RESEARCH ARTICLE
Modulation of Human Macrophage Responses to Mycobacterium tuberculosis by Silver Nanoparticles of Different Size and Surface Modification Srijata Sarkar1, Bey Fen Leo2,3, Claudia Carranza4, Shu Chen2, Cesar Rivas-Santiago1, Alexandra E. Porter2, Mary P. Ryan2, Andrew Gow5, Kian Fan Chung6, Teresa D. Tetley6, Junfeng (Jim) Zhang7, Panos G. Georgopoulos8, Pamela A. Ohman-Strickland9, Stephan Schwander1,10*
OPEN ACCESS Citation: Sarkar S, Leo BF, Carranza C, Chen S, Rivas-Santiago C, Porter AE, et al. (2015) Modulation of Human Macrophage Responses to Mycobacterium tuberculosis by Silver Nanoparticles of Different Size and Surface Modification. PLoS ONE 10(11): e0143077. doi:10.1371/journal.pone.0143077 Editor: David M. Ojcius, University of the Pacific, UNITED STATES Received: July 1, 2015 Accepted: October 31, 2015 Published: November 18, 2015 Copyright: © 2015 Sarkar et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: This work was supported by the National Institute of Environmental Health Sciences http:// www.niehs.nih.gov/: 5U19 ES019536, 5R01 ES02038202, P30ES005022; European Research Council http://erc.europa.eu/: 257182; and Else Widdowson fellowship. Competing Interests: The authors have declared that no competing interests exist.
1 Department of Environmental and Occupational Health School of Public Health, Rutgers University, Piscataway, New Jersey, United States of America, 2 Department of Materials and London Center for Nanotechnology, Imperial College, London, United Kingdom, 3 Department of Mechanical Engineering, University of Malaya, Kuala Lumpur, Malaysia, 4 Department of Microbiology, Instituto Nacional de Enfermedades Respiratorias, Mexico City, Mexico, 5 Department of Toxicology, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, New Jersey, United States of America, 6 National Heart and Lung Institute, Imperial College, London, United Kingdom, 7 Nicholas School of the Environment and Duke Global Health Institute, Duke University, Durham, North Carolina, United States of America, 8 Computational Chemodynamics Laboratory, Environmental and Occupational Health Sciences Institute, Robert Wood Johnson Medical School, Rutgers University, Piscataway, New Jersey, United States of America, 9 Department of Biostatistics, Rutgers University School of Public Health, Piscataway, New Jersey, United States of America, 10 Center for Global Public Health, School of Public Health, Rutgers University, Piscataway, New Jersey, United States of America * [email protected]
Abstract Exposure to silver nanoparticles (AgNP) used in consumer products carries potential health risks including increased susceptibility to infectious pathogens. Systematic assessments of antimicrobial macrophage immune responses in the context of AgNP exposure are important because uptake of AgNP by macrophages may lead to alterations of innate immune cell functions. In this study we examined the effects of exposure to AgNP with different particle sizes (20 and 110 nm diameters) and surface chemistry (citrate or polyvinlypyrrolidone capping) on cellular toxicity and innate immune responses against Mycobacterium tuberculosis (M.tb) by human monocyte-derived macrophages (MDM). Exposures of MDM to AgNP significantly reduced cellular viability, increased IL8 and decreased IL10 mRNA expression. Exposure of M.tb-infected MDM to AgNP suppressed M.tb-induced expression of IL1B, IL10, and TNFA mRNA. Furthermore, M.tb-induced IL-1β, a cytokine critical for host resistance to M.tb, was inhibited by AgNP but not by carbon black particles indicating that the observed immunosuppressive effects of AgNP are particle specific. Suppressive effects of AgNP on the M.tb-induced host immune responses were in part due to AgNPmediated interferences with the TLR signaling pathways that culminate in the activation of the transcription factor NF-κB. AgNP exposure suppressed M.tb-induced expression of a subset of NF-κB mediated genes (CSF2, CSF3, IFNG, IL1A, IL1B, IL6, IL10, TNFA,
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
1 / 28
AgNP Exposure and Innate Immunity
NFKB1A). In addition, AgNP exposure increased the expression of HSPA1A mRNA and the corresponding stress-induced Hsp72 protein. Up-regulation of Hsp72 by AgNP can suppress M.tb-induced NF-κB activation and host immune responses. The observed ability of AgNP to modulate infectious pathogen-induced immune responses has important public health implications.
Introduction Increased use of nanoparticles (NP) as additives in consumer products may cause frequent human exposures to NP. NP are single particles with diameters between 1 and 100 nm and have unique characteristics that differ from the same material in bulk form [1]. Due to the large specific surface areas, NP are potentially more reactive upon interaction with biological systems than larger particles [2–4]. NP that are taken up by innate immune cells (such as macrophages) can activate or suppress immune system functions [5] with potential consequences for the development of cancer, inflammatory or autoimmune diseases and alterations of host immune responses to pathogens [6]. Although the innate immune system is critical in sensing exposure to NP and functions as a first line of defense against infectious pathogens, only a few studies have assessed the interactions of NP with the human immune system [7–9]. Because of their antibacterial properties [10], silver (Ag) NP (AgNP) are among the most widely used NP in consumer products such as textiles, disinfectant sprays, antibacterial ointments, bandages and medical devices such as orthopedic implants. AgNP are also considered as vehicles for drug delivery and tissue-targeting e.g. through intravenous application [11,12]. Human exposure to AgNP may occur by inhalation via the respiratory tract, by adsorption through the skin, by ingestion through the digestive tract, by implantation, insertion of medical devices or occupationally in the nano-Ag manufacturing industry [13]. Differential effects of AgNP size and surface capping have recently been reported on cellular viability and inflammation and injury in murine lungs [14]. Physicochemical properties of AgNP such as surface charge are largely determined by the capping agents used to prevent NP aggregation. AgNP that are stabilized with weak capping agents such as citrate, which is weakly bound to the Ag core and stabilizes by charge repulsion, tend to aggregate more than those stabilized with strong capping agents such as PVP, which is strongly bound to the Ag core and sterically stabilizes AgNP [15–17]. A recent study indicated that AgNP exposures alter the population of intestinal microbiota and gut-associated immune responses in rats [18]. Anti-inflammatory effects of AgNP capped with polyvinlypyrrolidone (PVP) have also been reported in Chlamydia trachomatis infected mouse J774 macrophages [19]. However, the effects of AgNP on antibacterial human host immune cell responses have not been systematically examined. In the current study, we examined the effects of AgNP with different sizes (diameters 20 or 110 nm) and surface modifications (citrate or PVP-coated) on innate immune responses of human monocyte-derived macrophages (MDM) to infection with Mycobacterium tuberculosis (M.tb). M.tb causes tuberculosis (TB), a disease of major global health impact, and asymptomatically infects a third of the world population [20]. During natural infection, following inhalation, M.tb is taken up by phagocytic cells including alveolar macrophages in the respiratory tract with potential outcomes such as abrogation of the infection, latency of infection, progression to active disease or development of reactivation disease years after the primary infection [21]. Epidemiological studies have shown that exposures to cigarette smoke and indoor
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
2 / 28
AgNP Exposure and Innate Immunity
pollution [22–25] increase rates of TB development in endemic settings. In vitro studies have shown that cigarette smoke [26] and indoor air pollution particles [27] affect alveolar macrophages and MDM functions in response to M.tb. We have shown that exposure of immune cells to diesel exhaust particles (DEP) and air pollution particulate matter adversely affects human antimycobacterial immune mechanisms [28,29]. With this background, we hypothesized that exposure to AgNP may alter human host immune responses to M.tb. To test this hypothesis we examined the effects of four types of AgNP (Ag20-citrate, Ag110-citrate, Ag20-PVP and Ag110-PVP) on innate M.tb-specific responses of human MDM, which are widely used to study host immune responses to M.tb [30,31]. We demonstrate that AgNP suppress innate responses of MDM in response to M.tb infection including the production of IL1β. We propose that the upregulation of Hsp72 expression in MDM exposed to AgNP is important for AgNP-induced inhibition of M.tb-induced host immune responses.
Materials and Methods Ethics statement Study protocol, consent procedures, and recruitment process were approved by the Institutional Review Board of the legacy University of Medicine and Dentistry of New Jersey now Rutgers University under protocol number 0220100112. Written informed consent was obtained from all study subjects on annually IRB-approved, dated and signed consent forms that explained in detail the purpose of the study, the procedures, and the entirely voluntary character of the participation prior to performing any procedures.
Generation of MDM Peripheral whole heparinized blood was collected by venipuncture from healthy men and women at Rutgers University (study protocol approved by the Institutional Review Board of the legacy University of Medicine and Dentistry of New Jersey now Rutgers University under protocol number 0220100112). Peripheral blood mononuclear cells (PBMC) were prepared from whole heparinized venous blood by Ficoll gradient centrifugation [32] as described previously [28]. PBMC (5 x 106) were plated in 6-well plates (BD Falcon, Franklin Lakes, NJ) in 3 mL of complete culture medium per well and incubated at 37°C in a humidified 5% CO2 environment for two hours. Following incubation, nonadherent cells were removed by washing twice with RPMI1640 supplemented with Penicillin/Streptomycin/Glutamine (P/S/G). Plastic adherent cells (monocytes) were cultured at 37°C in humidified 5% CO2 environment for 7 days, which allows for differentiation into macrophages (MDM). Expression of macrophagespecific surface markers CD11b, CD11c, CD14, CD16, CD163 and HLA-DR on MDM were assessed by flow cytometry with a Gallios Flow Cytometer (Beckman Coulter, Miami, FL) and data analyzed with Kaluza Analysis Software (Beckman Coulter). MDM revealed a typical, earlier described [33–35], phenotype (S1 Table, S1 Fig).
AgNP characterization The NCNHIR (NIEHS Centers for Nanotechnology Health Implications Research) consortium provided the AgNP that had been manufactured by nanoComposix, Inc (San Diego, CA) for this study. All four AgNP had a 5–7 nm gold core that served as the nucleation centers during the manufacture of the AgNP via base-catalyzed reduction of silver nitrate. Physicochemical properties of the AgNP were characterized at the Nanotechnology Characterization Laboratory (NCL, National Cancer Institute at Frederick, SAIC-Frederick, Inc. Frederick, MD 21702, http://ncl.cancer.gov) under NIEHS-NCL Agreement NCL-NIEHS201111A. Additional
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
3 / 28
AgNP Exposure and Innate Immunity
analyses of the morphology and primary size distribution of the AgNP were performed at Imperial College London, using a JEOL 2000 transmission electron microscope (TEM), operated at an accelerating voltage of 200 kV. AgNP suspensions were sonicated for 10 seconds, a single drop of the suspension was deposited onto a 300 Cu Mesh grid with holey carbon support film, and left to dry under vacuum for TEM imaging and analysis. To assess the effects of pH on the stability of the AgNP, the AgNP were incubated in pH 7, sodium perchlorate (NaClO4)/perchloric acid (HClO4; Sigma-Aldrich) solution at pH 7, 37°C for 24 h, in the dark [36]. This solution was used to minimize the impact of anions on the stability of the AgNP. To correspond approximately to the pH of extracellular media pH 7 was chosen. Before TEM imaging and analysis, the AgNP in solution, were washed three times in DI-H2O using a centrifugation and re-dispersion process, to remove excess salts. A full description and discussion of these methods and comparison of TEM results to in situ small angle x-ray scattering analysis, including discussion of possible drying artefacts, are provided elsewhere [36].
Stability of AgNP: dissolution kinetics Inductively coupled plasma-optical emission spectroscopy (ICP-OES) was employed to analyze aliquots of Ag solutions at various time points from 1 hour up to 3 days (72 hours). The amount of dissolved Ag was determined at pH 5 and 7, matching approximately the pH found in the lysosomes and extracellular media, respectively. Non-interacting buffers were used to minimize the impact of anions on the stability of the AgNP. Each of the AgNP suspensions were incubated in a temperature controller at 37°C followed by centrifugation with 2kDa (< 4 nm) filter tubes (Sartorius Stedim VIVACON 500) at 13,000 rpm to separate any AgNP from the solution. The concentration of released Ag+ ions was assessed after the AgNP had been removed at 1, 6, 24 and 72 hours (n = 3). In addition, deionized water (no AgNP) as well as supernatant, after the removal of the AgNP, were analyzed in control experiments ensuring that residual AgNP were removed during centrifugation and filtering.
Preparation of AgNP and M.tb for in vitro exposure and infection For in vitro MDM exposure experiments, AgNP samples were diluted in complete cell culture medium without antibiotics (RPMI1640 supplemented with 10% pooled human AB serum) followed by sonication in a Branson 3510 water bath sonicator for 2 minutes prior to addition to the cell cultures. To assess the potential contribution of the stabilizers PVP10 (used to stabilize Ag20) and PVP40 (used to stabilize Ag110) to AgNP-induced cell toxicity or alterations of immune responses, mass equivalents of PVP10 and PVP40 within the 5, 10, 20 and 50 μg/mL exposure concentrations of Ag20-PVP and Ag110-PVP samples were calculated. Calculations of the PVP10 and PVP40 equivalents based on data supplied by NCL according to which PVP10 and PVP40 concentrations were 33.3 and 62.4 μg per 1 mg of Ag in Ag20-PVP and Ag110-PVP, respectively. MDM were infected with avirulent M.tb strain (H37Ra, ATCC catalog number 25177) at a multiplicity of infection (MOI) of ten bacilli (MOI 10) per cell.
MTS assay Cell viability was assessed by Cell Titer 96 Aqueous One Solution Cell Proliferation Assay [MTS, (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium), Promega,Madison WI] as per the manufacturer’s protocol. Briefly, MDM (44,000/ well) were incubated at 37°C in a humidified CO2 environment for 3, 6 and 24 hours in presence of 0 (cells alone, negative control), 5, 10, 20 and 50 μg/mL of AgNP (Ag20-citrate, Ag20-PVP, Ag110-citrate, Ag110-PVP) and PVP10 and PVP40 equivalents corresponding to
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
4 / 28
AgNP Exposure and Innate Immunity
the 5, 10, 20 and 50 μg/mL concentrations of Ag20-PVP and Ag110-PVP. Absorbance was recorded at 493 nm with an ELISA reader (ThermoScientific Multiskan FC, Finland). Percentages of viable cells were calculated as ratios of ODs of NP-exposed MDM (after background subtraction) to the ODs of unexposed MDM (after background subtraction) x 100.
Lactate dehydrogenase (LDH) assay Cell culture supernatants (50 μL) were collected following MDM exposures to AgNP and PVP10 and PVP40 controls and transferred into 96-well assay plates. Fifty μL of substrate (CytoTox 96 Non-radioactive cytotoxicity Assay, Promega, Madison, WI) was then added per well. Following incubation at room temperature for 30 minutes in the dark, stop solution (50 μL) was added to each well and absorbance recorded at 493 nm as described above. Cellular toxicity was defined as percent (%) LDH leakage from cells calculated from the ratios of ODs of NP-exposed MDM (after background subtraction) to the ODs of unexposed MDM (after background subtraction) x 100.
Quantitative RT-PCR to determine cytokine mRNA abundance The following primer sets were used for qRT-PCR, TNFA forward: GTGCTTGTTCCTCAGC CTCTT, TNFA reverse: ATGGGCTACAGGCTTGTCATC; IL1B forward: GAAGCTGAT GGCCCTAAACAG, IL1B reverse: AGCATCTTCCTCAGCTTGTCC; IL8 forward: ACTGA GAGT GAT TGA GAG TGG AC, IL8 reverse: AAC CCTCTGCACCCAGTTTTC; IL10 forward: ACCTGCCTAAGATGCTTCCAG, IL10 reverse: CTGGGTCTTGGTTCTCAGCTT; HSPA1 forward: AAGTACAAAGCGGAGGACGAG, HSPA1 reverse: CCACGAGATG ACCTCTTGACA. For each of the mRNAs, fold-changes relative to unexposed MDM were calculated as described previously [28].
Pathway-specific qRT-PCR arrays Human Toll-like Receptor (TLR) signaling pathway-specific RT2-Profiler arrays (Cat. No. PAHS 018E, Qiagen Sciences, MD) were used to screen for mRNA expression in AgNP and M. tb-exposed and unexposed MDM [28]. Levels of cDNA were calculated by the relative quantitation method (ΔΔCt method) from the PCR array data using analysis software accessed from http://sabiosciences.com/pcrarraydataanalysis.php. Statistical differences in fold-mRNA expression levels between exposed and unexposed cells were calculated using the same software.
ELISA for IL-1β detection Following plastic adherence for 7 days (as described above), MDM were treated with 5 mM EDTA/PBS for 5 minutes and then gently scraped from six-well plates and subsequently plated into 96-well plates. On the next day, cells were exposed to 0, 1 and 10 μg/mL of NP with simultaneous infection with M.tb at MOI 10. Culture supernatants from M.tb-infected and uninfected MDMs were collected at 6 and 8 hours, centrifuged for 5 minutes at 5,000 rpm to remove particles and bacteria, and assessed for IL-1ß protein content by ELISA following the manufacturer’s protocol (R&D Systems, Minneapolis, MN). Absorbance was recorded at 450 and 570 nm with an ELISA reader (ThermoScientific Multiskan FC, Finland).
Flow cytometry for Hsp72 detection MDM were washed with flow cytometry staining buffer and fixed in IC (intracellular) fixation buffer (eBiosciences, Inc. San Diago, CA). Fixed cells were permeabilized with 1x permeabilization
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
5 / 28
AgNP Exposure and Innate Immunity
buffer (eBiosciences) followed by staining with FITC conjugated anti-Hsp72 (cat. No. ADI-SPA810FI-D, Enzo Life sciences, Farmingdale, NY) or mouse IgG1 isotype control (cat. No. ADISAB-600FI-050, Enzo Life sciences) for 20 minutes at room temperature in the dark. After washing, the expression of Hsp72 in MDM was evaluated by flow cytometry with a Gallios Flow Cytometer (Beckman Coulter, Miami, FL) and analyzed with Kaluza Analysis Software (Beckman Coulter).
Colony forming unit (CFU) assay To evaluate direct, AgNP-mediated antibacterial effects, M.tb was grown in cell culture media in the presence or absence (control) of Ag20-citrate, Ag20-PVP, Ag110-ctrate, and Ag110-PVP. Ten μL of M.tb stock (CFU 1 x 107/mL) were diluted to 1 mL with cell culture media (RPMI1640 + 10% PHS) and incubated at 37°C with rotation on a revolver (Labnet International, Inc., Edison, NJ) in the presence of 0, 10 and 25 μg/mL of AgNP and 15.7 and 39.25 μg/mL of AgNO3 for 24 hours. AgNO3 concentrations corresponded to the total amounts of Ag+ ions present in 10 and 25 μg/mL of AgNP, respectively. Ten μL of the culture media samples were removed at 24 hours and serially 10-fold diluted in cell culture media without antibiotics (RPMI1640 + 10% PHS) and plated in triplicate onto 7H10 agar plates and incubated for 21 days at 37°C [37]. M.tb colonies (CFU) were counted using a stereo microscope at 40x magnification (Diagger Lab equipments, Vernon Hills, IL), and plotted as a function of the AgNP concentration. M.tb grown in NP-free culture media served as a control.
M.tb uptake/internalization Enriched CD14+CD3- PBMC were generated by negative selection through immunodepletion of non-monocytes as described previously [28]. For generation of MDM, enriched monocytes were plated onto 8-chamber (5x 105/chamber) culture slides (BD-Falcon, Cat. No. 354118) and allowed to differentiate for 7 days. Culture media were changed every 2–3 days during the 7-day incubation period. MDM were infected with M.tb at MOI 10 in presence of Ag20-citrate (10 μg/mL) or Ag110-citrate (10 μg/mL) for 2 and 4 hours. Following incubation, extracellular bacteria were removed by extensive washing with RPMI 1640 and slides were stained with Kinyoun Staining fluid as described previously [28]. Proportions of MDM harboring phagocytosed bacilli (stained in red) were assessed by oil immersion bright field microscopy (100X, Zeiss Primo Star) in a total of 300 MDM for each experimental condition. To determine the number of M.tb that had been internalized within individual MDM, MDM (2 x 105 monocyte/well) were grown in 96-well culture dishes, infected with M.tb as described above and washed after 4 hours to remove extracellular bacteria. MDM were then lysed by addition of 0.1% sodium dodecyl sulfate (SDS) in 7H9 Milddlebrook medium for 10 min at room temperature after which SDS was neutralized with 20% Bovine Serum Albumin (BSA). Lysed cells were serially diluted with 7H9 medium and plated out in triplicate onto agar plates (Middlebrook 7H10 agar) and incubated for 21 days at 37°C. CFU numbers were then determined as described above.
Statistical analysis Mixed linear models that include a random effect for experiments, no fixed intercept and an estimated common variance across doses were used to estimate the effect of dose within each condition on the logarithm of the fold-change. Previous examination of summary statistics demonstrated a relatively constant variance of the log-transformed fold-changes. Thus, with the small sample sizes (n = 4) for each dose, this approach would potentially give the most stable variance estimates. Wald tests examined whether the log-fold changes were significantly
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
6 / 28
AgNP Exposure and Innate Immunity
different than zero or, equivalently, whether the fold-changes were significantly different from one. Fold-changes of cytokine expression under exposure at doses of 1, 10 or 25 μg/mL relative to expression at no exposure were calculated within each stimulus-by-M.tb exposure combination. To examine AgNP dose effects on percent viability and LDH leakage, mixed linear models similar to those described above were used. Analyses were stratified by stimulus as well as hour. The two-tailed, unpaired Student’s t-test was used to examine (i) the effects of AgNP, carbon black and Ag+ ions on IL-1β expression, (ii) the effect of AgNP on M.tb phagocytosis/ internalization, and (iii) IL1B and HSPA1 expression.
Results Characterization of AgNP Physicochemical properties of AgNP are crucial determinants of their bioreactivities. Information on size (determined by dynamic light scattering after diluting AgNP 10-fold in 2 mM NaCl to measure the hydrodynamic diameter), charge (determined by Zeta potential measurement at pH 7), and endotoxin concentration (analyzed by limulus amebocyte lysate assay) of the AgNP (supplied by NCNHIR consortium) was provided by the NCL and is listed in Table 1. Endotoxin levels in AgNP were low reducing the likelihood that any observed AgNP induced immune modulations were endotoxin-induced. The primary size distribution of the citrate and PVP-stabilized Ag20 and Ag110 in water (Fig 1A–1D) and pH7 solution (Fig 1E– 1H) was compared by TEM performed at Imperial College, London. The size distributions of the different AgNP preparations studied here indicate that the diameters of the majority of Ag20 and Ag110 are >16 nm (Fig 1I and 1J) and >80 nm (Fig 1K and 1L), respectively. Assessments confirmed that physicochemical properties of the as–received AgNP (dispersed in DI water) were consistent with the specifications provided by NCL. Additional characteristics of AgNP with gold core are discussed elsewhere by Botelho et al.[38]. Our previous work [36] showed that dissolved Ag+ ions reprecipitate as insoluble Ag salts (e.g. Ag2O, AgCl and Ag2S) in the cell culture medium (RPMI and 10% pooled human serum) used in this study. For this reason, we decided not to measure the amount of ionic Ag+ in the cell culture medium as it was expected that the amount of free Ag+ ions in this medium would be below the detection limit of ICP, and not representative of the actual Ag+ ion-release. Therefore, ICP was employed to measure the dissolution rates of the AgNP in inorganic buffers at both pH 5 & 7. All AgNP showed a higher rate of dissolution at pH 5 than at pH 7 (Fig 2). Except for Ag20-citrate, all other AgNP released less than 2% Ag+ ions into the solution over a three-day incubation period (72 h). Furthermore, Ag+ ion levels were undetectable in either Ag110 citrate or Ag110 PVP in pH 7 buffer solutions, indicating that AgNP dissolution was negligible. Other studies have reported a 5 to 15% dissolution from citrate-stabilized particles Table 1. Physicochemical properties of AgNP. Samples
Diameter (nm)of >94% of particles
Zeta potential (mV)
Endotoxin conc.(EU/ml)
20 nm, Citrate-stabilized Ag
20.9 ± 2.1
-44.3 ± 1.3
Modulation of Human Macrophage Responses to Mycobacterium tuberculosis by Silver Nanoparticles of Different Size and Surface Modification Srijata Sarkar1, Bey Fen Leo2,3, Claudia Carranza4, Shu Chen2, Cesar Rivas-Santiago1, Alexandra E. Porter2, Mary P. Ryan2, Andrew Gow5, Kian Fan Chung6, Teresa D. Tetley6, Junfeng (Jim) Zhang7, Panos G. Georgopoulos8, Pamela A. Ohman-Strickland9, Stephan Schwander1,10*
OPEN ACCESS Citation: Sarkar S, Leo BF, Carranza C, Chen S, Rivas-Santiago C, Porter AE, et al. (2015) Modulation of Human Macrophage Responses to Mycobacterium tuberculosis by Silver Nanoparticles of Different Size and Surface Modification. PLoS ONE 10(11): e0143077. doi:10.1371/journal.pone.0143077 Editor: David M. Ojcius, University of the Pacific, UNITED STATES Received: July 1, 2015 Accepted: October 31, 2015 Published: November 18, 2015 Copyright: © 2015 Sarkar et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: This work was supported by the National Institute of Environmental Health Sciences http:// www.niehs.nih.gov/: 5U19 ES019536, 5R01 ES02038202, P30ES005022; European Research Council http://erc.europa.eu/: 257182; and Else Widdowson fellowship. Competing Interests: The authors have declared that no competing interests exist.
1 Department of Environmental and Occupational Health School of Public Health, Rutgers University, Piscataway, New Jersey, United States of America, 2 Department of Materials and London Center for Nanotechnology, Imperial College, London, United Kingdom, 3 Department of Mechanical Engineering, University of Malaya, Kuala Lumpur, Malaysia, 4 Department of Microbiology, Instituto Nacional de Enfermedades Respiratorias, Mexico City, Mexico, 5 Department of Toxicology, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, New Jersey, United States of America, 6 National Heart and Lung Institute, Imperial College, London, United Kingdom, 7 Nicholas School of the Environment and Duke Global Health Institute, Duke University, Durham, North Carolina, United States of America, 8 Computational Chemodynamics Laboratory, Environmental and Occupational Health Sciences Institute, Robert Wood Johnson Medical School, Rutgers University, Piscataway, New Jersey, United States of America, 9 Department of Biostatistics, Rutgers University School of Public Health, Piscataway, New Jersey, United States of America, 10 Center for Global Public Health, School of Public Health, Rutgers University, Piscataway, New Jersey, United States of America * [email protected]
Abstract Exposure to silver nanoparticles (AgNP) used in consumer products carries potential health risks including increased susceptibility to infectious pathogens. Systematic assessments of antimicrobial macrophage immune responses in the context of AgNP exposure are important because uptake of AgNP by macrophages may lead to alterations of innate immune cell functions. In this study we examined the effects of exposure to AgNP with different particle sizes (20 and 110 nm diameters) and surface chemistry (citrate or polyvinlypyrrolidone capping) on cellular toxicity and innate immune responses against Mycobacterium tuberculosis (M.tb) by human monocyte-derived macrophages (MDM). Exposures of MDM to AgNP significantly reduced cellular viability, increased IL8 and decreased IL10 mRNA expression. Exposure of M.tb-infected MDM to AgNP suppressed M.tb-induced expression of IL1B, IL10, and TNFA mRNA. Furthermore, M.tb-induced IL-1β, a cytokine critical for host resistance to M.tb, was inhibited by AgNP but not by carbon black particles indicating that the observed immunosuppressive effects of AgNP are particle specific. Suppressive effects of AgNP on the M.tb-induced host immune responses were in part due to AgNPmediated interferences with the TLR signaling pathways that culminate in the activation of the transcription factor NF-κB. AgNP exposure suppressed M.tb-induced expression of a subset of NF-κB mediated genes (CSF2, CSF3, IFNG, IL1A, IL1B, IL6, IL10, TNFA,
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
1 / 28
AgNP Exposure and Innate Immunity
NFKB1A). In addition, AgNP exposure increased the expression of HSPA1A mRNA and the corresponding stress-induced Hsp72 protein. Up-regulation of Hsp72 by AgNP can suppress M.tb-induced NF-κB activation and host immune responses. The observed ability of AgNP to modulate infectious pathogen-induced immune responses has important public health implications.
Introduction Increased use of nanoparticles (NP) as additives in consumer products may cause frequent human exposures to NP. NP are single particles with diameters between 1 and 100 nm and have unique characteristics that differ from the same material in bulk form [1]. Due to the large specific surface areas, NP are potentially more reactive upon interaction with biological systems than larger particles [2–4]. NP that are taken up by innate immune cells (such as macrophages) can activate or suppress immune system functions [5] with potential consequences for the development of cancer, inflammatory or autoimmune diseases and alterations of host immune responses to pathogens [6]. Although the innate immune system is critical in sensing exposure to NP and functions as a first line of defense against infectious pathogens, only a few studies have assessed the interactions of NP with the human immune system [7–9]. Because of their antibacterial properties [10], silver (Ag) NP (AgNP) are among the most widely used NP in consumer products such as textiles, disinfectant sprays, antibacterial ointments, bandages and medical devices such as orthopedic implants. AgNP are also considered as vehicles for drug delivery and tissue-targeting e.g. through intravenous application [11,12]. Human exposure to AgNP may occur by inhalation via the respiratory tract, by adsorption through the skin, by ingestion through the digestive tract, by implantation, insertion of medical devices or occupationally in the nano-Ag manufacturing industry [13]. Differential effects of AgNP size and surface capping have recently been reported on cellular viability and inflammation and injury in murine lungs [14]. Physicochemical properties of AgNP such as surface charge are largely determined by the capping agents used to prevent NP aggregation. AgNP that are stabilized with weak capping agents such as citrate, which is weakly bound to the Ag core and stabilizes by charge repulsion, tend to aggregate more than those stabilized with strong capping agents such as PVP, which is strongly bound to the Ag core and sterically stabilizes AgNP [15–17]. A recent study indicated that AgNP exposures alter the population of intestinal microbiota and gut-associated immune responses in rats [18]. Anti-inflammatory effects of AgNP capped with polyvinlypyrrolidone (PVP) have also been reported in Chlamydia trachomatis infected mouse J774 macrophages [19]. However, the effects of AgNP on antibacterial human host immune cell responses have not been systematically examined. In the current study, we examined the effects of AgNP with different sizes (diameters 20 or 110 nm) and surface modifications (citrate or PVP-coated) on innate immune responses of human monocyte-derived macrophages (MDM) to infection with Mycobacterium tuberculosis (M.tb). M.tb causes tuberculosis (TB), a disease of major global health impact, and asymptomatically infects a third of the world population [20]. During natural infection, following inhalation, M.tb is taken up by phagocytic cells including alveolar macrophages in the respiratory tract with potential outcomes such as abrogation of the infection, latency of infection, progression to active disease or development of reactivation disease years after the primary infection [21]. Epidemiological studies have shown that exposures to cigarette smoke and indoor
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
2 / 28
AgNP Exposure and Innate Immunity
pollution [22–25] increase rates of TB development in endemic settings. In vitro studies have shown that cigarette smoke [26] and indoor air pollution particles [27] affect alveolar macrophages and MDM functions in response to M.tb. We have shown that exposure of immune cells to diesel exhaust particles (DEP) and air pollution particulate matter adversely affects human antimycobacterial immune mechanisms [28,29]. With this background, we hypothesized that exposure to AgNP may alter human host immune responses to M.tb. To test this hypothesis we examined the effects of four types of AgNP (Ag20-citrate, Ag110-citrate, Ag20-PVP and Ag110-PVP) on innate M.tb-specific responses of human MDM, which are widely used to study host immune responses to M.tb [30,31]. We demonstrate that AgNP suppress innate responses of MDM in response to M.tb infection including the production of IL1β. We propose that the upregulation of Hsp72 expression in MDM exposed to AgNP is important for AgNP-induced inhibition of M.tb-induced host immune responses.
Materials and Methods Ethics statement Study protocol, consent procedures, and recruitment process were approved by the Institutional Review Board of the legacy University of Medicine and Dentistry of New Jersey now Rutgers University under protocol number 0220100112. Written informed consent was obtained from all study subjects on annually IRB-approved, dated and signed consent forms that explained in detail the purpose of the study, the procedures, and the entirely voluntary character of the participation prior to performing any procedures.
Generation of MDM Peripheral whole heparinized blood was collected by venipuncture from healthy men and women at Rutgers University (study protocol approved by the Institutional Review Board of the legacy University of Medicine and Dentistry of New Jersey now Rutgers University under protocol number 0220100112). Peripheral blood mononuclear cells (PBMC) were prepared from whole heparinized venous blood by Ficoll gradient centrifugation [32] as described previously [28]. PBMC (5 x 106) were plated in 6-well plates (BD Falcon, Franklin Lakes, NJ) in 3 mL of complete culture medium per well and incubated at 37°C in a humidified 5% CO2 environment for two hours. Following incubation, nonadherent cells were removed by washing twice with RPMI1640 supplemented with Penicillin/Streptomycin/Glutamine (P/S/G). Plastic adherent cells (monocytes) were cultured at 37°C in humidified 5% CO2 environment for 7 days, which allows for differentiation into macrophages (MDM). Expression of macrophagespecific surface markers CD11b, CD11c, CD14, CD16, CD163 and HLA-DR on MDM were assessed by flow cytometry with a Gallios Flow Cytometer (Beckman Coulter, Miami, FL) and data analyzed with Kaluza Analysis Software (Beckman Coulter). MDM revealed a typical, earlier described [33–35], phenotype (S1 Table, S1 Fig).
AgNP characterization The NCNHIR (NIEHS Centers for Nanotechnology Health Implications Research) consortium provided the AgNP that had been manufactured by nanoComposix, Inc (San Diego, CA) for this study. All four AgNP had a 5–7 nm gold core that served as the nucleation centers during the manufacture of the AgNP via base-catalyzed reduction of silver nitrate. Physicochemical properties of the AgNP were characterized at the Nanotechnology Characterization Laboratory (NCL, National Cancer Institute at Frederick, SAIC-Frederick, Inc. Frederick, MD 21702, http://ncl.cancer.gov) under NIEHS-NCL Agreement NCL-NIEHS201111A. Additional
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
3 / 28
AgNP Exposure and Innate Immunity
analyses of the morphology and primary size distribution of the AgNP were performed at Imperial College London, using a JEOL 2000 transmission electron microscope (TEM), operated at an accelerating voltage of 200 kV. AgNP suspensions were sonicated for 10 seconds, a single drop of the suspension was deposited onto a 300 Cu Mesh grid with holey carbon support film, and left to dry under vacuum for TEM imaging and analysis. To assess the effects of pH on the stability of the AgNP, the AgNP were incubated in pH 7, sodium perchlorate (NaClO4)/perchloric acid (HClO4; Sigma-Aldrich) solution at pH 7, 37°C for 24 h, in the dark [36]. This solution was used to minimize the impact of anions on the stability of the AgNP. To correspond approximately to the pH of extracellular media pH 7 was chosen. Before TEM imaging and analysis, the AgNP in solution, were washed three times in DI-H2O using a centrifugation and re-dispersion process, to remove excess salts. A full description and discussion of these methods and comparison of TEM results to in situ small angle x-ray scattering analysis, including discussion of possible drying artefacts, are provided elsewhere [36].
Stability of AgNP: dissolution kinetics Inductively coupled plasma-optical emission spectroscopy (ICP-OES) was employed to analyze aliquots of Ag solutions at various time points from 1 hour up to 3 days (72 hours). The amount of dissolved Ag was determined at pH 5 and 7, matching approximately the pH found in the lysosomes and extracellular media, respectively. Non-interacting buffers were used to minimize the impact of anions on the stability of the AgNP. Each of the AgNP suspensions were incubated in a temperature controller at 37°C followed by centrifugation with 2kDa (< 4 nm) filter tubes (Sartorius Stedim VIVACON 500) at 13,000 rpm to separate any AgNP from the solution. The concentration of released Ag+ ions was assessed after the AgNP had been removed at 1, 6, 24 and 72 hours (n = 3). In addition, deionized water (no AgNP) as well as supernatant, after the removal of the AgNP, were analyzed in control experiments ensuring that residual AgNP were removed during centrifugation and filtering.
Preparation of AgNP and M.tb for in vitro exposure and infection For in vitro MDM exposure experiments, AgNP samples were diluted in complete cell culture medium without antibiotics (RPMI1640 supplemented with 10% pooled human AB serum) followed by sonication in a Branson 3510 water bath sonicator for 2 minutes prior to addition to the cell cultures. To assess the potential contribution of the stabilizers PVP10 (used to stabilize Ag20) and PVP40 (used to stabilize Ag110) to AgNP-induced cell toxicity or alterations of immune responses, mass equivalents of PVP10 and PVP40 within the 5, 10, 20 and 50 μg/mL exposure concentrations of Ag20-PVP and Ag110-PVP samples were calculated. Calculations of the PVP10 and PVP40 equivalents based on data supplied by NCL according to which PVP10 and PVP40 concentrations were 33.3 and 62.4 μg per 1 mg of Ag in Ag20-PVP and Ag110-PVP, respectively. MDM were infected with avirulent M.tb strain (H37Ra, ATCC catalog number 25177) at a multiplicity of infection (MOI) of ten bacilli (MOI 10) per cell.
MTS assay Cell viability was assessed by Cell Titer 96 Aqueous One Solution Cell Proliferation Assay [MTS, (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium), Promega,Madison WI] as per the manufacturer’s protocol. Briefly, MDM (44,000/ well) were incubated at 37°C in a humidified CO2 environment for 3, 6 and 24 hours in presence of 0 (cells alone, negative control), 5, 10, 20 and 50 μg/mL of AgNP (Ag20-citrate, Ag20-PVP, Ag110-citrate, Ag110-PVP) and PVP10 and PVP40 equivalents corresponding to
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
4 / 28
AgNP Exposure and Innate Immunity
the 5, 10, 20 and 50 μg/mL concentrations of Ag20-PVP and Ag110-PVP. Absorbance was recorded at 493 nm with an ELISA reader (ThermoScientific Multiskan FC, Finland). Percentages of viable cells were calculated as ratios of ODs of NP-exposed MDM (after background subtraction) to the ODs of unexposed MDM (after background subtraction) x 100.
Lactate dehydrogenase (LDH) assay Cell culture supernatants (50 μL) were collected following MDM exposures to AgNP and PVP10 and PVP40 controls and transferred into 96-well assay plates. Fifty μL of substrate (CytoTox 96 Non-radioactive cytotoxicity Assay, Promega, Madison, WI) was then added per well. Following incubation at room temperature for 30 minutes in the dark, stop solution (50 μL) was added to each well and absorbance recorded at 493 nm as described above. Cellular toxicity was defined as percent (%) LDH leakage from cells calculated from the ratios of ODs of NP-exposed MDM (after background subtraction) to the ODs of unexposed MDM (after background subtraction) x 100.
Quantitative RT-PCR to determine cytokine mRNA abundance The following primer sets were used for qRT-PCR, TNFA forward: GTGCTTGTTCCTCAGC CTCTT, TNFA reverse: ATGGGCTACAGGCTTGTCATC; IL1B forward: GAAGCTGAT GGCCCTAAACAG, IL1B reverse: AGCATCTTCCTCAGCTTGTCC; IL8 forward: ACTGA GAGT GAT TGA GAG TGG AC, IL8 reverse: AAC CCTCTGCACCCAGTTTTC; IL10 forward: ACCTGCCTAAGATGCTTCCAG, IL10 reverse: CTGGGTCTTGGTTCTCAGCTT; HSPA1 forward: AAGTACAAAGCGGAGGACGAG, HSPA1 reverse: CCACGAGATG ACCTCTTGACA. For each of the mRNAs, fold-changes relative to unexposed MDM were calculated as described previously [28].
Pathway-specific qRT-PCR arrays Human Toll-like Receptor (TLR) signaling pathway-specific RT2-Profiler arrays (Cat. No. PAHS 018E, Qiagen Sciences, MD) were used to screen for mRNA expression in AgNP and M. tb-exposed and unexposed MDM [28]. Levels of cDNA were calculated by the relative quantitation method (ΔΔCt method) from the PCR array data using analysis software accessed from http://sabiosciences.com/pcrarraydataanalysis.php. Statistical differences in fold-mRNA expression levels between exposed and unexposed cells were calculated using the same software.
ELISA for IL-1β detection Following plastic adherence for 7 days (as described above), MDM were treated with 5 mM EDTA/PBS for 5 minutes and then gently scraped from six-well plates and subsequently plated into 96-well plates. On the next day, cells were exposed to 0, 1 and 10 μg/mL of NP with simultaneous infection with M.tb at MOI 10. Culture supernatants from M.tb-infected and uninfected MDMs were collected at 6 and 8 hours, centrifuged for 5 minutes at 5,000 rpm to remove particles and bacteria, and assessed for IL-1ß protein content by ELISA following the manufacturer’s protocol (R&D Systems, Minneapolis, MN). Absorbance was recorded at 450 and 570 nm with an ELISA reader (ThermoScientific Multiskan FC, Finland).
Flow cytometry for Hsp72 detection MDM were washed with flow cytometry staining buffer and fixed in IC (intracellular) fixation buffer (eBiosciences, Inc. San Diago, CA). Fixed cells were permeabilized with 1x permeabilization
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
5 / 28
AgNP Exposure and Innate Immunity
buffer (eBiosciences) followed by staining with FITC conjugated anti-Hsp72 (cat. No. ADI-SPA810FI-D, Enzo Life sciences, Farmingdale, NY) or mouse IgG1 isotype control (cat. No. ADISAB-600FI-050, Enzo Life sciences) for 20 minutes at room temperature in the dark. After washing, the expression of Hsp72 in MDM was evaluated by flow cytometry with a Gallios Flow Cytometer (Beckman Coulter, Miami, FL) and analyzed with Kaluza Analysis Software (Beckman Coulter).
Colony forming unit (CFU) assay To evaluate direct, AgNP-mediated antibacterial effects, M.tb was grown in cell culture media in the presence or absence (control) of Ag20-citrate, Ag20-PVP, Ag110-ctrate, and Ag110-PVP. Ten μL of M.tb stock (CFU 1 x 107/mL) were diluted to 1 mL with cell culture media (RPMI1640 + 10% PHS) and incubated at 37°C with rotation on a revolver (Labnet International, Inc., Edison, NJ) in the presence of 0, 10 and 25 μg/mL of AgNP and 15.7 and 39.25 μg/mL of AgNO3 for 24 hours. AgNO3 concentrations corresponded to the total amounts of Ag+ ions present in 10 and 25 μg/mL of AgNP, respectively. Ten μL of the culture media samples were removed at 24 hours and serially 10-fold diluted in cell culture media without antibiotics (RPMI1640 + 10% PHS) and plated in triplicate onto 7H10 agar plates and incubated for 21 days at 37°C [37]. M.tb colonies (CFU) were counted using a stereo microscope at 40x magnification (Diagger Lab equipments, Vernon Hills, IL), and plotted as a function of the AgNP concentration. M.tb grown in NP-free culture media served as a control.
M.tb uptake/internalization Enriched CD14+CD3- PBMC were generated by negative selection through immunodepletion of non-monocytes as described previously [28]. For generation of MDM, enriched monocytes were plated onto 8-chamber (5x 105/chamber) culture slides (BD-Falcon, Cat. No. 354118) and allowed to differentiate for 7 days. Culture media were changed every 2–3 days during the 7-day incubation period. MDM were infected with M.tb at MOI 10 in presence of Ag20-citrate (10 μg/mL) or Ag110-citrate (10 μg/mL) for 2 and 4 hours. Following incubation, extracellular bacteria were removed by extensive washing with RPMI 1640 and slides were stained with Kinyoun Staining fluid as described previously [28]. Proportions of MDM harboring phagocytosed bacilli (stained in red) were assessed by oil immersion bright field microscopy (100X, Zeiss Primo Star) in a total of 300 MDM for each experimental condition. To determine the number of M.tb that had been internalized within individual MDM, MDM (2 x 105 monocyte/well) were grown in 96-well culture dishes, infected with M.tb as described above and washed after 4 hours to remove extracellular bacteria. MDM were then lysed by addition of 0.1% sodium dodecyl sulfate (SDS) in 7H9 Milddlebrook medium for 10 min at room temperature after which SDS was neutralized with 20% Bovine Serum Albumin (BSA). Lysed cells were serially diluted with 7H9 medium and plated out in triplicate onto agar plates (Middlebrook 7H10 agar) and incubated for 21 days at 37°C. CFU numbers were then determined as described above.
Statistical analysis Mixed linear models that include a random effect for experiments, no fixed intercept and an estimated common variance across doses were used to estimate the effect of dose within each condition on the logarithm of the fold-change. Previous examination of summary statistics demonstrated a relatively constant variance of the log-transformed fold-changes. Thus, with the small sample sizes (n = 4) for each dose, this approach would potentially give the most stable variance estimates. Wald tests examined whether the log-fold changes were significantly
PLOS ONE | DOI:10.1371/journal.pone.0143077 November 18, 2015
6 / 28
AgNP Exposure and Innate Immunity
different than zero or, equivalently, whether the fold-changes were significantly different from one. Fold-changes of cytokine expression under exposure at doses of 1, 10 or 25 μg/mL relative to expression at no exposure were calculated within each stimulus-by-M.tb exposure combination. To examine AgNP dose effects on percent viability and LDH leakage, mixed linear models similar to those described above were used. Analyses were stratified by stimulus as well as hour. The two-tailed, unpaired Student’s t-test was used to examine (i) the effects of AgNP, carbon black and Ag+ ions on IL-1β expression, (ii) the effect of AgNP on M.tb phagocytosis/ internalization, and (iii) IL1B and HSPA1 expression.
Results Characterization of AgNP Physicochemical properties of AgNP are crucial determinants of their bioreactivities. Information on size (determined by dynamic light scattering after diluting AgNP 10-fold in 2 mM NaCl to measure the hydrodynamic diameter), charge (determined by Zeta potential measurement at pH 7), and endotoxin concentration (analyzed by limulus amebocyte lysate assay) of the AgNP (supplied by NCNHIR consortium) was provided by the NCL and is listed in Table 1. Endotoxin levels in AgNP were low reducing the likelihood that any observed AgNP induced immune modulations were endotoxin-induced. The primary size distribution of the citrate and PVP-stabilized Ag20 and Ag110 in water (Fig 1A–1D) and pH7 solution (Fig 1E– 1H) was compared by TEM performed at Imperial College, London. The size distributions of the different AgNP preparations studied here indicate that the diameters of the majority of Ag20 and Ag110 are >16 nm (Fig 1I and 1J) and >80 nm (Fig 1K and 1L), respectively. Assessments confirmed that physicochemical properties of the as–received AgNP (dispersed in DI water) were consistent with the specifications provided by NCL. Additional characteristics of AgNP with gold core are discussed elsewhere by Botelho et al.[38]. Our previous work [36] showed that dissolved Ag+ ions reprecipitate as insoluble Ag salts (e.g. Ag2O, AgCl and Ag2S) in the cell culture medium (RPMI and 10% pooled human serum) used in this study. For this reason, we decided not to measure the amount of ionic Ag+ in the cell culture medium as it was expected that the amount of free Ag+ ions in this medium would be below the detection limit of ICP, and not representative of the actual Ag+ ion-release. Therefore, ICP was employed to measure the dissolution rates of the AgNP in inorganic buffers at both pH 5 & 7. All AgNP showed a higher rate of dissolution at pH 5 than at pH 7 (Fig 2). Except for Ag20-citrate, all other AgNP released less than 2% Ag+ ions into the solution over a three-day incubation period (72 h). Furthermore, Ag+ ion levels were undetectable in either Ag110 citrate or Ag110 PVP in pH 7 buffer solutions, indicating that AgNP dissolution was negligible. Other studies have reported a 5 to 15% dissolution from citrate-stabilized particles Table 1. Physicochemical properties of AgNP. Samples
Diameter (nm)of >94% of particles
Zeta potential (mV)
Endotoxin conc.(EU/ml)
20 nm, Citrate-stabilized Ag
20.9 ± 2.1
-44.3 ± 1.3
