Mutation Research, 242 (1990) 195-208

195

Elsevier MUTGEN 01597

Molecular analysis of hprt mutants induced by 2-cyanoethylene oxide in human lymphoblastoid cells Leslie Redo, Deborah Simpson, Judi Cochrane, Howard Liber and Thomas R. Skopek b,.

a

Chemical Industry Institute of Toxicology, 6 Davis Drive, P. O. Box 12137, Research Triangle Park, N C 27709 (U.S.A.), a Harvard School of Public Health, Laboratory of Radiobiology, Department of Cancer Biology, 665 Huntington A venue, Boston, MA 02115 (U.S.A.) and b University of North Carolina, Department of Pathology, ChapellHill, NC 27599 (U.S.A.)

(Received23 January 1990) (Revision received5 May 1990) (Accepted 14 May 1990)

Keywords: Hprt mutants, molecularanalysis; 2-Cyanoethyleneoxide; Lymphoblastoidcells, human

Summary The mutagenic epoxide metabolite of acrylonitrile, 2-cyanoethylene oxide (ANO), was used to treat human TK6 lymphoblasts (150 # M × 2 h ANO). A collection of hypoxanthine-phosphoribosyltransferase ( h p r t ) mutants was isolated and characterized by dideoxy sequencing of cloned hprt cDNA. Base-pair substitution mutations in the hprt coding region were observed in 19/39 of hprt mutants; 11 occurred at AT base pairs and 8 at G C base pairs. Two - 1 frameshift mutations involving G C bases were also observed. Approximately half (17/39) of the hprt mutants displayed the complete loss of single and multiple exons from hprt cDNA, as well as small deletions, some extending from e x o n / e x o n junctions. Southern blot analysis of 5 mutants with single exon losses revealed no visible alterations. Analysis of 1 mutant missing exons 3 - 6 in its hprt mRNA revealed a visible deletion in the corresponding region in its genomic DNA. The missing exon regions of 4 mutants (one each with exon 6, 7 and 8 loss and one mutant with a 17-base deletion of the 5' region of exon 9) were PCR amplified from genomic D N A and analyzed by Southern blot using exon-specific probes. The exons missing from the hprt m R N A were present in the genomic hprt sequence. D N A sequencing of the appropriate i n t r o n / e x o n regions of hprt genomic D N A from a mutant with exon 8 loss and a mutant exhibiting aberrant splicing in exon 9 revealed point mutations in the splice acceptor site of exon 8 (T ---, A) and exon 9 (A ~ G), respectively.

Acrylonitrile (ACN) is widely utilized by the synthetic rubber and plastic industries in the manufacturing of numerous products. A C N is a

Correspondence: Dr. Leslie Recio, Chemical Industry Institute of Toxicology,6 Davis Drive, P.O. Box 12137, Research Triangle Park, NC 27709 (U.S.A.) (919) 541-2070, ext. 329.

rat carcinogen when administered in drinking water or by inhalation (Bigner et al., 1986; Maltoni et al., 1987; OSHA, 1978; Strother et al., 1989). Also, epidemiological data suggest that workers occupationally exposed to ACN are at an elevated risk of lung cancer (Delzell and Monson, 1982; Koerselman and van der Graaf, 1984; OSHA, 1978). An International Agency for Research on

0165-1218/90/$03.50 © 1990 ElsevierSciencePublishers B.V. (BiomedicalDivision)

196

Cancer (Lyon) working group has concluded that ACN is a probable human carcinogen (Class 2A; limited evidence for carcinogenicity in human and sufficient evidence for carcinogenicity in rodents; IARC, 1987). Additional research is needed to understand the mechanism of action of ACN and to determine the potential human health impact associated with ACN exposure. Our group has investigated the mutagenic mechanism of ACN in human cells (Recio and Skopek, 1988). ACN is inactive as a mutagen in the absence of metabolic activation; however, it is weakly mutagenic in the presence of aroclor-induced rat-liver homogenate (Crespi et al., 1985; Recio and Skopek, 1988). The principal route of ACN bioactivation is via epoxidation to the reactive metabolite 2-cyanoethylene oxide (ANO) (Guengerich et al., 1981). ANO is a direct-acting mutagen in human cells (Recio and Skopek, 1988). Furthermore, the amount of ANO produced from ACN in the presence of rat-liver homogenate can fully account for the mutagenic activity seen with ACN exposures (unpublished results). DNA amplification, cloning, and sequencing techniques have made it possible to directly analyze DNA-sequence alterations induced by mutagenic agents in endogenous genes in human cells (Liber et al., 1989; Simpson et al., 1987). Knowledge of the types of DNA changes induced by a particular agent (sequence specificity) can provide insights into its mutagenic mechanism (Bigger et al., 1989; DeJong et al., 1988; Drobetsky et al., 1987; Liber et al., 1989; Mazur and Glickman, 1988; Richardson et al., 1987; Vrieling et al., 1988, 1989). The sequence specificity of a given agent can suggest which DNA adducts are involved in the mutagenic process and which are not. Consequently, it can suggest which lesions in the DNA would best serve as target site dosimeters to assess exposure and derive dose-response relationships useful for quantitative risk assessment. The present work describes the molecular analysis of mutations induced by ANO at the human hprt locus in vitro. A cDNA/PCR sequencing method (Liber et al., 1989; Simpson et al., 1988) was used to determine genetic changes induced by ANO. The cDNA from a collection of hprt mutant

lymphoblasts was amplified using the polymerase chain reaction (PCR), cloned into M13, and sequenced to determine changes in DNA base sequence. This technique, along with Southern blot analysis, revealed that approximately one-half of the mutants induced by ANO contained point mutations in the coding region and the other one-half had mutations resulting in the aberrant splicing of hprt mRNA.

Materials and methods

Chemicals. ANO (99%) was purchased from Chemsyn Science Laboratories (Lenexa, KA) and was supplied in sealed ampules under an argon atmosphere. Biochemicals and enzymes for the cDNA/PCR system were obtained from the following sources: isopropyl-fl-D-thiogalactopyanoside (IPTG), 5-bromo-4-chloro-3-indolyl-fl-Dgalactoside (X-gal), dithiothreitol, restriction enzymes, M13mpl9, T4 DNA ligase, T4 DNA kinase, bacterial alkaline phosphatase (BAP), cDNA synthesis system from Bethesda Research Laboratories (Gaithersburg, MD); proteinase K, sodium pyrophosphate, from Sigma (St. Louis, MO); oligo dT, cellulose type 7 from Pharmacia Molecular Biology Division (Piscataway, NJ); Hybond-N from Amersham (Arlington Heights, IL); bacto-tryptone, bacto-yeast extract, bacto-peptone, bacto-agar from Difco (American Scientific Products, MacGraw Park, IL); polyethylene glycol from Aldrich (Milwaukee, WI). Chemicals used for transformation of bacteria were obtained from specific vendors as follows: hexamine cobalt chloride, potassium chloride, magnesium chloride. 4H20 gold label from Aldrich; calcium chloride. 2H20 from Fisher Scientific (Pittsburgh, PA). Ethyl methanesulfonate was purchased from Sigma and dimethyl sulfoxide from Mallinckrodt (Paris, KY). Oligonucleotides were synthesized on an Applied Biosystems 381 DNA Synthesizer (Foster City, CA). Reagents used to synthesize oligonucleotides were obtained from Applied Biosystems, Inc., Foster City, CA. 'Gene Amp' DNA amplification reagent kit was obtained from Perkin Elmer Cetus (Norwalk, CT).

197

Bacterial strains and media. The following E. coli K12 strains were used: JM101 [supE, thi, A(lacproA,B)/F', traD36, proA,B, (r~-, m~)laclqZM15]; DH5a[end A1, hsdR17(rk, m~-)

containing - 107 cells were frozen at - 70 ° C (in RPMI 1640, 15% horse serum and 10% DMSO) to be cultured at a later time for m R N A isolation.

sup E44; thi-1, X-, rec A1, gyr A96, rel A1, O 80d lac Z M15]. The bacterial media were prepared as follows: YT; 8 g/1 bacto-tryptone, 5 g/1 bactoyeast extract, 5 g/1 NaCI (for petri plates 1.5% agar), SOB; 20 g/1 bactotryptone, 5 g/1 bactoyeast extract, 10 m M NaC1, 2.5 mM KC1, 10 mM MgC12, 10 mM MgSO 4.

hprt cDNA / PCR

Cell culture and mutant isolation. The TK6 human lymphoblasts system has been described (Liber and Thilly, 1982; Skopek et al., 1978). Briefly, stocks and mutant cultures of TK6 cells were maintained in RPMI 1640 with L-glutamine and 15% heat-inactivated horse serum. Prior to exposure TK6 cells are treated with C H A T (cytidine, hypoxanthine, aminopterin and thymidine) to reduce the hprt- background. TK6 cells are from a male patient and contain only 1 X-chromosome (Yandell and Little, 1986). TK6 cells were treated with ANO as described in detail previously (Recio and Skopek, 1988). Briefly, flasks containing 3 x 10 7 cells (4 x 105 cells/ml) were treated with ANO (150 ttM x 2 h). A flask of nontreated controls and an EMS (200 /~M x 2 h) positive control were included in this experiment. A total of 10 flasks for ANO mutant isolation and mutant fraction determination were treated. Immediately after treatment with ANO, several independent flasks were inoculated with 5 x 106 treated cells and maintained with daily dilutions to 4 x 105/ml for 9 days to allow full expression of the 6-thioguanine-resistant mutant phenotype. Another set of flasks (untreated, EMS treated and 2 ANO treated) were maintained at 4 x 105 cells/ml to obtain relative percent survival and mutant fraction for the experiment used to isolate mutants. Hprt mutants were selected by plating in the presence of 6-thioguanine (1 ffg/ml) as described (Liber and Thilly, 1982). Mutant clones (one from each independent culture) were selected and recloned under selective conditions at a limiting dilution of 0.3 cells/well in 96-well microtiter dishes to obtain clones for analysis. Isolated mutant clones were expanded and aliquots

The methods utilized in our laboratory for the approach have continually evolved since our initial publication of the method (Simpson et al., 1988). Although a few of the mutants were analyzed as originally described (Simpson et al., 1988), the majority were analyzed using a modified method described below.

hprt c D N A / P C R

mRNA &olation. The m R N A isolation was performed as described (Badley et al., 1988; Simpson et al., 1988) with the following modifications: (1) 10-ml aliquots of lysis buffer were added to frozen pellets containing 75-100 x 10 6 mutant lymphoblasts. (2) The pellets were allowed to thaw completely before homogenization with a Tekmar model T-10 tissue homogenizer ( 1 / 2 power for 5 sec). (3) The lysate was incubated with 25-50 mg of oligo(dT) cellulose which was removed by centrifugation and then washed 5 times with 25-ml aliquots of 0.5 M NaC1, 0.01 M Tris pH 7.5. The OD260 of the final wash was less than 0.05. (4) After the final wash, the oligo(dT) pellets were resuspended in 500/~1 H20, transferred to 1.5-ml microcentrifuge tubes, and shaken at room temperature for 10 rain. The samples were briefly spun to pellet the oligo(dT). The supernatant containing the m R N A was transferred to a fresh tube and spun again to ensure that all oligo(dT) had been removed. This supernatant was again transferred to a fresh tube. Approx. 5 #g m R N A was obtained from 108 lymphoblasts. cDNA first strand synthesis and polymerase chain reaction amplification of hprt cDNA. The c D N A first strand synthesis was performed according to the BRL c D N A synthesis system using M-MLV reverse transcriptase, except that a hprt-specific primer (NEE; Table 1) was used instead of oligo dT. The amount of reverse transcriptase used was determined by the amount of message in each reaction, as specified by the vendor. The c D N A reaction was incubated at 3 7 ° C for 40 rain. Single-stranded hprt D N A was specifically con-

198 TABLE 1 SEQUENCE AND LOCATION OF SYNTHETIC OLIGONUCLEOTIDE PRIMERS AND PROBES USED IN THIS STUDY

(1)

h~rt eDNA and PCR primers $1 -14CCGGTCGACTCCGTTATG3 Sail

(2)

NEE 690CCTCAGGATAACTGTAGCGGTCATC'FI'AAGCG721 EcoRI Sequencing primers M13 universal primer GACG'FFGTAAAACGACGGCCAGTG C primer 392MGACATTCT~CCAGTT375

EE Primer 675TC,~u~CTTGAACTCTCATC 658

(3)

Exon-specific PCR primers and probes Exon 6 Ex6-3'Eco CGCG,~TTCCGACCTTGACCATCTTFGG463 EcoRI In5-5'Sala CGCGTCGACCCAGAATATCTCCATGTAGAT Sail Ex6 Probe 462ATTATACTGCCTGACC,~GG443 Exons 7-8 Ex7-5'Sal

ATTGTCGACTTGCTGGTG~,AAGGACCCCAs07 Sail

Ex8-3'Eeo GAAGAAFI'CAAATCCCTGAGTA"I-FC589 EcoRI Ex7-Probe 51 l'~GTGTTGGATAT'~GCCAGAC531 ExS-Probe 538CCTAAAC'FFI'AAGGTCTC555 Exon 9 Ex8-3'Sal 574GCCGTCGACTAT~TG,~TACTTCAGG600 Sail

NEE hprt eDNA PCR primer (above) Ex9-Probe 628CTTTGACC J I I IGGTTTTA646 Base numbers are as indicated in the Methods. All sequences are shown 5' to 3'. In certain cases only the 3' base number is indicated because the 5' end of the exon-specific primer resides within intron sequences. Certain mismatches were created to generate some of the restriction enzyme sites. Restriction enzyme sites within the primers are underlined. a This primer sequence resides entirely within intron 5. This sequence information was kindly provided by Pragna A. Patel.

verted to double-stranded DNA and amplified in vitro using the polymerase chain reaction (PCR) with Taq polymerase (Saiki et al., 1988) as previously described (Simpson et al., 1988) with the following changes: (1) the PCR reaction was immediately carried out by the addition of the reagents as described in the GeneAmp T M kit (Perkin-Elmer Cetus) and the complementary primer

to the cDNA reaction. (2) For the reaction 1 # M of each primer (S1 and NEE; Table 1) and 1 unit of Taq polymerase were used. (3) An automatic D N A Thermal cycler (Perkin Elmer Cetus) was used to perform the PCR reaction. The PCR conditions used are as follows: 94°C, 1 min (denature), 40 ° C, 2 min (anneal), 72 ° C, 3 rain (extend); a 2 min transition period was specified between

199 the 'anneal' and 'extend' incubations, while the other transitions were performed as quickly as possible. A total of 30 cycles was used. The 'extend' incubations of the last 10 cycles were increased 18 sec per cycle to give a final 'extend' period of 6 rain.

Cloning. PCR products were digested simultaneously with the restriction enzymes Sal I and Eco RI in 100 /~1. To monitor the efficiency of digestion, a 10-#1 aliquot was removed from each sample at the start of the digestion and added to 0.25 /~g of PBR322 previously cut with Pvu II. These were incubated with the other samples and then run on an agarose gel. After digestion the samples were ethanol-precipitated, resuspended in water, and loaded onto Linker 6 Sepharose spin columns (Boehringer Mannheim) to remove primers prior to ligation. Cloning of the PCR product into M13mpl9 and detection of positive plaques was carried out as previously described (Simpson et al., 1988). A consensus sequence of the PCR amplified hprt c D N A was obtained by pooling at least five hprt positive M13mpl9 plaques in a single tube for subsequent preparation of single-stranded M13m p l 9 DNA. DNA sequencing. Three sets of fluorescent primers (M13 universal primer and two primers homologous to the cloned hprt cDNA) were used to sequence the cloned hprt c D N A (Table 1). Dideoxy sequencing was carried out as specified by Applied Biosystems for use with their Model 370A automatic D N A sequencer using T7 D N A polymerase (Sequenase) and the appropriate dideo x y / d e o x y nucleotide mixtures (US Biochemicals, Cleveland, OH).

entire amino acid coding region of hprt (hprt c D N A was obtained from C. Thomas Caskey) and autoradiographs were examined for alterations with respect to the wild-type hybridization patterns.

Polymerase chain reaction amplification of hprt exons. Genomic D N A was isolated from ANOinduced hprt mutants using standard methods (Maniatis et al., 1982). Primers (Table 1) were used in the PCR reaction to amplify specific exon regions. Each reaction contained 1 /~M of each primer, 0.5/xg of genomic D N A and 1 unit of Taq polymerase. An automatic D N A thermal cycler (Perkin Elmer Cetus) was used to perform the PCR reaction. The PCR conditions used were the same as that described for the PCR amplification of hprt c D N A except that the first cycle used a 1.5 min 94 ° C 'denature' step.

Southern blot analysis of polymerase chain reaction amplified exons. Following PCR amplification of genomic DNA, the samples were electrophoresed in 2% agarose and the D N A was transferred to nylon membranes (Hybond; Amersham) by the method of Southern (1975). End-labelled (32p) exon-specific probes (Table 1) were hybridized to the filters that were then washed as recommended (Amersham).

Cloning and sequencing of PCR-amplified genomic hprt regions. The paired PCR primers used to amplify the genomic hprt regions contained restriction enzyme sites (EcoR1 and Sail) to permit directional cloning into M13mpl9. Plaques positive for the appropriate exon were identified using exon-specific probes (Table 1) end-labeled with 32p. Positive plaques were pooled to obtain a consensus sequence of the cloned regions.

Southern blot analysis of mutant genomic DNA. Southern blot analysis was done using a full length c D N A probe for the human hprt as described in detail (Liber et al., 1987). Genomic DNA was isolated using standard methods (Maniatis et al., !982), enzymatically digested with the restriction endonuclease HindlII, electrophoresed and transferred to nitrocellulose by the method of Southern (1975). The genomic D N A was probed with a radiolabeled 950-base-pair fragment containing the

Nomenclature. The hprt c D N A sequence from wild-type TK6 cells is the same as the published sequence (Jolly et al., 1983). We have used the wild-type sequence pattern obtained from TK6 to compare the sequence data generated from each mutant clone. The numbering system used here to indicate the location of primers, probes, and mutations in the hprt e D N A differs from this original publication. We designate base No. 1 as the first

200 TABLE 2 MUTAGENICITY OF ANO AT THE HPRT LOCUS IN HUMAN TK6 LYMPHOBLASTS Treatment

None

Exposure 6-TGr mutant Relativepercent concen- fraction(xl06) survival a tration (#M X2 h) -

4.2

Ethyl methanesulfonate 200

41

2-Cyanoethylene oxide 150

49 + 7 b

100 100 20

These results are from a parallel exposure that was used to isolate mutants for sequence analysis. a Relative percent survival was estimated by extrapolating the exponential portion of the growth curves back to the treatment time (DeLuca et al., 1983). b Duplicate determination ( _+SD).

A in the A U G codon. Base numbers 5' to the A U G codon are negative.

Results

Mutagenicity of ANO Treatment of TK6 cells with 150 /~M A N O x 2 h (Table 2) reduced the cellular survival to 20% of the untreated controls and induced an approximate 10-fold increase in the hprt mutant fraction. This response is similar to what we reported at the thymidine kinase locus (Recio and Skopek, 1988). The magnitude of the observed increase above the spontaneous background indicates that approximately 10% of the mutants analyzed could be spontaneous in origin.

Point mutations in hprt cDNA The wild-type hprt c D N A sequence from TK6 is identical to the published hprt c D N A sequence (Jolly et al., 1983). The entire c D N A sequence of each mutant was examined for sequence alterations. Each independent mutant clone analyzed (with the exception of mutant No. 51; see below) contained a single alteration in the hprt c D N A sequence. Base substitutions in the hprt c D N A coding region occurred in 19/39 of the hprt mutant c D N A sequences analyzed. Substitutions occurred

with approximately equal frequency at G C and AT base pairs and consisted of both transitions and tranversions. More mutations occurred at the 3' end of hprt than at the 5' end; 8 / 1 9 missense mutations (5 at G C and 3 at AT base pairs) occurred in exon 8 (Table 3). 11 base-substitution mutations at AT base pairs were observed. Most of these mutations occurred in AT-rich sequences with 9/11 occurring in the same orientation in the gene; that is, the A undergoing mutation was present in the coding strand. Most of the AT substitutions mutations (8/11) were missense mutations although three resulted in nonsense codons. Four of the missense mutations occurred at two sites [two at base 215 (A G; A ~ C) and two at base 533 (both T ~ G)]. An identical mutation observed in this collection (A G, base 215) has been observed previously in a spontaneous collection. Three nonsense mutations (two ochre and one amber) resulted from the same base change (A ~ T) at three different lysine codons (AAA). Base substitutions at GC base pairs were observed in 8 / 1 9 mutants. The majority occurred at sequences containing two or more consecutive guanines. A strand bias was also seen for these mutations at GC base pairs; all of the guanines undergoing change were located in the coding strand. The two - 1 frameshift mutations observed also involved G C base pairs with one of the changes located in a run of 6 guanine bases.

Mutants with deletions of hprt cDNA Approximately one-half (19/39) of the mutants analyzed had deletions in the hprt c D N A sequence (Table 4). 14 of 19 deletions corresponded to single exon sequences. One mutant (3A1) had a deletion in the hprt c D N A that corresponded to exons 3-6. Part of the sequence data from mutant 51 (Table 4) yielded a mixed sequence at the region corresponding to exon 8. Careful examination of this sequence data suggested that the D N A was prepared from a mixture of M13mpl9 plaques (some with exon 8 and some without). Reprobing of the plaques with an exon 8 specific oligomer confirmed that 74% (57/78) of the plaques isolated from the cloning of the c D N A PCR product from this mutant did not hybridize to exon 8.

201 TABLE 3 TK6 LYMPHOBLAST HPRT MUTANTS WITH POINT MUTATIONS IN HPRT cDNA Exon

Mutant

Sequence Alteration

Pos. #

Predicted Amino Acid Change

Target Sequence

33B1

A "~ T

109

lie -~ phe

-I-I-r

CCT

2

64

A -* T

205

lys -~ term

CTC A._AG GGG

3

25B2

A ÷G

215

tyr -~ cys

GGC TA._T AAA

3

14A2

A-*C

215

tyr-*ser

GGC TA._T AAA

3

8A1

A -* T

343

lys -* term

ATA

AAA GTA

4

61

A -* T

421

lys ÷ term

GGC AAA ACA

6

27A2

A -~ G

496

lys -* glu

GTG AAA AGG

7

72

T -~ C

533

phe -* tyr

GAC ~

G'IF

8

66

T -~ C

533

phe -* tyr

GAC ~

G'IF

8

51"

A-~T

590

glu-*val

AAT

GAA TAC

8

74

A -~ T

611

his -* leu

AAT

CA._T GTI"

9

32B2

G -~ T

135

arg -* ser

GAC AGG ACT

3

87

G -~ C

197

cys -* ser

CTC TG._T GTG

3

90

G -* A

355

gly -~ arg

GGT GGA GAT

6

95

G -~ C

538

gly -* arg

G3-1" GGA -FN"

8

77

G -* C

569

gly -* ala

GTA GG._A TAT

8

4A1

G -* A

599

arg -~ lys

"I-I'C

AGG GAT

8

21B1

G-*A

601

asp-~ asn

AGG G_AT "I-FG

8

6A2

G -* A

601

asp -~ asn

AGG G_AT TTG

8

A]-I"

65

-G

207-212

AAGGGGGGCT

3

101

-C

368

CTC TCA ACT

4

* This is the mutation found in the hprt cDNA from plaques that were positive for exon 8 from mutant 51 in Table 2.

T h o s e p l a q u e s t h a t h y b r i d i z e d to exon 8 were r e p o o l e d a n d sequenced. A p o i n t m u t a t i o n (A---, T; T a b l e 3) in exon 8 was observed. These observations f r o m this p a r t i c u l a r m u t a n t suggest t h a t this m u t a n t p o p u l a t i o n m a y have been a m i x t u r e of two m u t a n t clones; o n e with the i n d i c a t e d p o i n t m u t a t i o n a n d one with the d e l e t i o n of exon 8. H o w e v e r , r e c l o n i n g of this m u t a n t at 0.3 c e l l s / w e l l a n d S o u t h e r n b l o t analysis of P C R

a m p l i f i e d hprt c D N A revealed the presence of exon 8 in 10 i n d e p e n d e n t isolates i n d i c a t i n g that this was a single m u t a n t p r o d u c i n g a m i x t u r e ( + exon 8) of hprt m R N A . 3 m u t a n t s d i s p l a y e d d e l e t i o n s in their hprt c D N A that d i d n o t c o r r e s p o n d to entire exons. T h e terminus of the d e l e t i o n in two m u t a n t s occ u r r e d at the s a m e n u c l e o t i d e in e x o n 9 ( b a s e 626). I n one o f these m u t a n t s (13A1), the d e l e t i o n in-

202 TABLE 4 TK6 LYMPHOBLAST HPRT MUTANTS W I T H DELETIONS IN HPRT cDNA Mutants

Deleted (A) cDNA sequences

Exon(s) affected

94 92 3A1 a

Z128-31 A234-417 Z1234-582

exon 2 exon 3 loss exon 3-6 loss

22A1 30B2 b 103

A418-483 A418-483 A418-483

exon 4 loss exon 4 loss exon 4 loss

99 59 102

A418-483 A484-501 A484-501

exon 4 loss exon 5 loss exon 5 loss

13A1 llA2 b 98

A484-725 A502-584 A502-584

exon 5-partial exon 9 exon 6 loss exon 6 loss

2B2 b 86 70

za585-632 A585-632 A585-632

exon 7 loss exon 7 loss exon 7 loss

58 19A1 b 51 * 28A2 b

A632-725 A632-708 + A632-707 A709-725

exon 7 and 8 loss exon 8 loss + exon 8 loss Partial exon 9 loss

* The point mutation found in the hprt plaques positive for exon 8 is indicated in Table 1. a This mutant had a partial deletion of hprt revealed by Southern blot analysis (see Fig. 1). b These mutants did not have alterations of hprt detectable by Southern blot analysis (see Fig. 1).

cluded exons 5 - 8 plus 17 bases of exon 9 (a deletion of bases 385-626), while in the other mutant (28A2) 17 bases of exon 9 (bases 610-626) were deleted. These data suggest that the c D N A deletion observed in mutant 13A1 was due to a mutation that resulted in the aberrant splicing of exon 4 to a cryptic splice site in exon 9, while the deletion of hprt c D N A sequence observed in mutant 28A2 was due to a mutation resulting in the aberrant splicing of exon 8 to the same cryptic splice site in exon 9. A third mutant displayed a five base deletion (bases 28-32) at the 5' end of exon 2.

Genomic DNA analysis of mutants with deletions in the hprt cDNA sequence The precise loss of sequence corresponding to specific exons in the hprt c D N A suggests that

these were the result of mutations that affected the splicing of hprt m R N A . To begin to understand the mechanisms of exon loss from hprt cDNA, the genomic D N A from some of the mutants was isolated (Table 3) and examined by Southern blot analysis for structural alterations of the hprt gene. Initially, Southern analysis of hprt was done using a full length hprt c D N A probe. All the mutants examined that had single exon loss in their c D N A had a genomic hprt hybridization pattern similar to that of wild-type TK6 cells (Fig. 1). The hybridization pattern for mutant 3A1, which was missing exons 3 - 6 in its hprt cDNA, revealed a partial genomic deletion of the hprt gene involving a fragment that contained exons 3-6. Since Southern blot analysis can generally resolve relatively large losses of D N A , small deletions involving specific exons might go undetected. Therefore, regions of genomic hprt corresponding to the missing single exon sequences in 4 mutants were PCR amplified and analyzed by Southern blot using exon-specific primers for amplification and exon-specific probes (Figs. 2, 3). A mutant missing exon 6 (llA2), one missing exon 7 (2B2), one missing exon 8 (19A1) and a mutant missing the first 17 bases of exon 9 (28A2) were analyzed. The appropriate exon regions were amplified using a specific set of oligomers (Table 1). The

1 2 3 45

6 78

9

17.0 7.1 kb--, 5.0 3.4 Fig. 1. Southern blot analysis of total genomic DNA from mutants with single and multiple loss of exons in hprt eDNA. The nitrocellulose filter was probed with a full length hprt c D N A probe (Jolly et al., 1983). Lanes 1 and 2, hprt-total deletion mutants; lane 3, TK6 wild-type; lanes 4-9, mutants 19A1, 30B2, 3A1, 28A2, 2B2, llA2. The mutant in lane 6 (3A1) that had a loss of exons 3-6 in hprt cDNA has lost a 7.1-kb fragment of the genomic hprt DNA sequence.

203

1

23

456

gels, t r a n s f e r r e d to n y l o n m e m b r a n e s , a n d each m e m b r a n e was p r o b e d with either a n exon 6-, 7-, 8-, o r 9-specific p r o b e s e n d - l a b e l l e d with 32p. In all cases, the exon-specific p r o b e s h y b r i d i z e d to a P C R p r o d u c t of the a p p r o p r i a t e size: 0.3-kb fragm e n t for exon 7 or 8 (Figs. 2 a n d 3); 1.9-kb f r a g m e n t for exon 9 (Fig. 3); a n d 0.13-kb for exon 6 ( d a t a n o t shown). This p r o v i d e d a d d i t i o n a l p r o o f that the sequence i n f o r m a t i o n missing f r o m hprt e D N A was still p r e s e n t in g e n o m i c D N A .

0.56 k b * 0.30 kb-*

Fig. 2. Southern blot analysis of PCR-amplified exons from the genomic DNA of a mutant with a deletion of exon 7 in hprt eDNA (Mutant 2B2; Table 2). The nylon filter was probed with exon 7-specific probe (Table 1). Lane 1, X HindIII size standard; lane 2, hprt-total deletion mutant S10B; lane 3, wild-type TK6; lane 4, exon 7 PCR amplimers; lanes 5 and 6, hprt-mutants 2B2 (exon 7 loss in hprt cDNA; 0.3-kb genomic DNA PCR fragment) and 19A1, respectively. The exon not present in the hprt cDNA is present in the genomic hprt DNA.

e x o n 7 a n d 8 regions o f hprt were a m p l i f i e d t o g e t h e r using a single set o f o l i g o m e r s ( T a b l e 1) a n d d i v i d e d into two aliquots for S o u t h e r n a n a l y sis. T h e P C R a m p l i f i e d D N A was run o n agarose 1

2.0 kb..*

234

,-1.7 kb

0.56 kb.-* 0.30 k b.-,.

Fig. 3. Southern blot analysis of PCR-amplified exons from the genomic DNA of two mutants, one with a deletion of exon 8 and one with a 17-base deletion of exon 9 in hprt cDNA (Mutant 19A1 and 28A2; Table 2). The nylon filter was cut into two pieces and hybridized with either exon 8- or exon 9-specific probe. Lane 1, A HindIII size standard; lane 2, hprt-total deletion mutant S10B; lane 3, wild-type TK6; lane 4, exon 8 PCR amplimers; lanes 5 and 6, hprt-mutants 2B2 and 19A1 (exon 8 loss in hprt cDNA; 0.3-kb genomic DNA PCR fragmen0; Exon 9 analysis; lane 7, hprt-total deletion mutant S10B; lane 8, wild-type TK6; lane 9, exon 9 PeR amplimers; lane 10, mutant 28A2 (exon 9 loss in hprt cDNA; 1.7-kb genomic DNA PCR fragment). The exon and the fragment of DNA not present in the hprt cDNA is present in the genomic hprt DNA.

DNA sequence analysis of PCR amplified hprt gene products The hprt P C R a m p l i f i c a t i o n p r o d u c t s of the a p p r o p r i a t e regions in m u t a n t s 19A1 (exon 7 / i n t r o n 7 / e x o n 8), 28A2 (exon 8 / i n t r o n 8 / e x o n 9), 11A2 ( i n t r o n 5 / e x o n 6), a n d w i l d - t y p e T K 6 cell c o n t r o l s were c l o n e d into M 1 3 m p 1 9 a n d seq u e n c e d using universal primer. M u t a n t 19A1 c o n t a i n e d a p o i n t m u t a t i o n (T---, A) in the splice a c c e p t o r site in i n t r o n 7 (Table 5). A t r a n s v e r s i o n at this p a r t i c u l a r site p r o d u c e s a sequence which d o e s n o t fit the splice a c c e p t o r consensus sequence (Patel et al., 1986). Similarly, m u t a n t 28A2 cont a i n e d a p o i n t m u t a t i o n ( A ---, G ) at the consensus splice a c c e p t o r site in i n t r o n 8 ( T a b l e 5). T h e P C R a m p l i f i e d hprt p r o d u c t f r o m m u t a n t 11A2 was also c l o n e d into M 1 3 m p 1 9 a n d seq u e n c e d ( d a t a n o t shown). N o m u t a t i o n was observed in the splice a c c e p t o r r e g i o n e x a m i n e d . Therefore, in this m u t a n t the loss o f exon 6 f r o m hprt c D N A was n o t d u e to a m u t a t i o n in the a c c e p t o r splice sequence a n d m a y result f r o m a m u t a t i o n in the splice d o n o r region ( n o t analyzed). A s u m m a r y of the hprt e D N A s e q u e n c i n g results o b t a i n e d in this s t u d y a r e p r e s e n t e d in T a b l e 6. The hprt e D N A was a n a l y z e d f r o m a t o t a l of 39 mutants.

Discussion

Point mutations in hprt cDNA A N O i n d u c e s m u t a t i o n s at b o t h A T a n d G C b a s e pairs. T h e m a j o r i t y of p o i n t m u t a t i o n s o b served at A T b a s e p a i r s in the hprt c o d i n g region were p r e s e n t in A T - r i c h regions. T w o a d d i t i o n a l A T m u t a t i o n s ( n o t i n c l u d e d in T a b l e 2) were o b s e r v e d in splice a c c e p t o r sites ( T a b l e 4); these sites were also A T - r i c h . 8 m u t a n t s resulted f r o m

204 TABLE 5 P O I N T M U T A T I O N S OBSERVED IN T H E A C C E P T E R SPLICE SEQUENCES IN G E N O M I C D N A IN T W O M U T A N T S T H A T HAVE D E L E T I O N S O F hprt c D N A : M U T A N T 19A1 (EXON 8 LOSS) A N D M U T A N T 28A2 (17 BASE D E L E T I O N O F E X O N 9)

Mutant 19A1 Intron 7

WT

Exon 8

GAI-rCTITrrTA~ I

I _TTG'I'rGGAI-I-I'G

P

19A1

GA'I-I'CTITI-r AA(~ I _TTGTI'GGATTTG

Concensus Splice Accepter Site

C TA(~ I G

M~t¢nt 28A2 Intron 8

WT

t Jllilll

Exon 9

IA TAG I CATGTI'rGTGTCATTAGTGAAA

I 28A2

~,~ll,lAT~l

(deleted in cDNA) CKrGTTrGTGTCATT4T~d~

cryptic splice

site

WT, wild-type sequence determined in P C R fragments cloned from genomic D N A of T K 6 cells.

missense mutation at GC base pairs. 7 of these missense mutations occurred at or adjacent to a 5'-GGA-Y sequence. The sequence 5 ' - G G (A or TABLE 6 A S U M M A R Y O F T H E S E Q U E N C I N G RESULTS F R O M ANO-INDUCED MUTANTS Point mutations G: C A :T -G -C

21/39 8/21 11/21 1/21 1/21

Deletions of hprt c D N A single exert deletions multiple exon loss small deletions

19/39 14/19 3/19 2/19

This s u m m a r y includes the point mutation and deletion of exon 8 in the hprt c D N A observed in the same mutant. a These deletions of hprt c D N A were likely due to mutations affecting hprt m R N A splicing.

T)-3' is a 'hot-spot' for alkylation mutagenesis in bacterial systems (Richardson et al., 1987). The apparent enhancement of mutagenesis at G G A sequences in this collection of mutants suggests that local D N A context is important for alkylation mutagenesis in human cells. Two frameshift mutations were seen involving G C bases. One of the mutations was a single base deletion ( - G ) which occurred in a run of 6 consecutive guanines. A mutation affecting this run of six Gs ( + G) has been observed in a Lesch Nyhan patient (Gibbs et al., 1989). The other single base deletion ( - C ) results in the conversion of a serine (TCA) to a nonsense ochre codon. An apparent strand bias was observed for point mutations at both G C and A T base pairs in that the purine base was usually located in the coding strand of the DNA. A strand preference for point mutations occurs at hprt in mammalian cells following UV mutagenesis (Vrieling et al., 1988) and

205 at gpt in E. coli following exposure to alkylating agents (Richardson et al., 1987). The strand preference for mutagenesis may be related to strand bias involved in D N A repair, differences in polymerase fidelity on leading versus lagging strand, or simply due to the relative number of mutable sites in coding strands. This strand bias, once understood, may be useful in elucidating whether purine or pyrimidine adducts are involved in mutagenesis, especially in treatment regimens which produce a large variety of different adducts. Treatment of T K 6 cells results in a collection of hprt mutants with an equal distribution of point mutations among A T and G C base pairs. This suggests that at least two promutagenic D N A adducts are formed in the genome of human cells exposed to this metabolite of ACN. At present, an ANO-induced D N A adduct that occurs in rodents treated with A C N or T K 6 ceils treated with A N O has not been identified. 18 different point mutations sites (base substitution and frameshift) were observed in hprt cDNA. Three identical sites of mutation (two observations at each site) were observed. One site (base No. 215) was altered in two mutants although different substitutions were present. The low frequency of multiple sampling of the same mutagenic events suggests that the actual number of sites mutable by A N O is greater than the 18 sites observed. However, the fact that some multiple sampling has occurred (3/18) suggests that the number is probably not greater than three times the present number of observed sites.

Mutants with deletions of hprt cDNA A p p r o x i m a t e l y one-half of the m u t a n t s analyzed had deletions of hprt c D N A sequences. The majority of these deletions involved sequences that corresponded precisely to single or multiple exons. 14 of the deletions in the c D N A involved the loss of single exons with no apparent preference for a particular exon. The loss of exon 7 in the hprt c D N A observed in 3 mutants from this collection was also observed in a spontaneous hprt mutant, although the present data cannot reveal whether these are due to the same genetic event. In two mutants the deletion of the hprt c D N A sequence terminated at the same site (base No. 626) within exon 9; in one mutant the deletion

extended from the beginning of exon 5 (base No. 385) through base No. 626 and in the other mutant the deletion extended from the beginning of exon 9 (base No. 610) through base No. 626. This latter c D N A alteration was observed in a L e s c h - N y h a n derived lymphoblast (Gibbs et al., 1989). Another mutant was missing the first 5 bases of exon 2. This same cDNA alteration was also observed by our group in an in vivo-derived hprt T-cell mutant clone (unpublished observation). Analysis of a pooled plaque population from mutant 51 revealed a mixed sequence involving the exon 8 region (Tables 3 and 4). We determined that this mixed sequence resulted from a mixture of two types of M 1 3 m p l 9 plaques derived from this mutant, some containing hprt c D N A with exon 8 and some containing hprt c D N A without exon 8. A base substitution in exon 8 was observed in the pooled plaques possessing exon 8. Recloning of this mutant indicated that the sequence observed was due to a single mutant clone that produced a mixture of hprt m R N A s ( + exon 8). We have also observed this ' + exon 8' phenotype in two in vivo-derived hprt T-cell mutants (Recio et al., 1990). These data suggest that mutations can occur in hprt that produce inefficient splicing of exon 8, resulting in a mixture of hprt transcripts. A similar phenomenon has been observed by others in a dhfr mutant (Mitchell et al., 1986). This mutant is a dhfr ÷ second-site revertant of a dhfr mutant that displayed exon 5 loss in dhfr cDNA. Approximately 25% of the dhfr transcripts from this mutant were spliced correctly while 75% displayed the original loss of exon 5. The mutation resulting in this phenotype was located at the first base of exon 5. Southern analysis of the genomic D N A of six mutants with single exon skipping showed no structural alteration of hprt, suggesting that the exons missing in the hprt c D N A were present in the genomic hprt sequence. Furthermore, the single exons missing in 4 mutants were successfully P C R amplified from the genomic D N A , confirming their presence. The loss of multiple exons (exon 3-6) in the hprt c D N A from one mutant was due to a partial deletion of the genomic hprt sequence, A fragment that contained the region corresponding to the exons absent in the hprt c D N A was

206

absent in the genomic hprt sequence. These results suggest that ANO does not readily cause large deletions of hprt, an observation which has been previously made at the thymidine kinase locus in the same TK6 cell line (Recio and Skopek, 1988). The splice acceptor sites associated with a missing exon in one mutant and a 17-base deletion in another mutant were PCR amplified from genomic D N A and sequenced. A mutation in the splice acceptor sites that removed them from the consensus sequence was observed in each mutant. The genomic DNA from other mutants with aberrant hprt m R N A splicing from this and other studies is being examined to determine the molecular basis for the observed splicing defects. These data indicate that the deletion of exon sequences from hprt cDNA can result from point mutations affecting the splicing of hprt mRNA. The preference for mutation at AT base pairs in AT-rich regions exhibited by ANO, and the fact that splice acceptor sites are AT rich, may explain the large fraction of mutants in this collection with splicing aberrations. Two of the mutants displaying aberrant splicing utilized a cryptic acceptor site within exon 9. The sequence of this cryptic site ( T A G / G ) is used as an acceptor site at the junction of intron 2 / e x o n 3. The utilization of this site, resulting in the deletion of the first 17 bases of exon 9, occurs in a Lesch-Nyhan patient (Gibbs et al., 1989, 1990). Splicing of h n R N A to mature mRNA involves the interactions of i n t r o n / e x o n splice site sequences, sequences within introns (lariat sequence), and ribonucleoproteins that ultimately results in the excision of introns and the joining of exons (reviewed in Padgett et al., 1986; Sharp, 1987). The splicing of mRNA represents a posttranscriptional level of gene expression that ultimately determines the amino acid sequence of the synthesized protein. Aberrant m R N A splicing is the molecular basis for certain cases of human genetic diseases (Collins and Weissman, 1984; Horowitz et al., 1989; Triesman et al., 1983; Tromp and Prockop, 1988; Weil et al., 1988). The aberrant splicing observed in these genetic diseases includes the types observed at hprt in this study, namely exon skipping and splicing at cryptic splice sites. Exon skipping due to a point mutation in the acceptor splice

consensus sequence of the proa2(I) collagen gene is a molecular basis for a lethal variant of the collagen-related disease osteogenesis imperfecta (Weil et al., 1988). Point mutations in the acceptor and donor splice consensus sequences resulting in exon skipping occur in the Rb-1 gene (Horowitz et al., 1989; Yandell et al., 1989). Inactivation of this tumor suppressor gene by this type of mutation and others (Yandell et al., 1989) is a critical determinant of retinoblastoma and osteosarcoma in humans. Therefore, D N A alterations that result in splicing defects are an important class of mutations that are involved in a number of human disease states. The contribution of mutation-induced aberrant mRNA splicing and the mechanisms involved need to be considered in the development of an understanding of mutagenesis in mammalian cells. It is also important to note that mutation-induced aberrant m R N A splicing cannot be studied by the use of surrogate bacterial or viral genes transformed into mammalian cells. We have observed exon skipping in hprt c D N A from a number of human TK6 cell mutants and in vivo-derived hprt T-cell mutants. Therefore, exon skipping and other splicing defects apparently are common mechanisms that can result in a hprt mutant phenotype in human cells. The large fraction of m R N A splicing defects among ANO-induced mutants suggest that splice site sequences may be particularly susceptible to ANO mutagenesis. Our group has studied another compound (formaldehyde) which did not produce a large fraction of splicing defects (Liber et al., 1988), suggesting that the mutagenic specificity of compound is an important determinant of the fraction of mutants with aberrant splicing.

Acknowledgements We thank Sadie Leak and Linda Smith for typing this manuscript.

References Badley, J.E., G.A. Bishop, T. St. John and J.A. Frelinger (1988) A simple, rapid method for the purification of poly A + RNA, Bioteclmiques, 6, 114-117. Bigger, C.A.H., J. Strandberg, H. Yagi, D.M. Jerina and A. Dipple (1989) Mutagenic specificity of a potent carcinogen, benzo[c]phenanthrene (4R,3S)-dihydrodiol (2S,1R)-epox-

207 ide, which reacts with adenine and guanine in DNA, Proc. Natl. Acad. SCi. (U.S.A.), 86, 2291-2295. Bigner, D.D., S.H., Bigner, P.C. Burger, J.D. Shelburne and H.S. Friedman (1986) Primary brain tumors in Fischer 344 rats chronically exposed to acrylonitrile in their drinking water, Fd. Chem. Toxieol., 24, 129-137. Breitbart, R.E., A. Andreadis and B. Nadal-Ginard (1987) Alternative splicing: A ubiquitous mechanism for the generation of multiple protein isoforms from single genes, Annu. Rex,. Biochem., 56, 467-495. Collins, F.S., and S.M. Weissman (1984) The molecular genetics of human hemoglobin, Proc. Nucleic Acid Res. Mol. Biol., 31, 317-462. Crespi, C.L., C.G. Ryan, G.M. Seixas, T.R. Tuner and B.W. Penman (1985) Tests for mutagenic activity using mutation assays at two loci in the human lymphoblast cell lines TK6 and AHH-1, in: J. Ashby, F.J. de Serres, M. Draper, M. Ishidate, B.H. Margolin, B.E. Matter and M.D. Shelby (Eds.), Evaluation of Short-term Test for Carcinogens, Report of the International Programme on Chemical Safety, Collaborative Study on In Vitro Assay, Progress in Mutation Research, Vol. 5. Elsevier, Amsterdam, pp. 497-516. DeJong, P.J., A.J. Grosovsky and B.W. Glickman (1988) Spectrum of spontaneous mutation at the APRT locus of Chinese hamster ovary cells: An analysis at the DNA sequence level, Proc. Natl. Acad. Sci. (U.S.A.), 85, 3499-3503. DeLuca, J.G., L. Weinstein and W.G. Thilly (1983) Ultraviolet light-induced mutations in human lymphoblasts, Mutation Res., 107, 347-370. Deizell, E., and R.R. Monson (1982) Mortality among rubber workers: VI. Men with exposure to acrylonitrile, J. Occup. Med., 24, 767-769. Drobetsky, E.A., A.J. Grosovsky and B.W. Glickman (1987) The specificity of UV-induced mutations at an endogenous locus in mammalian cells, Proc. Natl. Acad. Sci. (U.S.A.), 84, 9103-9107. Gibbs, R.A., P.-N. Nguyen, L.J. McBride, S.M. Koepf and C.T. Caskey (1989) Identification of mutations leading to Lesch-Nyhan syndrome by automated direct DNA sequencing of in vitro amplified eDNA, Proc. Natl. Acad. Sci. (U.S.A.), 86, 1919-1923. Gibbs, R.A., P.-N. Nguyen, A. Edwards, A.B. Civitello and C.T. Caskey (1990) Multiplex DNA deletion detection and exon sequencing of the hypoxanthine phosphoribosyltransferase gene in Lesch-Nyhan families, Genomics, 7, 235-244. Guengerich, F.P., L.E. Geiger, L.L. Hogy and P.L. Wright (1981) In vitro metabolism of acrylonitrile to cyanoethylene oxide, reaction with glutathione, and irreversible binding to proteins and nucleic acids, Cancer Res., 41, 4925-4933. Horowitz, J.M., D.W. Yandell, S.-G. Park, S. Canning, P. Whyte, K. Buchkovieh, E. Harlow, R.A. Weinburg and T.P. Dryja (1988) Point mutational inactivation of the retinoblastoma antioncogene, Science, 243, 937-940. International Agency for Research on Cancer (IARC) (1987) IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, Suppl. 7, Overall Evaluations of Carcinogenic-

ity: An Updating of IARC Monographs Vols. 1-42. Lyon, France. Jolly, D.J., H. Okayama, P. Berg, A.C. Esty, D. Filpula, P. Bohlen, G.G. Johnson, J.E. Shively, T. Hunkapillar and T. Friedman (1983) Isolation and characterization of a fulllength expressible eDNA for human hypoxanthine phosphoribosyltransferase, Proc. Natl. Acad. Sci. (U.S.A.), 80, 477-481. Koerselman, W., and M. van der Graaf (1984) Acrylonitrile: a suspected human carcinogen, Int. Arch. Occup. Environ. Hlth., 54, 317-324. Liber, H.L., and W.G. Thilly (1982) Mutation assay at the thymidine kinase locus in diploid human lymphoblasts, Mutation Res., 94, 467-485. Liber, H., K.M. Call and J.B. Little (1987) Molecular and biochemical analyses of spontaneous and X-ray-induced mutants in human lymphoblastoid cells, Mutation Res., 178, 143-153. Liber, H.L., K. Benfardo, R.M. Crosby, D. Simpson and T.R. Skopek (1989) Formaldehyde-induced and spontaneous alterations in human hprt DNA sequence and mRNA expression, Mutation Res., 226, 31-37. Mahoni, C., A. Ciliberti, G. Cotti and G. Perino (1987) Experimental research on acrylonitrile carcinogenesis, in: C. Maltoni and M.A. Mehlman (Eds.), Archives of Research on Industrial Carcinogenesis, Vol. VI, Princeton Scientific Publishing Co., Princeton. Maniatis, T., E.F. Fritsch and J. Sambrook (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, New York. Mazur, M., and B.W. Glickman (1988) Sequence specificity of mutations induced by benzo[ a ]pyrene-7,8-diol-9,10-epoxide at endogenous hprt gene in CHO cells, Somat. Cell Mol. Genet., 14, 393-400. Mitchell, P.J., G. Urlaub and L. Chasin (1986) Spontaneous splicing mutations at the dihydrofolate reductase locus in Chinese hamster ovary cells, Mol. Cell Biol., 6, 1926-1935. Occupational Safety and Health Administration (1978) Occupational exposure to acrylonitrile (vinyl cyanide), Proposed standard and notice of hearing, Fed. Reg. 43, 2586; Final standard ibid., 43, 45762. Padgett, R.A., P.J. Grabowski, M.M. Konarska, S. Seiler and P.A. Sharp (1986) Splicing of messenger RNA precursors, Annu. Rev. Biochem., 55, 1119-1150. Patel, P.I., P.E. Framson, C.T. Caskey and A.C. Chinault (1986) Fine structure of the human hypoxanthine phosphoribosyltransferase gene, Mol. Cell. Biol., 6, 393-403. Recio, L., and T.R. Skopek (1988) Mutagenicity of acrylonitrile and its metabolite 2-cyanoethylene oxide in human lymphoblasts in vitro, Mutation Res., 206, 297-305. Recio, L., J. Cochrane, D. Simpson, T.R. Skopek, J.P. O'Neill, J.P. Nicklas and R.J. Albertirti (1990) DNA sequence analysis of in vivo hprt mutation in human T-lymphocytes, Mutagenesis, in press. Richardson, K.K., F.C. Richardson, R.M. Crosby, J.A. Swenberg and T.R. Skopek (1987) DNA base changes and alkylation following in vivo exposure of Escherichia coil to

208 N-methyl-N-nitrosourea or N-ethyl-N-nitrosourea, Proc. Natl. Acad. Sci. (U.S.A.), 84, 344-348. Saiki, R.K., D.N. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis and H.A. Erlich (1988) Primer-detected enzymatic amplification of DNA with a thermostable DNA polymerase, Science, 239, 487-491. Sharp, P.A. (1987)" Splicing of messenger RNA precursors, Science, 235, 766-771. Simpson, D., R.M. Crosby and T.R. Skopek (1988) A method for specific cloning and sequencing of human HPRT cDNA for mutation analysis, Biochem. Biophys. Res. Commun., 151, 487-492. Skopek, T.R., H.L. Liber, B.W. Penman and W.G. Thilly (1978) Isolation of a human lymphoblastoid line heterozygous at the thymidine kinase locus: possibility for a rapid human cell mutation assay, Biochem. Biophys. Res. Commun., 84, 411-416. Southern, E. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis, J. Mol. Biol., 98, 503-517. Strother, D.E., R.W. Mast, R.C. Kraska and V. Frankos (1989) Acrylonitrile as a carcinogen: research needs for better risk assessment, Ann. NY Acad. Sci., 534, 169-178. Triesman, R., S.H. Orkin and T. Maniatis (1983) Specific transcription and RNA splicing defects in five cloned flthalasemia genes, Nature (London), 302, 591-596.

Tromp, G., and D.J. Prockop (1988) Single base mutation in the proa2(I) collagen gene that causes efficient splicing of RNA from exon 27 to exon 29 and synthesis of a shortened but inframe proa2(I) chain, Proc. Natl. Acad. Sci. (U.S.A.), 85, 5254-5258. Vrieling, H.M., M.J. Nierecker, J.W.I.M. Simons and A.A. Van Zeeland (1988) Molecular analysis of mutations induced by N-ethyl-N-nitrosourea at the HPRT locus in mouse lymphoma cells, Mutation Res., 198, 99-106. Vrieling, H., M.L. Van Rooijen, N.A. Groen, M.Z. Zdzienicka, J.W.I.M. Simons, P.H.M. Lohman and A.A. van Zeeland (1989) DNA strand specificity for UV-induced mutations in mammalian cells, Mol. Cell. Biol., 9, 1277-1283. Well, D., M. Bernard, N. Combates, M.K. Wirtz, D.W. Hollister, B. Steinmann and F. Ramirez (1988) Identification of a mutation that causes exon skipping during collagen premRNA splicing in an Ehlers-Danlas syndrome variant, J. Biol. Chem., 263, 8561-8564. Yandell, D.W., and J.B. Little (1986) Chromosome 14 marker appearance in a human B lymphoblastoid cell line of nonmalignant origin, Cancer Genet. Cytogenet., 20, 231-239. Yandell, D.W., J.A. Campbell, S.H. Dayton, R. Peterson, D. Walton, J.B. Little, A. McConkie-Rosell, E.G. Buckley and T.P. Dryja (1989) Oncogenic point mutations in the human retinoblastoma gene: their application to genetic counseling, N. Engl. J. Meal., 321, 1689-1695.