J. Mol. Biol. (1992) 224. 87-102

Molecular

Analysis of the Bacillus subtilis Bacteriophage Region Encompassing Genes I to 6

SPPl

The Products of Gene 1 and Gene 2 are Required for pat Cleavage Sunghee Chai, Alicia Bravo?, Gerhild Liider, Alexandra Nedlin, Thomas A. Trautner and Juan C. AlonsoS Max-Plan&-Institut

fiir molekulare Genetik, Ihnestrasse D-1000 Berlin 33, Germany

73

(Received 6 June 1991: accepted 73 November 1991) Packaging of Bacillus subtilis phage SPPl DNA into viral capsids is initiated at a specific DNA site termed pat. Using an in viva assay for pat cleavage, we show that initiation of DNA synthesis and DNA packaging are uncoupled. When the DNA products of yac cleavage were analyzed, we could detect the pat end that was destined to be packaged, but we failed to detect the other end of the cleavage reaction. SPPI conditional lethal mutants, which map adjacent to pat, were analyzed with our assay. This revealed that the products of gene 7 and gene 2 are essential for pat cleavage. SPPl mutants that are affected in the genes necessary for viral capsid formation (gene 41) or involved in headful cleavage (gene 6) remain proficient in pat site cleavage. Analysis of the nucleotide sequence (2.769 x lo3 base-pairs) of the region of the genes required for pat cleavage revealed five presumptive genes. We have assigned gene 1 and gene 2 to two of these open reading frames (orf), giving the gene order gene l-gene 2-orf 3-orf 4-orf 5. The direction of transcription of t,he gene 1 to orf 5 operon and the length of the mRNAs was determined. We have identified, upstream from gene I, the major transcriptional start point (Pi). Transcription originating from P, requires a phageencoded factor for activity. The organization of gene 1 and gene 2 of SPPl resembles the organization of genes in the paclcos region of different Escherichia coli double-stranded DNA phages. We propose that the conserved gene organization is representative of the packaging machinery of a primordial packaging system. Keywords:

B. subtilis

phages;

SPPl;

pat site; DNA

1. Introduction

t Present address: Cent’ro de Biologia Molecular, C’niversidad Autonoma de Madrid, Madrid, Spain. 1 Author to whom correspondence should be addressed.

0 Abbreviations used: kb, lo3 base-pairs; bp, base-pair; cl. conditional lethal; p.f.u., plaque-forming units; orf, open reading frame; gpX, gen product of cistron X; RBS. ribosomal binding site. 87 16 $03.00/0

terminase

Tavares et al., unpublished results). The processive headful packaging model, originally proposed for phage T4 by Streisinger et al. (1967) and refined for phage P22 by Tye et al. (1974) can explain the generation of such a population of SPPl DNA molecules. In an analysis of host or viral packaged DNA, the following facts about SPPl packaging emerged: (1) initiation of SPPl packaging occurs at a, unique site, termed nac. which is located within the 8.0 kb EcoRI restriction fragment 1 of SPPl DNA: (2) an 83 bp segment’ containing pat is sufficient to direct phage-specific DNA encapsidation; (3) the pat site provides a recognition site for initiation of DNA packaging; (4) cleavage at pat generates a 3’ protruding terminus, and such cuts show a heterogeneity of five to seven nucleotides; (5) the pat site is used only once per packaging series: (6) the size of

The BaciEEus subtilis bacteriophage SPPl is a prototype of a number of virulent phages collectively referred to as group 5 (Hemphill & Whitely, 1975). SPPl has a genome of 459 kbg. The mature SPPl DNA is terminally redundant (about 4 %) and partially circularly permuted (Morelli et al.. 1978; P.

0022-2836/92/050087

packaging;

c 1992 Acatiemic Press I,imit,ed

,Y. ('hi

X8

rt

al.

___-

f~~nc~atrrner f’rom which packaging CJ(YTII'S is t hreta to five headfuls. and (7) the headful cut terminatjing pavkaginp is imprecise (Morelli rt nZ., 197X: Humphreys $ Trautner, 1981; ljeichelbohrer e:t (11.. 1982: Bravo of nl.. 1990: Bravo & Alonso. 1990). Herv. we present an in rGo assay t,o analyze the pat cleavage reaction of phage SPPl Phagr-encoded products that are needed for the par cleavage reartion were analyzed with the help of SPPI con& tional lethal (cl) mutants. The region in whic%h thosr genes map has hern cloned and sequenced. WC have compared t,hr gcnomic organization and the I)rrdic+rd protjrin srquences of the first two genes of t lw operon. wi-ith the packaging rrgions and ~jroduc+s of other hart,eriophages. the

2. Materials

and Methods

I{. subtilis YN#ti (su~J~). HA101 13 (SUP-~) and SB1207 (SU~J-3) strains have been described (Yasbin ut al., 1980; Behrens et al., 1979: Viret & Alonso, 1987a,b). hkhurichia coli strains were JM 103 and BL21 IJE3. Strain ,JM103 was used for propagating plasmids and phagr M 13 growth (Yanisch-Perron et al.. 1985). Strain 1~121 DE3 was used in protein labeling studies (Studier & Moffat~t. 1986). I’lasmids pHP13 (Hairna et 111.. 1987) and pT712 ((iI IU”O-KRT,. Brrlin) were used as cloning vehicles. I’lasmids pI948. IJB(Z Id, pRC;i!J and pBT36 have been described (Deichelbohrer ef al.. 1985; Alonso of al.. 19%: Hra\-o c~fnl., 1990). Plasmid pLysE was used to titrat’e TS RNA polvtnrrasr as described (Moffatt 8: Studier. 1987). l~avteriophage SPI’l wik-type and the cl mutants wrrr from our phage collrction (Rrhrens rt al.. 1979). Bacterio~~hape M 13mp18 and mpl9 (Yanisvh-Perron rt al., 1985) were usrd for thr c+orlstruc+on of sequencing templates. phagr stocks were propagated routineI>, in IZ. subtilis YB886, SB1207 or HBIOlB. 411 phage manipulat~tons followed the standard procedures described for SPPl bv Brhrens et al. (1979). Phage stocks gave titers of 1.0 x 10’) to 5.0 x 10’0 p.f.u./ml when plat.rd undrr prrmissirc~ c,ondit,ions. Reversion frequrnc+s of ~1 mutant’s wvre not higher than IO- 5. Tf not stated otherwise the temprrat,ure used to grow thr phages was 37°C’. E. roli phage sto(aks were propagated as described (Sambrook e/ ol.. 1989).

Bacteria were grown and maintained on TY (Bis,wal rl ~1.. 1967), unless otherwise stated. Dilutions and resuspensions were done in TBT (Biswal et al., 1967). K. su6tilis competent cells were prepared as described by Rott,lGnder & Trautner (1970) and E. coli competent cells as described by Sambrook et ul. (1989). R. subtilis transformants were selrcted on agar medium containing 100 ng phleomycin: ml, 5 peg neomycin or chloramphenicol/ml. E. coli transformants were plated on agar medium containing 15 p’g rhloramphenicol/ml and 50 pg erythromycin/ml or 50 pg ampicillin/ml. Transfection procedures followed protocols described by Trautner & Spatz (1973) and Sambrook it al. (1989), for R. su6tiZi.s and IC. coli. respectively.

Plasmids were purified as described (Birnboim 8r Daly. 1979; Alonso & Trautner.1985). Phage lysates were concentrated by centrifugation and subsequently purified

by sedimentation through a pr~~formc~tl ( ‘s( ‘I strl) gradicvri as described (Trantnrr Pr Spatz. l!f73). liac,tt~ricJl,ll;t~c, SPl’l 1)X,1. was prvparrd 1)~ vxtravtion with ~~hf~ttol tollowetl t)p extertsivr dialysis against TE I~utGr (5 ntv Tris. HC’I (pH 7.5), 0.1 rn~-EDTA). Single-stranded c~losc~l circular Ml3mp18 and 31 lBmp19 I)iV.\s \vvrc’ l)urifircl iih described h,v Sarnbrook et al. (1989). Restric.tion c~ndonuvleasr~s and l)PI;.4-rrrotlif~~if~g .4nsl> enzymes wet-v used as specified by their suppliers. tical and prf’parativtl gel rlt~c~trolJhort~se:Y of plasmid ljS.4~ and restriction fragments wrre varrird out in 0.X”,, (K/v) agarose,Tris-acetate-EI)TAiethidium bromidr horizontal slab gels. Nick-translated pUTIli3. 1~lS’l’42 ot’ plYI’M I)S.\ FV;LS prepared hy using a nic*k-translation kit (Il-XaS3 (1 : I) to stop thr phagcs infrc-tire cycle. (‘hilled. phagr-infec:t,ed cells wtarc‘ caentrifugrd and rrsuspendrd in I.5 ml of TKT buffer. I,vsozyme to 200 &ml w-as added and t,hr suspension was iroxen in solid C’O,/ethanol. The (~11s wt’rv warrnrd brirfl>. at 37 (’ and frozen t,wicr. SDS to I O. and Z;aA(. (J)H 5.2) was added to 0.1 M. after which an tlqual volumr of watrrsaturat,ed phenol (at room tetnpcraturv) was added. Extraction of thtb bactrrial Iysatr at 72°C (I,rorthardt, & Alonso. 1987) was followtvl by c*rntrifugat.ion (Herarus tninifuge. 6000 rrvsimin for 15rnin) and 3 furt,ht:r r+ extractions. The RNA was first precipitatvcl with I,i(‘l t,o 6 M final concentration (Heraeus minifuge. 6000 revs/min for 15 min) and the pellet was then precipitated with 2.5

SPPl

pat Cleanaqe

vol. ethanol in the presence of 03~-NaAc (pH 5.2). The precipitate was washed with 70% (v/v) ethanol, dissolved in water, and stored at -20°C. All the solutions were prepared with water treated with diethylpyrocarbonate. For mapping of 5’ ends of transcripts, primer extension analysis was performed as described by Sambrook et al. (1989). Tn short, a 50 pg sample of total RNA and about 1 pg of end-labeled oligonucleotide (a 2Lmer, co-ordinates 432 to 452, see Fig. 7(b)) were mixed. Then 3.5 units of reverse transcripta,se was added per sample. and incubation was at 42°C for 60 min. Afterwards the samples were treated with phenol. precipitated with ethanol and loaded onto a 6?(!:, (w/v) polyacrylamide-urea gel, DNA and RNA caoncentrations were determined using molar extinction coefficients of 2.3 x lo4 cm’/g and 20x IO4 CJJI*/~ at 260nm for RNA and double-stranded DNA, respectively.

(d) Preparation

and analysis of DNA

SPI’l-infected

from

cells

SPPI-infect,ed (*ells were prepared as described (Bravo et al.. 1990). At given times after infection, samples (3 ml) were removed and poured onto frozen TBT buffer (1 : 1) containing sodium azide to 10 mM. The SPPlinfected cells were concentrated by centrifugation (12,000g in a SS34 rotor for 10 min). Crude DNA lysates were obtained and processed as described (Viret & Alonso, 1981a,b). (P) in viva

pat cleavage assay

The pat cleavage assay is based on the measurement of the kinetics of generation of the non-molar par-end fragments during SPPI growth. Crude DNA lysatea obtained at various times of phage growth (see sectlon (d): above) were digested with the appropriate restriction enzyme, and the digests were electrophoresed overnight in 0%9& agarose. The DNA was transferred to a nylon membrane (GeneScreen, 8E,\) and anal-vzed by the Southern technique essentially as drscaribed by Sambrook et ccl. (1989). (f) Sorthrrn

blot hybridization

Northern blot, analysis was Jjerformed by fractionation of RNA samples (20 pg/lane) on 1.25 y0 agarose gels containing 2”;) (v/v) formaldehyde (Sambrook et al.. 1989), followed by transfer tfo nylon membrane filters (GeneScreen. Nu’E?r’). RNA size markers were purchased from GTHCO-HRI, (RNA ladder from 016 to 1.77 kb and 0.24 to 9.5 kb) and visualized on autoradiograms by using a nick-translat,ed plasmid DNA probe. RNA was fixed to the filter by baking at 80°C’ for 2 h. The filters were prehgbridized. hybridized and washed as described by Sambrook et al. (1989). The filters were blot dried and exJ)osed to a Kodax X-Omat film at -70°C. The relative amounts of RNA present in any particular band drt,e(ted by hybridization was quantitatively scaannrd with a laser densitometer (see section (c). above).

(g) (‘or~struction

of new

plasmids

The 2.6 kb RanI- HindITI DNA fragment (co-ordinates 94 to 2769, ser Fig. 5) from SPPl wild-type or different cl (SW or Is) mutants was cloned into SmaI-cleaved pHP13. This generated plasmids: pBT163 (wild-type), pBT162 (sus70). pHT165 (.5~sll4), pBT167 (~~~116). pBT176 (ausl 19). pRTl66 (sus19). pBTl75 (ts6M) and pBT174 (tsMl0). Plasmid ~1948 is a PC194 derivative that, contains SPPl DNA ranging from co-ordinate 157 to 2769 (see

89

Fig. 5; Alonso ef al., 1986). thus excluding the promoter(s) controlling t)he expression of the genes under investigation. From p1948. an XhoIJ-EcoRJ UN-4 fragment, containing SPPI DNA between co-ordinates 157 and 1044 was cloned into HnmHI-EcoRI-cleaved pr’cl X. generating plasmid pBT42. The plasmid constructions using the pT712 expression vecator are depicted in Fig. 8. The Xholl-EcoRI DNA fragment (co-ordinate 157 to 1044) from plasmid p1948 was (*loned into UamHI’EcoRT-cleaved pT712. generating plasmid pBT115. An EcoRT DNA segment containing Sf’f’l ~~70 DNA between co-ordinates 94 and 1044 was joined to EcoRI-cleaved pT712 (plasmid EcoRV fragment (co-ordinate 271 to pRTl58). The BsmI 2184) from plasmid p1948 was joined to HindIT-cleaved pTTl2 (plasmid pBTI48). The AhaII-EcoRV (co-ordinate 218 to 2184) from pBTl66 (SPPlsusl9 DNA) was joined to HiradIT-cleaved pT712 to generate plasmid pBT173. I’lasmid pBT130 wa.s constructed in 2 steps. First the XmaITTLHindII DNA segment of p1948 (co-ordinate 731 to 2595) was joined to HindII cleaved pT512. Srrond. thf, small EcoR\DNA subfragment (co-ordinate 2182 to 2481) was deleted in vitro. For the construction of pKT132. first the I~mTILHindITI DKA segment (co-ordinate 1668 to 2765) was joined to HindIT-cleaved pT712. In a 2nd step an internal EcoRV deletion (cao-ordinate 2184 to 2668) was introduced. pBT154 was caonst,ructetl by ,joining the &oRI-Hind11 segment, (co-ordinate 2036 t,o 259.5) to the HindII-cleaved pT712. pBTl.57. which derives from pBT1.54, lacks the small EcoRV DNA fragment (co-ordinat,e 2184 to 2481). For the construction of pBTI59 the .4hccIT Hind11 D?jA segment (co-ordinatr 2356 to 2595) was joined to Hin,dII-cleaved pT712. Plasmid pRT133 contains only the small HindWHi?~dTIJ DNi\ srgment, (co-ordinate 2595 to 2769). of labeled

(h) El~~ctrnphowsis

protrim

‘T’hr 6. cd; BJ,ll DE3[pT7 121 host-vector cloning system alIons the specific labelling of protein products encoded by penes under control of a T7 RNA polymerase promoter (Studier K: Moffatt. 1986). Since a minor residual synthesis of the TT RNA polymerase made thr T7 RSA polymerase was Jjlasmids highly unst)able, titrat,ed with plasmids pLsyS or pL,vsE. as described b> Moffatt bt St,udier (1987). To BL21DE3 cells carrying plasmids grown to AS60 = 5 m~I-isopro1)yl-B-n-thiominimal medium, @5 in galactopyranoside was added. After 15 min, 200 pg rifampicinlml was added and the cells were incuba,ted further for 90 min. Protein labeling and separation was performed esselltially as described (Alonso & Tailor. 1987: J,armmli. 1970). (i) (Yomputer

sequence

analysis

(‘omparison of primary protein structure, the investigation of D?U’A and RNA secondary structures, transcription terminators etc. were carried out with the computer software package of the University of Wisconsin Genetic, Computer Group on a VAX computer (see Rrrndel d: Trifanov. 1984: Devereux et al. 1984).

3. Results (a) K&et&s

and

products

SPPl DNA is packaged series of headfuls. DNA

of pat

clravnyr

from a concatemer packaging initiates

in a b3

131 B-

EcoRI

kb

-I 50

I/

I

14 13 ,1,10,1,0,

4

I 40

I

1 30

5

,

1

2

1 20

15 ,I, 7 ,ll,

1

6

16 ,

I IO

12 131 ,9 ,-Jr\

3

I 0

Figure 1. EcoRI restriction map of the XPPI mature chromosome. One of the ends of the DNA molecule is at ye, and the other end is after a headful cut (104 % of the phage genome). The &oRI DNA%fragment 1. which is also shown in Fig. 2(a). is marked as a hatched bar. The increasing numbers represent diminishing fragment sizes. The relevant c.istrons mapped around the pnc cleavage region are shown (Behrens et al., 1979). recognition of a specific 83 bp sequence. within which cleavage occurs at a site t,ermed pat. This cleavage site is recognized both when present in into concatemeric phage DNA OT when integrated the host’ chromosome (Deichelbohrer et al.. 1982; Bravo et al., 1990). The SPPI pat site is located within the 8.0 kb EcoRI DNA fragment 1 (see Fig. I). Cleavage at pat divides it into 0.72 kb and 7.3 kb DNA fragments (Fig. 2(a)). Only the 0.72 kb tc:coRI DNA fragment (EcoRI 13t) is found in about 22 to 30% molar yield in an EcoRT digest of linear SPPI DNA molecules obtained from mature SPPl particles (Behrens et al., 1979). The 7.3 kb DNA segment has not, been seen in mat.ure phage DNA (Ratcliff et al.; 1979). To determine the requirements for the SPPl pat cleavage reaction we have developed an in viva assay, in which phage DNA is isolated from infected cells at various t’imes. Total intracellular DNA is digested with appropriate restriction enzymes, and separated by gel electrophoresis (Fig. 2). The DNA is then hybridized by Southern blotting with nicktranslated pBT42 DNA. By measuring the increment of the DKA mass of the EcoRI fragment 1 we can analyze SPPl DSA replication, and by measuring the kinetics in the generation of pacterminated restriction fragments we can det’ermine l)?iA packaging initiation and the fate of both pacends. Furthermore, the relative molarity of t’ht: EcoRT 13t DNA fragment can indicate the average number of processive headfuls packaged from a concatemer. Newly replicated SPPI DNA is detectable five to eight minutes after infection (Fig. 2(b) and 2(c)). consistent with a previous observation that the incorporation of radiolabeled material into concatemerit SPPI DNA can be detected six minutes after infection (Burger $ Trautner, 1978). A densitometric scanning of the autoradiogram of Figure 2(c) revealed that the amount of SPPI DNA detected 30 minutes after infection is about 150 to 200-fold greater than the amount detected at the time of infection (time zero),

The 0.72 kb EcoRI 13t DNA subfragment., which would normally be packaged, began to be detectable at ten minutes after infection. Thus, I)h’A replication precedes packaging cleavage. The amount of pat-end generated fragments at 12 minutes and at 30 minutes after infect’ion is about 3.7- to 4.5fold lower than any of the equimolar restriction fragments. At 12 minutes aft,er infection the amount of the 0.72 kb EcoRI 13t DNA fragment is more than l&fold higher t#han the background level (5 or 8 min after infection). The 7.3 kb DNA segment (see Fig. 2(a)) terminated by pat and the right EcoRI sit,e would not be detectable under these condit,ions (Fig. 2(a)). since it, might be masked by the &O kb EcoRl DNA fragment 1. To resolve this, we performed the same experiments as above with a ticoR and lZanI digest which could allow us to distinguish bet,ween both pat ended segments. L’pon cleavage at put, the @95 kb EcoRI-BunI DXA subfragment (highlighted with our DNA probe) is cleaved into 0.72 kb and 023 kb fragments (Fig. 2(a)). As revealed in Figure 2(d), t’he EcoRI 13t and the 095 kb EcoRI--&MI fragments were readily detectable: but we failed to detect the 0.23 kb DIVA fragment. even after very long exposure times. Such failure was not a tech nical detection problem. since an equivalent I)NA segment similar in size and concentration run together with the DNA crude extract was readily detectable (data not shown). Therefore. we conclude that only one pat terminated fragment. EcoRI 131, can be maintained in the infected cell. (b) Identi$cation of yp 1 and gp 2 ns wsrntial components for SPPl pat cleavage in vivo To test whether the genes that map in the vicinity of the pat site (see Fig. 1) are needed for yac cleavage we have used the assay described above (see section (a), above), infecting cells with SPPl cl mutants encompassing gene 41 to gene 7 (Fig. 1). All mutant phages are proficient in DNA replication conditions, because the under non-permissive

SPPl

pat Cleavage

(a) POC

Ba I

1

(cl

(b)

_____--_______---______-------_--M

_-__-------.i -------7

(d

1

Timr in min

Figure 2. The kinetics of pat cleavage following SPPl infect,ion of B. su6tiZis cells. (a) Physical map of the SPPI putcontaining EcoRI fragment 1. The vertical arrow denotes t,he SPPl put cleavage site. The EcoRI-yac DNA fragment (EcoRI 13t) which is encapsidated. is shown as a hatched bar. Upon cleavage at pat the 095 kb EcoRIFRanI DNA subfragment is cleaved into 072 and @23 kb DXA segments. The wavy line denotes the SPPl DNA present in plasmid pBT42. The pBT42 DNA probe is fully identical in sequence with the 0.72 kb segment; identity with the 7.3 kb DNA fragment. however, is limited to @17 kb. (b) The ethidium bromide-stained agarose gel of EcoRI-digested DN.4 isolated from strain YB886 at, different times after infection. In the lanes indicated with c. mature SPPI DR’A was loaded. The EcoRI-generated Sl’fl DNA fragments are denoted (from EcoRI-1 to EcoRI-13). As a molecular weight marker EcoRIdigested SPPI DNA was used (EcoRI-1. %Okb; EcoRT-2, 7.1 kb: IscoRI-3. 60 kb; EcoRI-4. 4.7 kb; EcoRI-A. 3.4 kb: EcoRT-6. 2.7 kb; EcoRT-7. 1.9 kb: EcoRI-8, 1.X kb: EcoRI-9, 15 kb: EcoRT-10. 1.4 kb; EcoRI-I 1. 1.2 kb; E’coRI-12. 1.0 kb. EcoRI-13 and EcoRI-13t, 0.7 kb. see Ratcliff et al.. 1979). (c) The DNA in the gel shown in (b) was Southern transferred and hybridized with pBT42. (d) EcoRI-RanI-digested DKA isolated from strain YB886 at different times after infection was analyzed by Southern transfer hybridization using plasmid pBT42 as probe. The arrow denotes the position of migration postulated for a 023 kb DNA segment. The position of t,hr E’coRI fragmrnts 1 (8.0 kb) and 13 (0.72 kb) in (1)). (c) and (d) are indicated.

amount of SPT’l EcoRT fragment 1 detected 40 minutes after infection is more than 50-fold greater than the amount detected at time zero (data not’ shown). As shown in Figure 3, the SPPl sus mutants of gene I (sus2, sus70. susll4 and ~~119) and gene 2 (susl9) are blocked in pat cleavage. The SPPI thermosensitive mutants ts6M and tsMl0 (gene2) show a lo- to 20-fold reduction in the generation of the 0.72 kb pat terminated fragment, when compared to SPPI wild-type. Furthermore, in the ls6M and tsMl0 mutant phages the molar ratio of the pacgenerated fragment to the EcoRI fragment 1 is 25. to BO-fold lower than in wild-type; in the sus2. sus70, SUSI 14, susl19 and su.sl9 mutants this ratio is 80-fold lower.

(c) {)a’ cleavage is independent

qf DIVA

encapsidation

To learn whether pat cleavage can be performed in the absence of precapsids, B. subtilis cells were infected with SPPl mutant phages either deficient in viral capsid formation (sus62 (gene41) or in the performance of the headful cut (~~115 and sus86 (gene 6); Esche, 1975; Esche et al., 1975; Mertens et al., 1979; P. Tavares et al., unpublished results). As revealed in Figure 3, a defect in genes 41. G or 7 does not affect the accumulation of the pat-generated DNA fragment in viva. The similarity in size between the bona fide EcoRI 13t DNA fragment and that of the mutant DNAs indicates that also in the absence of packaging the pat site is recognized as a cleavage signal. The molarity of the EcoRI 13t

41 sus 62

2 sus19

1S"Si

2 ts6M

1

1 5"s 114

2 ts Ml0

6 SUSIIS

7susl

Figure 3. pnc cleavage following infection of is. .subtiZis cells with Sl’l’l C/ mutants. YBX86 cells were infected with a SPPl phage impaired in gene 31 (sus62). gene 1 (C~~sd.s~s’i0, ~~~114 and susl 19), gene 2 (suslY~ ts6M and tsMlO), gene h’ (su&6 and ~~~115) or gene 7 (sus’~). Total DiVA of YR886-infected ~11s was purified, EcoRl-digested, separated by agarose gel electrophoresis and transferred t’o a nylon membrane. The times (min) after infe&ion at which the samples were obtained are indicated. EcoRT-digested SPPl plaque-forming DNA wa,s loaded as control and is indicated by C. The DNA probe used is highlighting the SPPl KcoRI-1 (84 kb) and EcoRI-1% (0.72 kb). The temperature of infection for the fs6M and tsMl0 l)hages was 46°C’. The hybriclizin# conditions are those descaribed in Fig. 2.

I)NA fragment, 40 minutes after infection. is 1.4- to 1.7.fold higher for ~~$62, ~susllli or sus86 mutants t’han in the sus7 or in the mature wild-type phage. (tl) ,Vuclrotidr

seqwnce

of the SPPI

packaging

region

A detailed restriction map of the SW1 genome. in the gene 1 to gene fi region, was generated and is presented in Figure 4(b). This physical map has been confirmed by DNA sequencing (see below). The sequencing strategy for this region is presented in Figure 4(a). Only the nucleotide sequence of the nonsense strand. i.e. equivalent t,o that, of t’ht mRNA sequence, is shown in Figures. The first, 1044 nucleotides of this sequence had been determined (Deichelbohrer et al., 1982). Our analysis permitted the elimination of a few sequencing errors of our previous work. Computer-assisted analysis of the 2.769 kb DNA sequence enables the prediction of six potential protein-coding frames on the basis of the length of the orf and the presence of a ribosome binding site (RRS; see Stormo et al.. 1982a.h). By using the

above paramet’er, no orfs could be predicted from the reading of the complementary strand (data not shown). The frames are shown diagrammatically in Figure 4(c). their extent in Table I, t)heir DNA and deduced amino ataid sequent’ in Figure ;? and the products from t,hrl orfs in Table 2 and Figure 8. Those orfs t,o which a biologica, activity has been associated (see above) were termed genes I, 2 and rS. According to t’his nucleotide sequence analysis and our genetic dat,a, gene d might start with either a (:T(‘ at position 693 (gene 2*) or an ATG at position 633 (see below). Translation of this orf would give polypeptides composed of either 402 OI 122 residues (see Tables I and 2). Preceding the second start codon but not, the first one; there is a typical RKS at. position 678 to 685 (see Stormo et al., 1982a,h). A c+omputer-based comparison of the amino acid sequrn~. deduced from the nucleotide sequence, of the five open reading frames shown in Figure 5 with primary protein sequences currently available in the NRK,F (release 250) or the Swiss protein (release

(0)

(b)

H EC HiEc R Hg EcRRE R R Ho Hg RHoRRA t (11 11 \"!I 1 --d I(i(f 9 12

Ho E R\AsRHo III\YI

HI I

Ho HoHg I II

Ha I

1 6;

gene ;~~~s70

Cc) gene 2 orf4 orf5 gene 6 mm-

MI0

4

(sus 19)

susl9

(susl9)

6M

-

I

I 2769

I

I

/I

2000

1000 Nucleotlde

I

number

Figure 4. Physical and genetic map of the SPPl phage at t~hepat region. (a) The arrows represent the direction and csxtent. of the various sequence determinations. (b) The numbers of Ec,oRI restrict,ion fragments (vertical broken lines) are indicated The r&Avant restriction sites are shown. The abbreviations are: A. ArcI; As, A.suII; E, EcoRI; EC, EcoRV: H, orfs and of HindTII: Ha, HpccTT; Hg, NgaI: Hi, Hind11 and R, RsaT. (c) The locations of defined genes. putative mutations that. render SPPI deficient in pat cleavage are indicated. (d) the major pat cleavage site is indicated by a vertical arrow. Thta DNA t,o be encapsidated is denoted by a thin lint,, whereas the other end bp a wavy line. Su&otidc 1 wrrrsponds to 1041 on the scaaleof Deichelbohrer et nZ. (1982). I 3.0) data hasrs was performed wit’hout det’ecting significant identity. A nucalrotide sequence analysis of the BalLI/lindTIT DNA fragment (co-ordinate 94 to 2769) from t hc ~2~~70. ~~~114. susll6 and susl19 mutant phages reveals that, the mutations carried by these phages generate stop signals in gene 1, consistent with the definition of our orf. The cl phenotype of the mutants is due to a single base-pair change (see Fig. 5). The mut,ations are clustered within a 40 bp segment (co-ordinate 367 to 407, Fig. 5), and mutants susll6 and ~~~119: isolated independently,

carry the same nucleotide change. A guanine to thymine transversion in sus70. and a cytosine to thymine transition in phages ~~114, and ~~116/ 119 generate an ochre stop codon. This is consistent with’the fact that the mutant phages were isolated in the HAlOlR strain (with the sup-3 mutant allele), which is a suppressor of the ochre codon (Mellado et al., 1976; Lovett et al.. 1991). Analysis of the nucleotide sequence of mutant phages impaired in gene 2 revealed that SPPlsusl9 is a triple mutant. The ochre stop codon of SPPlsusl9 was at position 778. The second

Table 1 Open reading orf (hP (Zene (:enr orn orf4 orf5 Gene

1 Ff 2’

fi

frames

KBS”

Windowb

AAGGAGGT ND (:AM:TGT AAAGGAGC: GG(:GGT AAGGAGG AGGAGGT

8 H 9 T 9 8

predicted from the DNA

sequence

Start’ ATG ATG GTC‘ BTQ ATG ATG ATG

(194) (633) (693) (1 X92) (2107) (2389) (2660)

TAA TAG TBG TAA TAA TGA

(748) (1901) (1901) (2107) (2364) (2658) !

“Nucleotide sequence with extensive complementarity to the 3’ terminal region of the B. suhtilis 16 S rRNA. “The number of nucleotides between the proposed RBS and the initiator codon define the window. ‘Sequence position corresponding to the 1st and the last codon are in parentheses. dExtent of the orf in nucleotides. ‘A RBS sequence WBSnot detected (ND) by any of the Stormo rules (Storm0 rt al., 1982a.h). ‘see t,he text

--:xX, I269 1209 “16 “5X 270 ,

’ ’ ’ the

From derived amino acid sequence. This is the molecular mass from the position of the protein band appearing on the polyacrylamide gel (we Pig. 5). Products with apparent, mobility of 48, 46. 44 and 43 kI)a have been d&vted when t.hr pnc recognition srqu~nw in not fwsrnt, construct.

mut,ation resulting wild-type

is a cytosine in a replacement with a leucine

to adenine transversion of a phenylalanine in the residue in the mutant, at

position thymine leucine

in

851/53. The third mutation is a cyt,osinr to transition that’ results in a change f’rom in the wild-type to a yhenylalanine rrsiduca

-

Figure 5. Nucleotide sequence of the DNA of SPPl pat region and the amino acid sequence of deduced polypeptides. starts from the 1st base of an The SPPl non-sense strand (see Morelli et al., 1978) 1s sh own here and the numbering HpaII site. The extent of the orf is shown by brackets. The deduced amino acid sequence is shown below the DNA sequence. The deviations from the wild-type sequence in the cl mutants mapped in this interval are shown below the wild type DNA and amino acid sequence, respectively. The putative promoter and transcriptional terminator regions are boxed and shown by converging arrows, respectively. The P, and P, 5’-end of transcription are shown. The potential ribosomal-binding sites (RBS) are underlined. The DNA absent in plasmid p1948 (co-ordinate 1 to 157) is bracketed. The major pat cleavage site is shown by a vertical arrow.

SPPl

pat Cleavage

(e) SPPl gene 1 to gene 6 are part of the same transcriptional unit.

-2.4 -

1.77

-

I.52 I.28

-

0.78

Figure 6. Northern blot hybridization analysis of mRNA transcribed from the SPPl gene 1 to gene 6 region. Cultures of YB886 cells were grown to A,,, = 645 and infected with SPPI (time zero). Total RNA (20 pg) isolated at different times (1.0 min; 2, 6 min; 3, 8 min and 4. 10 min) after infection was fractionated on 1.25% agarose-formaldehyde gels, blotted onto nylon membrane and hybridized to 32P-labeled pBT42 DNA. Molecular weight markers (in kb) indicated at the right of the Figure were an RNA ladder visualized by ethidium bromide stain. The major RNA species are denoted by horizontal arrows.

in the mutant protein at position 1329/31. Recently a single SPPl cl mutant, carrying only the ochre mutation of susl9 has been isolated (S. Chai & G. Liider, unpublished results). The thermosensitive phenotype of the SPPlts6M is the result of a single change of base 684, from t,hyminr t’o cytosine (Fig. 5). The mutation of SPPltsBM maps in the carboxyl end of gene 1 as well as in the amino terminus of gene 2 (if initiation takes place at the ATG start codon). The change results in a replacement of a valine (in gene I) and a tryptophan (in gene2) in the wild-type proteins. with an alaninr (in gene 1) and an arginine residue (gene 2) in the mutant proteins. Alternatively, only the second start point is used (gene2*) and the mutation is within the putative RBS of gene 2*. Since the thermosensitive phenotype of the SPPlts6M phage is mainly correlated with a defect in the second orf (gene 2 or gene 2*), we inferred that the replacement in gene 1 should be a silent mutation. The thermosensitive phenotype of SPPltsMlO is the result of a single base-pair change at position 1866. A cytosine to thymine transition in the noncoding strand results in a replacement of a aspartic acid in the wild-type with a asparagine residue in the mutant’ protein.

Gene 1 is preceded by a typical host sigma 42-RNA polymerase consensus region at nucleotide 119 to 124 ( - 35 region) and 143 to 148 (- 10 region). A structure reminiscent of a transcription terminator is located upstream from the putative promoter, with a hairpin-forming region beginning at nucleotide 93. Furthermore. t’he DNA sequence presented in Figure 5 is characterized by an overlap between the end of one orf and the beginning of the following one. Such features suggest that these genes might be part’ of an operon. Alternatively, those genes and orfs are monocistronic and transcribed from novel phage promoters, whose consensus sequence remains unknown. To di&nguish bet,ween these alternatives, H. subtilis cells were infected with phage SPPl and. at) various times after infection, total RNA was isolated. The RSA bulk was separated by gel electrophoresis, t’ransferred to a nylon membrane, and hybridized with specific 32Plabeled DNA probes. The DNA probes are subsets of each other, and all of them share the same 5’ region (pBT36 (co-ordinate 157 to 354). pKT42 (co-ordinate 157 to 1044) or pBTl63 (co-ordinate 94 to 2769)). Three major mRNA molecules of about 5.0, 2.3 and 1.4 kb become detectable, with the pBT42 DNA probe, eight’ minutes after infection (see Fig. 6). After a long exposure of the autoradiograms, two additional minor molecular species of 0.9 and 96 kb long were also detected. Ident,ical hybridization patterns were obtained by using pRT36 and pBT163 as DNA probes (data not shown). From those data, we inferred that a promoter(s) upstream from gene 2 is responsible for such mRNA species. Furthermore, by using strandspecific probes we could show that all the mRNA species are transcribed from the same I)NA strand. When chloramphenicol is added one minute after infection. at a final concentration of lOOpg/ml, the specific mRNA species were not observed. Under this condition. however, the amount of 16 S rRP\‘A was comparable to the one observed in t’he absence of the antibiotic (data not shown). The transcript of gene 1 was determined hy primer extension with a 21-mer primer complementary to the 5’.flanking region (co-ordinate 432 to 452, Fig. 7). As shown in Figure 7(a), two molecular species of mRNAs of 316 and 279 nucleotides were detected. On the basis of the position of the 21.mer oligonucleotide and the nucleotide length of the observed species, we mapped the 5’.ends of the transcripts at positions 137 and 174 (see Fig. 7(b)). Nine nucleotides upstream from the t’ranscription start. at’ position 137 (promoter PI), a TL4T,4AT consensus region at nucleotides 122 t,o 127 ( - 10 region) common among B. subtilis promoters was detected. but no significant homology to a -35 promoter consensus region was observed. Ry computer analysis, typical host RNA polymerase consensus regions at nucleotides 119 to 124 ( - 35) and 143 to 148 (- 10) were predicted. Twenty-five

340 241

TGATGAATATTTCATAAACGGCATCA~TGC~CAAAAGCGGCTATTGCGGCTCGTTAI tlltk TAAAAACTCTGCTTCGACTATTGCGGCCCCAGAACATCCAAAAACCCCACGTCC~G~A,.~;

320

301 361

TATCGAGGAAAGATTGCCACAAATGGACACAAAAGAATCCACC~ACTT~,

300

421

GGAGCATTTCACTCGCATTGCACTCGGCCAGGAAAAGGAACAGGTGCTCA~G~G,,A~,(.: GACCGTAACGTCACCCGGTCC 5,

\!.

3’

280 (b)

260

(a)

Figure 7. Mapping of the 5’.ends of transcripts encompassing gene 1 to gene h’. (a) Total KlUA of H. suhtilis YB886-infected cells was hybridized to a 21.mer ‘*P-end-labeled oligonucleotide, and the product of the extended primer, by reverse transcriptase, was analyzed in a 6”/b polyacrylamide gel containing 7 M-urea. A Dh’A sequencing’ reaction was run in parallel as a molecular weight standard (in bp). Co-ordinates are indicated. (b) The nucleotidr box sryuencr of the non-coding strand. including relevant features, of the gene 1 region is shown. The TATAAT indicated the - 10 consensus sequence of promoter PI, A putative inverted repeated sequence (denoted with straight and broken lines) is observed upstream from promoter Pl. The broken line boxes denote t,he -35 and - IO consensus sequence, respectively, of promoter P2. The RBS and the initiator codon sequences are underlined. The pat site is bracketed. The pat cleavage sites are indicated by vertical arrows. A repeat region containing the par site is indiclated bq wavy lines. Co-ordinat,es are those of Fig. 5.

nucleotides downstream from this putative - IO box, at’ position 174 (promoter P2), a transcription start was also observed. These two promoters funcationed with a different efficiency as judged hy the intensity of’ the two primer extended hands. The mRNA mass of the 316 nucleotides species is 97-fold higher than the one of the 279 nucleotide species. From the data presented above we can infer that: (1) the region encompassing genes I to h’ is part of the same transcriptional unit, and (2) the expression of this operon requires a phage encoded product (middle or late transcripts). On the basis of the size of t,he mRNA species and the initiation start point)s we caan predict that their 3’.end could he located either downstream from the DNA sequence shown in Figure 5 (5.0 kh species) including gene h’ (P. Tavarrs & al., unpublished results), orf4 (2.3 kb species). gene 8 (1.4 kb species) or gene I (0.9 kh

species). The relevance unknown.

To SPPl

of the minor 0.6 kb species is

identify the polypeptides encoded hy the region characterized here, different I)NA segments from either wild-type or ,SUB mutant phages were cloned under the control of a T7 RNA polymerase promoter on the E. coli expression vector pT7 12. The polypeptides synthesized af%er induction of ‘I’7 RNA polymerase expression werr analyzed hy SDS/polyacrylamide gel electrophoresis (Fig. 8). Plasmid p-‘HTI I5 and pBT158 carry gene I from wild-type (184 codons) and SPPlsus70 (58 codons). respectively. Both plasmids also contain t’he first pBT115 producrs I 17 (sodons of gene 2. Plasmid

SPPl

97

pat Cleavage

46

30-

21.5 -

12-5-

12.5 -

65 -

6.5 -

(e

)

H EcHi EC A

E

0

EC E

AsX

XBA

HI

.w@ 1

gene 2 . gene69rf5

-

OrfL

_ort

--,

I

sus70

L I

sus:9

c H W

I

1

, H

0

pBT115 pBT15.8

1

pBT

148

1

pBT

173

pBT

130

pBT132

+--

I

-

pBT

157

pBT

154

pBT159 ~BT133

Figure 8. Physical map and translation products of the SPPl right end of the genome. Synthesis of proteins in E. coli RL21DE3 carrying plasmids ((a) and (b)). The products were separated on a 20% polyacrylamide/SDS gel, fluorographed and autoradiographed. The low and high molecular weight (LMW and HMW) standard (in kDa) are indicated. The origin of the gel is indicated by a horizontal arrow. A schematic representation of the SPPl region and L)NA subfragments inserted into pT712 are presented in (c). Abbreviations of restriction sites are those of Fig. 3(b). and 13. BanJ: D. &a11 and X. XmaIII.

~)olype@es of molecular mass about 20 and 10 kDa. Cells carrying pBT158 synthesize polypeptides of molecular mass 10, 6.5 and 4 kDa (Fig. S(a)). Plasmid pHT148 and pBT173 contain the 3’. end of gene I. gene 2, orf 3 and the 5’-end of orf 4 (27 codons) from wild-type and SPPlsus19, respectively. Polypeptides of molecular mass 48, 10 and 8 kDa wcrc detected with plasmid pBT148, but the 48 kDa product is missing with pBT173 (Fig. 8(a)). From t#hese result’s we conclude that, under denat,uring conditions, t’he molecular masses of the produc+ encoded by genes I, gene 2 and orf3 are 20.

4X and 10 kDa. respectively. This is consistent with the molecular masses predicted from the DNA sequence (see Table 2). From the DNA sequence, we attribute the 10 kDa product of pBTl15 and pBTl58 to the amino terminal sequence of gene2 (see Fig. X(c)). The expected molecular masses of gp I sus70 and gp2srbsl9 are 66 and 1th9 kI)a, respectively. As revealed in Figure S(a), products with molecular masses of about 6-5 (pBT158) and 10 kDa (pHTl73) were observed. With pKT173 this 10 kDa band, overlaps wit,h the product of orf3. Furthermore. a producst of about 8 kDa. which could be a

rc~lt of’ a c~himeric~ polypeptide formed hetwckerr orfl and the vector coding region was observed in plasmids pl~Tl48 and pHTl73. We assume that the 4 k I)a polypeptidca observed with pKTl58 originated from either abort,ive termination or t’he degradation of a largrar product. This may also be t.hr reason for t,he generation of smaller derivatives of gp2. which WC observed after extensive overexposure of gels such as those of Figure 8(a) or with p13T14H derivatives lacking the pat sitr (our unpub lisihfd rrsults). For reasons not understood the production of gp% (pETl48, Fig. H(a)) is always associated with retention of lal)eled material in the gel origin: when the /),a~ sit,r is present, and the appearance of minor amounts of polvpept’ides smaller in size (44 and 43 kl)a). To learn whether the orfs located between gene Z and gene 6 are expressed, a series of additional plasmids was constructed: pBTI30, pRT132. pHT157. pRT154, pBT159 and pBT133 (Fig. 8(c)). The pattern of labeled polypeptides of plasmidbearing genes is shown in Figure 8(b). Plasmids pBT130 and pBTI32 contain orf3 and a modified orfl (termed orf4 * and orf4**> respectively). Plasmid pBTl30 produces polypeptides of molecular mass 10 and 9.5 kDa. Clells carrying pHTl32 synthesize polypeptides of molecular mass 10 and 7.5 kDa. Since the 10 kDa polypeptide is not detected in cells carrying either pBT157 or pBT15-l (see Fig. 8(b) and (c)), we conclude t,hat it must be encoded by orf3. This is also compatible with the analysis of plasmids pBT148 and pBTl73. Th(s molecular mass for the orf 3 product, predicted from the DKA sequence. is X.5 kDa. Its observed mobilit) (10 kDa) could be due to the fact that. tht> DSA sequence predict,s a highly positively charged protein. Plasmid pBT154 carried an intact orf4 and pBT130 (orf4*). pBT157 (orfl*) and pBT132 (orf4 **) carried a modified orf4 gene. From the polypeptides synthesized in cells carrying these plasmids we can conclude that both orf4 and orf4 * encode a product of 9.5 kDa and orf4 ** one of 7.5 kDa. The molecular mass, predicted from the D?uTA sequence, for orf4 is 10.2 kDa (see Table 2). The SPPI DNA segment present in pRTl59 has a coding capacity for a modified orf 5 (orf 5 *). Plasmid pRTl33, which carries a truncated orfti (orffi*). encodes a polypeptide of 6 kDa. From these results we infer that under denaturing conditions the molecular masses of orf.5 * and gp6 * are 9 and 6 kDa, respectively. This is consistent with the sizr predicted from the DNA sequence (9.5 and 6% kDa. respectively). No cl SPPl mutations have been isolated in orf3; orf4 and orf5 so it is unknown whether the polypeptides identified in vitro are essential for phage growth.

4. Discussion Several packaging

properties of the initiation of SPPl became accessible t’o investigation

DNA using

the assa!. for ~KLCc~lravapt~ tlrsc~ribr~d hc~rr>.I~oIIo~\ 111~ the kinrtic~s of par csle;Lvagr during phag(t prowt h, 12-e realize that. this pro~ss bc~c*omr~s (let(~(~tat)l(~ following ii head st,art 01 iLk~Ollt fi)ur milrute:: of‘ SPPI I),lr’A synthesis. ITsing t 11~3 trrrrlinc)log>, describing the hierarchy in the devrlopnrr~lt of’ phage func+ons; phage DKA synt’hrsis woul~l I,(> ali early, and pat cleavage an intjf~rmediatc~ f’llllct ion. One of the structural puzzles of’ the /X/C’ . 1ht packageable ;uac terminated fragment. It is c.olrc*ri\, able that this asymmetry reflects the formal ion after or during pat cleavage of a c+oniplex brxt we’tan phage I)NA and the pac‘kaging rnacxhiner! I~~hich would prot.ect packageable 1)NA against, nuc~leolytic~ attack. It has been shown t,hat KPPl I)NA sJ,nthcasis takes place upon inact.ivation of t I-It, ICxo\’ enzyme (Bravo & Alonso, 1990, iLrlt1 rc~ti~rYncW therein). Therefore. the nucleasr(s) t>hat c~)r~ld l)tx responsible for the ohserved activity rytnain(s) unknown. Another unresolved mechanistic f&t ury is the fact t,hat. the c,leavagr signal rrprc~sc~~ltt~d I)>, the yu~ region is apparently only rec~ogni& on(‘tl per concat~~mer. Sternberg & (‘oulhy (lY90) iLft1.L buted this fart in 1’1 t,o regulatjiorr by 1h(a Clarrl rnet,hyltjransferase. Such an rxplanatjion would. however. not hold for S1’1’1 1 where no regulatory effect’ of mrthylation has been observed (our unpub lished results). Analyzing the stjoicBhiometjry ht~t.wc~c~n t)hr pnc terminated fragment EcoKl 13t and any of the equimolar restrict’ion fragments showed that the incidence of t,he h’,:coR~ 13t I)NA fragment in matured I)NA or in middle and Me times of phage growth is reduced. i.e. indicating t,he sietb of the packageable concatemer of 3.7 to 4.5 grnomt.s. As replication goes on. the relative frrquencav of’ t,hc EcoR#I 13t DNA fragment incareases, indicative of an enhanced initiation of cleavage at pnc. The identification of “middle or late” SPPI mutants. which were proficient in DNA replication. but deficient either in performing packaging cleavage (genes I and 2). encapsidation (gene 6). or capsid formation (gene 41) permitted a study of the relat,ionship between DNA replication and packaging. With all mutants tested. DNA replication proceeded as in the wild-type. The SPPI packaging system. like thosch of /:‘. r.oli phages lambda. 7’1 and 1’22, is initiatetl ill the absence of DNA encapsidation (Murialdo 8 Fife, 1984; St,ernberg & Coulby, 19X7: Ramsey 8 Kitchie, 1983; 1,aski 62 Jackson. 1982: t,his work). Exc,rpt for bacteriophage Tl, under such conditions not (‘very par or I‘OS site is cleaved. In the case of phage ‘1’1, a phage mutant, in headful cleavage renders unitlengt,h molecules by repeat,rd pnr sit’e c+avage (Ramsay k Rit,ohie. 1983). The cl mutations, which led to deficiency in SPPI pat-cleavage. were localized by DNA sequencing in either gene 1 or gene %. Inspection of the prirnary struct,ure of gpl revealed bet,ween residues 24 to 45

#PPl

pat Cleavage

(a)

(b)

Figure 9. Amino acid sequence of proteins encoded at the SPPl pat region. Relevant features are indicated. (a) The putative P\‘TP-binding motif-containing protein domains are indicated. Broken lines followed by a circle denote the motif (HTH) motif is underlined. (b) B and brokrn linrs followed by a rectangle denote motif A. The putative helix-turn-helix Genetic. map of the putative SPPl terminase genes. The location of the relevant, regions are represented schematically. Thr thick and thin lines denote the left and right ends of the SPPl genome, respectively. The dotted box denotes the location of the 83 bp par region (Bravo et al., 1990). The length of the vertical arrows indicate the frequency of cutting at the pat cleavage site. The gene 1 (small) and gene 2 (large) orfs are shown as open rectangles. The ATP-binding motif (motifs A and H) and the HTH are indicated. The asterisk denot’es the SPPltsMlO mutation.

a helix--turn-helix binding motif (see Fig. 9(a)) frequently observed in DNA-binding proteins (see Pabo C!!LSauer, 1984; Brennan & Matthews, 1989). A putative ATP-binding motif AXXXXGKL (motif A; Walker rt al., 1982) and a nucleotidebinding pocket DE (motifB) were identified between residues 113 to 122 and 18 t’o 19, respectively (Fig. 9(a)). Both motifs are preceded by hydrophobic stretches of amino acids (see Higgins et al., 1988; Gorbalenya $ Koonin, 1990). A nucleotide binding pocket DD (motif B; Walker et al., 1982) preceded by hydrophobic amino acid residues was identified between residues 106 to 114 of gp2 (see Fig. 9(a) and (b)). Most likely gpl and gp2 represent t’he two subunits of the terminase, as observed also among several E. coli bacteriophages. The terminase enzyme is commonly composed of two subunits (for a review. see Black, 1989). One is a small (160 to 190 residues long) and the other is a large subunit (420 to 650 residues long; Black, 1989). In general terms the small subunit. which is implicated in the binding of a specific DNA site, appears to bind and hydrolyze ATP, and could be non-essential for packaging mature DNA. The large subunit appears to bind to the proheads and may be involved in cutting the phage molecules (Black, 1989). The gene organization of the terminase operon is highly conserved among the diflerent E. coli bacteriophages (e.g. phages lambda (Feiss, 1986), T3/T7 (Hamada et al., 1986a.h). P22 ((‘asjens et al., 1987; Schmieger et al., 1990) and T4 (Powell et aE., 1990)). A schematic presentation of the SPPl terminase region is shown in Figure 9(b). As with other phage systems, the pat site falls into the gene 1. In the case of phage SPPI genes 7 and ,” are followed by three smaller reading frames (orf 3, orf4, orf5). IJsing three DNA probes with similar 5’-ends, in Northern blotting of RPPl mRNA, the same mRNA species were identified. This indicates that, synthesis

of all mRNA species commenced at the 5’-end of the operon, most likely at promoter P, (see Fig. 7) and extended for various lengths into this transcriptional unit and beyond it. Since no putative transcriptional terminators were detected that could be responsible for the generation of the different mRNA species, we assume that phage- or hostencoded product(s) represent the operative transcriptional terminators in these cases. Either an overlapping or a window of a few basepairs between the end of one and t,he beginning of the next orf was observed (see Figs4 and 5). This gene organization is often associated with translational coupling (Oppenheim & Yanofsky, 1980). We have identified t,he start point of transcription and the length of the mRNA species. Since an identical mR#NA pattern was observed with any of t,he DNA probes used, and by computer analysis we failed to detect putative transcriptional terminat#ors, we hypothesized that an endoribonucleolytic cleavage or a 5-to-3’ exoribonucleolytic degradation cannot account for the appearance of these mRNA species. Rather a host- or phage-encoded product could function as a transcriptional terminator (attenuator). The temporal program of SPPI transcription has been examined before by hybridizing total RNA from SPPl-infected cells. Except for the early transcripts, protein synthesis and/or D?iA replication are required for middle and late transcription (Montenegro & Trautner, 1981). The promoter used in the transcription of the terminase-portal protein operon like other “late” promoters could not be identified in previous in vitro analyses involving electron microscopy of transcriptional complexes formed in vitro using SPPl DNA and E. coli or R. rubtilis RNA polymerases (Stiiber et al., 1981). Transcription of this region required preceding protein and/or DNA synthesis. Therefore it is likely

t tr;rI t.hts rwopitiorl rfv~uirf~s somcl Sl’l’

of’ the IIIIIISII~~ I’, f)romotcbr, I -encoded fact)or. Transvrif)t,ion of’ t.he entjire region proceeds fhflowing our f9nv(‘i~t ion f’rom right t.o left. Hrnve. with the results reported here, SPPI l)?;A is transcaribed asyrnmt~trically in it,s entirety. with the high drnsit’y “H” strand (Moreffi it ~1.. 1978) of SPPI I)pl;i\ serving as the only template for mR,SX synthesis. A phape-entaoded product is needed for gene I to gene (i expression (middle or fate genes). Like E. w/i positively regulated promot)ers ‘(see Raihaud & Stahwarts. 1984). promoter PI has a - IO region t>hat, is similar to the - 10 consensus secfuen(ae hut its -35 region is poorly matched, if’ at) all. to the conventional - 35 consensus seyuence. The rnechanism of a&on of’ t,he SPPl positive factor(s) is unknown (i.e. whether it, binds to R,NA polyrnerase or dire&y to a I)XA structure or sequence). The region of the gene I to ci (the terminascportal protein region) operon of’ SPPl is strikingly similar in genornic location and organizat,ion to funcat ionsfly identical operons of E. Co/i or SnlN/ond/cL fyph~muriur~r phages (for a review. SW f)lat*k. 19X9). Apparent 1y this organizatjion int’o one operon and the relative IocAation of the genes conservecf must have a strong fimctjiona,f advantage. (‘omparing primary amino acid srquen~s of these proteins. we are struck with their total Iavk of similarity. LUso t,he pan signals of the various phages tlifl’er in their nucnleot,idr sequence. The t~~nsrrved genomic organization indicates that e&her the (hornf)osite proteins have diverged from a common ancvstor a long time ago or that t,hey have derivecf from different genes and are the produtAtj of vonverpent, evolut,ion. To explain vonservation in grnomiv organization and convergent c~vofution. however. it hits to he assumetf that the linkage of gent’s with interacting functions were favorahlr during rvolrlCon. Fisher (1930) had predicted that if some allele t+omhination is superior to ot’her suc*h linkage van I)tb transmit,ted int.acat suffering only a minimal disruf)t ion hy rec*omhination. 1%~ experiments in which the int,erchangeaf)ilit? from different sources is of analogous proteins tested. one might a,pproach the question of whet,hrr different p~,c signals forced the evolution of. f’or example. different terminase or portal prot’rins (see I )onut,r rt f/J. 1 19%)).

‘f’his research ~vas partially supportrtl by I)rutst.hts F(lrsc:hurlUsRrmeinschafi, DFG (Al 284/I- I ), ,A. IS. ~vas stcf)ported I)g an E1fBO Long Term Fellowship. The nuc~feotitlr sequence reported in this paper has tm~rr submitted to thv ICMBL Data bank with acc.rssion number XNNfi4. References Afonso.

,I. (‘. R: Trautner.

T. A. (1985).

A gene

controlling

segregation of the Bucill~s subtilis plasmid fK’l94. Mol. f&n. f&net. 198, 427.--431. ‘lIonso. .J. C’.. T,iidrr. C. 8: Trautner. ‘I’. A. (19%). Reyuirrment,s for the formation of plasm&t,ransducing SPPl.

particles of Hncillus subtilis EMRO .J. 5. 3723-3728.

bacteriophage

Krendf~l. \‘. &! Trifonov. rithtn fi)t, ttssting

15. S. J)otrtttial

(l!N). .I c~~nr~autf~r alpctltrokaryotic. tt~rtttitrators.

.Y/K/. Arids Kr.u. 12. 441 I Ud7. fSurger. li. .I. & ‘I’rant,twr. ‘1‘. ‘4. (197X). Spfv,ific, of tvftfic~atinp synthesis

SPI’I f)S,\. idrntitic.ation

atrtf

Analysis of’ Jthagr

of’ viral tftta-getrw.

labelling f)h’A :l/ol.

166. 277~ 1X.5. S.. Huany. IV. 11.. Haytlrtr. )I. & f’arr. I.

thy

I)XA ./. ;Vo/.

Niol. 194. 11 f-12:! f)eichefbohrrr.

I..

Messer.

LV. & Trautner.

T.

.A. (I9xP).

(:rnotnt~ of’ Hecilll~.v ,suh&lis bat~teriophage SPPI : strucTurr and nucfrotidr sequence of put. thfb origin of f)Ki\ packaging. ,/. ITid. 42. 83~~90. I)eic~helt)c,ht~er. I. .\lonso. ‘I’. :I. (198.5). I’fasmitf

.I. C’.. 1,iitfrr. (:. &Y ‘l’rautttrt~. transtlitctiott by Hc~vi///rs s&i/is I~;ic~t.c~riftftlra~~ SPI’I : fafiect,s of f)XvX honlofog>~ ltet\+t~ett ltlasmitf ant1 hac+rriophapt~. .I I~tr~/~vin/. 162. I”:18 164:1. I)rvt~rrt~a. .I.. Harbrrli. I’. & Smithitns. 0. (I!N). .Z programs I’ot c~ottrftr~~trf~rrsi~f~ srt of’ stqtwnc*t anal+* the Y;\S. .Ycrcl. .1cid.s Rr.s. 12, 3X7 3!K I)onatv. I,. R.. 1Ittrialdo. H. & (‘arrascostt. ,I. I,. (l!NO). f’rotluction of j&429 f)hagv c,hitnrras. I’iroto!qy. 179.

936 !bM). Esc.htl. H. (l!)i:‘).

(:rttr

rxptxwiorr

of I)~tc.tt,rioi)f’~tgt,

Sf’f’l

fityulatq~ aspects. Mol. (ictt. Grvtrt. 142. 57- (iti. Eschc. H.. Schweiger. M. $ Trautner. T. :\. (1975). (Awe expression of’ bacteriophage SPP I I. Phage diwtrf~ Il.

proteitt Feiss.

hf.

synthesis. (19Xfj).

ant1 pac&kaging 100

Mol. Cm. Grind.

Trrminasr

and

t,hr

of 7. chromosomes.

142, 45-55. cutting

recwgnition.

Trrrds

fk~upt. 2.

101.

LV.. Miller. C:.. .Johnson. (;. Hr f~eiss. .\I.. LViffner. (‘histiansen, S. (1983). Structure of thr bactrriophage lamb&% cohesive end site: Iwation of’ thr sites of trrrninwr binding (cosH) anti nicking (co.sS). Qmr. 24. Fisher.

207- “IX. I;! I)K;A in the absrnsr of l)KA packaging. .I No/. Jjiol. 154. .565-~.57!). f,rwnh;trdt. I,. & ,\lottso. ,J. (‘. (1988). (‘onstrwtion of a sttttttlr vrv,tor for inducBible gene Pxpression in Ir:schurid/in

u/Ii

im(l

I-hri1l1t.s

ts/rhtilics.

J. GPX

,1licv~biol.

134.

tiO.5 fit)9 I,owtt.

I’. S.. ~~mbtrlos. S. I’., Mulbry. \I:.. Saguchi, rS. & JLopc~rs. E. .I (1991 ). l’Ci.4 van be decoded as trypto.J. Hnrfariol. pllatl at, low tAl’tic.itv1c.y in RncilZus suhtilis. 173.1x10- IHI-‘. Mellaclo. lC.f’.. \‘ittwla. E. & Salas. M. (1976). Isolation of strong supJttwsot’ of nonsense mutations in Rncilltr* tsuhfiti.s.

h’ur.

,J. Wiod~em.

65.

213

%%.

Merttqts. (i.. Amantt. E. & Reeve. J. (1979). BacterioJjttagth Sl’l’l polvpeptides synthesized in infected tttirricvlls ant1 ir/ vj/ro. Mol. Oen. Tenet. 172, 271C279. Moffatt. I%. A. & Studirr. F. F’. (1987). T7 Iysozymr inhibits trattsc.riJ,tion hy T7 RN,4 Jwlymrraw. (‘ill. 49. ??I 227. Montrnrgro. >I. .\. Hi Trautner. T. A. (1981). In viva t t~attsc~riptiort of RnciZ1u.s subtilis bacterioJ,hage SPPI

Mol. (kn. (:c~r!rt. 181. 51%517. Morelli. (i.. Montwrgro, M.. Hillenbrand, G.. Schrrzinger. E:. 8r Traut.ttc~r. T. A. (1978). The genome of H. subtilis Jlhagtk SI’I’I assignment of 5’-3’-polarity to the c,c,rttJ)lrttient;lr~ strands of WI’1 fINA. Mol. Gevt.

(:/J//W/.164. !I3 97. ~lurialtlo. H. & Fife. N’. 1,. (1984). The maturation of c.c,liJ)hag:r latttbda IIN:\ in thp absence of its pacakaging. (v?w~. 30. l83~-I!M. 0J)Jwnheitn. I). S. & \-anofsky, C. (1980). Translational cwJ)ling during rxJwession of the tryptophan operon of’ Kwherirhitr

rwli.

(Grnrfirs.

95,

785-795.

f’abo.

(‘. 0. & Saurr. K. T. (1984). Protein- I)XA recognt iott. .3 UMU. Kc/.. JZiochrvva. 53, 693-Xl. Powell. I).. Franklin, .I., Arisaka, F. & Mosig, G. (1990). I!,acteric)phage T4 DNA packaging genes lli and 17.

Srcrl. A rids Krs. 18. 4005. Raibaud. 0 6 S(. Ornut. 18. 17X “OG Ratnsay S. & I