Accepted Article
Article Type: Original Article
Molecular characterization of intergeneric hybrid between Aspergillus oryzae and Trichoderma harzianum by protoplast fusion
1, 2
Nilambari S. Patil1, Swapnil M. Patil1, Sanjay P. Govindwar2, Jyoti P. Jadhav1, 2* 1
Department of Biotechnology, Shivaji University, Kolhapur- 416004
2
Department of Biochemistry, Shivaji University, Kolhapur- 416004
* Department of Biochemistry and Biotechnology, Shivaji University, Kolhapur- 416004
Running head: Molecular characterization of intergeneric hybrid
*Corresponding author Prof. Mrs. Jyoti P. Jadhav Professor and Head Department of Biotechnology, Shivaji University, Vidyanagar, Kolhapur 416004, India E-mail: [email protected] Tel.: +91 231 2609365 Fax: +91 231 1691533.
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/jam.12711 This article is protected by copyright. All rights reserved.
Accepted Article
Abstract Aims: Protoplast fusion between Aspergillus oryzae and Trichoderma harzianum and application of fusant in degradation of shellfish waste. Methods and Results: The filamentous chitinolytic fungal strains Aspergillus oryzae NCIM
1272 and Trichoderma harzianum NCIM 1185 were selected as parents for protoplast fusion. Viable protoplasts were released from fungal mycelium using enzyme cocktail containing 5 mg mL-1 lysing enzymes from T. harzianum, 0.06 mg mL-1 β-glucuronidase from H. pomatia and 1 mg mL-1 purified P. ochrochloron chitinase in 0.8 M sorbitol as an osmotic stabilizer. Intergeneric protoplast fusion was carried out using 60 % polyethylene glycol as a fusogen. At optimum conditions, the regeneration frequency of the fused protoplasts on colloidal chitin medium and fusion frequency were calculated. Fusant showed higher rate of growth pattern, chitinase activity and protein content than parents. Fusant formation was confirmed by morphological markers viz., colony morphology and spore size and denaturation gradient gel electrophoresis (DGGE). Conclusions: The present study revealed protoplast fusion between Aspergillus oryzae and
Trichoderma harzianum significantly enhanced chitinase activity which ultimately provides potential strain for degradation of shellfish waste. Consistency in the molecular characterization results using DGGE is the major outcome of present study which can be emerged as a fundamental step in fusant identification. Significance and Impact of the Study: Now it is need to provide attention over effective chitin degradation in order to manage shrimp processing issues. In this aspect, ability of fusant to degrade shellfish waste efficiently in short incubation time revealed discovery of potential strain in the reclamation of seafood processing crustacean bio-waste.
This article is protected by copyright. All rights reserved.
Accepted Article
Keywords: Protoplast fusion, intergeneric hybrid, Aspergillus oryzae, Trichoderma harzianum, chitinase, DGGE (denaturing gradient gel electrophoresis)
1. Introduction Chitin is a high molecular weight linear homopolymer of β- 1, 4 linked N-acetyl-D-
glucosamine (Lower 1984). It is found in insects as a major component of the cuticle, the peritrophic membrane and also as a protective sleeve, and in gut lining of many insects (Kramer and Koga 1986). It also constitutes the structural polysaccharide of fungal cell walls and the outer shell of crustaceans, nematodes, etc. (Wang et al. 2001). Chitin and its derivatives have great economical value because of their biological activities and their escalating demand in industrial applications. Main commercial sources of chitin are shells of crustaceans such as shrimps, crabs, lobsters and krill that are available in large quantities by the shellfish processing (Wassila et al. 2013).
In India 60,000 ± 80,000 tonnes of chitinous wastes are produced annually. Shellfish
processing industries faced severe problems in disposing off the formidable quantity of shellfish solid wastes (Nirmala 1991). However, despite small quantity used for the extraction of chitin most of these valuable byproducts are discarded by ocean dumping or incineration. Moreover, chemical method of extraction of chitin involves deproteinization and demineralization which
are expensive and not ecofriendly techniques (Wassila et al. 2013). Therefore, attention must be paid to overcome this problem and discover effective, economic method of chitin utilization in order to manage shrimp processing waste. Bioconversion of waste by microbial chitinase (E.C. 3.2.1.14) which has potential of catalyzing the enzymatic degradation of chitin polymer is
This article is protected by copyright. All rights reserved.
Accepted Article
probably the most cost effective and environment friendly procedure for waste utilization (Healy et al. 1994). Protoplast fusion is an important tool in strain improvement for bringing genetic
recombination and developing hybrid strains in filamentous fungi (Lalithakumari 2000). It is
used to produce interspecific or even intergeneric hybrids. It has become an important tool of gene manipulation because it breakdown the barriers to genetic exchange imposed by conventional mating systems. Protoplast fusion technique has a great potential for genetic analysis and for strain improvement. It is particularly useful for industrially useful microorganisms (Murlidhar and Panda 2000). These techniques have been widely used for enhanced yield in conversion of cellulose to ethanol (Knowles et al. 1987), strain improvement for alcohol fermentation (Lima et al. 1995), citric acid producing strains of Aspergillus niger (Kirimura et al. 1986). Moreover, this technique is an important tool for the genetic manipulation of industrially important fungi. Ogawa et al. (1989) reported enhanced cellulase production in Trichoderma reesei by inter-specific protoplast fusion while Prabavathy et al. (2006) reported increase in chitinase production and biocontrol activity in Trichoderma harzianum by self fusion of protoplasts but not much work has been focused for application of chitinase in shellfish waste degradation using this technique.
Recently, the development of molecular techniques has created new possibilities for the selection and genetic improvement of livestocks (Godrat et al. 2005). Nearly all RAPD markers are dominant, i.e. it is not possible to distinguish whether a DNA segment is amplified from a locus that is heterozygous or homozygous. Co dominant RAPD markers, observed as different-sized DNA segments amplified from the same locus, are detected only rarely. Thus, the RAPD
This article is protected by copyright. All rights reserved.
Accepted Article
technique is notoriously laboratory dependent and not reproducible. Mismatches between the primer and the template concentration may result in the total absence of PCR product as well as in a merely decreased amount of the product. Thus, the RAPD results can be difficult to interpret (Senthil Kumar and Gurusubramanian 2011). On the other hand, denaturing gradient gel electrophoresis (DGGE) is an electrophoresis technique to identify single base changes in segment of DNA. DGGE separates PCR amplicons according to their nucleotides composition and reveals microbial community dynamics in both environmental and pure cultures population studies (Muyzer et al. 1993; Muyzer and Smalla, 1998). DGGE could allow considerable savings of time and treatment costs. The protoplast isolation, regeneration have been reported for different fungi in literature,
however, not much work has been focused on intraspecific and intrageneric protoplast fusion in filamentous fungi. Also, all the reports on strain improvement for high yields of titers of chitinase are by mutation and no reports are available in this regard by exploiting protoplast fusion system. This prompted us to develop an intergeneric fusant of Aspergillus oryzae and
Trichoderma
harzianum
using
protoplast
fusion
technology.
In
addition
molecular
characterization of fusant identification was done by DGGE (Denaturating gradient gel electrophoresis) and approach of fusant was focused for degradation of crab shell waste.
Materials and methods Chemicals and enzymes Chitin and polyethylene glycol were purchased from Sigma (St Louis, MO). Other chemicals used were highest purity and analytical grade. P. ochrochloron MTCC 517 was obtained from MTCC, Chandigarh, Trichoderma harzianum NCIM 1185, Aspergillus oryzae NCIM 1272, were
This article is protected by copyright. All rights reserved.
Accepted Article
procured from NCIM, Pune. Colloidal chitin was prepared from commercial chitin by the method of Hsu and Lockwood (1975).
Screening for chitinase production
1
The organism was tested for chitinase activity on colloidal chitin agar (composition g L-
): NaNO3 (3), K2HPO4 (1), KCl (0.5), MgSO4.7H2O (0.5), FeSO4 (0.01), agar (25) and colloidal
chitin (20), pH 7.0) at 30°C by the method of Kenji et al. (1998). Qualitative and quantitative screening for extracellular chitinase resulted in selecting Trichoderma harzianum and Aspergillus oryzae strain for protoplast fusion programme. The parental strains were cultured on
czapek dox agar medium and maintained on potato dextrose agar medium.
Protoplast formation Protoplast formation was carried out according to method of Kitamoto et al. (2000) with
slight modifications. The spore suspensions (1×106 spore’s mL-1) from both fungi have been
inoculated into potato dextrose broth (pH 6.0). The flasks were incubated on a rotary shaker at 120 rpm for 48 h at 30 oC. After incubation, mycelia were harvested by filtration through cheese cloth and collected by centrifugation at (1000×g, 5 min) and washed twice with distilled water. Protoplasting was performed using 50 mg wet mycelia in 5.0 ml of 25 mM sodium phosphate buffer, pH 7.0. For protoplast generation, enzyme cocktail containing 5 mg mL-1 lysing enzymes
from T. harzianum, 0.06 mg mL-1 β-glucuronidase from H. pomatia and 1 mg mL-1 purified P.
ochrochloron chitinase (Patil et al. 2013) and osmotic stabilizer 0.8 M sorbitol; were incubated at 37 °C on a rotary shaker (120 rpm) and protoplast release was examined under light microscope. After 2 h, the protoplasts preparation was filtered through sterile cotton wad and centrifuged at
This article is protected by copyright. All rights reserved.
Accepted Article
100 rpm for 10 min. The supernatant was discarded and the sedimented protoplasts were suspended immediately in buffered-osmotic stabilizer solution. Protoplast yield (protoplasts mL1
) was determined by using a Neubauer haemocytometer (Marienfeld).
Protoplast fusion Fusion of protoplasts of Trichoderma harzianum and Aspergillus oryzae was carried out
by the method of Stasz et al. (1988) with slight modification. Polyethylene glycol (PEG)
prepared in STC buffer (0.8 M Sorbitol; 10 mM Tris–HCl; 10 mM CaCl2, pH 6.5) was used as
fusogen. One mL of protoplast suspension from each parents were mixed with equal volume of PEG solution (6000, 60 %) and the fusion mixture was incubated at 30 °C. After 10 min, the mixture was diluted with 1 mL of STC buffer. The PEG in the fusion mixture was washed away, using STC buffer and the fused protoplasts were collected by centrifugation at 100 rpm for 10 min, suspended in STC buffer and plated on 2 % colloidal chitin agar (CCA) selective medium containing (g L-1) colloidal chitin (5.0), NaNO3(2.0), K2HPO4 (1.0), KCl (0.5), MgSO4 (0.5), FeSO4 (0.01), sucrose (0.8 M), agar (15) distilled water 1000 ml at pH 7.0. The plates were incubated at 25 °C and the protoplast regeneration and development of colonies were observed. The regenerated protoplasts were transferred to PDA slants. Nuclear staining of fused protoplasts has been performed using aceto-orcein stain (Bos and Slakhorst 1981).
Markers for fusant identification Colony morphology, spore size were used as fusant markers. DGGE analysis was
performed using molecular marker of ITS region for fusant identification. The genomic DNA of parent 1, 2 and fusant was extracted according to the method described by Prabha et al. (2013).
This article is protected by copyright. All rights reserved.
Accepted Article
NrITS region were first amplified using the primer pairs ITS1 forward and ITS2 reverse according to White et al. (1990). All reactions were carried out in a 50 μL reaction mixture
containing 1X PCR buffer, 1 pM, 1 nM of dNTPs, 2 mM MgSO4, 1 unit Taq DNA polymerase, 0.25 pM of forward and reverse primers and 2 μL of template DNA. The thermocycling program was as follows: initial denaturation at 95 oC for 5 min, 35 cycles of 95 oC for 15 s, 50 oC for 15 s, and 72 oC for 15 s, followed by 10 min final extension at 72 oC. PCR product was then check on 2 % agarose gel. Successfully amplified products were then purified using GenEluteTM PCR
clean-up kit (Sigma) as per manufacture instruction. For DGGE analysis, a nested PCR was performed in a total volume of 50 μL, each with 2
μL of purified PCR product from the previous reaction as template DNA. Amplification was performed using the forward primer ITS1-GC clamped (CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCGCGGCCGC) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC). Nested PCR reaction were performed at higher stringency (increasing temperature by 4 °C and decreasing cycles to 30). The cycling scheme was as follows: 5 min denaturation at 94 oC, followed by 35 cycles of 1 min denaturation at 94 oC, 1 min annealing at 58 oC for ITS1-GC primer or 62 oC for ITS2-GC primer, 1 min extension at 72 o
C with a final extension step at 72 oC. PCR products were analyzed by electrophoresis in a 2 %
(w/v) agarose gel. Amplified product was purified and denaturing gradient gel electrophoresis (DGGE) of
concentrated product was performed using Decode Universal Mutation Detection System (BioRad). Samples were loaded onto 8 % (w/v) polyacrylamide gels (37.5:1, acrylamide: bisacrylamide) in 1× TAE buffer with a denaturing gradient ranging from 20 % to 80 % ,
This article is protected by copyright. All rights reserved.
Accepted Article
denaturant run at 60 oC, 100 V for 12 hr (Joshi et al. 2013). Gel was stained using SYBR gold and visualized on UVITEC gel documentation system.
Estimation of protein and chitinase activity in the culture filtrates Above stated medium in screening was used for the production of chitinase. Parents and
fusants (2 × 107 spores mL-1) were inoculated in flasks containing medium that has colloidal
chitin as sole source of carbon and incubated in an orbital shaker at 40 °C and 120 rpm for 72 h. After 72 hrs, the cultures were harvested, filtered through Whatman No. 1 filter paper and centrifuged at 8161× g at 4 °C. The cell free culture filtrates of parent and fusants were used as enzyme sources for chitinase assay. Chitinase enzyme assay was carried out with colloidal chitin as a substrate. The assay
mixture contained 1 ml 0.5 % colloidal chitin, 0.5 ml sodium phosphate buffer (25 mM, pH 7.0) and 0.5 ml enzyme solution, which was incubated for 1h at 40 °C (Waghmare and Ghosh 2010). The reducing sugar released during the reaction was quantified by using N-acetyl-β-Dglucosamine standards with concentrations ranging from 100 to 1,000 μg mL−1 by DNS method (Miller 1959). One unit of enzyme activity was defined as the amount of enzyme required to release 1 μmol of reducing sugar from colloidal chitin per minute. The protein content was estimated by Lowry et al. (1951) using bovine serum albumin as standard protein.
Decomposition of crab shell waste by parent and fusant Fresh crab shell chitin waste (CSCW) containing head and shell was obtained from local
marine food supplier market. It was washed twice with tap water in order to remove the dirt. The washed CSCW chips were dried at 60 °C for 24 h in a hot air oven, milled with an electric wearing blender and sieved through mesh sieve. The CSCW powder was used for further process This article is protected by copyright. All rights reserved.
Accepted Article
without any further demineralization or deproteinization. To test the degradation of CSCW parents and fusant strain were cultured with degradation media containing 0.1 % (w/v) of CSCW powder with vigorous agitation at 40 °C. The percentage degradation of CSCW was determined by considering the dry weight of
substrate remaining in the culture broth at the end of experiment. The results were expressed as percentage of the initial weight (considered as 100 %) and calculated by comparison between the dry weight of residual substrate before and after hydrolysis (Cortezi et al. 2008).
Results Effect of enzyme concentration for protoplast formation Penicillium ochrochloron MTCC 517 has been reported earlier for chitinase production
in submerged (Patil et al. 2013) and solid state fermentation (Patil et al. 2014). Enzyme cocktail posse’s immense potential to digest the cell wall of various fungi and production of large number of protoplasts. It was observed that lysing enzyme β-glucuronidase was not much effective in the release of protoplasts, when used individually. Combination of the enzyme cocktail with 5 mg mL-1 lysing enzymes from T. harzianum, 0.06 mg mL-1 β-glucuronidase from H. pomatia in
combination with 1 mg mL-1 purified P. ochrochloron chitinase, lysed the cell wall components efficiently and yielded high amounts of protoplasts. The amount of protoplasts obtained after enzymatic treatment were 5.2 × 107 and 1 × 106 for Aspergillus oryzae and Trichoderma harzianum respectively. Effect of osmotic stabilizers In order to identify the best osmotic stabilizers, we used different osmotic stabilizers at 0.8 M concentration. Among them, 0.8 M sorbitol was found to be optimal for release of protoplasts from both T. harzianum and A. oryzae (data not shown).
This article is protected by copyright. All rights reserved.
Accepted Article
Effect of incubation time The maximum yields of protoplasts were reached after 2 h incubation, but the number
decreased above 3 h due to bursting and prolonged incubation caused lysis of protoplasts. Empty hyphal segments were detected after protoplasts were released into surrounding medium through openings in the cell wall. Protoplasts released after 1 hr of incubation from partially digested
mycelia and large size protoplasts have been obtained after 2 hr of incubation (Fig 1).
Effect of PEG concentration during protoplast fusion The effect of PEG concentration on protoplast fusion was studied with various
concentrations of PEG (30–70 % v/v) with a uniform concentration of 10 mM CaCl2. The present study revealed that incubation mixture containing 10 mM CaCl2 and 10 mM Tris - HCl
buffer with 1 ml of PEG (60 %) was favorable for the development of fusant (Table 1). When PEG solution was added to the protoplasts, they were attracted with each other. Later, the plasma membrane at the place of contact dissolved and protoplasmic contents fused together. Finally, the fusion protoplasts became single oval shaped structures (Fig 2). Nuclear staining showed presence of two nuclei in fused protoplasts (Fig 3). The present study revealed that incubation mixture containing 10 mM CaCl2, 0.8 M sorbitol and 10 mM Tris – HCl buffer with 1 ml of PEG (60 %) was favorable for the development of fusant.
Selection of fusants The fused protoplasts were plated on 2 % colloidal chitin medium for fusant selection.
Fused protoplasts grew very fast than parental strains. Similar observations have been made by Prabavathy et al. (2006) in Trichoderma harzianum.
This article is protected by copyright. All rights reserved.
Accepted Article
The parental colonies of T. harzianum were pure white in color while A. oryzae parental colonies were greenish in color. The fusant colonies were greenish white in color (Fig 4). Spore size was considered by Mrinalini (1997) to select fusants of Trichoderma sp. The sizes of the conidiospores were 4.96 um, 5.12 um and 5.84 um (diam.) in A. oryzae, T. harzianum and fusant respectively. In the present study, DGGE has been focused as a molecular tool for identification of
fusant. After extraction of DNA from parents and fusant, ITS was amplified using ITS1 and ITS2 primers, which were subsequently analyzed by denaturing gradient gel electrophoresis (DGGE). PCR amplification of the extracted DNA from parents and fusant showed single amplification product of 300 bps on 2 % agarose gel (Fig 5A). In DGGE analysis single band were observed in the case of both parents but at different position. On the other hand, in fusant sample two bands were observed and their respective position confirms the fusion process (Fig 5B). Estimation of protein and chitinase activity in the culture filtrates In addition to growth pattern, fusant showed enhanced production of extracellular
chitinase and protein content (Table 2). High protein content was observed in fusant than in parent. Similarly, in case of chitinase production appreciable increase in chitinase activity was observed in fusant than in parent. The formed fusant by protoplast fusion shows the productivity of chitinase maximum
upto four subcultures in 6 months thereafter slight decrease in activity was observed. Decomposition of crab shell waste by parent and fusant Highly chitinolytic fusant strain was used for degradation of crab shell waste. The fusant
was able to degrade 0.1 % CSCW at about 92 % in 4 days (Fig 6).
This article is protected by copyright. All rights reserved.
Accepted Article
Discussion A lot of work needs to be done on strain improvement of different fungi by protoplast
fusion for increasing the production of industrially important enzymes. With a view of strain improvement, the present study is aimed at developing an intergeneric fusant between slow growing high chitinase producing fungus Trichoderma harzianum and fast growing high
chitinase producing fungus Aspergillus oryzae. Osmotic stabilizers are one of the important parameters for high yield of protoplasts.
Osmotic stabilizers play an important role in the release and maintenance of the integrity of the protoplast (Mukherjee and Sengupta 1988). Chang et al. (1985) and Savitha et al. (2010) have reported that 0.6 M KCl served as the best osmotic stabilizer for Trichoderma sp. and Rhizoctonia solani. Tashpulatov et al. (1991) have reported that 0.4 M NaCl and 0.7 M mannitol were effective in protoplast yield from T. harzianum.
The molecular weight of PEG is critical to the fusion frequency and in most of the studies PEG chain length of 4000 or 6000 was used (Revathi and Lalithakumari 1993). 40 % PEG was reported as optimum for interspecific fusion of protoplasts between T. harzianum and Trichoderma longibrachiatum (Mrinalini and Lalithakumari 1998) and the concentration between 40 % and 60 % was suitable for protoplasts fusion in different fungi (Hashiba and Yamada 1984). The higher frequency of regeneration from fungal protoplasts is not only the foundation of fungi genetic manipulation and improvement but also a good experimental system
for the study of gene expression and molecular studies (Xuanwei et al. 2008). Fused protoplasts
grew very fast than parental strains. Similar observations have been made by Prabavathy et al. in Trichoderma harzianum.
This article is protected by copyright. All rights reserved.
Accepted Article
The higher frequency of regeneration from fungal protoplasts is not only the foundation of fungal genetic manipulation and improvement but also a good experimental system for the
study of gene expression and molecular studies (Xuanwei et al. 2008). Reversion and regeneration of protoplasts to normal mycelia is important. Colony morphology has been used to identify interspecific and intergeneric fusion
products especially if the species differ greatly in colony morphology (Mrinalini 1997). Protoplast fusion may have resulted in genetic interaction at the metabolic level, giving rise to the pigment variation in hybrid colonies. The modification or stimulation of pigment production
during protoplast hybridization has been observed in other species of fungi also (Kevei and Peberdy 1977; Raymond et al. 1986). Random amplified polymorphic DNA (RAPD) and restriction fragment length
polymorphism (RFLP) techniques have been used for protoplast fusant identification. Mycologists are working on new techniques of polymerase chain reaction with primers specific for fungi followed by either terminal restriction fragment length polymorphism analysis (TRFLP) or DGGE (Nikolcheva and Barlocher 2003a). DGGE, however, can distinguish differences in sequences down to one nucleotide (Barlocher, 2010). By using DGGE, gene diversity can more accurately be visualized rather than simply relying on gene size as is the case with traditional agarose gel electrophoresis (Nikolcheva and Barlocher 2003b). From present study, it was found that DDGE analysis is a method that enables confirmation of protoplast fusion. Considering the pattern of CSCW degradation literature survey revealed that
Streptomyces rimosus was also effective in shrimp shell decomposition 38.2 % after 14 days (Brzezinska et al. 2013) while Hoang et al. (2010) studied the degradation of shrimp shells by
This article is protected by copyright. All rights reserved.
Accepted Article
Streptomyces sp TH-11 in 21 days. Wang et al. (2001) reported microbial reclamation of shellfish wastes for the production of chitinases where they prepared shrimp and crab shell powder by boiling and crushing shellfish processing waste which was used as a substrate for chitinolytic microorganisms. Moreover, ability of fusant to degrade CSCW efficiently than parent in short incubation time revealed foundation of hybrid strain by protoplast fusion technique in the reclamation of seafood processing crustacean bio-waste. Enormous efforts are being invested by investigators in harnessing new species of
microorganisms as well as different bioprocesses for economic enzyme production. In this aspect, protoplast fusion technique provides way of strain improvement programme. With enormous significance of protoplast fusion technique in gene manipulation, it is possible to develop superior hybrid strains in fungi that lack sexual reproduction capability.
Acknowledgements Nilambari S. Patil and Swapnil M. Patil wish to thank UGC, New Delhi for awarding
BSR meritorious fellowship for doctoral research. Corresponding author wishes to thank DBT– IPLS programme.
Conflict of interest Authors declare that they have no conflict of interest.
References Barlocher, F. (2010) Molecular approaches promise a deeper and broader understanding of the evolutionary ecology of aquatic hyphomycetes. J N Am Benthlol Soc 29, 1027-1041.
This article is protected by copyright. All rights reserved.
Accepted Article
Bos, C., Slakhorst, S. (1981) Isolation of protoplasts from Aspergillus nidulans conidiospores. Can J Microbiol 27, 400-407. Brzezinska, M.S., Jankiewicz, U. and Walczak, M. (2013) Biodegradation of chitinous substances and chitinase production by the soil actinomycete Streptomyces rimosus. Int Biodeter Biodegr 84, 104-110. Chang, S.T., Li, G.S. and Peberdy, J.F. (1985) Isolation of protoplast from edible fungi. Mircen J 1, 185–194. Cortezi, M., Cilli, E. and Contiero, J. (2008) Bacillus amyloliquefaciens: a new keratinolytic feather degrading bacteria. Curr Trends Biotechnol Pharm 2,170−177. Godrat, R., Alireza, K., Ardeshir, N.J. and Saeid, S. (2005) Evaluation of genetic variability in a breeder flock of native chicken based on randomly amplified polymorphic DNA markers. Iran J Biotech 3, 231-234. Hashiba, T. and Yamada, M. (1984) Interspecific protoplast fusion between auxotrophic mutants of Rhizoctonia solani. Phytopathol 74, 398–400. Healy, M.G., Romo, C.R. and Bustos, R. (1994) Bioconversion of marine crustacean shell waste. Resour Conserv Recy 11,139-147. Hoang, K.C., Lai, T.H., Lin, C.S., Chen, Y.T. and Liau, C.Y. (2011) The chitinolytic activities of Streptomyces sp. TH-1. Int J Mol Sci 12, 56-65. Hsu, S.C. and Lockwood, J.L. (1975) Powdered chitin agar as a selective medium for enumeration of actinomycetes in water and soil. J Applied Microbiol 9,422–426. Joshi, S.M., Inamdar, S.A., Patil, S.M. and Govindwar, S.P. (2013) Molecular assessment of shift in bacterial community in response to Congo red. Int Biodeter Biodegr 77, 18-21.
This article is protected by copyright. All rights reserved.
Accepted Article
Kenji, S., Akira, Y., Hajime, K., Mamoru, W. and Mitsuaki, M. (1998) Purification and characterization of three thermostable endochitinases of a noble Bacillus strain, MH-1, isolated from chitin containing compost. Appl Environ Microbiol 64, 3397–3402. Kevei, F. and Peberdy, J.F. (1977) Interspecific hybridization between Aspergillus nidulans and Aspergillus rugulosus by fusion of somatic protoplasts. J Gen Microbiol 102,255–262. Kirimura, K., Yaguchi, T. and Usami, S. (1986) Intraspecific protoplast fusion of citric acidproducing strains of Aspergillus niger. J Ferment Technol 64,473-479. Knowles, J., Lehtovaara, P., Penttila, M., Salovuori, I. and Andre, L. (1987) The application of recombinant-DNA technology to cellulases and lignocellulosic wastes. Phil Trans R Soc Lond 321, 449-454. Kramer, K.J. and Koga, D. (1986) Insect chitin: physical state, synthesis, degradation and metabolic rate. Insect Biochem 16, 851–877. Lalithakumari, D. (2000) Fungal Protoplasts—A Biotechnological Tool. Oxford & IBH Publishing Company Private Limited, New Delhi, India. Lima, N., Moreira, C., Teixeira, J.A and Mota, M. (1995) Introduction of flocculation into industrial yeast, Saccharomyces cerevisiae sake, by protoplast fusion. Microbios 328,187197. Lower, S.E. (1984) Polymers from the sea: Chitin and chitosan. Manufac Chem 55, 73–75. Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, R.J. (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193,265–275. Miller, G.L. (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 31,426–428.
This article is protected by copyright. All rights reserved.
Accepted Article
Mrinalini, C. (1997) Strain improvement for enhancement and integration of biocontrol potential and fungicide tolerance in Trichoderma spp. Ph.D. Thesis, University of Madras, Chennai, India. Mrinalini, C. and Lalithakumari, D. (1998) Integration of enhanced biocontrol efficacy and fungicide tolerance in Trichoderma spp. by electrofusion. J Plant Dis Prot 105, 34–40. Mukherjee, M. and Sengupta, S. (1988) Isolation and regeneration of protoplasts from Termitomyces clypeatus. Can J Microbiol 34, 1330–1332. Murlidhar, R. and Panda, T. (2000) Fungal protoplast fusion : A revisit. Bioprocess Biosyst Engg 22,429-431. Muyzer G. and Smalla K. (1998) Application of denaturating gradient gel electrophoresis (DGGE) and temperature gradient get electrophoresis (TGGE) in microbial ecology. A van Leeuw 93,127-141. Muyzer, G., De Waal, E. and Uitterlinden, A.G. (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis: analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environment Microb 59, 695–700. Nikolcheva, L.G. and Barlocher, F. (2003a) Molecular approaches to estimate fungal diversity. I terminal restriction fragment length polymorphism (T-RFLP). In: Graca MAS, Barlocher F and Gessner MO (ed.) Methods to study litter decomposition: A Practical Guide. Springer, Dordrecht, Netherlands, pp. 151-158. Nikolcheva, L.G. and Barlocher, F. (2003b) Molecular approaches to estimate fungal diversity.II. Denaturing gradient gel electrophoresis (DGGE). In: Graca MAS, Barlocher F and Gessner MO (ed.) Methods to study litter decomposition: A Practical Guide. Springer,Dordrecht, Netherlands, pp. 151-158.
This article is protected by copyright. All rights reserved.
Accepted Article
Nirmala, R.R. (1991) Shrimp waste utilization, INFOFISH Technical Handbook 4. Kulalumpur: INFOFISH. Ogawa, K., Ohara, H., Koide, T. and Toyama, N. (1989) Interspecific hybridization of T. reesei by protoplast fusion. J Ferment Bioeng 67,207– 209. Patil, N.S., Waghmare, S.R. and Jadhav, J.P. (2013) Purification and characterization of an extracellular antifungal chitinase from Penicillium ochrochloron MTCC 517 and its application in protoplast formation. Proc Biochem 48, 176–183. Patil, N.S. and Jadhav, J.P. (2014) Enzymatic production of N-acetyl-D-glucosamine by solid state fermentation of chitinase by Penicillium ochrochloron MTCC 517 using agricultural residues. Int Biodeter Biodegr 91, 9–17. Prabavathy, V.R., Mathivanan, N., Sagadevan, E., Murugesan, K. and Lalithakumari, D. (2006) Self-fusion of protoplasts enhances chitinase production and biocontrol activity in Trichoderma harzianum. Bioresour Technol 97, 2330–2334. Prabha, T.R., Revathi, K., Vinod, M.S., Shanthakumar, P. and Bernard, P. (2013) A simple method for total genomic DNA extraction from water moulds. Curr Sci 104,345-347. Raymond, P., Veau, P. and Fevre, M. (1986) Production by protoplast fusion of new strains of Penicillium caseicolum for use in the dairy industry. Enzyme Microb Technol 8, 45–48. Revathi, R. and Lalithakumari, D. (1993) Venturia inaequalis: a novel method for protoplast isolation and regeneration. J Plant Dis Prot 100,211–219. Savitha, S., Sadhasivam, S. and Swaminathan, K. (2010) Regeneration and molecular characterization of an intergeneric hybrid between Graphium putredinis and Trichoderma harzianum by protoplasmic fusion. Biotech Adv 28,285–292.
This article is protected by copyright. All rights reserved.
Accepted Article
Senthil Kumar, N. and Gurusubramanian, G. (2011) Random amplified polymorphic DNA (RAPD) markers and its applications. Sci Vis 3,116-124. Stasz, T.E., Harman, G.E. and Weeden, N.F. (1988) Protoplast preparation and fusion in two biocontrol strains of Trichoderma harzianum. Mycologia 80, 141–150. Tashpulatov, Z.H., Shulman, T.S., Baibev, B.G. and Mirzarakhimowa, M. (1991) Protoplast formation and regeneration by cellulolytically active fungus Trichoderma harzianum 19. Microbiologia 60,541–545. Waghmare, S.R. and Ghosh, J.S. (2010) Study of thermostable chitinases from Oerskovia xanthineolytica NCIM 2839. Appl Microbiol Biotechnol 86, 1849- 1856. Wang, S.Y., Moyne, A.L., Thootappilly, G., Wu, S.J., Locy, R.D. and Singh, N.K. (2001) Purification and characterization of a Bacillus cereus exochitinase. Enzyme Microb Technol 28,492-498. Wassila, A., Leila, A., Lydia, A. and Abdeltif, A. (2013) Chitin Extraction from Crustacean Shells by Biological Methods – A review. Food Technol Biotechnol 51, 12–25. White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, pp. 315–322. Xuanwei, Z., Yamin, W., Zinan, W., Juan, L., Lu, L. and Kexuan, T.T. (2008) Protoplast formation, regeneration and transformation from the taxol-producing fungus Ozonium sp. African. J Biotechnol 7, 2017-2024.
`
Yutaka, K., Mori, N., Yamamoto, M., Ohiwa, T. and Ichikawa, Y. A. (1988) simple method for protoplast formation and improvement of protoplast regeneration from various fungi using an enzyme from Trichoderma harzianum. Appl Microbiol Biotechnol 28,445-450.
This article is protected by copyright. All rights reserved.
Accepted Article
Figure captions Figure 1. Microscopic observation (400×) of hyphae and released protoplasts. (A) Parent hyphae of Aspergillus oryzae, (B) Parent hyphae of Trichoderma harzianum, (C,D) Release of protoplasts after digestion of hyphal tip by the action of chitinase, (E) Single protoplasts. Figure 2. Intrageneric protoplast fusion between Aspergillus oryzae and Trichoderma harzianum. (A) Close contact and formation of pair of protoplasts with each other, (B) Rupture of membranes of fusing protoplasts, (C) Complete rupture of membranes and fusion of protoplasts. Figure 3. Nuclear staining of fused protoplasts. Figure 4. Regeneration of protoplasts. (A) Aspergillus oryzae. (B) Trichoderma harzianum, (C) fused protoplasts on 2 % colloidal chitin agar. Figure 5. PCR amplification (A) and DGGE analysis (B) of Aspergillus oryzae (1), Trichoderma harzianum (2) and fusant (3). Figure 6. Degradation of CSCW by Aspergillus oryzae and Trichoderma harzianum and fusant.
This article is protected by copyright. All rights reserved.
Accepted Article
Tables
Table 1 Effect of polyethylene glycol concentration on protoplast fusion. PEG concentration (%)
Fusion frequency (%)
30
0.15 ±0.09
40
0.34±0.04
50
0.52±0.10
60
0.75±0.06
70
0.61±0.08
Values are mean of three replicates ± standard deviation
Table 2 Chitinase activity and protein content in culture filtrates of parents and fusant
Chitinase activity (U /mL)
Trichoderma harzianum 20 ± 0.06
Aspergillus oryzae 13.63±0.02
Fusant 64 ±0.01
Protein content (µg /mL )
15± 0.08
27 ± 0.001
60 ±0.05
Each value represents the mean ± standard error values (n=3)
This article is protected by copyright. All rights reserved.
Accepted Article
Figures
Fig. 1
This article is protected by copyright. All rights reserved.
Accepted Article
Fig. 2
Fig.3
This article is protected by copyright. All rights reserved.
Accepted Article
Fig.4
Fig. 5
This article is protected by copyright. All rights reserved.
Accepted Article
Fig. 6
This article is protected by copyright. All rights reserved.
Article Type: Original Article
Molecular characterization of intergeneric hybrid between Aspergillus oryzae and Trichoderma harzianum by protoplast fusion
1, 2
Nilambari S. Patil1, Swapnil M. Patil1, Sanjay P. Govindwar2, Jyoti P. Jadhav1, 2* 1
Department of Biotechnology, Shivaji University, Kolhapur- 416004
2
Department of Biochemistry, Shivaji University, Kolhapur- 416004
* Department of Biochemistry and Biotechnology, Shivaji University, Kolhapur- 416004
Running head: Molecular characterization of intergeneric hybrid
*Corresponding author Prof. Mrs. Jyoti P. Jadhav Professor and Head Department of Biotechnology, Shivaji University, Vidyanagar, Kolhapur 416004, India E-mail: [email protected] Tel.: +91 231 2609365 Fax: +91 231 1691533.
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/jam.12711 This article is protected by copyright. All rights reserved.
Accepted Article
Abstract Aims: Protoplast fusion between Aspergillus oryzae and Trichoderma harzianum and application of fusant in degradation of shellfish waste. Methods and Results: The filamentous chitinolytic fungal strains Aspergillus oryzae NCIM
1272 and Trichoderma harzianum NCIM 1185 were selected as parents for protoplast fusion. Viable protoplasts were released from fungal mycelium using enzyme cocktail containing 5 mg mL-1 lysing enzymes from T. harzianum, 0.06 mg mL-1 β-glucuronidase from H. pomatia and 1 mg mL-1 purified P. ochrochloron chitinase in 0.8 M sorbitol as an osmotic stabilizer. Intergeneric protoplast fusion was carried out using 60 % polyethylene glycol as a fusogen. At optimum conditions, the regeneration frequency of the fused protoplasts on colloidal chitin medium and fusion frequency were calculated. Fusant showed higher rate of growth pattern, chitinase activity and protein content than parents. Fusant formation was confirmed by morphological markers viz., colony morphology and spore size and denaturation gradient gel electrophoresis (DGGE). Conclusions: The present study revealed protoplast fusion between Aspergillus oryzae and
Trichoderma harzianum significantly enhanced chitinase activity which ultimately provides potential strain for degradation of shellfish waste. Consistency in the molecular characterization results using DGGE is the major outcome of present study which can be emerged as a fundamental step in fusant identification. Significance and Impact of the Study: Now it is need to provide attention over effective chitin degradation in order to manage shrimp processing issues. In this aspect, ability of fusant to degrade shellfish waste efficiently in short incubation time revealed discovery of potential strain in the reclamation of seafood processing crustacean bio-waste.
This article is protected by copyright. All rights reserved.
Accepted Article
Keywords: Protoplast fusion, intergeneric hybrid, Aspergillus oryzae, Trichoderma harzianum, chitinase, DGGE (denaturing gradient gel electrophoresis)
1. Introduction Chitin is a high molecular weight linear homopolymer of β- 1, 4 linked N-acetyl-D-
glucosamine (Lower 1984). It is found in insects as a major component of the cuticle, the peritrophic membrane and also as a protective sleeve, and in gut lining of many insects (Kramer and Koga 1986). It also constitutes the structural polysaccharide of fungal cell walls and the outer shell of crustaceans, nematodes, etc. (Wang et al. 2001). Chitin and its derivatives have great economical value because of their biological activities and their escalating demand in industrial applications. Main commercial sources of chitin are shells of crustaceans such as shrimps, crabs, lobsters and krill that are available in large quantities by the shellfish processing (Wassila et al. 2013).
In India 60,000 ± 80,000 tonnes of chitinous wastes are produced annually. Shellfish
processing industries faced severe problems in disposing off the formidable quantity of shellfish solid wastes (Nirmala 1991). However, despite small quantity used for the extraction of chitin most of these valuable byproducts are discarded by ocean dumping or incineration. Moreover, chemical method of extraction of chitin involves deproteinization and demineralization which
are expensive and not ecofriendly techniques (Wassila et al. 2013). Therefore, attention must be paid to overcome this problem and discover effective, economic method of chitin utilization in order to manage shrimp processing waste. Bioconversion of waste by microbial chitinase (E.C. 3.2.1.14) which has potential of catalyzing the enzymatic degradation of chitin polymer is
This article is protected by copyright. All rights reserved.
Accepted Article
probably the most cost effective and environment friendly procedure for waste utilization (Healy et al. 1994). Protoplast fusion is an important tool in strain improvement for bringing genetic
recombination and developing hybrid strains in filamentous fungi (Lalithakumari 2000). It is
used to produce interspecific or even intergeneric hybrids. It has become an important tool of gene manipulation because it breakdown the barriers to genetic exchange imposed by conventional mating systems. Protoplast fusion technique has a great potential for genetic analysis and for strain improvement. It is particularly useful for industrially useful microorganisms (Murlidhar and Panda 2000). These techniques have been widely used for enhanced yield in conversion of cellulose to ethanol (Knowles et al. 1987), strain improvement for alcohol fermentation (Lima et al. 1995), citric acid producing strains of Aspergillus niger (Kirimura et al. 1986). Moreover, this technique is an important tool for the genetic manipulation of industrially important fungi. Ogawa et al. (1989) reported enhanced cellulase production in Trichoderma reesei by inter-specific protoplast fusion while Prabavathy et al. (2006) reported increase in chitinase production and biocontrol activity in Trichoderma harzianum by self fusion of protoplasts but not much work has been focused for application of chitinase in shellfish waste degradation using this technique.
Recently, the development of molecular techniques has created new possibilities for the selection and genetic improvement of livestocks (Godrat et al. 2005). Nearly all RAPD markers are dominant, i.e. it is not possible to distinguish whether a DNA segment is amplified from a locus that is heterozygous or homozygous. Co dominant RAPD markers, observed as different-sized DNA segments amplified from the same locus, are detected only rarely. Thus, the RAPD
This article is protected by copyright. All rights reserved.
Accepted Article
technique is notoriously laboratory dependent and not reproducible. Mismatches between the primer and the template concentration may result in the total absence of PCR product as well as in a merely decreased amount of the product. Thus, the RAPD results can be difficult to interpret (Senthil Kumar and Gurusubramanian 2011). On the other hand, denaturing gradient gel electrophoresis (DGGE) is an electrophoresis technique to identify single base changes in segment of DNA. DGGE separates PCR amplicons according to their nucleotides composition and reveals microbial community dynamics in both environmental and pure cultures population studies (Muyzer et al. 1993; Muyzer and Smalla, 1998). DGGE could allow considerable savings of time and treatment costs. The protoplast isolation, regeneration have been reported for different fungi in literature,
however, not much work has been focused on intraspecific and intrageneric protoplast fusion in filamentous fungi. Also, all the reports on strain improvement for high yields of titers of chitinase are by mutation and no reports are available in this regard by exploiting protoplast fusion system. This prompted us to develop an intergeneric fusant of Aspergillus oryzae and
Trichoderma
harzianum
using
protoplast
fusion
technology.
In
addition
molecular
characterization of fusant identification was done by DGGE (Denaturating gradient gel electrophoresis) and approach of fusant was focused for degradation of crab shell waste.
Materials and methods Chemicals and enzymes Chitin and polyethylene glycol were purchased from Sigma (St Louis, MO). Other chemicals used were highest purity and analytical grade. P. ochrochloron MTCC 517 was obtained from MTCC, Chandigarh, Trichoderma harzianum NCIM 1185, Aspergillus oryzae NCIM 1272, were
This article is protected by copyright. All rights reserved.
Accepted Article
procured from NCIM, Pune. Colloidal chitin was prepared from commercial chitin by the method of Hsu and Lockwood (1975).
Screening for chitinase production
1
The organism was tested for chitinase activity on colloidal chitin agar (composition g L-
): NaNO3 (3), K2HPO4 (1), KCl (0.5), MgSO4.7H2O (0.5), FeSO4 (0.01), agar (25) and colloidal
chitin (20), pH 7.0) at 30°C by the method of Kenji et al. (1998). Qualitative and quantitative screening for extracellular chitinase resulted in selecting Trichoderma harzianum and Aspergillus oryzae strain for protoplast fusion programme. The parental strains were cultured on
czapek dox agar medium and maintained on potato dextrose agar medium.
Protoplast formation Protoplast formation was carried out according to method of Kitamoto et al. (2000) with
slight modifications. The spore suspensions (1×106 spore’s mL-1) from both fungi have been
inoculated into potato dextrose broth (pH 6.0). The flasks were incubated on a rotary shaker at 120 rpm for 48 h at 30 oC. After incubation, mycelia were harvested by filtration through cheese cloth and collected by centrifugation at (1000×g, 5 min) and washed twice with distilled water. Protoplasting was performed using 50 mg wet mycelia in 5.0 ml of 25 mM sodium phosphate buffer, pH 7.0. For protoplast generation, enzyme cocktail containing 5 mg mL-1 lysing enzymes
from T. harzianum, 0.06 mg mL-1 β-glucuronidase from H. pomatia and 1 mg mL-1 purified P.
ochrochloron chitinase (Patil et al. 2013) and osmotic stabilizer 0.8 M sorbitol; were incubated at 37 °C on a rotary shaker (120 rpm) and protoplast release was examined under light microscope. After 2 h, the protoplasts preparation was filtered through sterile cotton wad and centrifuged at
This article is protected by copyright. All rights reserved.
Accepted Article
100 rpm for 10 min. The supernatant was discarded and the sedimented protoplasts were suspended immediately in buffered-osmotic stabilizer solution. Protoplast yield (protoplasts mL1
) was determined by using a Neubauer haemocytometer (Marienfeld).
Protoplast fusion Fusion of protoplasts of Trichoderma harzianum and Aspergillus oryzae was carried out
by the method of Stasz et al. (1988) with slight modification. Polyethylene glycol (PEG)
prepared in STC buffer (0.8 M Sorbitol; 10 mM Tris–HCl; 10 mM CaCl2, pH 6.5) was used as
fusogen. One mL of protoplast suspension from each parents were mixed with equal volume of PEG solution (6000, 60 %) and the fusion mixture was incubated at 30 °C. After 10 min, the mixture was diluted with 1 mL of STC buffer. The PEG in the fusion mixture was washed away, using STC buffer and the fused protoplasts were collected by centrifugation at 100 rpm for 10 min, suspended in STC buffer and plated on 2 % colloidal chitin agar (CCA) selective medium containing (g L-1) colloidal chitin (5.0), NaNO3(2.0), K2HPO4 (1.0), KCl (0.5), MgSO4 (0.5), FeSO4 (0.01), sucrose (0.8 M), agar (15) distilled water 1000 ml at pH 7.0. The plates were incubated at 25 °C and the protoplast regeneration and development of colonies were observed. The regenerated protoplasts were transferred to PDA slants. Nuclear staining of fused protoplasts has been performed using aceto-orcein stain (Bos and Slakhorst 1981).
Markers for fusant identification Colony morphology, spore size were used as fusant markers. DGGE analysis was
performed using molecular marker of ITS region for fusant identification. The genomic DNA of parent 1, 2 and fusant was extracted according to the method described by Prabha et al. (2013).
This article is protected by copyright. All rights reserved.
Accepted Article
NrITS region were first amplified using the primer pairs ITS1 forward and ITS2 reverse according to White et al. (1990). All reactions were carried out in a 50 μL reaction mixture
containing 1X PCR buffer, 1 pM, 1 nM of dNTPs, 2 mM MgSO4, 1 unit Taq DNA polymerase, 0.25 pM of forward and reverse primers and 2 μL of template DNA. The thermocycling program was as follows: initial denaturation at 95 oC for 5 min, 35 cycles of 95 oC for 15 s, 50 oC for 15 s, and 72 oC for 15 s, followed by 10 min final extension at 72 oC. PCR product was then check on 2 % agarose gel. Successfully amplified products were then purified using GenEluteTM PCR
clean-up kit (Sigma) as per manufacture instruction. For DGGE analysis, a nested PCR was performed in a total volume of 50 μL, each with 2
μL of purified PCR product from the previous reaction as template DNA. Amplification was performed using the forward primer ITS1-GC clamped (CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCGCGGCCGC) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC). Nested PCR reaction were performed at higher stringency (increasing temperature by 4 °C and decreasing cycles to 30). The cycling scheme was as follows: 5 min denaturation at 94 oC, followed by 35 cycles of 1 min denaturation at 94 oC, 1 min annealing at 58 oC for ITS1-GC primer or 62 oC for ITS2-GC primer, 1 min extension at 72 o
C with a final extension step at 72 oC. PCR products were analyzed by electrophoresis in a 2 %
(w/v) agarose gel. Amplified product was purified and denaturing gradient gel electrophoresis (DGGE) of
concentrated product was performed using Decode Universal Mutation Detection System (BioRad). Samples were loaded onto 8 % (w/v) polyacrylamide gels (37.5:1, acrylamide: bisacrylamide) in 1× TAE buffer with a denaturing gradient ranging from 20 % to 80 % ,
This article is protected by copyright. All rights reserved.
Accepted Article
denaturant run at 60 oC, 100 V for 12 hr (Joshi et al. 2013). Gel was stained using SYBR gold and visualized on UVITEC gel documentation system.
Estimation of protein and chitinase activity in the culture filtrates Above stated medium in screening was used for the production of chitinase. Parents and
fusants (2 × 107 spores mL-1) were inoculated in flasks containing medium that has colloidal
chitin as sole source of carbon and incubated in an orbital shaker at 40 °C and 120 rpm for 72 h. After 72 hrs, the cultures were harvested, filtered through Whatman No. 1 filter paper and centrifuged at 8161× g at 4 °C. The cell free culture filtrates of parent and fusants were used as enzyme sources for chitinase assay. Chitinase enzyme assay was carried out with colloidal chitin as a substrate. The assay
mixture contained 1 ml 0.5 % colloidal chitin, 0.5 ml sodium phosphate buffer (25 mM, pH 7.0) and 0.5 ml enzyme solution, which was incubated for 1h at 40 °C (Waghmare and Ghosh 2010). The reducing sugar released during the reaction was quantified by using N-acetyl-β-Dglucosamine standards with concentrations ranging from 100 to 1,000 μg mL−1 by DNS method (Miller 1959). One unit of enzyme activity was defined as the amount of enzyme required to release 1 μmol of reducing sugar from colloidal chitin per minute. The protein content was estimated by Lowry et al. (1951) using bovine serum albumin as standard protein.
Decomposition of crab shell waste by parent and fusant Fresh crab shell chitin waste (CSCW) containing head and shell was obtained from local
marine food supplier market. It was washed twice with tap water in order to remove the dirt. The washed CSCW chips were dried at 60 °C for 24 h in a hot air oven, milled with an electric wearing blender and sieved through mesh sieve. The CSCW powder was used for further process This article is protected by copyright. All rights reserved.
Accepted Article
without any further demineralization or deproteinization. To test the degradation of CSCW parents and fusant strain were cultured with degradation media containing 0.1 % (w/v) of CSCW powder with vigorous agitation at 40 °C. The percentage degradation of CSCW was determined by considering the dry weight of
substrate remaining in the culture broth at the end of experiment. The results were expressed as percentage of the initial weight (considered as 100 %) and calculated by comparison between the dry weight of residual substrate before and after hydrolysis (Cortezi et al. 2008).
Results Effect of enzyme concentration for protoplast formation Penicillium ochrochloron MTCC 517 has been reported earlier for chitinase production
in submerged (Patil et al. 2013) and solid state fermentation (Patil et al. 2014). Enzyme cocktail posse’s immense potential to digest the cell wall of various fungi and production of large number of protoplasts. It was observed that lysing enzyme β-glucuronidase was not much effective in the release of protoplasts, when used individually. Combination of the enzyme cocktail with 5 mg mL-1 lysing enzymes from T. harzianum, 0.06 mg mL-1 β-glucuronidase from H. pomatia in
combination with 1 mg mL-1 purified P. ochrochloron chitinase, lysed the cell wall components efficiently and yielded high amounts of protoplasts. The amount of protoplasts obtained after enzymatic treatment were 5.2 × 107 and 1 × 106 for Aspergillus oryzae and Trichoderma harzianum respectively. Effect of osmotic stabilizers In order to identify the best osmotic stabilizers, we used different osmotic stabilizers at 0.8 M concentration. Among them, 0.8 M sorbitol was found to be optimal for release of protoplasts from both T. harzianum and A. oryzae (data not shown).
This article is protected by copyright. All rights reserved.
Accepted Article
Effect of incubation time The maximum yields of protoplasts were reached after 2 h incubation, but the number
decreased above 3 h due to bursting and prolonged incubation caused lysis of protoplasts. Empty hyphal segments were detected after protoplasts were released into surrounding medium through openings in the cell wall. Protoplasts released after 1 hr of incubation from partially digested
mycelia and large size protoplasts have been obtained after 2 hr of incubation (Fig 1).
Effect of PEG concentration during protoplast fusion The effect of PEG concentration on protoplast fusion was studied with various
concentrations of PEG (30–70 % v/v) with a uniform concentration of 10 mM CaCl2. The present study revealed that incubation mixture containing 10 mM CaCl2 and 10 mM Tris - HCl
buffer with 1 ml of PEG (60 %) was favorable for the development of fusant (Table 1). When PEG solution was added to the protoplasts, they were attracted with each other. Later, the plasma membrane at the place of contact dissolved and protoplasmic contents fused together. Finally, the fusion protoplasts became single oval shaped structures (Fig 2). Nuclear staining showed presence of two nuclei in fused protoplasts (Fig 3). The present study revealed that incubation mixture containing 10 mM CaCl2, 0.8 M sorbitol and 10 mM Tris – HCl buffer with 1 ml of PEG (60 %) was favorable for the development of fusant.
Selection of fusants The fused protoplasts were plated on 2 % colloidal chitin medium for fusant selection.
Fused protoplasts grew very fast than parental strains. Similar observations have been made by Prabavathy et al. (2006) in Trichoderma harzianum.
This article is protected by copyright. All rights reserved.
Accepted Article
The parental colonies of T. harzianum were pure white in color while A. oryzae parental colonies were greenish in color. The fusant colonies were greenish white in color (Fig 4). Spore size was considered by Mrinalini (1997) to select fusants of Trichoderma sp. The sizes of the conidiospores were 4.96 um, 5.12 um and 5.84 um (diam.) in A. oryzae, T. harzianum and fusant respectively. In the present study, DGGE has been focused as a molecular tool for identification of
fusant. After extraction of DNA from parents and fusant, ITS was amplified using ITS1 and ITS2 primers, which were subsequently analyzed by denaturing gradient gel electrophoresis (DGGE). PCR amplification of the extracted DNA from parents and fusant showed single amplification product of 300 bps on 2 % agarose gel (Fig 5A). In DGGE analysis single band were observed in the case of both parents but at different position. On the other hand, in fusant sample two bands were observed and their respective position confirms the fusion process (Fig 5B). Estimation of protein and chitinase activity in the culture filtrates In addition to growth pattern, fusant showed enhanced production of extracellular
chitinase and protein content (Table 2). High protein content was observed in fusant than in parent. Similarly, in case of chitinase production appreciable increase in chitinase activity was observed in fusant than in parent. The formed fusant by protoplast fusion shows the productivity of chitinase maximum
upto four subcultures in 6 months thereafter slight decrease in activity was observed. Decomposition of crab shell waste by parent and fusant Highly chitinolytic fusant strain was used for degradation of crab shell waste. The fusant
was able to degrade 0.1 % CSCW at about 92 % in 4 days (Fig 6).
This article is protected by copyright. All rights reserved.
Accepted Article
Discussion A lot of work needs to be done on strain improvement of different fungi by protoplast
fusion for increasing the production of industrially important enzymes. With a view of strain improvement, the present study is aimed at developing an intergeneric fusant between slow growing high chitinase producing fungus Trichoderma harzianum and fast growing high
chitinase producing fungus Aspergillus oryzae. Osmotic stabilizers are one of the important parameters for high yield of protoplasts.
Osmotic stabilizers play an important role in the release and maintenance of the integrity of the protoplast (Mukherjee and Sengupta 1988). Chang et al. (1985) and Savitha et al. (2010) have reported that 0.6 M KCl served as the best osmotic stabilizer for Trichoderma sp. and Rhizoctonia solani. Tashpulatov et al. (1991) have reported that 0.4 M NaCl and 0.7 M mannitol were effective in protoplast yield from T. harzianum.
The molecular weight of PEG is critical to the fusion frequency and in most of the studies PEG chain length of 4000 or 6000 was used (Revathi and Lalithakumari 1993). 40 % PEG was reported as optimum for interspecific fusion of protoplasts between T. harzianum and Trichoderma longibrachiatum (Mrinalini and Lalithakumari 1998) and the concentration between 40 % and 60 % was suitable for protoplasts fusion in different fungi (Hashiba and Yamada 1984). The higher frequency of regeneration from fungal protoplasts is not only the foundation of fungi genetic manipulation and improvement but also a good experimental system
for the study of gene expression and molecular studies (Xuanwei et al. 2008). Fused protoplasts
grew very fast than parental strains. Similar observations have been made by Prabavathy et al. in Trichoderma harzianum.
This article is protected by copyright. All rights reserved.
Accepted Article
The higher frequency of regeneration from fungal protoplasts is not only the foundation of fungal genetic manipulation and improvement but also a good experimental system for the
study of gene expression and molecular studies (Xuanwei et al. 2008). Reversion and regeneration of protoplasts to normal mycelia is important. Colony morphology has been used to identify interspecific and intergeneric fusion
products especially if the species differ greatly in colony morphology (Mrinalini 1997). Protoplast fusion may have resulted in genetic interaction at the metabolic level, giving rise to the pigment variation in hybrid colonies. The modification or stimulation of pigment production
during protoplast hybridization has been observed in other species of fungi also (Kevei and Peberdy 1977; Raymond et al. 1986). Random amplified polymorphic DNA (RAPD) and restriction fragment length
polymorphism (RFLP) techniques have been used for protoplast fusant identification. Mycologists are working on new techniques of polymerase chain reaction with primers specific for fungi followed by either terminal restriction fragment length polymorphism analysis (TRFLP) or DGGE (Nikolcheva and Barlocher 2003a). DGGE, however, can distinguish differences in sequences down to one nucleotide (Barlocher, 2010). By using DGGE, gene diversity can more accurately be visualized rather than simply relying on gene size as is the case with traditional agarose gel electrophoresis (Nikolcheva and Barlocher 2003b). From present study, it was found that DDGE analysis is a method that enables confirmation of protoplast fusion. Considering the pattern of CSCW degradation literature survey revealed that
Streptomyces rimosus was also effective in shrimp shell decomposition 38.2 % after 14 days (Brzezinska et al. 2013) while Hoang et al. (2010) studied the degradation of shrimp shells by
This article is protected by copyright. All rights reserved.
Accepted Article
Streptomyces sp TH-11 in 21 days. Wang et al. (2001) reported microbial reclamation of shellfish wastes for the production of chitinases where they prepared shrimp and crab shell powder by boiling and crushing shellfish processing waste which was used as a substrate for chitinolytic microorganisms. Moreover, ability of fusant to degrade CSCW efficiently than parent in short incubation time revealed foundation of hybrid strain by protoplast fusion technique in the reclamation of seafood processing crustacean bio-waste. Enormous efforts are being invested by investigators in harnessing new species of
microorganisms as well as different bioprocesses for economic enzyme production. In this aspect, protoplast fusion technique provides way of strain improvement programme. With enormous significance of protoplast fusion technique in gene manipulation, it is possible to develop superior hybrid strains in fungi that lack sexual reproduction capability.
Acknowledgements Nilambari S. Patil and Swapnil M. Patil wish to thank UGC, New Delhi for awarding
BSR meritorious fellowship for doctoral research. Corresponding author wishes to thank DBT– IPLS programme.
Conflict of interest Authors declare that they have no conflict of interest.
References Barlocher, F. (2010) Molecular approaches promise a deeper and broader understanding of the evolutionary ecology of aquatic hyphomycetes. J N Am Benthlol Soc 29, 1027-1041.
This article is protected by copyright. All rights reserved.
Accepted Article
Bos, C., Slakhorst, S. (1981) Isolation of protoplasts from Aspergillus nidulans conidiospores. Can J Microbiol 27, 400-407. Brzezinska, M.S., Jankiewicz, U. and Walczak, M. (2013) Biodegradation of chitinous substances and chitinase production by the soil actinomycete Streptomyces rimosus. Int Biodeter Biodegr 84, 104-110. Chang, S.T., Li, G.S. and Peberdy, J.F. (1985) Isolation of protoplast from edible fungi. Mircen J 1, 185–194. Cortezi, M., Cilli, E. and Contiero, J. (2008) Bacillus amyloliquefaciens: a new keratinolytic feather degrading bacteria. Curr Trends Biotechnol Pharm 2,170−177. Godrat, R., Alireza, K., Ardeshir, N.J. and Saeid, S. (2005) Evaluation of genetic variability in a breeder flock of native chicken based on randomly amplified polymorphic DNA markers. Iran J Biotech 3, 231-234. Hashiba, T. and Yamada, M. (1984) Interspecific protoplast fusion between auxotrophic mutants of Rhizoctonia solani. Phytopathol 74, 398–400. Healy, M.G., Romo, C.R. and Bustos, R. (1994) Bioconversion of marine crustacean shell waste. Resour Conserv Recy 11,139-147. Hoang, K.C., Lai, T.H., Lin, C.S., Chen, Y.T. and Liau, C.Y. (2011) The chitinolytic activities of Streptomyces sp. TH-1. Int J Mol Sci 12, 56-65. Hsu, S.C. and Lockwood, J.L. (1975) Powdered chitin agar as a selective medium for enumeration of actinomycetes in water and soil. J Applied Microbiol 9,422–426. Joshi, S.M., Inamdar, S.A., Patil, S.M. and Govindwar, S.P. (2013) Molecular assessment of shift in bacterial community in response to Congo red. Int Biodeter Biodegr 77, 18-21.
This article is protected by copyright. All rights reserved.
Accepted Article
Kenji, S., Akira, Y., Hajime, K., Mamoru, W. and Mitsuaki, M. (1998) Purification and characterization of three thermostable endochitinases of a noble Bacillus strain, MH-1, isolated from chitin containing compost. Appl Environ Microbiol 64, 3397–3402. Kevei, F. and Peberdy, J.F. (1977) Interspecific hybridization between Aspergillus nidulans and Aspergillus rugulosus by fusion of somatic protoplasts. J Gen Microbiol 102,255–262. Kirimura, K., Yaguchi, T. and Usami, S. (1986) Intraspecific protoplast fusion of citric acidproducing strains of Aspergillus niger. J Ferment Technol 64,473-479. Knowles, J., Lehtovaara, P., Penttila, M., Salovuori, I. and Andre, L. (1987) The application of recombinant-DNA technology to cellulases and lignocellulosic wastes. Phil Trans R Soc Lond 321, 449-454. Kramer, K.J. and Koga, D. (1986) Insect chitin: physical state, synthesis, degradation and metabolic rate. Insect Biochem 16, 851–877. Lalithakumari, D. (2000) Fungal Protoplasts—A Biotechnological Tool. Oxford & IBH Publishing Company Private Limited, New Delhi, India. Lima, N., Moreira, C., Teixeira, J.A and Mota, M. (1995) Introduction of flocculation into industrial yeast, Saccharomyces cerevisiae sake, by protoplast fusion. Microbios 328,187197. Lower, S.E. (1984) Polymers from the sea: Chitin and chitosan. Manufac Chem 55, 73–75. Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, R.J. (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193,265–275. Miller, G.L. (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 31,426–428.
This article is protected by copyright. All rights reserved.
Accepted Article
Mrinalini, C. (1997) Strain improvement for enhancement and integration of biocontrol potential and fungicide tolerance in Trichoderma spp. Ph.D. Thesis, University of Madras, Chennai, India. Mrinalini, C. and Lalithakumari, D. (1998) Integration of enhanced biocontrol efficacy and fungicide tolerance in Trichoderma spp. by electrofusion. J Plant Dis Prot 105, 34–40. Mukherjee, M. and Sengupta, S. (1988) Isolation and regeneration of protoplasts from Termitomyces clypeatus. Can J Microbiol 34, 1330–1332. Murlidhar, R. and Panda, T. (2000) Fungal protoplast fusion : A revisit. Bioprocess Biosyst Engg 22,429-431. Muyzer G. and Smalla K. (1998) Application of denaturating gradient gel electrophoresis (DGGE) and temperature gradient get electrophoresis (TGGE) in microbial ecology. A van Leeuw 93,127-141. Muyzer, G., De Waal, E. and Uitterlinden, A.G. (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis: analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environment Microb 59, 695–700. Nikolcheva, L.G. and Barlocher, F. (2003a) Molecular approaches to estimate fungal diversity. I terminal restriction fragment length polymorphism (T-RFLP). In: Graca MAS, Barlocher F and Gessner MO (ed.) Methods to study litter decomposition: A Practical Guide. Springer, Dordrecht, Netherlands, pp. 151-158. Nikolcheva, L.G. and Barlocher, F. (2003b) Molecular approaches to estimate fungal diversity.II. Denaturing gradient gel electrophoresis (DGGE). In: Graca MAS, Barlocher F and Gessner MO (ed.) Methods to study litter decomposition: A Practical Guide. Springer,Dordrecht, Netherlands, pp. 151-158.
This article is protected by copyright. All rights reserved.
Accepted Article
Nirmala, R.R. (1991) Shrimp waste utilization, INFOFISH Technical Handbook 4. Kulalumpur: INFOFISH. Ogawa, K., Ohara, H., Koide, T. and Toyama, N. (1989) Interspecific hybridization of T. reesei by protoplast fusion. J Ferment Bioeng 67,207– 209. Patil, N.S., Waghmare, S.R. and Jadhav, J.P. (2013) Purification and characterization of an extracellular antifungal chitinase from Penicillium ochrochloron MTCC 517 and its application in protoplast formation. Proc Biochem 48, 176–183. Patil, N.S. and Jadhav, J.P. (2014) Enzymatic production of N-acetyl-D-glucosamine by solid state fermentation of chitinase by Penicillium ochrochloron MTCC 517 using agricultural residues. Int Biodeter Biodegr 91, 9–17. Prabavathy, V.R., Mathivanan, N., Sagadevan, E., Murugesan, K. and Lalithakumari, D. (2006) Self-fusion of protoplasts enhances chitinase production and biocontrol activity in Trichoderma harzianum. Bioresour Technol 97, 2330–2334. Prabha, T.R., Revathi, K., Vinod, M.S., Shanthakumar, P. and Bernard, P. (2013) A simple method for total genomic DNA extraction from water moulds. Curr Sci 104,345-347. Raymond, P., Veau, P. and Fevre, M. (1986) Production by protoplast fusion of new strains of Penicillium caseicolum for use in the dairy industry. Enzyme Microb Technol 8, 45–48. Revathi, R. and Lalithakumari, D. (1993) Venturia inaequalis: a novel method for protoplast isolation and regeneration. J Plant Dis Prot 100,211–219. Savitha, S., Sadhasivam, S. and Swaminathan, K. (2010) Regeneration and molecular characterization of an intergeneric hybrid between Graphium putredinis and Trichoderma harzianum by protoplasmic fusion. Biotech Adv 28,285–292.
This article is protected by copyright. All rights reserved.
Accepted Article
Senthil Kumar, N. and Gurusubramanian, G. (2011) Random amplified polymorphic DNA (RAPD) markers and its applications. Sci Vis 3,116-124. Stasz, T.E., Harman, G.E. and Weeden, N.F. (1988) Protoplast preparation and fusion in two biocontrol strains of Trichoderma harzianum. Mycologia 80, 141–150. Tashpulatov, Z.H., Shulman, T.S., Baibev, B.G. and Mirzarakhimowa, M. (1991) Protoplast formation and regeneration by cellulolytically active fungus Trichoderma harzianum 19. Microbiologia 60,541–545. Waghmare, S.R. and Ghosh, J.S. (2010) Study of thermostable chitinases from Oerskovia xanthineolytica NCIM 2839. Appl Microbiol Biotechnol 86, 1849- 1856. Wang, S.Y., Moyne, A.L., Thootappilly, G., Wu, S.J., Locy, R.D. and Singh, N.K. (2001) Purification and characterization of a Bacillus cereus exochitinase. Enzyme Microb Technol 28,492-498. Wassila, A., Leila, A., Lydia, A. and Abdeltif, A. (2013) Chitin Extraction from Crustacean Shells by Biological Methods – A review. Food Technol Biotechnol 51, 12–25. White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, pp. 315–322. Xuanwei, Z., Yamin, W., Zinan, W., Juan, L., Lu, L. and Kexuan, T.T. (2008) Protoplast formation, regeneration and transformation from the taxol-producing fungus Ozonium sp. African. J Biotechnol 7, 2017-2024.
`
Yutaka, K., Mori, N., Yamamoto, M., Ohiwa, T. and Ichikawa, Y. A. (1988) simple method for protoplast formation and improvement of protoplast regeneration from various fungi using an enzyme from Trichoderma harzianum. Appl Microbiol Biotechnol 28,445-450.
This article is protected by copyright. All rights reserved.
Accepted Article
Figure captions Figure 1. Microscopic observation (400×) of hyphae and released protoplasts. (A) Parent hyphae of Aspergillus oryzae, (B) Parent hyphae of Trichoderma harzianum, (C,D) Release of protoplasts after digestion of hyphal tip by the action of chitinase, (E) Single protoplasts. Figure 2. Intrageneric protoplast fusion between Aspergillus oryzae and Trichoderma harzianum. (A) Close contact and formation of pair of protoplasts with each other, (B) Rupture of membranes of fusing protoplasts, (C) Complete rupture of membranes and fusion of protoplasts. Figure 3. Nuclear staining of fused protoplasts. Figure 4. Regeneration of protoplasts. (A) Aspergillus oryzae. (B) Trichoderma harzianum, (C) fused protoplasts on 2 % colloidal chitin agar. Figure 5. PCR amplification (A) and DGGE analysis (B) of Aspergillus oryzae (1), Trichoderma harzianum (2) and fusant (3). Figure 6. Degradation of CSCW by Aspergillus oryzae and Trichoderma harzianum and fusant.
This article is protected by copyright. All rights reserved.
Accepted Article
Tables
Table 1 Effect of polyethylene glycol concentration on protoplast fusion. PEG concentration (%)
Fusion frequency (%)
30
0.15 ±0.09
40
0.34±0.04
50
0.52±0.10
60
0.75±0.06
70
0.61±0.08
Values are mean of three replicates ± standard deviation
Table 2 Chitinase activity and protein content in culture filtrates of parents and fusant
Chitinase activity (U /mL)
Trichoderma harzianum 20 ± 0.06
Aspergillus oryzae 13.63±0.02
Fusant 64 ±0.01
Protein content (µg /mL )
15± 0.08
27 ± 0.001
60 ±0.05
Each value represents the mean ± standard error values (n=3)
This article is protected by copyright. All rights reserved.
Accepted Article
Figures
Fig. 1
This article is protected by copyright. All rights reserved.
Accepted Article
Fig. 2
Fig.3
This article is protected by copyright. All rights reserved.
Accepted Article
Fig.4
Fig. 5
This article is protected by copyright. All rights reserved.
Accepted Article
Fig. 6
This article is protected by copyright. All rights reserved.
