role of a GDI-like protein which inhibits both the dissociationof GDP and membrane binding, as recently shown by Takai and co-workers for smg p25A (rab3A) (32). The fact that an isoprenylated cytoplasmic form of rab6p is also detected in insect cells could indicate the presenceof a GDI-like protein in thesecells. In any case,the 23 kD cytoplasmic form likely representsa pool in equilibrium with the membrane-boundform, both in insectand mammaliancells. 1503
Vol.
182, No. 3, 1992
BIOCHEMICAL
AND BIOPHYSICAL RESEARCH COMMUNICATIONS
DISCUSSION The experiments
reported here demonstrate the presence of the mtDNA control
region in sea urchin sperm, strongly suggesting that this mtDNA is competent in the replication. Deletions in mtDNA
molecules have been described recently in mitochondrial
diseases. In most cases mtDNA shows deletions of different length, from one single base up to a region of 5 kb. All the deletions, however, are in regions of the mitochondrial genome containing structural components of the respiratory chain [21]. It has been demonstrated that mutated DNA is still replication competent if a specific region the LSP promotor, having a key role in mtDNA replication by directing synthesis of an RNA primer, is present in the D-loop control region [221. In the case of sea urchin, such a detailed analisys has yet to be carried out, though the region that we detected and amplified corresponds to the control region of mammalian mtDNA and therefore we can assume that sperm mtDNA is not impaired per se in the replication.
It is still possible that, although the overall
length of this region is exactly that of the egg mtDNA, the base sequence of this region is different from the corresponding egg mtDNA sequence. However, since the size is identical
and the P32 hybridization
was carried out under stringent
conditions, the possibility that large base rearrengments
destroying the ability to
replicate, have occurred, remains unlike. It is interesting to note that by using this technique the number of molecules present in a given biological source can be easily quantitated.
The average number
of D-loop fragments we obtained in each sperm cell was between 4 and 28; it is very probable that these figures coincide with the copy number of the entire mtDNA molecules because, as a rule, each mtDNA contains only a single D-loop region, and only a few exceptions have been reported [23,24]. It is known for many years that the midpiece of the sea urchin sperm is composed by a single, large, ring-shaped mitochondrion. During spermatogenesis, mitochodria aggregate, reduce in number and increase in size to give rise to the single mitochondria in mature sperm [251. On the other hand, mammalian mature sperm contain approximately 75 mitochondria [141. During spermatogenesis the number of mt genomes decreases 8-10 fold resulting of one copy of mtDNA /mitochondrion 1131. Since the sea urchin sperm cells we used were all at the same developmental stage, the number we report is an average number of mature sperm cell. Whether such a number is developmentally regulated or not, we cannot say at the moment.
ACKNOWLEDGMENTS The authors thank Dr. Graxiano Pesole for his critical reading of the manuscript. This work was supported in part by a grant from Ministero della Universita e della Ricerca Scientifica. 1458
Vol.
182,
No.
3, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
REFERENCES
De Giorgi, C., and Saccone, C. (1988) Cell Bio ys. 14,67-78. Kocher, T.D.,Thomas, V.K., Meyer, A., Edwar x s, S.V., Paabo, S., Villablanca, F.X., and Wilson, A.C. (1989) Proc.Natl.Acad.Sci USA 86,6196-6200.
10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20.
21. 22. 23. 24. 25.
Dawid., LB., and Blacker, A.W. (1972) Dev. Biol. 29,152-161. Hutchison III, C.A., Newbold, J.E., Potter, S.S., and Edge& M.H. (1974). Nature 251,536~538. Francisco, J., and Simpson, M.V. (1977) FEBS Lett. 79,291-294. Kroon, A.M., deVos, W.M., and Bakker, H. (1978) B&him. Biophys. Acta 519269-273. Hayasm, J., Yanekawa, H., Gotoh, O., Watanabe, J., and Tagashira, Y. (1978). Biochem. Biophys. Res. Commun. 83: 1032-1038. Avise, J.C., Lansman, R.A., and Shade, R.O. (1979) Genetics 92,279-295. Giles, R.E., Blanc, H., Cann, H.M., and Wallace, D.C. (1980) Proc.Natl.Acad. Sci. USA 77,6715-6719. Kondo, R., Satta, Y., Matsuura, E.T., Ishiwa, H., Takahata, N., and CIngusa, S.I. (1990) Genetics 126,657-663. Hoeh, W.R., Blakley, KH., and Brown, W.M. (1991) Science 241,1488-1490. Gyllensten, U., Wharton, D., Josefsson, A., and Wilson, AC. (1991) Nature 352,255-257. Hecht, N., Liem, H., Kleene, KC., Distel, R.J., and Ho, S. (1984) Dev. Bio. 102,452-461. Michaels, G.S., Hauswirth, W.W., and Laipis, P.J. (1982) Dev. Bio. 94, 246-251. Maniatis, T., Fritsch, E.F.,and Sambrook, J. (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Jacobs, H.T., Herbert, E.R. and Rankine, J. (1989) Nut. Acids Res. 17, 8949-8965. De Giorgi, C., Lanave, C., Musci, M.D., and Saccone, C. (1991) Mol. Biol. and Evol. 8,55-529. Jacobs, H.T., Elliot, D., Veerabhadracharya, B.M., and Farquharson, A. (1988) J. Mol. Biol. 202,185-217. Cantatore, P., Roberti, M., RainaIdi, G., Gadaleta, M-N., and Saccone, C. (1989) J. Biol.Chem. 264,10965-10975. Saccone, C., Attimonelh, M., De Giorgi, C., Lanave, C., and Sbisa’, E. (1990) In Structure , function and biogenesis of energy transfer systems (Quagliariello, Papa, Pahnieri, Saccone eds), 93-96. Elsevier Science Publishers. Schon, E., Rizzuto, A., Moraes, C.T., Nakase, H., Zeviani, M., and Di Mauro, S. (1989) Science 244,346-349. Moraes, C.T., Andreetta, F., Bonilla, E., Shanske, S., Di Mauro, S., and Schon, E.A. (1991) Mol. Cell. Biol. 11,1631-1637. Moritz, C., and Brown, W.M. (1987) Science 223,1425-1427. Snyder, M., Fraser, A.R., Laroche, J., Gratner- Kepkay, KD., and Zouros, E. (1987) Proc. Natl. Acad. S&USA 84,7595-7599. Stearns, L.W. Sea urchin development: Cellular and molecular aspect. (1974). Dowden, Hutchinson & Ross, Inc. Stroudsburg Pennsylvania.
1459
