Modulatory Effect of Cadmium on the Expression of Phospholipase A2 and Proinflammatory Genes in Rat Testis Chinnarasu Sivaprakasam, Vasanthi Nachiappan Biomembrane Laboratory, Department of Biochemistry, School of Life Sciences, Bharathidasan University, Tiruchirappalli, Tamilnadu 620024, India
Received 14 October 2014; revised 21 January 2015; accepted 25 January 2015 ABSTRACT: Cadmium (Cd) is a toxic metal that is hazardous to health, and its exposure showed a significant reduction in mitochondrial phospholipid function in the rat testes. Cd induction enhanced phospholipases (PLA2s) activities, specifically the secretory PLA2 and cytosolic PLA2. There was a reduction in mitochondrial membrane potential and significant decline in the respiratory complexes, which was confirmed by 2D blue native gel. The mRNA expression of cyclooxygenase and proinflammatory cytokine genes interleukin (IL)-1, IL-6, tumor necrosis factor-a, inducible nitric oxide synthase, and interferon-g increased and that of anti-inflammatory cytokine IL-10 reduced with Cd exposure in a time-dependent manner. The gene expression of the proapoptotic factor Bax was elevated, and in parallel, the antiapoptotic factor Bcl2 was down-regulated. Hence, this study explored the testes under Cd toxicity and observed alterations in PLA2s and mitochondrial membrane composition/function and further explored C 2015 Wiley Periodicals, Inc. Environ Toxicol the impact of these alterations on proinflammation and apoptosis. V 00: 000–000, 2015.
Keywords: cadmium; phospholipase A2; proinflammation; mitochondrial dysfunction; phospholipid
INTRODUCTION Cadmium (Cd) is a toxic metal widely used in industrial processes and consumer products, thereby contaminating the environment and causing health-related problems. Exposure to Cd causes multiple changes in DNA repair, DNA methylation, cell cycle, gene expression, and signaling pathways, inducing cancer and other diseases (Waisberg et al., 2003; Wang et al., 2012). It affects lung, liver, kidney, bone, the cardiovascular system, and the reproductive system (Fowler, 2009). Infertility affects approximately 15% of people, and is a major adverse effect during Cd contamination. Sex steroid
Correspondence to: V. Nachiappan; e-mail: [email protected] Contract grant sponsor: Bharathidasan University (BDU), Tiruchirappalli, Tamilnadu, India Published online 00 Month 2015 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/tox.22124
hormones play important roles in both reproductive and nonreproductive functions. Mitochondria play a major role in the biosynthesis of pregnenolone, a precursor of sex steroids (Papadopoulos and Miller, 2012). Mitochondrial membranes possess a high content of phospholipids (PLs), whereas sterols and sphingolipids are present in low amounts (Daum and Vance, 1997). The major PLs in the mitochondrial membrane are phosphatidylcholine and phosphatidylethanolamine and also cardiolipin (CL), which is an exclusive component of the mitochondrial membrane (Zinser et al., 1991). Alterations in PL composition has an impact on membrane integrity, permeability, intracellular membrane trafficking, etc. (Yorio and Frazier, 1990; Stenger et al., 2009). PLs in the membranes are regulated by phospholipases (PLAs). The phospholipases A2 (PLA2s) are ubiquitous in nature and have a vital role in many biological processes, like membrane remodeling, signal transduction (Schaloske and Dennis, 2006), and regulation of lipid metabolism by generation of proinflammatory lipid mediators, such as
C 2015 Wiley Periodicals, Inc. V
1
2
SIVAPRAKASAM AND NACHIAPPAN
prostaglandins and leukotrienes (Glaser, 1995). More than 20 isoforms of PLA2s have been classified, based on primary structure, Ca21 dependence, and substrate specificity. PLA2s are again divided into five groups: secretory PLA2s, cytosolic PLA2s (cPLA2s), Ca21-independent PLA2s, plateletactivating factor acetylhydrolases, and lysosomal PLA2s. Of these, cPLA2 is essential for eicosanoid biosynthesis because this ubiquitously expressed enzyme shows specificity for PLs containing arachidonicacid (Murakami, 2011). The Ca21independent PLA2 is more involved in membrane homeostasis and energy metabolism. The secretory PLA2 is known to regulate extracellular PLs and is also expressed in macrophages and epithelial cells to generate lipid mediators. The classification of two recently identified PLAs, lysosomal PLA2 and adipose-specific PLA2, is based on their location. Although cPLA2 is constitutively expressed, certain PLAs are activated in distinct cell populations to supply precursors of lipid mediators needed for varied functions. These PLA2s have diverse regulatory mechanisms and different expression, distribution, and biochemical actions (Schaloske and Dennis, 2006). PLA2s act on sn-2 ester bond of PLs and release free fatty acids and lysophospholipids. PLA2s mobilize arachidonic acid from PLs that serve as substrate for prostaglandin H synthase 1 and 2 and cyclooxygenases (COX-1 and -2), resulting in prostaglandin production and also have a vital role in cellular injury by mediating inflammatory responses. In this study, we studied Cd-induced PLA2 alterations and its effect on proinflammatory cytokines in rat testes.
Experimental Design After the acclimatization period, animals were divided into four different groups of six animals each. CdSO4 was administered to rats intraperitoneally (i.p.) as reported earlier (Konstantinos et al., 2003). The first group (group I) served as a control and received physiological saline i.p. Groups II, III, and IV were injected CdSO4 (3 mg/kg body weight) i.p. and euthanized after 12, 24, and 48 h, respectively (the animals were fasted overnight and euthanized under anesthesia, and the testes samples were collected).
Isolation of Testes Mitochondria Mitochondria were isolated from the testes of rats by standard differential centrifugation (La-Salete et al., 2008). Testes excised from the rats were homogenized in an ice-cold isolation medium containing 0.25 M sucrose, 20 mM HEPES, 1 mM EDTA, 0.2% (w/v) defatted bovine serum albumin (pH 7.4) and homogenized (final volume of 10 mL/g) using a homogenizer. Nuclei and unbroken cells were separated from the homogenate by centrifugation at 700 3 g for 10 min at 4 C, and the mitochondria were separated from the supernatant by centrifugation at 10 000 3 g for 10 min at 4 C. The mitochondrial pellet was washed twice and resuspended in a medium containing 0.25 M sucrose and 20 mM HEPES (pH 7.4) and suspended at 15–30 mg of protein/mL. The protein concentration of mitochondrial suspension was measured by the Bradford method (Bradford, 1976), using bovine serum albumin as a standard.
MATERIALS AND METHODS Cadmium sulfate (high performance liquid chromatographygrade) was obtained from M/S Merck Specialties, Mumbai, India. Silica gel 60F254 thin-layer chromatography (TLC) plates were purchased from Merck (Darmstat, Germany). All chemicals and solvents were purchased from Sigma (St. Louis, MO) unless specifically mentioned.
Animals The male albino rats of Wistar strain, having a body weight of 150–200 g, were bought from the Animal Facility of the Indian Institute of Science, Bangalore. Rats were placed in the Animal Facility at Bharathidasan University, Tiruchirappalli, India, under hygienic and standard environmental conditions (temperature: 24 C 6 1 C, light–dark cycle, 12:12 h). The rats were acclimatized for a week by providing standard pellet diet (Sai Durga Feeds, Bangalore, India) and water ad libitum. The animals were then used for experimental purposes after obtaining due permission from the University and Institutional legislation regulated by the committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA Permission No. BDU/IAEC/15/2013/ 09.04.2013), Ministry of Social Justice and Empowerment, Government of India.
Environmental Toxicology DOI 10.1002/tox
Analysis of Phospholipids from Testis Mitochondria The total lipids were extracted from the mitochondria according to Folch et al. (1957). Briefly, the testes were isolated and washed well with ice-cold saline. The mitochondria were isolated, and the protein was estimated. The mitochondria containing 100 mg protein were mixed with 10 mL of chloroform/methanol (2:1, v/v), vortexed vigorously and centrifuged at 10 000 3 g for 10 min, and, to the organic phase, 0.2 mL of acidified water (0.02% phosphoric acid) was added, vortexed vigorously, and the chloroform extract (organic top layer) was evaporated under reduced pressure and dissolved in required volume of chloroform. The lipids were spotted on TLC plates (Silica gel G, Merck) and were separated using chloroform/methanol/acetone/acetic acid/water (50:10:20:15:5 v/v). The plates were dried, and the spots were exposed to iodine vapor, and the individual PL spots were identified by comparing its Rf value with the known PL standards.
Determination of Phosphorus from Phospholipid The lipid was extracted, and the PL separated using TLC and quantified following the method of Rouser et al. (1970).
MODULATORY EFFECT OF CADMIUM ON RAT TESTES PHOSPHOLIPASE A2
TABLE I.
3
List of primer sequences used in RT-PCR analysis
S. No.
Gene Name
1
PLA2 G-II
2
PLA2 G-IV
3
PLA2 G-V
4
PLA2 G-VI
5
Cox-2
6
IL-1
7
IL-6
8
IL-10
9
TNF-a
10
iNOS
11
INF-g
12
Bax
13
Bcl2
14
b-Actin
Briefly, the spots from TLC plates were scraped and digested at 180 C with 70% perchloric acid in glass tubes. To the digested sample, 2.5% ammonium molybdate and 10% ascorbic acid were added, and the final volume was made to 5 mL with distilled water. The tubes were kept for 10 min in a boiling water bath, centrifuged for 10 min at 2000 3 g, and the absorbance of the sample was measured at A800 nm. Then, the phosphorus present in the sample was measured, and the PLs were quantified.
Isolation of RNA RNA was isolated by the Trizol method (Sigma) according to the manufacturer’s protocol. Briefly, Trizol was added to testis tissue (25–100 mg) and mixed well. The tissue was minced with the help of a polytron and passed through pipette several times. Chloroform (0.2 mL) was added, and the samples were shaken vigorously for 15 s and kept at room temperature for 15 min. The mixture was centrifuged at 12 000 3 g for 15 min at 4 C. The aqueous phase was transferred to a fresh tube, and isopropanol (0.5 mL) was added, mixed, and was incubated at room temperature for 10 min. The RNA was pelleted by centrifugation (12 000 3 g), washed with ethanol (75%), pelleted, air dried, and sus-
Primer Sequence 0
FW-5 ATG AAG GTC CTC CTG TTG CTA G 30 RW-50 TCA GCA ACT GGG CGT CTT CCC TT 30 FW-50 AGTGGTTCTACGTGCCACCA 30 RW-50 GTACCATGTGGAGCCGGACA 30 FW-50 ATG AAG CGC CTC CTC ACG CTG 30 RW-50 AGA GGA AGG CAG ATC CAA GAC CT 30 FW-50 CAGCACCTGACGGACCTCAT 30 RW-50 ACGTCACAGCCCCTCTTCAG 30 FW-50 GCTTGGCTTGTGACTTTGGC 30 RW-50 TGTCAGAACCCCCTCCAATTC 30 FW-50 TGTCTGACCCATGTGAGCTG 30 RW-50 CAGGGAGGGAAACACACGTT 30 FW-50 CACTTCACAAGTCGGAGGCT 30 RW-50 AGCACACTAGGTTTGCCGAG 30 FW-50 GCTCAGCACTGCTATGTTGC 30 RW-50 GTAGATGCCGGGTGGTTCAA 30 FW-50 CGGCTTCTAAACAAGCCCTTT 30 RW-50 CCGGGGTTATGTACGCTTGA 30 FW-50 ATTCCCAGCCCAACAACACA 30 RW-50 TTGGACCACTGAATCCTGCC 30 FW-50 GGATCCATGAGTGCTACACG 30 RW-50 GGCACACTCTCTACCCCAGA 30 FW-50 AGAGGATGGCTGGGGAGAC 30 RW-50 GTGGGCGTCCCGAAGTAG 30 FW-50 GAGGGGCTACGAGTGGGATA 30 RW-50 GCATGCTGGGGCCATATAGT 30 FW-50 CAT CCA GGC TGT GCT GTC CCT 30 RW-50 TGC CAA TAG TGA TGA CCT GGC 30
pended in diethylpyrocarbonate-treated water, and the total RNA was estimated by spectrophotometry at A260 nm.
Reverse Transcription Polymerase Chain Reaction The rat testis cDNA was prepared from the total RNA, and the targeted genes amplified (primer sequences are given in Table I). The polymerase chain reaction (PCR) was carried out by 30 cycles at 94 C for 30 s, 60 C for 30 s, and 72 C for 30 s, followed by a final extension cycle at 72 C for 5 min. The reverse transcriptase (RT-PCR) products were analyzed in 1.5% agarose gel. The expression of genes was quantified by comparing the expression of b-actin. The semi-quantitatively analyzed RT-PCR results were scanned for gel images, and the intensity of each PCR product was measured using Bio-Rad Quantity one software version 4.6.9.30 gel documentation.
Spectrofluorometric Determination of Mitochondrial Membrane Potential The mitochondrial membrane potential (MMP) (Dwmit) was measured using rhodamine 123 (Rho123) dye with the aid of
Environmental Toxicology DOI 10.1002/tox
4
SIVAPRAKASAM AND NACHIAPPAN
Fig. 1. Effect of cadmium on mitochondrial phospholipid content. (A) Animals were treated with CdSO4 (3 mg/kg body weight). Mitochondria were isolated, and lipids were extracted and resolved in silica TLC. The phospholipids were separated using chloroform:methanol:ammonia (65:25:5, v/v) in first dimension and chloroform:methanol:acetone:aceticacid:water (50:10:20:15:5, v/v) in the second dimension. The Rf value of standard phospholipids were used to compare the Rf value of unknown phospholipid spots. PC: phosphatidylcholine, PE: phosphatidylethanolamine, PS: phosphatidylserine, PI: phosphatidylinositol, CL: cardiolipin. (B) Quantification data of phospholipids. All experiments were performed in triplicates and were representative of at least six independent experiments. Cd- and saline-treated control cells were compared, and data were indicated as mean 6 standard deviation, with a statistical significance of *p < 0.05 and **p < 0.01.
spectrofluorometer. The mitochondria (0.2 mg/mL) from the testis was added to the solution (150 mM sucrose, 4 mM MgCl2, 5 mM potassium phosphate, and 30 mM KOHHEPES, pH 7.4) followed by the addition of 0.1 lM Rho123 in the presence of 8 mM malate and 8 mM glutamate. The total dye concentration of rhodamine 123([Rho123]total, in nmol/lL) was initially measured. After equilibrium was reached, the suspension was centrifuged at 15 000 3 g to pellet the mitochondria, and the fluorescence was measured. The Rho123 concentration remaining in the solution ([Rho123]out, in nmol/lL) was calculated from the fluorescence values of the supernatant. The initial total amount of Rho123 in the cuvette ([Rho123]total) and the amount remaining in the solution ([Rho123]out) were used to calculate the amount of Rho123 taken up by mitochondria ([Rho123]mit, in nmol/mg protein). The concentration of free Rho-123 in the matrix ([Rho123]in, in nmol/lL) was calculated using the following equation and the binding partition coefficients (Ki 5 26 lL/mg and Ko 5 120 lL/mg) at 37 C: [Rho123]mit 5 Ki [Rho123]in 1 Ko [Rho123]out.
Environmental Toxicology DOI 10.1002/tox
MMPs (negative inside) were calculated by the electrochemical Nernst–Guggenheim equation: Dw 5 59 log ([Rho123]in/[Rho123]out) (Russell et al., 1999).
Two-Dimensional Blue Native Gel The proteins of the mitochondrial super complexes were separated by blue native sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The proteins were distorted, and their subunits resolved by SDS-PAGE. Briefly, mitochondria (100 mg protein) were isolated, lysed (TrisHCl (pH 7.4), KCl, MgCl2, and EDTA), and the proteins were separated by 8% native PAGE. Each lane was excised, incubated in equilibration buffer (2% SDS, 6 M urea, 30% glycerol, 0.05 M Tris-HCl (pH 8.8), and 20 mg/mL DTT) for 30 min at room temperature to dissociate the proteins in the complexes. The lanes were placed on top of a 4% stacking and 12% gradient stocking SDS-PAGE and ran at 50 V. Gel was silver stained and visualized by Bio Rad gel documentation set up.
MODULATORY EFFECT OF CADMIUM ON RAT TESTES PHOSPHOLIPASE A2
5
Fig. 2. The mRNA levels of phospholipase A2 genes. Total RNA was isolated, and cDNA was constructed using reverse transcriptase. Rat phospholipase genes (types II, IV, V, and VI) were amplified using specific primer sequences. Band intensity was measured by Image one software. The mRNA expression of specific gene/actin was calculated. Each experiment was conducted in triplicates, and the data shown are mean 6 standard deviation from six independent experiments. Control cells were compared with that of other groups, with a statistical significance of *p < 0.05 and **p < 0.01.
Statistical Analysis Data were analyzed using the programs of GraphPad Prism 6.0 software package for Windows. All the values reported in the article were the mean of six replicates. Statistical analysis was carried out by post hoc testing and, for intergroup comparisons, using Tukey’s multiple comparisons test. Values are statistically significant at **p < 0.01 and *p < 0.05.
RESULTS Effect of Cadmium Administration on Phospholipid Profile in the Mitochondria of Rat Testis The mitochondria from the testes of Cd-treated rats were isolated, and the lipid was extracted and separated by TLC (Fig. 1). The total PL and other major PL were found to be significantly decreased upon Cd treatment. The levels of phosphatidylcholine (42, 62, and 71%), phosphatidylethanolamine (34, 57, and 82%), phosphatidylinositol (23, 53, and 76%), and phosphatidylserine (15, 58, and 77%) were found to decrease in a time-dependent manner (12, 24, and 48 h) compared with the control saline-treated group. The level of CL, a specialized mitochondrial PL present in the inner membrane, also showed a significant reduction (30, 80, 96%) upon Cd treatment.
Reduction in Phospholipids Is Due to Enhanced Phospholipase A2 Next, we wanted to elucidate whether the reduction in PL levels may be due to increased degradation by PLA2s under Cd exposure. Our laboratory previously reported that exposure to toxic substances enhanced the PL degradation pathway (Sabarirajan et al., 2013; Vijayaraj et al., 2014). In this experiment also, we observed an increase in the genes
expression of PLA2s namely G-II (0.5-, 0.9-, and 1.1-fold), G-IV (1-, 1.2-, and 2-fold), G-V (0.7-, 0.9-, and 1.5-fold), and G-VI (0.3-, 0.5-, and 1.1-fold), with Cd exposure compared with control animals (Fig. 2).
Cyclooxygenase Pathway Was Activated by Phospholipase A2 Under Cadmium Toxicity Membrane PLs were hydrolyzed at the sn-2 position with the release of unsaturated fatty acids, mainly arachidonic acid (n6, 20:4) that forms eicosanoids. Cd induction upregulated the gene expression COX-2 (Fig. 3), and this in turn induced the mRNA expression of proinflammatory cytokine and growth factor genes, implying its role in inflammation and cell growth regulation.
mRNA Expression in Rat Testis Denoted an Up-Regulation of Proinflammatory Genes and Down-Regulation of Anti-inflammatory Genes Next with Cd treatment, we analyzed the mRNA expression of proinflammatory genes (interleukin (IL)-1, IL-6, tumor necrosis factor (TNF)-a, and interferon (INF)-g) and also anti-inflammatory gene, IL-10. The mRNA expression was increased in IL-1 (threefold), INF-g (threefold), TNF-a (10fold), and also with IL-6 gene and inducible nitric oxide synthase (iNOS) (Fig. 3) in a time-dependent manner. On the contrary, the mRNA expression level of anti-inflammatory cytokine (IL-10) was significantly decreased during Cd treatment (Fig. 3).
Alteration of Anti- and Proapoptotic Factors Under Cadmium Treatment The members of the Bcl2 family (comprising of death agonists and antagonists) were important in determining the resistance of a cell to apoptosis. The levels of antiapoptotic
Environmental Toxicology DOI 10.1002/tox
6
SIVAPRAKASAM AND NACHIAPPAN
Fig. 3. Effect of Cd on the mRNA expression levels of the COX-2, both pro- and anti-inflammatory. Total RNA was isolated, and cDNA was constructed using reverse transcriptase. Specific genes were amplified using their specific primer sequences, and the band intensity was measured by Image one software. The mRNA expression of specific gene/actin was calculated. Each experiment was conducted in triplicates, and the data shown are mean 6 standard deviation from six independent experiments. Control cells were compared with that of other groups, with a statistical significance of *p < 0.05 and **p < 0.01.
factor (Bcl-2) was reduced, whereas the proapoptotic factor (Bax) was significantly increased (Fig. 4) in a timedependent manner with Cd exposure.
brane potential (Dwm), altered apoptogenic factors, and oxidative phosphorylation complexes.
Mitochondrial Respiratory Complex Proteins Altered Under Cadmium Toxicity Alteration of Phospholipid Level and Loss of Membrane Potential in Mitochondria During Cadmium Toxicity Reduction in PLs might have an impact on MMP and was measured using rhodamine 123 dye. The MMP was assumed as 100% in control animals, and Cd exposure depicted a decrease in MMP (Fig. 5), depolarization of the transmem-
The mitochondrial respiratory chain consists of five enzyme complexes that are responsible for ATP generation. The respiratory chain super-complexes in the inner membrane of mitochondria form “respirasome” structures, which mainly comprise complexes I and III, and the enzyme COX (complex IV) in mammalian cells (Schagger and Pfeiffer, 2000, 2001). Complexes II and V are usually not associated with
Fig. 4. mRNA expression levels of anti- and proapoptotic genes. RNA from rat testes was isolated, and cDNA was constructed by using reverse transcriptase. Rat anti- and proapoptotic genes (Bcl2 and Bax, respectively) were amplified using specific primer sequences. Band intensity was measured using Image one software. Expression was calculated as the ratio (mRNA expression of specific gene/actin). The data shown are mean 6 standard deviation from six independent experiments. Control cells were compared with that of other groups, with a statistical significance of *p < 0.05 and **p < 0.01.
Environmental Toxicology DOI 10.1002/tox
MODULATORY EFFECT OF CADMIUM ON RAT TESTES PHOSPHOLIPASE A2
7
rated by 8% native gel, and the gel lanes were placed on 12% SDS-PAGE, and the separated complex proteins were visualized by silver stain. We observed a significant decrease in the mitochondrial membrane super complex protein levels in a time-dependent manner (Fig. 6) upon Cd exposure.
DISCUSSION
Fig. 5. Loss of mitochondrial membrane potential under CdSO4. From the rat testis, mitochondria (treated with (6) CdSO4) were isolated, and equal amount were taken and treated with rhodamine 123 fluorescent dye and measured in spectrofluorometer. The data shown are mean 6 standard deviation from three independent experiments. Control cells were compared with other groups, with a statistical significance of *p < 0.05 and **p < 0.01.
any other complexes (Acın-Perez et al., 2008). Blue native SDS-PAGE is the popular method for analyses of proteincomplex and the respiratory super complex here. Based on this procedure, the animal mitochondrial membrane proteins were separated. First, the mitochondrial proteins were sepa-
Fig. 6. Mitochondrial respiratory complex status upon cadmium exposure. From the rat testis, mitochondria (treated with (6) CdSO4) were isolated, and equal amount of mitochondrial protein (based on protein concentration) was loaded and separated by 2D blue native SDS-PAGE. In the first dimension, proteins were separated by 8% native gel, and in the second dimension, by 12% SDS polyacrylamide gel. Protein bands were visualized by silver stain.
Cadmium is an environmental and occupational toxic metal (Honda et al., 2010) that has also been reported to be a testicular toxicant (Siu et al., 2009). Cd induces germ cell apoptosis (Ozawa et al., 2002; Kim and Soh., 2009), male infertility, and semen of poor quality (Pant et al., 2003; Wu et al., 2008). Cd targets testicular tissue, damages it, and reduces spermatogenesis (Benoff et al ., 2004; KaismanElbaz et al., 2009; Acharya et al., 2008; Xu et al., 2003; Kusakabe et al., 2008). Sertoli cells form a blood–testis barrier, creating a stable microenvironment, or the niche, for the development of male germ cells, and the toxic effect of Cd damages these Sertoli cells. However, the molecular mechanism of Cd-induced testicular toxicity is poorly understood. In this study, a significant reduction was observed under Cd treatment in the rat testis PLs levels. We initially explored the expression pattern of PLA2 (the largest family of lipid-hydrolyzing enzymes that are involved in PL degradation) and found it to be up-regulated under Cd toxicity in rat testes, which may account for the decrease in the PL levels. The enzyme COX-2 is rapidly and transiently upregulated by a large variety of signals and has implications in pathological conditions such as inflammation (Dubois et al., 1998). COX-2 gene expression was up-regulated (Fig. 3) under Cd toxicity on rat testes. The expression levels of proinflammatory cytokine genes, IL-1, IL-6, and also iNOS and INF-g, were elevated under Cd exposure in a timedependent manner (Fig. 3), and similar observations were also observed during certain pathological conditions like testicular torsion and autoimmune orchitis. Proinflammatory cytokine IL-1 and TNF-a inhibit the gene expression of steroid-synthesizing enzymes (Hales, 2002) in the Leydig cells of the testes. During normal physiological conditions, TNF-a and IL-1 are produced in the testis and play a vital role in the maintenance of the testicular function. During cytokine-mediated cell death, several signaling pathways are involved (Eizirik and Mandrup-Poulsen, 2001), but induction of apoptosis is yet to be elucidated. Whether the cell death is induced by the proinflammatory cytokines or by apoptosis or by necrosis is yet to be determined. In rat testes, the gene expression of the proapoptotic factor Bax was upregulated and that of the Antiapoptotic factor Bcl2 was down-regulated. We also measured MMP and respiratory super complex and found a decrease with both in the rat testis upon Cd exposure. The mitochondria facilitate energy with the aid of the oxidative phosphorylation system and
Environmental Toxicology DOI 10.1002/tox
8
SIVAPRAKASAM AND NACHIAPPAN
consist of five major membrane complexes I to V. The super complexes and the CL content in the inner mitochondrial membrane regulate the growth conditions (Zhang et al., 2002; Pfeiffer et al., 2003). In summary, we observed a reduction in both MMP and respiratory complex proteins with Cd exposure. Reduction in PL and subsequent increase in the PLA2 expression was also observed during Cd toxicity. The activation of COX-2 activated the proinflammatory cytokines and proapoptotic factor and down-regulated anti-inflammatory cytokines and antiapoptotic factor in the rat testis during Cd toxicity. These findings might help us in elucidating the molecular mechanism underlying the infertility produced during Cd exposure in the testis. The instrumentation facility by Department of Science & Technology (DST) under DST-FIST and DST-PURSE programmes are gratefully acknowledged. The authors thank Dr. Natarajaseenivasan, Professor, Department of Microbiology, BDU, for generously providing his facility.
REFERENCES Acharya UR, Mishra M, Patro J, Panda MK. 2008. Effect of vitamins C and E on spermatogenesis in mice exposed to cadmium. Reprod Toxicol 25:84–88. Acın-Perez R, Fernandez-Silva P, Peleato ML, Perez-Martos A, Enriquez JA. 2008. Respiratory active mitochondrial supercomplexes. Mol Cell 32:529–539. Benoff SH, Millan C, Hurley IR, Napolitano B, Marmar JL. 2004. Bilateral increased apoptosis and bilateral accumulation of cadmium in infertile men with left varicocele. Hum Reprod 19: 616–627. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. Daum G, Vance JE. 1997. Import of lipids into mitochondria. Prog Lipid Res 36:103–130. Dubois RN, Abramson SB, Crofford L, Gupta RA, Simon LS, Van De Putte LB, Lipsky PE. 1998. Cyclooxygenase in biology and disease. FASEB J 12:1063–1073. Eizirik DL, Mandrup-Poulsen TA. 2001. Choice of death: The signal-transduction of immune-mediated beta-cell apoptosis. Diabetologia 44:2115–2133. Folch J, Lees M, Sloane Stanley GH. 1957. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226:497–509. Fowler BA. 2009. Monitoring of human populations for early markers of cadmium toxicity: A review. Toxicol Appl Pharmacol 238:294–300. Glaser KB. 1995. Regulation of phospholipase A2 enzymes: Selective inhibitors and their pharmacological potential. Adv Pharmacol 32:31–66. Hales DB. 2002. Testicular macrophage modulation of Leydig cell steroidogenesis. J Reprod Immunol 57:3–18.
Environmental Toxicology DOI 10.1002/tox
Honda R, Swaddiwudhipong W, Nishijo M, Mahasakpan P, Teeyakasem W, Ruangyuttikarn W, Satarug S, Padungtod C, Nakagawa H. 2010. Cadmium induced renal dysfunction among residents of rice farming area downstream from a zincmineralized belt in Thailand. Toxicol Lett 198:26–32. Kaisman-Elbaz T, Sekler I, Fishman D, Karol N, Forberg M, Kahn N, Hershfinkel M, Silverman WF. 2009. Cell death induced by zinc and cadmium is mediated by clusterin in cultured mouse seminiferous tubules. J Cell Physiol 220:222–229. Kim J, Soh J. 2009. Cadmium-induced apoptosis is mediated by the translocation of AIF to the nucleus in rat testes. Toxicol Lett 188:45–51. Konstantinos N, Tzirogiannis Georgios I, Panoutsopoulos GI, Demonakou MD, Hereti RI, Alexandropoulou KN, Basayannis AC, Mykoniatis MG. 2003. Time-course of cadmium-induced acute hepatotoxicity in the rat liver: The role of apoptosis. Arch Toxicol 77:694–701. Kusakabe T, Nakajima K, Nakazato K, Suzuki K, Takada H, Satoh T, Oikawa M, Arakawa K, Nagamine T. 2008. Changes of heavy metal, metallothionein and heat shock proteins in Sertoli cells induced by cadmium exposure. Toxicol In Vitro 22: 1469–1475. La-Salete R, Oliveira MM, Palmeira CA, Almeida J, Peixoto FP. 2008. Mitochondria a key role in microcystin-LR kidney intoxication. J Appl Toxicol 28:55–62. Murakami M, Taketomi Y, Miki Y. 2011. Recent progress in phospholipase A2 research: From cells to animals to humans. Prog Lipid Res 50:152–192. Ozawa N, Goda N, Makino N, Yamaguchi T, Yoshimura Y, Suematsu M. 2002. Leydig cell-derived heme oxygenase-1 regulates apoptosis of premeiotic germ cells in response to stress. J Clin Invest 109:457–467. Pant N, Upadhyay G, Pandey S, Mathur N, Saxena DK, Srivastava SP. 2003. Lead and cadmium concentration in the seminal plasma of men in the general population: Correlation with sperm quality. Reprod Toxicol 17:447–450. Papadopoulos V, Miller WL. 2012. Role of mitochondria in steroidogenesis. Best Pract Res Clin Endocrinol Metab 26:771– 790. Pfeiffer K, Gohil V, Stuart RA, Hunte C, Brandt U, Greenberg ML, Sch€agger H. 2003. Cardiolipin stabilizes respiratory chain supercomplexes. J Biol Chem 278:52873–52880. Rouser G, Fleischer S, Yamamoto A. 1970. Two dimensional thin-layer chromatographic separation of polar lipids and determination of phospholipids by phosphorus analysis of spots. Lipids 5:494–496. Russell C, Scaduto JR, Grotyohann LW. 1999. Measurement of mitochondrial membrane potential using fluorescent rhodamine derivatives. Biophys J 76:467–477. Sabarirajan S, Vijayaraj P, Vasanthi MSN. 2013. Effect of lipopolysaccharide on alteration of phospholipids and their fatty acid composition in spleen and thymus by in vitro metabolic labeling. J Appl Toxicol 33:418–425. Schagger H, Pfeiffer K. 2000. Supercomplexes in the respiratory chains of yeast and mammalian mitochondria. EMBO J 19: 1777–1783.
MODULATORY EFFECT OF CADMIUM ON RAT TESTES PHOSPHOLIPASE A2
Schagger H, Pfeiffer K. 2001. The ratio of oxidative phosphorylation complexes I-V in bovine heart mitochondria and the composition of respiratory chain supercomplexes. J Biol Chem 276: 37861–37867. Schaloske RH, Dennis EA. 2006. The phospholipase A2 superfamily and its group numbering system. Biochim Biophys Acta 1761:1246–1259. Siu ER, Mruk DD, Porto CS, Cheng CY. 2009. Cadmium induced testicular injury. Toxicol Appl Pharmacol 238:240–249. Stenger PC, Alonso C, Zasadzinski JA, Waring AJ, Jung CL, Pinkerton KE. 2009. Environmental tobacco smoke effects on lung surfactant film organization. Biochim Biophys Acta 1788: 358–370.
9
death and increase of cell proliferation in rats and mice. PLoS One 7:e33853. Wu HM, Lin-Tan DT, Wang ML, Huang HY, Wang HS, Soong YK, Lin JL. 2008. Cadmium level in seminal plasma may affect the pregnancy rate for patients undergoing infertility evaluation and treatment. Reprod Toxicol 25:481–484. Xu DX, Shen HM, Zhu QX, Chua L, Wang QN, Chia SE, Ong CN. 2003. The associations among semen quality, oxidative DNA damage in human spermatozoa and concentrations of cadmium, lead and selenium in seminal plasma. Mutat Res 534: 155–163. Yorio T, Frazier LW. 1990. Phospholipids and electrolyte transport. Proc Soc Exp Biol Med 195:293–303.
Vijayaraj P, Sivaprakasam C, Varthini VL, Vasanthi MSN. 2014. In vitro exposure of tobacco specific nitrosamines decreases the rat lung phospholipids by enhanced phospholipase A2 activity. Toxicol In Vitro 28:1097–1105.
Zhang M, Mileykovskaya E, Dowhan W. 2002. Gluing the respiratory chain together. Cardiolipin is required for supercomplex formation in the inner mitochondrial membrane. J Biol Chem 277:43553–43556.
Waisberg M, Joseph P, Hale B, Beyersmann D. 2003. Molecular and cellular mechanisms of cadmium carcinogenesis. Toxicology 192:95–117.
Zinser E, Sperka-Gottlieb CDM, Fasch EV, Kohlwein SD, Paltauf F, Daum G. 1991. Phospholipid synthesis and lipid composition of subcellular membranes in the unicellular eukaryote Saccharomyces cerevisiae. J Bacteriol 173:2026– 2034.
Wang B, Li Y, Tan Y. 2012. Low-dose CD induces hepatic gene hypermethylation, along with the persistent reduction of cell
Environmental Toxicology DOI 10.1002/tox
Received 14 October 2014; revised 21 January 2015; accepted 25 January 2015 ABSTRACT: Cadmium (Cd) is a toxic metal that is hazardous to health, and its exposure showed a significant reduction in mitochondrial phospholipid function in the rat testes. Cd induction enhanced phospholipases (PLA2s) activities, specifically the secretory PLA2 and cytosolic PLA2. There was a reduction in mitochondrial membrane potential and significant decline in the respiratory complexes, which was confirmed by 2D blue native gel. The mRNA expression of cyclooxygenase and proinflammatory cytokine genes interleukin (IL)-1, IL-6, tumor necrosis factor-a, inducible nitric oxide synthase, and interferon-g increased and that of anti-inflammatory cytokine IL-10 reduced with Cd exposure in a time-dependent manner. The gene expression of the proapoptotic factor Bax was elevated, and in parallel, the antiapoptotic factor Bcl2 was down-regulated. Hence, this study explored the testes under Cd toxicity and observed alterations in PLA2s and mitochondrial membrane composition/function and further explored C 2015 Wiley Periodicals, Inc. Environ Toxicol the impact of these alterations on proinflammation and apoptosis. V 00: 000–000, 2015.
Keywords: cadmium; phospholipase A2; proinflammation; mitochondrial dysfunction; phospholipid
INTRODUCTION Cadmium (Cd) is a toxic metal widely used in industrial processes and consumer products, thereby contaminating the environment and causing health-related problems. Exposure to Cd causes multiple changes in DNA repair, DNA methylation, cell cycle, gene expression, and signaling pathways, inducing cancer and other diseases (Waisberg et al., 2003; Wang et al., 2012). It affects lung, liver, kidney, bone, the cardiovascular system, and the reproductive system (Fowler, 2009). Infertility affects approximately 15% of people, and is a major adverse effect during Cd contamination. Sex steroid
Correspondence to: V. Nachiappan; e-mail: [email protected] Contract grant sponsor: Bharathidasan University (BDU), Tiruchirappalli, Tamilnadu, India Published online 00 Month 2015 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/tox.22124
hormones play important roles in both reproductive and nonreproductive functions. Mitochondria play a major role in the biosynthesis of pregnenolone, a precursor of sex steroids (Papadopoulos and Miller, 2012). Mitochondrial membranes possess a high content of phospholipids (PLs), whereas sterols and sphingolipids are present in low amounts (Daum and Vance, 1997). The major PLs in the mitochondrial membrane are phosphatidylcholine and phosphatidylethanolamine and also cardiolipin (CL), which is an exclusive component of the mitochondrial membrane (Zinser et al., 1991). Alterations in PL composition has an impact on membrane integrity, permeability, intracellular membrane trafficking, etc. (Yorio and Frazier, 1990; Stenger et al., 2009). PLs in the membranes are regulated by phospholipases (PLAs). The phospholipases A2 (PLA2s) are ubiquitous in nature and have a vital role in many biological processes, like membrane remodeling, signal transduction (Schaloske and Dennis, 2006), and regulation of lipid metabolism by generation of proinflammatory lipid mediators, such as
C 2015 Wiley Periodicals, Inc. V
1
2
SIVAPRAKASAM AND NACHIAPPAN
prostaglandins and leukotrienes (Glaser, 1995). More than 20 isoforms of PLA2s have been classified, based on primary structure, Ca21 dependence, and substrate specificity. PLA2s are again divided into five groups: secretory PLA2s, cytosolic PLA2s (cPLA2s), Ca21-independent PLA2s, plateletactivating factor acetylhydrolases, and lysosomal PLA2s. Of these, cPLA2 is essential for eicosanoid biosynthesis because this ubiquitously expressed enzyme shows specificity for PLs containing arachidonicacid (Murakami, 2011). The Ca21independent PLA2 is more involved in membrane homeostasis and energy metabolism. The secretory PLA2 is known to regulate extracellular PLs and is also expressed in macrophages and epithelial cells to generate lipid mediators. The classification of two recently identified PLAs, lysosomal PLA2 and adipose-specific PLA2, is based on their location. Although cPLA2 is constitutively expressed, certain PLAs are activated in distinct cell populations to supply precursors of lipid mediators needed for varied functions. These PLA2s have diverse regulatory mechanisms and different expression, distribution, and biochemical actions (Schaloske and Dennis, 2006). PLA2s act on sn-2 ester bond of PLs and release free fatty acids and lysophospholipids. PLA2s mobilize arachidonic acid from PLs that serve as substrate for prostaglandin H synthase 1 and 2 and cyclooxygenases (COX-1 and -2), resulting in prostaglandin production and also have a vital role in cellular injury by mediating inflammatory responses. In this study, we studied Cd-induced PLA2 alterations and its effect on proinflammatory cytokines in rat testes.
Experimental Design After the acclimatization period, animals were divided into four different groups of six animals each. CdSO4 was administered to rats intraperitoneally (i.p.) as reported earlier (Konstantinos et al., 2003). The first group (group I) served as a control and received physiological saline i.p. Groups II, III, and IV were injected CdSO4 (3 mg/kg body weight) i.p. and euthanized after 12, 24, and 48 h, respectively (the animals were fasted overnight and euthanized under anesthesia, and the testes samples were collected).
Isolation of Testes Mitochondria Mitochondria were isolated from the testes of rats by standard differential centrifugation (La-Salete et al., 2008). Testes excised from the rats were homogenized in an ice-cold isolation medium containing 0.25 M sucrose, 20 mM HEPES, 1 mM EDTA, 0.2% (w/v) defatted bovine serum albumin (pH 7.4) and homogenized (final volume of 10 mL/g) using a homogenizer. Nuclei and unbroken cells were separated from the homogenate by centrifugation at 700 3 g for 10 min at 4 C, and the mitochondria were separated from the supernatant by centrifugation at 10 000 3 g for 10 min at 4 C. The mitochondrial pellet was washed twice and resuspended in a medium containing 0.25 M sucrose and 20 mM HEPES (pH 7.4) and suspended at 15–30 mg of protein/mL. The protein concentration of mitochondrial suspension was measured by the Bradford method (Bradford, 1976), using bovine serum albumin as a standard.
MATERIALS AND METHODS Cadmium sulfate (high performance liquid chromatographygrade) was obtained from M/S Merck Specialties, Mumbai, India. Silica gel 60F254 thin-layer chromatography (TLC) plates were purchased from Merck (Darmstat, Germany). All chemicals and solvents were purchased from Sigma (St. Louis, MO) unless specifically mentioned.
Animals The male albino rats of Wistar strain, having a body weight of 150–200 g, were bought from the Animal Facility of the Indian Institute of Science, Bangalore. Rats were placed in the Animal Facility at Bharathidasan University, Tiruchirappalli, India, under hygienic and standard environmental conditions (temperature: 24 C 6 1 C, light–dark cycle, 12:12 h). The rats were acclimatized for a week by providing standard pellet diet (Sai Durga Feeds, Bangalore, India) and water ad libitum. The animals were then used for experimental purposes after obtaining due permission from the University and Institutional legislation regulated by the committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA Permission No. BDU/IAEC/15/2013/ 09.04.2013), Ministry of Social Justice and Empowerment, Government of India.
Environmental Toxicology DOI 10.1002/tox
Analysis of Phospholipids from Testis Mitochondria The total lipids were extracted from the mitochondria according to Folch et al. (1957). Briefly, the testes were isolated and washed well with ice-cold saline. The mitochondria were isolated, and the protein was estimated. The mitochondria containing 100 mg protein were mixed with 10 mL of chloroform/methanol (2:1, v/v), vortexed vigorously and centrifuged at 10 000 3 g for 10 min, and, to the organic phase, 0.2 mL of acidified water (0.02% phosphoric acid) was added, vortexed vigorously, and the chloroform extract (organic top layer) was evaporated under reduced pressure and dissolved in required volume of chloroform. The lipids were spotted on TLC plates (Silica gel G, Merck) and were separated using chloroform/methanol/acetone/acetic acid/water (50:10:20:15:5 v/v). The plates were dried, and the spots were exposed to iodine vapor, and the individual PL spots were identified by comparing its Rf value with the known PL standards.
Determination of Phosphorus from Phospholipid The lipid was extracted, and the PL separated using TLC and quantified following the method of Rouser et al. (1970).
MODULATORY EFFECT OF CADMIUM ON RAT TESTES PHOSPHOLIPASE A2
TABLE I.
3
List of primer sequences used in RT-PCR analysis
S. No.
Gene Name
1
PLA2 G-II
2
PLA2 G-IV
3
PLA2 G-V
4
PLA2 G-VI
5
Cox-2
6
IL-1
7
IL-6
8
IL-10
9
TNF-a
10
iNOS
11
INF-g
12
Bax
13
Bcl2
14
b-Actin
Briefly, the spots from TLC plates were scraped and digested at 180 C with 70% perchloric acid in glass tubes. To the digested sample, 2.5% ammonium molybdate and 10% ascorbic acid were added, and the final volume was made to 5 mL with distilled water. The tubes were kept for 10 min in a boiling water bath, centrifuged for 10 min at 2000 3 g, and the absorbance of the sample was measured at A800 nm. Then, the phosphorus present in the sample was measured, and the PLs were quantified.
Isolation of RNA RNA was isolated by the Trizol method (Sigma) according to the manufacturer’s protocol. Briefly, Trizol was added to testis tissue (25–100 mg) and mixed well. The tissue was minced with the help of a polytron and passed through pipette several times. Chloroform (0.2 mL) was added, and the samples were shaken vigorously for 15 s and kept at room temperature for 15 min. The mixture was centrifuged at 12 000 3 g for 15 min at 4 C. The aqueous phase was transferred to a fresh tube, and isopropanol (0.5 mL) was added, mixed, and was incubated at room temperature for 10 min. The RNA was pelleted by centrifugation (12 000 3 g), washed with ethanol (75%), pelleted, air dried, and sus-
Primer Sequence 0
FW-5 ATG AAG GTC CTC CTG TTG CTA G 30 RW-50 TCA GCA ACT GGG CGT CTT CCC TT 30 FW-50 AGTGGTTCTACGTGCCACCA 30 RW-50 GTACCATGTGGAGCCGGACA 30 FW-50 ATG AAG CGC CTC CTC ACG CTG 30 RW-50 AGA GGA AGG CAG ATC CAA GAC CT 30 FW-50 CAGCACCTGACGGACCTCAT 30 RW-50 ACGTCACAGCCCCTCTTCAG 30 FW-50 GCTTGGCTTGTGACTTTGGC 30 RW-50 TGTCAGAACCCCCTCCAATTC 30 FW-50 TGTCTGACCCATGTGAGCTG 30 RW-50 CAGGGAGGGAAACACACGTT 30 FW-50 CACTTCACAAGTCGGAGGCT 30 RW-50 AGCACACTAGGTTTGCCGAG 30 FW-50 GCTCAGCACTGCTATGTTGC 30 RW-50 GTAGATGCCGGGTGGTTCAA 30 FW-50 CGGCTTCTAAACAAGCCCTTT 30 RW-50 CCGGGGTTATGTACGCTTGA 30 FW-50 ATTCCCAGCCCAACAACACA 30 RW-50 TTGGACCACTGAATCCTGCC 30 FW-50 GGATCCATGAGTGCTACACG 30 RW-50 GGCACACTCTCTACCCCAGA 30 FW-50 AGAGGATGGCTGGGGAGAC 30 RW-50 GTGGGCGTCCCGAAGTAG 30 FW-50 GAGGGGCTACGAGTGGGATA 30 RW-50 GCATGCTGGGGCCATATAGT 30 FW-50 CAT CCA GGC TGT GCT GTC CCT 30 RW-50 TGC CAA TAG TGA TGA CCT GGC 30
pended in diethylpyrocarbonate-treated water, and the total RNA was estimated by spectrophotometry at A260 nm.
Reverse Transcription Polymerase Chain Reaction The rat testis cDNA was prepared from the total RNA, and the targeted genes amplified (primer sequences are given in Table I). The polymerase chain reaction (PCR) was carried out by 30 cycles at 94 C for 30 s, 60 C for 30 s, and 72 C for 30 s, followed by a final extension cycle at 72 C for 5 min. The reverse transcriptase (RT-PCR) products were analyzed in 1.5% agarose gel. The expression of genes was quantified by comparing the expression of b-actin. The semi-quantitatively analyzed RT-PCR results were scanned for gel images, and the intensity of each PCR product was measured using Bio-Rad Quantity one software version 4.6.9.30 gel documentation.
Spectrofluorometric Determination of Mitochondrial Membrane Potential The mitochondrial membrane potential (MMP) (Dwmit) was measured using rhodamine 123 (Rho123) dye with the aid of
Environmental Toxicology DOI 10.1002/tox
4
SIVAPRAKASAM AND NACHIAPPAN
Fig. 1. Effect of cadmium on mitochondrial phospholipid content. (A) Animals were treated with CdSO4 (3 mg/kg body weight). Mitochondria were isolated, and lipids were extracted and resolved in silica TLC. The phospholipids were separated using chloroform:methanol:ammonia (65:25:5, v/v) in first dimension and chloroform:methanol:acetone:aceticacid:water (50:10:20:15:5, v/v) in the second dimension. The Rf value of standard phospholipids were used to compare the Rf value of unknown phospholipid spots. PC: phosphatidylcholine, PE: phosphatidylethanolamine, PS: phosphatidylserine, PI: phosphatidylinositol, CL: cardiolipin. (B) Quantification data of phospholipids. All experiments were performed in triplicates and were representative of at least six independent experiments. Cd- and saline-treated control cells were compared, and data were indicated as mean 6 standard deviation, with a statistical significance of *p < 0.05 and **p < 0.01.
spectrofluorometer. The mitochondria (0.2 mg/mL) from the testis was added to the solution (150 mM sucrose, 4 mM MgCl2, 5 mM potassium phosphate, and 30 mM KOHHEPES, pH 7.4) followed by the addition of 0.1 lM Rho123 in the presence of 8 mM malate and 8 mM glutamate. The total dye concentration of rhodamine 123([Rho123]total, in nmol/lL) was initially measured. After equilibrium was reached, the suspension was centrifuged at 15 000 3 g to pellet the mitochondria, and the fluorescence was measured. The Rho123 concentration remaining in the solution ([Rho123]out, in nmol/lL) was calculated from the fluorescence values of the supernatant. The initial total amount of Rho123 in the cuvette ([Rho123]total) and the amount remaining in the solution ([Rho123]out) were used to calculate the amount of Rho123 taken up by mitochondria ([Rho123]mit, in nmol/mg protein). The concentration of free Rho-123 in the matrix ([Rho123]in, in nmol/lL) was calculated using the following equation and the binding partition coefficients (Ki 5 26 lL/mg and Ko 5 120 lL/mg) at 37 C: [Rho123]mit 5 Ki [Rho123]in 1 Ko [Rho123]out.
Environmental Toxicology DOI 10.1002/tox
MMPs (negative inside) were calculated by the electrochemical Nernst–Guggenheim equation: Dw 5 59 log ([Rho123]in/[Rho123]out) (Russell et al., 1999).
Two-Dimensional Blue Native Gel The proteins of the mitochondrial super complexes were separated by blue native sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The proteins were distorted, and their subunits resolved by SDS-PAGE. Briefly, mitochondria (100 mg protein) were isolated, lysed (TrisHCl (pH 7.4), KCl, MgCl2, and EDTA), and the proteins were separated by 8% native PAGE. Each lane was excised, incubated in equilibration buffer (2% SDS, 6 M urea, 30% glycerol, 0.05 M Tris-HCl (pH 8.8), and 20 mg/mL DTT) for 30 min at room temperature to dissociate the proteins in the complexes. The lanes were placed on top of a 4% stacking and 12% gradient stocking SDS-PAGE and ran at 50 V. Gel was silver stained and visualized by Bio Rad gel documentation set up.
MODULATORY EFFECT OF CADMIUM ON RAT TESTES PHOSPHOLIPASE A2
5
Fig. 2. The mRNA levels of phospholipase A2 genes. Total RNA was isolated, and cDNA was constructed using reverse transcriptase. Rat phospholipase genes (types II, IV, V, and VI) were amplified using specific primer sequences. Band intensity was measured by Image one software. The mRNA expression of specific gene/actin was calculated. Each experiment was conducted in triplicates, and the data shown are mean 6 standard deviation from six independent experiments. Control cells were compared with that of other groups, with a statistical significance of *p < 0.05 and **p < 0.01.
Statistical Analysis Data were analyzed using the programs of GraphPad Prism 6.0 software package for Windows. All the values reported in the article were the mean of six replicates. Statistical analysis was carried out by post hoc testing and, for intergroup comparisons, using Tukey’s multiple comparisons test. Values are statistically significant at **p < 0.01 and *p < 0.05.
RESULTS Effect of Cadmium Administration on Phospholipid Profile in the Mitochondria of Rat Testis The mitochondria from the testes of Cd-treated rats were isolated, and the lipid was extracted and separated by TLC (Fig. 1). The total PL and other major PL were found to be significantly decreased upon Cd treatment. The levels of phosphatidylcholine (42, 62, and 71%), phosphatidylethanolamine (34, 57, and 82%), phosphatidylinositol (23, 53, and 76%), and phosphatidylserine (15, 58, and 77%) were found to decrease in a time-dependent manner (12, 24, and 48 h) compared with the control saline-treated group. The level of CL, a specialized mitochondrial PL present in the inner membrane, also showed a significant reduction (30, 80, 96%) upon Cd treatment.
Reduction in Phospholipids Is Due to Enhanced Phospholipase A2 Next, we wanted to elucidate whether the reduction in PL levels may be due to increased degradation by PLA2s under Cd exposure. Our laboratory previously reported that exposure to toxic substances enhanced the PL degradation pathway (Sabarirajan et al., 2013; Vijayaraj et al., 2014). In this experiment also, we observed an increase in the genes
expression of PLA2s namely G-II (0.5-, 0.9-, and 1.1-fold), G-IV (1-, 1.2-, and 2-fold), G-V (0.7-, 0.9-, and 1.5-fold), and G-VI (0.3-, 0.5-, and 1.1-fold), with Cd exposure compared with control animals (Fig. 2).
Cyclooxygenase Pathway Was Activated by Phospholipase A2 Under Cadmium Toxicity Membrane PLs were hydrolyzed at the sn-2 position with the release of unsaturated fatty acids, mainly arachidonic acid (n6, 20:4) that forms eicosanoids. Cd induction upregulated the gene expression COX-2 (Fig. 3), and this in turn induced the mRNA expression of proinflammatory cytokine and growth factor genes, implying its role in inflammation and cell growth regulation.
mRNA Expression in Rat Testis Denoted an Up-Regulation of Proinflammatory Genes and Down-Regulation of Anti-inflammatory Genes Next with Cd treatment, we analyzed the mRNA expression of proinflammatory genes (interleukin (IL)-1, IL-6, tumor necrosis factor (TNF)-a, and interferon (INF)-g) and also anti-inflammatory gene, IL-10. The mRNA expression was increased in IL-1 (threefold), INF-g (threefold), TNF-a (10fold), and also with IL-6 gene and inducible nitric oxide synthase (iNOS) (Fig. 3) in a time-dependent manner. On the contrary, the mRNA expression level of anti-inflammatory cytokine (IL-10) was significantly decreased during Cd treatment (Fig. 3).
Alteration of Anti- and Proapoptotic Factors Under Cadmium Treatment The members of the Bcl2 family (comprising of death agonists and antagonists) were important in determining the resistance of a cell to apoptosis. The levels of antiapoptotic
Environmental Toxicology DOI 10.1002/tox
6
SIVAPRAKASAM AND NACHIAPPAN
Fig. 3. Effect of Cd on the mRNA expression levels of the COX-2, both pro- and anti-inflammatory. Total RNA was isolated, and cDNA was constructed using reverse transcriptase. Specific genes were amplified using their specific primer sequences, and the band intensity was measured by Image one software. The mRNA expression of specific gene/actin was calculated. Each experiment was conducted in triplicates, and the data shown are mean 6 standard deviation from six independent experiments. Control cells were compared with that of other groups, with a statistical significance of *p < 0.05 and **p < 0.01.
factor (Bcl-2) was reduced, whereas the proapoptotic factor (Bax) was significantly increased (Fig. 4) in a timedependent manner with Cd exposure.
brane potential (Dwm), altered apoptogenic factors, and oxidative phosphorylation complexes.
Mitochondrial Respiratory Complex Proteins Altered Under Cadmium Toxicity Alteration of Phospholipid Level and Loss of Membrane Potential in Mitochondria During Cadmium Toxicity Reduction in PLs might have an impact on MMP and was measured using rhodamine 123 dye. The MMP was assumed as 100% in control animals, and Cd exposure depicted a decrease in MMP (Fig. 5), depolarization of the transmem-
The mitochondrial respiratory chain consists of five enzyme complexes that are responsible for ATP generation. The respiratory chain super-complexes in the inner membrane of mitochondria form “respirasome” structures, which mainly comprise complexes I and III, and the enzyme COX (complex IV) in mammalian cells (Schagger and Pfeiffer, 2000, 2001). Complexes II and V are usually not associated with
Fig. 4. mRNA expression levels of anti- and proapoptotic genes. RNA from rat testes was isolated, and cDNA was constructed by using reverse transcriptase. Rat anti- and proapoptotic genes (Bcl2 and Bax, respectively) were amplified using specific primer sequences. Band intensity was measured using Image one software. Expression was calculated as the ratio (mRNA expression of specific gene/actin). The data shown are mean 6 standard deviation from six independent experiments. Control cells were compared with that of other groups, with a statistical significance of *p < 0.05 and **p < 0.01.
Environmental Toxicology DOI 10.1002/tox
MODULATORY EFFECT OF CADMIUM ON RAT TESTES PHOSPHOLIPASE A2
7
rated by 8% native gel, and the gel lanes were placed on 12% SDS-PAGE, and the separated complex proteins were visualized by silver stain. We observed a significant decrease in the mitochondrial membrane super complex protein levels in a time-dependent manner (Fig. 6) upon Cd exposure.
DISCUSSION
Fig. 5. Loss of mitochondrial membrane potential under CdSO4. From the rat testis, mitochondria (treated with (6) CdSO4) were isolated, and equal amount were taken and treated with rhodamine 123 fluorescent dye and measured in spectrofluorometer. The data shown are mean 6 standard deviation from three independent experiments. Control cells were compared with other groups, with a statistical significance of *p < 0.05 and **p < 0.01.
any other complexes (Acın-Perez et al., 2008). Blue native SDS-PAGE is the popular method for analyses of proteincomplex and the respiratory super complex here. Based on this procedure, the animal mitochondrial membrane proteins were separated. First, the mitochondrial proteins were sepa-
Fig. 6. Mitochondrial respiratory complex status upon cadmium exposure. From the rat testis, mitochondria (treated with (6) CdSO4) were isolated, and equal amount of mitochondrial protein (based on protein concentration) was loaded and separated by 2D blue native SDS-PAGE. In the first dimension, proteins were separated by 8% native gel, and in the second dimension, by 12% SDS polyacrylamide gel. Protein bands were visualized by silver stain.
Cadmium is an environmental and occupational toxic metal (Honda et al., 2010) that has also been reported to be a testicular toxicant (Siu et al., 2009). Cd induces germ cell apoptosis (Ozawa et al., 2002; Kim and Soh., 2009), male infertility, and semen of poor quality (Pant et al., 2003; Wu et al., 2008). Cd targets testicular tissue, damages it, and reduces spermatogenesis (Benoff et al ., 2004; KaismanElbaz et al., 2009; Acharya et al., 2008; Xu et al., 2003; Kusakabe et al., 2008). Sertoli cells form a blood–testis barrier, creating a stable microenvironment, or the niche, for the development of male germ cells, and the toxic effect of Cd damages these Sertoli cells. However, the molecular mechanism of Cd-induced testicular toxicity is poorly understood. In this study, a significant reduction was observed under Cd treatment in the rat testis PLs levels. We initially explored the expression pattern of PLA2 (the largest family of lipid-hydrolyzing enzymes that are involved in PL degradation) and found it to be up-regulated under Cd toxicity in rat testes, which may account for the decrease in the PL levels. The enzyme COX-2 is rapidly and transiently upregulated by a large variety of signals and has implications in pathological conditions such as inflammation (Dubois et al., 1998). COX-2 gene expression was up-regulated (Fig. 3) under Cd toxicity on rat testes. The expression levels of proinflammatory cytokine genes, IL-1, IL-6, and also iNOS and INF-g, were elevated under Cd exposure in a timedependent manner (Fig. 3), and similar observations were also observed during certain pathological conditions like testicular torsion and autoimmune orchitis. Proinflammatory cytokine IL-1 and TNF-a inhibit the gene expression of steroid-synthesizing enzymes (Hales, 2002) in the Leydig cells of the testes. During normal physiological conditions, TNF-a and IL-1 are produced in the testis and play a vital role in the maintenance of the testicular function. During cytokine-mediated cell death, several signaling pathways are involved (Eizirik and Mandrup-Poulsen, 2001), but induction of apoptosis is yet to be elucidated. Whether the cell death is induced by the proinflammatory cytokines or by apoptosis or by necrosis is yet to be determined. In rat testes, the gene expression of the proapoptotic factor Bax was upregulated and that of the Antiapoptotic factor Bcl2 was down-regulated. We also measured MMP and respiratory super complex and found a decrease with both in the rat testis upon Cd exposure. The mitochondria facilitate energy with the aid of the oxidative phosphorylation system and
Environmental Toxicology DOI 10.1002/tox
8
SIVAPRAKASAM AND NACHIAPPAN
consist of five major membrane complexes I to V. The super complexes and the CL content in the inner mitochondrial membrane regulate the growth conditions (Zhang et al., 2002; Pfeiffer et al., 2003). In summary, we observed a reduction in both MMP and respiratory complex proteins with Cd exposure. Reduction in PL and subsequent increase in the PLA2 expression was also observed during Cd toxicity. The activation of COX-2 activated the proinflammatory cytokines and proapoptotic factor and down-regulated anti-inflammatory cytokines and antiapoptotic factor in the rat testis during Cd toxicity. These findings might help us in elucidating the molecular mechanism underlying the infertility produced during Cd exposure in the testis. The instrumentation facility by Department of Science & Technology (DST) under DST-FIST and DST-PURSE programmes are gratefully acknowledged. The authors thank Dr. Natarajaseenivasan, Professor, Department of Microbiology, BDU, for generously providing his facility.
REFERENCES Acharya UR, Mishra M, Patro J, Panda MK. 2008. Effect of vitamins C and E on spermatogenesis in mice exposed to cadmium. Reprod Toxicol 25:84–88. Acın-Perez R, Fernandez-Silva P, Peleato ML, Perez-Martos A, Enriquez JA. 2008. Respiratory active mitochondrial supercomplexes. Mol Cell 32:529–539. Benoff SH, Millan C, Hurley IR, Napolitano B, Marmar JL. 2004. Bilateral increased apoptosis and bilateral accumulation of cadmium in infertile men with left varicocele. Hum Reprod 19: 616–627. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. Daum G, Vance JE. 1997. Import of lipids into mitochondria. Prog Lipid Res 36:103–130. Dubois RN, Abramson SB, Crofford L, Gupta RA, Simon LS, Van De Putte LB, Lipsky PE. 1998. Cyclooxygenase in biology and disease. FASEB J 12:1063–1073. Eizirik DL, Mandrup-Poulsen TA. 2001. Choice of death: The signal-transduction of immune-mediated beta-cell apoptosis. Diabetologia 44:2115–2133. Folch J, Lees M, Sloane Stanley GH. 1957. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226:497–509. Fowler BA. 2009. Monitoring of human populations for early markers of cadmium toxicity: A review. Toxicol Appl Pharmacol 238:294–300. Glaser KB. 1995. Regulation of phospholipase A2 enzymes: Selective inhibitors and their pharmacological potential. Adv Pharmacol 32:31–66. Hales DB. 2002. Testicular macrophage modulation of Leydig cell steroidogenesis. J Reprod Immunol 57:3–18.
Environmental Toxicology DOI 10.1002/tox
Honda R, Swaddiwudhipong W, Nishijo M, Mahasakpan P, Teeyakasem W, Ruangyuttikarn W, Satarug S, Padungtod C, Nakagawa H. 2010. Cadmium induced renal dysfunction among residents of rice farming area downstream from a zincmineralized belt in Thailand. Toxicol Lett 198:26–32. Kaisman-Elbaz T, Sekler I, Fishman D, Karol N, Forberg M, Kahn N, Hershfinkel M, Silverman WF. 2009. Cell death induced by zinc and cadmium is mediated by clusterin in cultured mouse seminiferous tubules. J Cell Physiol 220:222–229. Kim J, Soh J. 2009. Cadmium-induced apoptosis is mediated by the translocation of AIF to the nucleus in rat testes. Toxicol Lett 188:45–51. Konstantinos N, Tzirogiannis Georgios I, Panoutsopoulos GI, Demonakou MD, Hereti RI, Alexandropoulou KN, Basayannis AC, Mykoniatis MG. 2003. Time-course of cadmium-induced acute hepatotoxicity in the rat liver: The role of apoptosis. Arch Toxicol 77:694–701. Kusakabe T, Nakajima K, Nakazato K, Suzuki K, Takada H, Satoh T, Oikawa M, Arakawa K, Nagamine T. 2008. Changes of heavy metal, metallothionein and heat shock proteins in Sertoli cells induced by cadmium exposure. Toxicol In Vitro 22: 1469–1475. La-Salete R, Oliveira MM, Palmeira CA, Almeida J, Peixoto FP. 2008. Mitochondria a key role in microcystin-LR kidney intoxication. J Appl Toxicol 28:55–62. Murakami M, Taketomi Y, Miki Y. 2011. Recent progress in phospholipase A2 research: From cells to animals to humans. Prog Lipid Res 50:152–192. Ozawa N, Goda N, Makino N, Yamaguchi T, Yoshimura Y, Suematsu M. 2002. Leydig cell-derived heme oxygenase-1 regulates apoptosis of premeiotic germ cells in response to stress. J Clin Invest 109:457–467. Pant N, Upadhyay G, Pandey S, Mathur N, Saxena DK, Srivastava SP. 2003. Lead and cadmium concentration in the seminal plasma of men in the general population: Correlation with sperm quality. Reprod Toxicol 17:447–450. Papadopoulos V, Miller WL. 2012. Role of mitochondria in steroidogenesis. Best Pract Res Clin Endocrinol Metab 26:771– 790. Pfeiffer K, Gohil V, Stuart RA, Hunte C, Brandt U, Greenberg ML, Sch€agger H. 2003. Cardiolipin stabilizes respiratory chain supercomplexes. J Biol Chem 278:52873–52880. Rouser G, Fleischer S, Yamamoto A. 1970. Two dimensional thin-layer chromatographic separation of polar lipids and determination of phospholipids by phosphorus analysis of spots. Lipids 5:494–496. Russell C, Scaduto JR, Grotyohann LW. 1999. Measurement of mitochondrial membrane potential using fluorescent rhodamine derivatives. Biophys J 76:467–477. Sabarirajan S, Vijayaraj P, Vasanthi MSN. 2013. Effect of lipopolysaccharide on alteration of phospholipids and their fatty acid composition in spleen and thymus by in vitro metabolic labeling. J Appl Toxicol 33:418–425. Schagger H, Pfeiffer K. 2000. Supercomplexes in the respiratory chains of yeast and mammalian mitochondria. EMBO J 19: 1777–1783.
MODULATORY EFFECT OF CADMIUM ON RAT TESTES PHOSPHOLIPASE A2
Schagger H, Pfeiffer K. 2001. The ratio of oxidative phosphorylation complexes I-V in bovine heart mitochondria and the composition of respiratory chain supercomplexes. J Biol Chem 276: 37861–37867. Schaloske RH, Dennis EA. 2006. The phospholipase A2 superfamily and its group numbering system. Biochim Biophys Acta 1761:1246–1259. Siu ER, Mruk DD, Porto CS, Cheng CY. 2009. Cadmium induced testicular injury. Toxicol Appl Pharmacol 238:240–249. Stenger PC, Alonso C, Zasadzinski JA, Waring AJ, Jung CL, Pinkerton KE. 2009. Environmental tobacco smoke effects on lung surfactant film organization. Biochim Biophys Acta 1788: 358–370.
9
death and increase of cell proliferation in rats and mice. PLoS One 7:e33853. Wu HM, Lin-Tan DT, Wang ML, Huang HY, Wang HS, Soong YK, Lin JL. 2008. Cadmium level in seminal plasma may affect the pregnancy rate for patients undergoing infertility evaluation and treatment. Reprod Toxicol 25:481–484. Xu DX, Shen HM, Zhu QX, Chua L, Wang QN, Chia SE, Ong CN. 2003. The associations among semen quality, oxidative DNA damage in human spermatozoa and concentrations of cadmium, lead and selenium in seminal plasma. Mutat Res 534: 155–163. Yorio T, Frazier LW. 1990. Phospholipids and electrolyte transport. Proc Soc Exp Biol Med 195:293–303.
Vijayaraj P, Sivaprakasam C, Varthini VL, Vasanthi MSN. 2014. In vitro exposure of tobacco specific nitrosamines decreases the rat lung phospholipids by enhanced phospholipase A2 activity. Toxicol In Vitro 28:1097–1105.
Zhang M, Mileykovskaya E, Dowhan W. 2002. Gluing the respiratory chain together. Cardiolipin is required for supercomplex formation in the inner mitochondrial membrane. J Biol Chem 277:43553–43556.
Waisberg M, Joseph P, Hale B, Beyersmann D. 2003. Molecular and cellular mechanisms of cadmium carcinogenesis. Toxicology 192:95–117.
Zinser E, Sperka-Gottlieb CDM, Fasch EV, Kohlwein SD, Paltauf F, Daum G. 1991. Phospholipid synthesis and lipid composition of subcellular membranes in the unicellular eukaryote Saccharomyces cerevisiae. J Bacteriol 173:2026– 2034.
Wang B, Li Y, Tan Y. 2012. Low-dose CD induces hepatic gene hypermethylation, along with the persistent reduction of cell
Environmental Toxicology DOI 10.1002/tox
