Developmental and Comparative Immunology 51 (2015) 48–55
Contents lists available at ScienceDirect
Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i
Molecular characterization of LvAV in response to white spot syndrome virus infection in the Pacific white shrimp (Litopenaeus vannamei) Shulin He a, Lei Song b, Zhaoying Qian c, Fujun Hou a, Yongjie Liu a, Xianzong Wang a, Zhangming Peng d, Chengbo Sun d, Xiaolin Liu a,*,1 a College of Animal Science and Technology, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Northwest A&F University, Yangling, Shaanxi 712100, China b Department of Politics Teaching Office, Military Economics Academy of Airforce, Wuhan 430035, China c School of Resource & Environmental Management, Guizhou University of Finance and Economics, Guizhou 550025, China d Fisheries College, Guangdong Ocean University, Guangdong 524088, China
A R T I C L E
I N F O
Article history: Received 8 November 2014 Revised 25 February 2015 Accepted 26 February 2015 Available online 28 February 2015 Keywords: Litopenaeus vannamei LvAV C-type lectin WSSV Vibrio parahaemolyticus
A B S T R A C T
Litopenaeus vannamei is the most important farmed shrimp species globally, but its production is affected by several factors, including infectious disease. White spot syndrome virus (WSSV), in particular, causes significant shrimp losses. To understand the shrimp’s immune response against WSSV, we cloned LvAV from L. vannamei and analyzed its expression pattern in different tissues, in addition to its expression following infection. We employed dsRNA and recombinant (r)LvAV to explore the potential role of LvAV in shrimp immunity when infected with WSSV. We find that LvAV is a C-type Lectin composed of 176 amino acids with a signal peptide and a specific C-type Lectin-type domain (CTLD). It shares 81% amino acid similarity with PmAV, an antiviral-like C-type Lectin from Penaeus monodom, and it is highly expressed in the hepatopancreas. Its expression is affected by infection with both WSSV and V. parahaemolyticus. Significantly, injection with rLvAV slowed WSSV replication, while injection with LvAV dsRNA initially led to enhanced virus propagation. Surprisingly, LvAV dsRNA subsequently led to a dramatic decrease in viral load in the later stages of infection, suggesting that LvAV may be subverted by WSSV to enhance viral replication or immune avoidance. Our results indicate that LvAV plays an important, but potentially complex role in the Pacific white shrimp’s immune defense. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Shrimp is the largest single fishery merchandise in international trade (Food and Agricultural Organization). Shrimp farms now produce approximately 50% of global penaeid shrimp output (Moss et al., 2006). Higher growth rate of the Pacific white shrimp (Litopenaeus vannamei) has led to its replacement of the native shrimp as the most important farmed penaeid shrimp species globally (Alcivar-Warren et al., 2007; Wakida-Kusunoki et al., 2011). However, L. vannamei is easily affected by multiple factors, particularly emerging bacterial and viral pathogens that are reported to be responsible for 60% and 20% shrimp damage globally, respectively (Flegel et al., 2008; Liu et al., 2009). Among viruses, white spot
* Corresponding author. College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Shaanxi Yangling 712100, China. Tel.: +86 29 87054333; fax: +86 29 87092164. E-mail address: [email protected] (X. Liu). 1 Professor, as well as Qian Jiang specially invited Expert in the City of Hangzhou. http://dx.doi.org/10.1016/j.dci.2015.02.020 0145-305X/© 2015 Elsevier Ltd. All rights reserved.
syndrome virus (WSSV), a double-stranded DNA virus, is a major pathogenic cause of Pacific white shrimp losses. Studies have attempted to enhance shrimp immunity against WSSV through priming with feed supplemented with inactivated WSSV, WSSV protein and plasmid DNA encoding a viral protein gene (Namikoshi et al., 2004; Pathan et al., 2013; Rout et al., 2007; Witteveldt et al., 2004). Additionally, RNAi pathways as potential antiviral mechanisms in shrimp have been studied (Labreuche and Warr, 2012). But there still has been no effective way to control this disease in L. vannamei farms. In this study, we investigated host innate immune factor involved in shrimp disease control, and identified potential approaches for tackling WSSV disease. Shrimp lack a traditional adaptive immune response. Like many invertebrates, disease prevention is heavily reliant on innate immunity, including a series of humoral and cellular immune factors (Söderhäll, 1999). Humoral defenses are performed by molecules stored within and released from hemocytes such as the prophenoloxidase system (Holmblad and Söderhäll, 1999). Cellular defenses are executed directly by hemocytes (Jiravanichpaisal et al., 2006). As a kind of vital pattern recognition protein, shrimp lectins,
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
which belong to a family of single or multi-domain glycoproteins capable of binding sugar moieties, have been identified as potentially critical immune effector molecules in shrimp defense (Zhang et al., 2009). This family includes Calnexin, Galectins, C-, L-, M-, Pand S-type Lectins (Wang and Wang, 2013). C-type Lectins are calcium-dependent and exist widely in vertebrates and particularly invertebrates. They represent an important recognition mechanism for oligosaccharides at cell surfaces and are unique in that they contain a carbohydrate recognition domain (CRD), which mediates sugar binding with Ca2+ (Drickamer, 1999; Feizi, 2000). C-type Lectin, NK cell receptors, IgE Fc receptors and coagulation factors all possess a C-type Lectin-like domain (CTLD) that plays an important role in immunity (Drickamer, 1999). Antiviral gene (AV) from the shrimp Penaeus monodom (PmAV), was the first shrimp gene found to encode an innate immune protein. It has an open reading frame (ORF) encoding a 170 amino acid peptide containing a CTLD (Luo et al., 2003). PmAV is up-regulated in response to viral infection and recombinant (r)PmAV protein shows high antiviral activity in vitro (Luo et al., 2003). It has been shown that rPmAV can be used as an effective therapeutic agent against WSSV in P. monodon (Pathan et al., 2013). It is not clear if the related Pacific white shrimp (Litopenaeus vannamei) encodes this gene or whether it is involved in shrimp immunity. The purpose of this study was to explore the potential function of the Antiviral protein (AV) in L. vannamei. We characterized the partial cDNA encoding AV from L. vannamei (designated LvAV from hereon), and analyzed its expression in controlled WSSV infection assays. We employed both rLvAV protein and LvAV dsRNA to experimentally upregulate and downregulate LvAV function respectively, in order to investigate the role of LvAV in shrimp immunity following infection with WSSV. We investigated the specificity of the response by conducting parallel experiments using the bacterium Vibrio parahaemolyticus. 2. Materials and methods 2.1. Experimental animals Healthy adult L. vannamei (15–20 g) devoid of WSSV (as detected by PCR) were obtained from a local commercial farm in HengXing (GuangDong, China). Shrimp were acclimated to laboratory conditions by rearing them at 26 ± 1 °C in tanks with recirculating seawater for two weeks. During the acclimation period, the shrimp were fed an artificial shrimp diet twice daily. Only shrimp in intermolt stage were used in this study (de Oliveira Cesar et al., 2006). After acclimation, tissue samples were dissected from three individuals. We isolated hepatopancreas, hemocyte, ovary, gill, muscle, eyestalk and intestine, and extracted RNA from each tissue separately. 2.2. Challenge assay WSSV was supplied by Fuhua Li (Chinese Academy of Science) and the Vibrio parahaemolyticus was preserved by our lab. WSSV was dissolved in phosphate-buffered saline (PBS) and injected into shrimp for in vivo propagation. We purified WSSV from infected shrimp before they had died as previously described (Sun et al., 2013b). Briefly, muscle tissues of WSSV-infected shrimp were homogenized in PBS with 2.4% NaCl on ice followed by centrifugation for 15 min at 7000 rpm (4 °C). The supernatant was added with sucrose to 30% and centrifuged for 50 min at 16 000 rpm (4 °C), followed by filtration through a 0.45 μm filter, after which purified virus was suspended in PBS for subsequent use in experiments. V. parahaemolyticus was cultured in LB medium at 37 °C overnight and centrifuged for 10 min at 7500 rpm, after which bacteria were washed twice and resuspended in PBS followed by heat-killing by boiling for 30 min.
49
Table 1 Primers used in present study. Primer names
Sequences(5′-3′)
Application
LvAV-F LvAV-R LvAVD-F LvAVD-R EF1-αD-F EF1-αD-R LvAVB-F LvAVB-R LvAVi-F
CCGCCGATGTCACAATGAATCT CTCGGATGGTGTCGCAGTATGA GGGTCTTTGGCTGTGGATG TGTTGAGCGACGGAGGTG TGCTCTGGACAACATCGAGC CGGGCACTGTTCCAATACCT CGGGATCCACCTTATACGAGAAAAGTGC GGGAGCTCGTCAAAACTTGTCAGCAGAT TAATACGACTCACTATAGGGAGACCGCCG ATGTCACAATGAATCT TAATACGACTCACTATAGGGAGACTCGG ATGGTGTCGCAGTATGA AAACCTCCGCATTCCTGTGA TCCGCATCTTCTTCCTTCAT
Cloning
LvAVi-R W-F W-R
qRT-PCR
Prokaryotic recombinant expression dsRNA Synthesis
WSSV copies detection (You et al., 2010)
Note: The italic letter in LvAVB-F/R with fine lines were BamH 1 and Xho 1 enzyme restriction sites for recombinant expression, respectively. The italic letter in LvAVi-F/R with bold lines were T7 RNA polymerase binding site for dsRNA in vitro transcription.
Shrimp were separated into three groups after acclimation. Two experimental groups were injected with V. parahaemolyticus and WSSV while the final group was injected with PBS which served as the control. Individuals were injected into the last abdominal segment with 10 μl PBS containing inactive V. parahaemolyticus (107 CFU/ml) and 10 μl (80 copies/μl) WSSV, respectively. The control group was injected with 10 μl of PBS. Hepatopancreas of five shrimp in each group were collected at 0, 2, 4, 6, 12, 24 and 48 h post injection and separately preserved in liquid nitrogen for RNA isolation. 2.3. Total RNA isolation and cDNA synthesis Total RNA was extracted from different shrimp tissues with TRIZOL reagent (Invitrogen, USA) following manufacturer’s instructions. RNA purity was quantified using a ND-1000 spectrophotometer (NanoDrop Technologies, USA) and treated with RNase-free DNase I (Takara) to remove potential DNA contamination before RT-PCR. cDNA was synthesized by PrimeScript RT reagent kit (Takara, Japan) from 500 ng of total RNA using oligo-dT and random hexamer primers according to the manufacturer’s instructions. 2.4. Cloning of LvAV cDNA fragment We designed specific primers based on PmAV (GenBank accession no.: AAQ75589.1). Specific primers (LvAV-F/R) were used to amplify the nucleotide sequence of LvAV from the cDNA of hepatopancreas in L. vannamei. Primer sequences are listed in Table 1. The PCR products were analyzed by electrophoresis on a 1.5% agarose gel to determine amplified fragment size and the target band was purified using a universal DNA purification Kit (TIANGEN, China). The purified fragment was cloned into the pUT-T Easy vector following manufacturer’s instructions (Cwbiotech). Recombinant bacteria were confirmed by PCR and then sequenced. 2.5. Analysis of nucleotide and amino acid sequences The cloned partial cDNA sequence and deduced amino acid sequence of LvAV were analyzed using BLAST algorithm (NCBI). LvAV amino acid sequence analysis was performed with the ExPASy Proteomics Server (Artimo et al., 2012), SignalP 4.0 (Petersen et al., 2011) and SMART (Schultz et al., 1998). Pairwise and multiple sequence alignments were analyzed using ClustalW v4.0 (Thompson et al., 1994). LvAV phylogenies were determined using MEGA v4.0 with the NeighborJoining Method (Saitou and Nei, 1987; Tamura et al., 2007). Bootstrap values were determined based on 1000 pseudo replicates.
50
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
2.6. Quantitative reverse transcription (qRT)-PCR Expression levels of LvAV were evaluated by qRT-PCR in a CFX96 system (Bio-Rad, USA), using specific primers LvAVD-F/R (Table 1). EF1-α was amplified with specific primers EF1-αD-F/R as an internal control. Reactions contained 12.5 μl 2*SYBR® Premix Ex Taq™ II (TaKaRa, China), 0.5 μl forward primer (10 μM), 0.5 μl reverse primer (10 μM), 1 μl cDNA template equivalent to 50 ng total RNA, and 10.5 μl sterile distilled water made up to 25 μl. Each reaction was run in triplicate. Thermal cycling conditions were 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 58 °C for 30 s, and 72 °C for 30 s. The relative expression level of target genes were calculated using the comparative Ct method with the formula 2-ΔΔCt. One way analysis of variance (one way ANOVA) and Tukey’s multiple comparison tests were used to analyze the data in SPSS v17.0. P-values less than 0.05 were determined to be statistically significant. 2.7. Prokaryotic recombinant expression and purification of the fusion protein of LvAV A pair of gene-specific primers, LvAVB-F/R (Table 1) containing BamH I and Xho I restriction sites, was used to amplify the cDNA fragment for recombinant expression. The target PCR product was purified and sub-cloned into the pET-32a (+) vector containing a hexa histidine-tag (His-tag) to obtain a recombinant plasmid pET-AV. Plasmid pET-AV was transformed into E. coli BL21 (DE3) competent cells. Expression of the fusion protein was induced by 0.1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 14 h at 20 °C. The His-LvAV protein was purified using ProteinIsoTM Ni-NTA Resin (TransGen Biotech) according to manufacturer’s instructions. The concentration of the recombinant protein was measured using the Bradford method, using the Bradford Assay kit (Takara, China). 2.8. Synthesis of double stranded RNA Double stranded RNA (dsRNA) that matched the nucleotide sequence of LvAV was synthesized by in vitro transcription. The template DNA for generating dsRNA was amplified by LvAVi-F/R (Table 1). Both primers contained a T7 RNA polymerase binding site (GAATTAATACGACTCACTATAGGGAGA) at the 5’ end. PCR products from 100 μl PCR reactions were purified using a universal DNA purification Kit (TIANGEN, China). Purified products were used as
a transcription template for T7 RNA polymerase reactions. dsRNA was analyzed and purified by agarose gel electrophoresis. 2.9. The effect of LvAV on WSSV challenge To assess the function of LvAV on WSSV infection in L.vannamei, we quantified WSSV viral load after silencing LvAV mRNA by dsRNA, and injection of recombinant protein His-LvAV. Shrimp were divided into three groups, each containing 20 individuals. The groups were injected with 20 μg of LvAV dsRNA, His-LvAV, or PBS at two timepoints separated by an interval of 24 h prior to injection with WSSV. Twelve hours after the second injection, individuals from each group were injected with 800 WSSV viral particles (0 h). Then at 6 h, 12 h, 24 h and 48 h post infection (p.i.), hepatopancreas samples from three individuals from each group were collected. Genomic DNA from gill tissue was collected for WSSV detection by qRT-PCR. 2.10. Detection of viral copy number qRT-PCR was performed with two WSSV-specific primers W-F/R (Table 1). PCR amplification conditions were as follows: 30 s at 95 °C, 30 s at 95 °C, 40 cycles at 94 °C for 30 s and 68 °C for 1 min. For quantification, 10-fold serial dilutions of an internal standard plasmid were used to estimate a standard curve. Each sample was amplified as described above and WSSV copies were determined according to the standard curve, with R2 >0.998. The data were analyzed statistically using a paired Student’s t-test. 3. Results 3.1. Characterization of LvAV The LvAV partial mRNA sequence obtained by cloned PCR has been deposited in Genbank (JX983205.1; Amino acid sequence: AGC54451.1). The partial cDNA of LvAV is 596 bp in length (Fig. 1). Sequence analysis revealed the presence of a single open reading frame (ORF), a 5’ untraslated region (14 bp) and a 3’ untranslated region (51 bp). The start (ATG) and stop codons (TGA) were located at positions 15 and 542, respectively. The ORF consists of 531 bp and encodes a peptide that comprises 176 amino acids (Fig. 1). We analyzed LvAV and PmAV for the presence of signal peptides using the SignalP 4.0 program. In both cases, we found a signal peptide
Fig. 1. Nucleotide sequence of LvAV with its encoding protein sequence. The italic letters with no shadow show the predicted signal peptide and the shadowed letters indicate the CTLD domain. Shadowed italic letters indicate carbohydrate binding site and underlined italic “C” indicate putative cysteine residues forming disulfide bridges.
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
containing 19 contiguous amino acid residues, indicating a cleavage site between Ala19 and Thr20 and suggesting that the mature protein is exported from the cell. For LvAV, the mature protein has a molecular mass of 18.004 kD and a theoretical pI of 4.747. Based on the predicted signal peptide, the molecular mass of the pro-LvAV was calculated to be 19.828 kD. SMART analysis revealed that LvAV contains one functional CTLD domain (residues 33–166) (Fig. 1). There are three putative disulfide bonds in the CTLD domain, in which cysteine occurs at positions 33, 62, 126, 141, 157 and 165 (Fig. 1). Cysteine residues determine carbohydrate-binding specificity through involvement in disulfide bridge formation and Ca2+ binding site 2 (Q133-P134-N135) (Fig. 2). 3.2. LvAV sequence and phylogenetic analysis BLAST analyses revealed significant sequence similarity between LvAV and C-type Lectins from other shrimp lectins. LvAV displayed closest identity with PmAV (AAQ75589.1), and an antivirallike C type Lectin from Fenneropenaeus indicus (ADV17348.1), sharing 81% and 79% amino acid identity, respectively. The LvAV and ten single CRD C-type Lectins from other invertebrates were used in a multiple sequences alignment analysis. We found that the amino acid sequence of LvAV was moderately conserved compared with other C-type Lectins (Fig. 2). A phylogenetic tree was constructed using a neighbor-joining method with 1000 bootstrap pseudo replicates, based on the multiple alignments of LvAV and additonal 25 single CRD C-type Lectins from crustaceans, other invertebrates and vertebrates. LvAV, PmAV and antiviral-like C-type Lectin from F. indicus were clustered together and within a broadly crustacean clade (Fig. 3). Mannosebinding proteins (MBP) – which are related C-type Lectins – from crustaceans Scylla paramamosain, Portunus pelagicus, Pacifastacus leniiusculus and Procambarus calarkia were used as an outgroup (Fig. 3). 3.3. Distribution of LvAV Quantitative RT-PCR was employed to measure LvAV mRNA expression in intestinal, hepatopancreas, muscle, gill, hemocyte, ovary and eye stalk tissue. EF1-α was used as internal control. Transcription levels of LvAV in hepatopancreas was significantly greater than
51
in any other tissue (P < 0.05) attaining approximately 250 fold enrichment over the intestine. Lowest expression occurred in the muscle, eye stalk, gills and ovaries (Fig. 4). 3.4. LvAV expression in hepatopancreas following infection To understand the potential role of LvAV in L. vannamei, we measured LvAV expression in the hepatopancreas after injection with WSSV and V. parahaemolyticus. After infection with WSSV, LvAV expression was significantly upregulated 2 hrs p.i.(P < 0.05). Surprisingly, relative expression of LvAV was significantly lower than the control treatment by 12 hrs p.i. (P < 0.05), but this was followed by a return to similar LvAV between treatment groups by 24 hrs and 48 hrs p.i. (P > 0.05). WSSV load was unchanged during the first 2 hrs, but then increased from 101 to approx. 103 copies by 6 hrs p.i. WSSV load remained stable until 48 hrs p.i., at which point viral copies increased significantly from 103 to 106. The relative expression level of LvAV when infected with V. parahaemolyticus was not significantly different at 6 h as compared to the control (P > 0.05), but this was followed by an obvious change at 8 hrs p.i. The expression of LvAV was significantly lower than that in the control at 12 hrs and 24 hrs p.i. (P < 0.05), followed by higher but not significant expression than in the control at 48 h after injection (Fig. 5) (P > 0.05). 3.5. Effect of rLvAV The recombinant plasmid (pET32-LvAV) was transformed into E.coli BL21. After IPTG induction for 14 h at 20 °C, the whole cell lysate was analyzed by SDS-PAGE and a distinct band was revealed with a molecular mass of 35.5 kDa in accordance with the predicted molecular mass of recombinant LvAV protein with Histag in the N-terminal and the successful expression of recombinant was purified. Based on highest purity, we selected one of three replicate protein preparations for subsequent use in experiments (Fig. 6). 3.6. The function of LvAV in WSSV infection To further explore the function of LvAV, we infected shrimp with WSSV following exposure to dsRNA LvAV, rLvAV or PBS. We first
Fig. 2. LvAV alignment with other C-type Lectins. The asterisk indicates the putative cysteine residues forming disulfide bridges and the boxed letter indicates the carbohydrate binding site across different lectins. FiAV-like: Fenneropenaeus indicus, antiviral-like C-type Lectin, ADV17348.1; LvLectin-1: L.vannamei, C-type lectin-1, ADW08726.1; LvLectin-2: L.vannamei, C-type lectin-2, ADW08727.1; MjLectin C: Marsupenaeus japonicas, lectin C, ADG85667.1; FcLectin: Fenneropenaeus chinensis, C-type lectin 1, ABA54612.1; EsLectin: Eriocheir sinensis, lectin, ADB10837.1; XtLectin: Xenopus (Silurana) tropicalis, hepatic lectin-like, XP_002933953.1; AfLectin: Azumapecten farreri, C-type lectin 5, ADF87943.1; AiLectin: Argopecten irradians, C-type lectin, ADL27440.1.
52
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
Fig. 3. Neighbor-joining phylogenetic tree. The box indicates the position of LvAV. PtLP: Portunus trituberculatus; PpCTL: Portunus pelagicus; HsCTL: Homo sapiens; SsCTL: Salmo salar; DrCTL: Danio rerio; CgCTL: Crassostrea gigas;DmCTL: Drosophila melanogaster; CeCTL: Caenorhabditis elegans; SpMBP: Scylla paramamosain; PpMBP: Portunus pelagicus; PlMBP: Pacifastacus leniusculus; PcMBP: Procambarus clarkii.
investigated the efficiency of silencing by dsRNA in L. vannamei (Fig. 7) and recorded both LvAV expression and WSSV load (Fig. 8). The dsRNA injection, which significantly decreased expression of LvAV in shrimp, showed lower LvAV expression than the control at all 4 timepoints. Injection with rLvAV also resulted in reduced LvAV expression, although this difference was not significant across all timepoints. WSSV copies following dsRNA LvAV injection was significantly higher than for the rLvAV and PBS treatments at 12 hrs p.i., with 105 copies vs. approx. 103 viral copies, respectively (P < 0.05). Interestingly, WSSV copy number in the LvAV dsRNA group then decreased dramatically at 24 hrs p.i. and by 48 hrs p.i., WSSV load in the LvAV dsRNA group (approx. 102 copies) was significantly lower than both rLvAV (105 copies) and PBS (106 copies) groups (P < 0.05).
Fig. 4. The tissue distribution of LvAV in L.vannamei. O, ovary; G, gill; He, hemocyte; Hp, hepatopancreas; M, muscle; ES, eyestalk; In, intestine. The expression of LvAV in intestine was set to 1 and data in different tissues (n = 3; mean ± SE) with different letters indicating significantly different comparisons (p < 0.05).
4. Discussion WSSV is a common virus that severely affects shrimp production globally, but there are currently no effective methods to control
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
53
Fig. 5. The expression pattern of LvAV in hetopancreas after infection with pathogens. (a) Expression of LvAV at 0, 2, 6, 12, 24 and 48 h after infection with WSSV and the change of WSSV copies in gill of shrimp at the corresponding timepoint. (b) Expression of LvAV at 2, 4, 6, 8, 12, 24 and 48 h after injection with Vibrio parahaemolyticus. The expressions of LvAV at all timepoints with injection of PBS were set to 1. Asterisks indicate significantly different expression between PBS-injected and pathogen injected-shrimp.
its spread. In particular, knowledge of how WSSV infects and replicates within shrimp hosts remains unclear. In the present study, we explored the interaction between WSSV and its shrimp host to understand underlying mechanisms of infection. We cloned LvAV and conducted controlled WSSV infection experiments to investigate its potential role in shrimp immunity. Shrimp AV gene was first discovered in Peneaus monodon (termed PmAV; Luo et al., 2003), and was later classified as a C-type Lectin (Wang and Wang, 2013). In this study, we describe its probable gene homologue in L. vannamei. It contains 6 more amino acids and we predict the presence of a signal peptide sequence. Both LvAV and PmAV have a CTLD domain and Ca2+ binding site. Our phylogenetic analysis suggests a close relationship between LvAV, PmAV, and an antiviral-like C-type Lectin from F. indicus. Previous studies indicate that PmAV has no pathogen binding activity (Luo et al., 2003), and we postulate a similar non-binding role for LvAV due to its amino acid similarity to PmAV. The successful purification of PmAV from shrimp hemolymph (Luo et al., 2003), alongside our prediction of a signal peptide, indicates that LvAV functions as an extracellular factor. We found that its expression was tissue specific, and highly expressed in the hepatopancreas, which has an important role in
Fig. 6. Purification of rLvAV in 10% PAGE gel. M: protein molecular weight marker (Low); Replications 1–3 are indicated.
metabolism and immunity, with similar functions to the liver and pancreas of mammals, or fat body of insects (Gibson and Barker, 1979; Wang and Wang, 2013). In shrimp hepatopancreas, many proteins involved in stress and immunity are expressed (Jiang et al., 2009). It is the source of many CTLs (Gross et al., 2001), including LvAV. Its specific expression in hepatopancreas further indicates that it is involved in shrimp immunity. We quantified virus copy number to estimate infection severity (Rahman et al., 2008; Sun et al., 2013a; You et al., 2010). We focused on virus quantification in gill tissue as both virulence (You et al., 2010) and total pathogen load are positively correlated with WSSV copy number in the gill (Sun et al., 2013a). We combined virus load estimated from gill tissues with LvAV expression patterns in hepatopancreas of L.vannamei following experimental infection with WSSV. Our results show that expression of LvAV is broadly negatively correlated with infection severity, but that the relationship between LvAV expression and viral load is complex. LvAV expression shortly after infection is typically high (Fig. 5; 6 hrs p.i.). This might be induced by the initial recognition of WSSV particles (Sun et al., 2013a), suggesting an early defensive role for LvAV. However, a subsequent drop in LvAV expression at 24 hrs p.i. is followed by a dramatic increase in viral load at 48 hrs p.i. (Fig. 5) pointing to a deteriorating or ineffective immune response to the virus, in turn indicating that WSSV may be able to adopt effective mechanisms to avoid host immune clearance, thereby facilitating viral propagation in the later stages of infection (Luo et al., 2003; Sun et al.,
Fig. 7. The expression of LvAV after injection of PBS and dsRNA. The expressions of LvAV at all timepoints were set to 1 and the asterisks indicate the significantly different expression between PBS-injected shrimp and dsRNA-injected shrimp.
54
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
Fig. 8. Change of WSSV copies after (a) injection with PBS, rLvAV and alongside (b) the expression of LvAV at corresponding timepoints. The line indicates the WSSV copies in gill of shrimp after infection with virus and the bar indicated the expression of LvAV where the expression of LvAV at 6 hours after WSSV infection in the PBS-injected group was set to 1. As before, asterisks indicate the significant difference in expression.
2013a). The expression of LvAV then increases at 48 hrs p.i., potentially as a delayed response to increased viral load. To explore the particular role of LvAV in WSSV infection, we employed rLvAV and dsRNA LvAV to enhance or silence LvAV expression in L. vannamei. Compared to the PBS treatment, rLvAV injection led to delayed propagation of WSSV during the initial and later stage of infection. A previous study has also analyzed the efficiency of different rPmAV forms against WSSV, finding that injection of rPmAV could be an effective molecule to control WSSV infection (Pathan et al., 2013). This confirms results that show recombinant PmAV to harbor high antiviral activity in vitro (Luo et al., 2003). We argue that LvAV plays a similar role in shrimp against WSSV infection, although research to understand LvAV antiviral activity in vitro is required. We found that dsRNA LvAV effectively silenced expression of LvAV. However, its role is complex: injection of dsRNA initially led to significantly increased virus load, indicating a role for an LvAV in minimizing WSSV propagation during the early phase of infection. Surprisingly, however, we found a significant decline of viral load in LvAV dsRNA-treated shrimp in the late phase of infection. Our finding implies that LvAV could play a dual role in the host– pathogen interaction, with WSSV subverting LvAV to further facilitate replication. Since AV reportedly does not bind to WSSV directly (Luo et al., 2003), and we predict that it contains a signal peptide, we postulate that AV is involved in a signal pathway or protein complex that functions in extracellular shrimp immunity. Mannose-binding lectins have recently been reported to perform dual functions in defending against disease (Ibernon et al., 2014) and the complement system, of which mannose-binding lectin is a component, may be a double-edged sword during human immunodeficiency virus infection (Ballegaard et al., 2014). While our data indicate that AV may delay propagation of WSSV in both L. vannamei and P. monodon (Pathan et al., 2013), the underlying molecular mechanisms remain unclear. Our findings indicate a complex role for LvAV during viral infection, and further research is required to understand its full role in shrimp immunity. Finally, expression changes of LvAV associated with bacterial infection (V. parahaemolyticus) also demonstrate that this antiviral gene may play a general role in shrimp immunity. Acknowledgments Comments from Dino Mcmahon and anonymous reviewers have greatly improved the manuscript. This work was supported by the Agricultural Science and Technology Achievement Transformation Fund Project of Ministry of Science and Technology, China (no. 2012GB2E200361), the National Fundamental Research Program,
China (no. 2006AA10A406), the Key Laboratory of Marine Biology, Institute of Oceanology, Chinese Academy of Sciences and the Northwest A&F University experimental demonstration station (base) and innovation of science and technology achievement transformation project (no. XNY2013-4). References Alcivar-Warren, A., Meehan-Meola, D., Park, S.W., Xu, Z., Delaney, M., Zuniga, G., 2007. ShrimpMap: a low-density, microsatellite-based linkage map of the pacific whiteleg shrimp, Litopenaeus vannamei: identification of sex-linked markers in linkage group 4. J. Shellfish Res. 26, 1259–1277. Artimo, P., Jonnalagedda, M., Arnold, K., Baratin, D., Csardi, G., De Castro, E., et al., 2012. ExPASy: SIB bioinformatics resource portal. Nucleic Acids Res. 40, W597– W603. Ballegaard, V., Haugaard, A.K., Garred, P., Nielsen, S.D., Munthe-Fog, L., 2014. The lectin pathway of complement: advantage or disadvantage in HIV pathogenesis? Clin. Immunol. 154, 13–25. de Oliveira Cesar, J.R., Zhao, B., Malecha, S., Ako, H., Yang, J., 2006. Morphological and biochemical changes in the muscle of the marine shrimp Litopenaeus vannamei during the molt cycle. Aquaculture 261, 688–694. Drickamer, K., 1999. C-type lectin-like domains. Curr. Opin. Struct. Biol. 9, 585–590. Feizi, T., 2000. Carbohydrate-mediated recognition systems in innate immunity. Immunol. Rev. 173, 79–88. Flegel, T.W., Lightner, D.V., Lo, C., Owens, L., 2008. Shrimp Disease Control: Past, Present and Future. Diseases in Asian Aquaculture VI. Fish Health Section. Asian Fisheries Society, Manila, Philippines, pp. 355–378. Gibson, R., Barker, P.L., 1979. The decapod hepatopancreas.Oceanoger. Mar. Biol. Ann. Rev. 17, 285–346. Gross, P.S., Bartlett, T.C., Browdy, C.L., Chapman, R.W., Warr, G.W., 2001. Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L. setiferus. Dev. Comp. Immunol. 25, 565–577. Holmblad, T., Söderhäll, K., 1999. Cell adhesion molecules and antioxidative enzymes in a crustacean, possible role in immunity. Aquaculture 172, 111–123. Ibernon, M., Moreso, F., Serón, D., 2014. Innate immunity in renal transplantation: the role of mannose-binding lectin. Transplant. Rev. 28, 21–25. Jiang, H., Li, F., Xie, Y., Huang, B., Zhang, J., Zhang, J., et al., 2009. Comparative proteomic profiles of the hepatopancreas in Fenneropenaeus chinensis response to hypoxic stress. Proteomics 9, 3353–3367. Jiravanichpaisal, P., Sricharoen, S., Söderhäll, I., Söderhäll, K., 2006. White spot syndrome virus (WSSV) interaction with crayfish haemocytes. Fish Shellfish Immunol. 20, 718–727. Labreuche, Y., Warr, G.W., 2012. Insights into the antiviral functions of the RNAi machinery in penaeid shrimp. Fish Shellfish Immunol. 34, 1002–1010. Liu, H.P., Soderhall, K., Jiravanichpaisal, P., 2009. Antiviral immunity in crustaceans. Fish Shellfish Immunol. 27, 79–88. Luo, T., Zhang, X., Shao, Z., Xu, X., 2003. PmAV, a novel gene involved in virus resistance of shrimp Penaeus monodon. FEBS Lett. 551, 53–57. Moss, S.M., Arce, S.M., Moss, D.R., Otoshi, C.A., 2006. Disease Prevention Strategies for Penaeid Shrimp Culture. The Oceanic Institute, Hawaii USA. Namikoshi, A., Wu, J.L., Yamashita, T., Nishizawa, T., Nishioka, T., Arimoto, M., et al., 2004. Vaccination trials with Penaeus japonicus to induce resistance to white spot syndrome virus. Aquaculture 229, 25–35. Pathan, M., Gireesh-Babu, P., Pavan-Kumar, A., Jeena, K., Sharma, R., Makesh, M., et al., 2013. In vivo therapeutic efficacy of recombinant Penaeus monodon antiviral protein (rPmAV) administered in three different forms to WSSV infected Penaeus monodon. Aquaculture 376–379, 64–67.
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
Petersen, T.N., Brunak, S., von Heijne, G., Nielsen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8, 785–786. Rahman, M.M., Corteel, M., Escobedo-Bonilla, C.M., Wille, M., Alday-Sanz, V., Pensaert, M.B., et al., 2008. Virulence of white spot syndrome virus (WSSV) isolates may be correlated with the degree of replication in gills of Penaeus vannamei juveniles. Dis. Aquat. Organ. 79, 191–198. Rout, N., Kumar, S., Jaganmohan, S., Murugan, V., 2007. DNA vaccines encoding viral envelope proteins confer protective immunity against WSSV in black tiger shrimp. Vaccine 25, 2778–2786. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Schultz, J., Milpetz, F., Bork, P., Ponting, C.P., 1998. SMART, a simple modular architecture research tool: identification of signaling domains. PNAS 95, 5857– 5864. Söderhäll, K., 1999. Special issue: invertebrate immunity. Dev. Comp. Immunol. 23, 263. Sun, Y., Li, F., Xiang, J., 2013a. Analysis on the dynamic changes of the amount of WSSV in Chinese shrimp Fenneropenaeus chinensis during infection. Aquaculture 376–379, 124–132. Sun, Y., Li, F., Chi, Y., Xiang, J., 2013b. Enhanced resistance of marine shrimp Exopalamon carincauda Holthuis to WSSV by injecting live VP28-recombinant bacteria. Acta Oceanologica Sinica 32, 52–58.
55
Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596– 1599. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Wakida-Kusunoki, A.T., Amador-del Angel, L.E., Alejandro, P.C., Brahms, C.Q., 2011. Presence of Pacific white shrimp Litopenaeus vannamei (Boone, 1931) in the Southern Gulf of Mexico. Aquat. Invasions 6, S139–S142. Wang, X.W., Wang, J.X., 2013. Diversity and multiple functions of lectins in shrimp immunity. Dev. Comp. Immunol. 39, 27–38. Witteveldt, J., Cifuentes, C.C., Vlak, J.M., van Hulten, M.C.W., 2004. Protection of Penaeus monodon against white spot syndrome virus by oral vaccination. J. Virol. 78, 2057–2061. You, X.X., Su, Y.Q., Mao, Y., Liu, M., Wang, J., Zhang, M., et al., 2010. Effect of high water temperature on mortality, immune response and viral replication of WSSV-infected Marsupenaeus japonicus juveniles and adults. Aquaculture 305, 133–137. Zhang, Y., Qiu, L., Song, L., Zhang, H., Zhao, J., Wang, L., et al., 2009. Cloning and characterization of a novel C-type lectin gene from shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 26, 183–192.
Contents lists available at ScienceDirect
Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i
Molecular characterization of LvAV in response to white spot syndrome virus infection in the Pacific white shrimp (Litopenaeus vannamei) Shulin He a, Lei Song b, Zhaoying Qian c, Fujun Hou a, Yongjie Liu a, Xianzong Wang a, Zhangming Peng d, Chengbo Sun d, Xiaolin Liu a,*,1 a College of Animal Science and Technology, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Northwest A&F University, Yangling, Shaanxi 712100, China b Department of Politics Teaching Office, Military Economics Academy of Airforce, Wuhan 430035, China c School of Resource & Environmental Management, Guizhou University of Finance and Economics, Guizhou 550025, China d Fisheries College, Guangdong Ocean University, Guangdong 524088, China
A R T I C L E
I N F O
Article history: Received 8 November 2014 Revised 25 February 2015 Accepted 26 February 2015 Available online 28 February 2015 Keywords: Litopenaeus vannamei LvAV C-type lectin WSSV Vibrio parahaemolyticus
A B S T R A C T
Litopenaeus vannamei is the most important farmed shrimp species globally, but its production is affected by several factors, including infectious disease. White spot syndrome virus (WSSV), in particular, causes significant shrimp losses. To understand the shrimp’s immune response against WSSV, we cloned LvAV from L. vannamei and analyzed its expression pattern in different tissues, in addition to its expression following infection. We employed dsRNA and recombinant (r)LvAV to explore the potential role of LvAV in shrimp immunity when infected with WSSV. We find that LvAV is a C-type Lectin composed of 176 amino acids with a signal peptide and a specific C-type Lectin-type domain (CTLD). It shares 81% amino acid similarity with PmAV, an antiviral-like C-type Lectin from Penaeus monodom, and it is highly expressed in the hepatopancreas. Its expression is affected by infection with both WSSV and V. parahaemolyticus. Significantly, injection with rLvAV slowed WSSV replication, while injection with LvAV dsRNA initially led to enhanced virus propagation. Surprisingly, LvAV dsRNA subsequently led to a dramatic decrease in viral load in the later stages of infection, suggesting that LvAV may be subverted by WSSV to enhance viral replication or immune avoidance. Our results indicate that LvAV plays an important, but potentially complex role in the Pacific white shrimp’s immune defense. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Shrimp is the largest single fishery merchandise in international trade (Food and Agricultural Organization). Shrimp farms now produce approximately 50% of global penaeid shrimp output (Moss et al., 2006). Higher growth rate of the Pacific white shrimp (Litopenaeus vannamei) has led to its replacement of the native shrimp as the most important farmed penaeid shrimp species globally (Alcivar-Warren et al., 2007; Wakida-Kusunoki et al., 2011). However, L. vannamei is easily affected by multiple factors, particularly emerging bacterial and viral pathogens that are reported to be responsible for 60% and 20% shrimp damage globally, respectively (Flegel et al., 2008; Liu et al., 2009). Among viruses, white spot
* Corresponding author. College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Shaanxi Yangling 712100, China. Tel.: +86 29 87054333; fax: +86 29 87092164. E-mail address: [email protected] (X. Liu). 1 Professor, as well as Qian Jiang specially invited Expert in the City of Hangzhou. http://dx.doi.org/10.1016/j.dci.2015.02.020 0145-305X/© 2015 Elsevier Ltd. All rights reserved.
syndrome virus (WSSV), a double-stranded DNA virus, is a major pathogenic cause of Pacific white shrimp losses. Studies have attempted to enhance shrimp immunity against WSSV through priming with feed supplemented with inactivated WSSV, WSSV protein and plasmid DNA encoding a viral protein gene (Namikoshi et al., 2004; Pathan et al., 2013; Rout et al., 2007; Witteveldt et al., 2004). Additionally, RNAi pathways as potential antiviral mechanisms in shrimp have been studied (Labreuche and Warr, 2012). But there still has been no effective way to control this disease in L. vannamei farms. In this study, we investigated host innate immune factor involved in shrimp disease control, and identified potential approaches for tackling WSSV disease. Shrimp lack a traditional adaptive immune response. Like many invertebrates, disease prevention is heavily reliant on innate immunity, including a series of humoral and cellular immune factors (Söderhäll, 1999). Humoral defenses are performed by molecules stored within and released from hemocytes such as the prophenoloxidase system (Holmblad and Söderhäll, 1999). Cellular defenses are executed directly by hemocytes (Jiravanichpaisal et al., 2006). As a kind of vital pattern recognition protein, shrimp lectins,
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
which belong to a family of single or multi-domain glycoproteins capable of binding sugar moieties, have been identified as potentially critical immune effector molecules in shrimp defense (Zhang et al., 2009). This family includes Calnexin, Galectins, C-, L-, M-, Pand S-type Lectins (Wang and Wang, 2013). C-type Lectins are calcium-dependent and exist widely in vertebrates and particularly invertebrates. They represent an important recognition mechanism for oligosaccharides at cell surfaces and are unique in that they contain a carbohydrate recognition domain (CRD), which mediates sugar binding with Ca2+ (Drickamer, 1999; Feizi, 2000). C-type Lectin, NK cell receptors, IgE Fc receptors and coagulation factors all possess a C-type Lectin-like domain (CTLD) that plays an important role in immunity (Drickamer, 1999). Antiviral gene (AV) from the shrimp Penaeus monodom (PmAV), was the first shrimp gene found to encode an innate immune protein. It has an open reading frame (ORF) encoding a 170 amino acid peptide containing a CTLD (Luo et al., 2003). PmAV is up-regulated in response to viral infection and recombinant (r)PmAV protein shows high antiviral activity in vitro (Luo et al., 2003). It has been shown that rPmAV can be used as an effective therapeutic agent against WSSV in P. monodon (Pathan et al., 2013). It is not clear if the related Pacific white shrimp (Litopenaeus vannamei) encodes this gene or whether it is involved in shrimp immunity. The purpose of this study was to explore the potential function of the Antiviral protein (AV) in L. vannamei. We characterized the partial cDNA encoding AV from L. vannamei (designated LvAV from hereon), and analyzed its expression in controlled WSSV infection assays. We employed both rLvAV protein and LvAV dsRNA to experimentally upregulate and downregulate LvAV function respectively, in order to investigate the role of LvAV in shrimp immunity following infection with WSSV. We investigated the specificity of the response by conducting parallel experiments using the bacterium Vibrio parahaemolyticus. 2. Materials and methods 2.1. Experimental animals Healthy adult L. vannamei (15–20 g) devoid of WSSV (as detected by PCR) were obtained from a local commercial farm in HengXing (GuangDong, China). Shrimp were acclimated to laboratory conditions by rearing them at 26 ± 1 °C in tanks with recirculating seawater for two weeks. During the acclimation period, the shrimp were fed an artificial shrimp diet twice daily. Only shrimp in intermolt stage were used in this study (de Oliveira Cesar et al., 2006). After acclimation, tissue samples were dissected from three individuals. We isolated hepatopancreas, hemocyte, ovary, gill, muscle, eyestalk and intestine, and extracted RNA from each tissue separately. 2.2. Challenge assay WSSV was supplied by Fuhua Li (Chinese Academy of Science) and the Vibrio parahaemolyticus was preserved by our lab. WSSV was dissolved in phosphate-buffered saline (PBS) and injected into shrimp for in vivo propagation. We purified WSSV from infected shrimp before they had died as previously described (Sun et al., 2013b). Briefly, muscle tissues of WSSV-infected shrimp were homogenized in PBS with 2.4% NaCl on ice followed by centrifugation for 15 min at 7000 rpm (4 °C). The supernatant was added with sucrose to 30% and centrifuged for 50 min at 16 000 rpm (4 °C), followed by filtration through a 0.45 μm filter, after which purified virus was suspended in PBS for subsequent use in experiments. V. parahaemolyticus was cultured in LB medium at 37 °C overnight and centrifuged for 10 min at 7500 rpm, after which bacteria were washed twice and resuspended in PBS followed by heat-killing by boiling for 30 min.
49
Table 1 Primers used in present study. Primer names
Sequences(5′-3′)
Application
LvAV-F LvAV-R LvAVD-F LvAVD-R EF1-αD-F EF1-αD-R LvAVB-F LvAVB-R LvAVi-F
CCGCCGATGTCACAATGAATCT CTCGGATGGTGTCGCAGTATGA GGGTCTTTGGCTGTGGATG TGTTGAGCGACGGAGGTG TGCTCTGGACAACATCGAGC CGGGCACTGTTCCAATACCT CGGGATCCACCTTATACGAGAAAAGTGC GGGAGCTCGTCAAAACTTGTCAGCAGAT TAATACGACTCACTATAGGGAGACCGCCG ATGTCACAATGAATCT TAATACGACTCACTATAGGGAGACTCGG ATGGTGTCGCAGTATGA AAACCTCCGCATTCCTGTGA TCCGCATCTTCTTCCTTCAT
Cloning
LvAVi-R W-F W-R
qRT-PCR
Prokaryotic recombinant expression dsRNA Synthesis
WSSV copies detection (You et al., 2010)
Note: The italic letter in LvAVB-F/R with fine lines were BamH 1 and Xho 1 enzyme restriction sites for recombinant expression, respectively. The italic letter in LvAVi-F/R with bold lines were T7 RNA polymerase binding site for dsRNA in vitro transcription.
Shrimp were separated into three groups after acclimation. Two experimental groups were injected with V. parahaemolyticus and WSSV while the final group was injected with PBS which served as the control. Individuals were injected into the last abdominal segment with 10 μl PBS containing inactive V. parahaemolyticus (107 CFU/ml) and 10 μl (80 copies/μl) WSSV, respectively. The control group was injected with 10 μl of PBS. Hepatopancreas of five shrimp in each group were collected at 0, 2, 4, 6, 12, 24 and 48 h post injection and separately preserved in liquid nitrogen for RNA isolation. 2.3. Total RNA isolation and cDNA synthesis Total RNA was extracted from different shrimp tissues with TRIZOL reagent (Invitrogen, USA) following manufacturer’s instructions. RNA purity was quantified using a ND-1000 spectrophotometer (NanoDrop Technologies, USA) and treated with RNase-free DNase I (Takara) to remove potential DNA contamination before RT-PCR. cDNA was synthesized by PrimeScript RT reagent kit (Takara, Japan) from 500 ng of total RNA using oligo-dT and random hexamer primers according to the manufacturer’s instructions. 2.4. Cloning of LvAV cDNA fragment We designed specific primers based on PmAV (GenBank accession no.: AAQ75589.1). Specific primers (LvAV-F/R) were used to amplify the nucleotide sequence of LvAV from the cDNA of hepatopancreas in L. vannamei. Primer sequences are listed in Table 1. The PCR products were analyzed by electrophoresis on a 1.5% agarose gel to determine amplified fragment size and the target band was purified using a universal DNA purification Kit (TIANGEN, China). The purified fragment was cloned into the pUT-T Easy vector following manufacturer’s instructions (Cwbiotech). Recombinant bacteria were confirmed by PCR and then sequenced. 2.5. Analysis of nucleotide and amino acid sequences The cloned partial cDNA sequence and deduced amino acid sequence of LvAV were analyzed using BLAST algorithm (NCBI). LvAV amino acid sequence analysis was performed with the ExPASy Proteomics Server (Artimo et al., 2012), SignalP 4.0 (Petersen et al., 2011) and SMART (Schultz et al., 1998). Pairwise and multiple sequence alignments were analyzed using ClustalW v4.0 (Thompson et al., 1994). LvAV phylogenies were determined using MEGA v4.0 with the NeighborJoining Method (Saitou and Nei, 1987; Tamura et al., 2007). Bootstrap values were determined based on 1000 pseudo replicates.
50
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
2.6. Quantitative reverse transcription (qRT)-PCR Expression levels of LvAV were evaluated by qRT-PCR in a CFX96 system (Bio-Rad, USA), using specific primers LvAVD-F/R (Table 1). EF1-α was amplified with specific primers EF1-αD-F/R as an internal control. Reactions contained 12.5 μl 2*SYBR® Premix Ex Taq™ II (TaKaRa, China), 0.5 μl forward primer (10 μM), 0.5 μl reverse primer (10 μM), 1 μl cDNA template equivalent to 50 ng total RNA, and 10.5 μl sterile distilled water made up to 25 μl. Each reaction was run in triplicate. Thermal cycling conditions were 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 58 °C for 30 s, and 72 °C for 30 s. The relative expression level of target genes were calculated using the comparative Ct method with the formula 2-ΔΔCt. One way analysis of variance (one way ANOVA) and Tukey’s multiple comparison tests were used to analyze the data in SPSS v17.0. P-values less than 0.05 were determined to be statistically significant. 2.7. Prokaryotic recombinant expression and purification of the fusion protein of LvAV A pair of gene-specific primers, LvAVB-F/R (Table 1) containing BamH I and Xho I restriction sites, was used to amplify the cDNA fragment for recombinant expression. The target PCR product was purified and sub-cloned into the pET-32a (+) vector containing a hexa histidine-tag (His-tag) to obtain a recombinant plasmid pET-AV. Plasmid pET-AV was transformed into E. coli BL21 (DE3) competent cells. Expression of the fusion protein was induced by 0.1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 14 h at 20 °C. The His-LvAV protein was purified using ProteinIsoTM Ni-NTA Resin (TransGen Biotech) according to manufacturer’s instructions. The concentration of the recombinant protein was measured using the Bradford method, using the Bradford Assay kit (Takara, China). 2.8. Synthesis of double stranded RNA Double stranded RNA (dsRNA) that matched the nucleotide sequence of LvAV was synthesized by in vitro transcription. The template DNA for generating dsRNA was amplified by LvAVi-F/R (Table 1). Both primers contained a T7 RNA polymerase binding site (GAATTAATACGACTCACTATAGGGAGA) at the 5’ end. PCR products from 100 μl PCR reactions were purified using a universal DNA purification Kit (TIANGEN, China). Purified products were used as
a transcription template for T7 RNA polymerase reactions. dsRNA was analyzed and purified by agarose gel electrophoresis. 2.9. The effect of LvAV on WSSV challenge To assess the function of LvAV on WSSV infection in L.vannamei, we quantified WSSV viral load after silencing LvAV mRNA by dsRNA, and injection of recombinant protein His-LvAV. Shrimp were divided into three groups, each containing 20 individuals. The groups were injected with 20 μg of LvAV dsRNA, His-LvAV, or PBS at two timepoints separated by an interval of 24 h prior to injection with WSSV. Twelve hours after the second injection, individuals from each group were injected with 800 WSSV viral particles (0 h). Then at 6 h, 12 h, 24 h and 48 h post infection (p.i.), hepatopancreas samples from three individuals from each group were collected. Genomic DNA from gill tissue was collected for WSSV detection by qRT-PCR. 2.10. Detection of viral copy number qRT-PCR was performed with two WSSV-specific primers W-F/R (Table 1). PCR amplification conditions were as follows: 30 s at 95 °C, 30 s at 95 °C, 40 cycles at 94 °C for 30 s and 68 °C for 1 min. For quantification, 10-fold serial dilutions of an internal standard plasmid were used to estimate a standard curve. Each sample was amplified as described above and WSSV copies were determined according to the standard curve, with R2 >0.998. The data were analyzed statistically using a paired Student’s t-test. 3. Results 3.1. Characterization of LvAV The LvAV partial mRNA sequence obtained by cloned PCR has been deposited in Genbank (JX983205.1; Amino acid sequence: AGC54451.1). The partial cDNA of LvAV is 596 bp in length (Fig. 1). Sequence analysis revealed the presence of a single open reading frame (ORF), a 5’ untraslated region (14 bp) and a 3’ untranslated region (51 bp). The start (ATG) and stop codons (TGA) were located at positions 15 and 542, respectively. The ORF consists of 531 bp and encodes a peptide that comprises 176 amino acids (Fig. 1). We analyzed LvAV and PmAV for the presence of signal peptides using the SignalP 4.0 program. In both cases, we found a signal peptide
Fig. 1. Nucleotide sequence of LvAV with its encoding protein sequence. The italic letters with no shadow show the predicted signal peptide and the shadowed letters indicate the CTLD domain. Shadowed italic letters indicate carbohydrate binding site and underlined italic “C” indicate putative cysteine residues forming disulfide bridges.
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
containing 19 contiguous amino acid residues, indicating a cleavage site between Ala19 and Thr20 and suggesting that the mature protein is exported from the cell. For LvAV, the mature protein has a molecular mass of 18.004 kD and a theoretical pI of 4.747. Based on the predicted signal peptide, the molecular mass of the pro-LvAV was calculated to be 19.828 kD. SMART analysis revealed that LvAV contains one functional CTLD domain (residues 33–166) (Fig. 1). There are three putative disulfide bonds in the CTLD domain, in which cysteine occurs at positions 33, 62, 126, 141, 157 and 165 (Fig. 1). Cysteine residues determine carbohydrate-binding specificity through involvement in disulfide bridge formation and Ca2+ binding site 2 (Q133-P134-N135) (Fig. 2). 3.2. LvAV sequence and phylogenetic analysis BLAST analyses revealed significant sequence similarity between LvAV and C-type Lectins from other shrimp lectins. LvAV displayed closest identity with PmAV (AAQ75589.1), and an antivirallike C type Lectin from Fenneropenaeus indicus (ADV17348.1), sharing 81% and 79% amino acid identity, respectively. The LvAV and ten single CRD C-type Lectins from other invertebrates were used in a multiple sequences alignment analysis. We found that the amino acid sequence of LvAV was moderately conserved compared with other C-type Lectins (Fig. 2). A phylogenetic tree was constructed using a neighbor-joining method with 1000 bootstrap pseudo replicates, based on the multiple alignments of LvAV and additonal 25 single CRD C-type Lectins from crustaceans, other invertebrates and vertebrates. LvAV, PmAV and antiviral-like C-type Lectin from F. indicus were clustered together and within a broadly crustacean clade (Fig. 3). Mannosebinding proteins (MBP) – which are related C-type Lectins – from crustaceans Scylla paramamosain, Portunus pelagicus, Pacifastacus leniiusculus and Procambarus calarkia were used as an outgroup (Fig. 3). 3.3. Distribution of LvAV Quantitative RT-PCR was employed to measure LvAV mRNA expression in intestinal, hepatopancreas, muscle, gill, hemocyte, ovary and eye stalk tissue. EF1-α was used as internal control. Transcription levels of LvAV in hepatopancreas was significantly greater than
51
in any other tissue (P < 0.05) attaining approximately 250 fold enrichment over the intestine. Lowest expression occurred in the muscle, eye stalk, gills and ovaries (Fig. 4). 3.4. LvAV expression in hepatopancreas following infection To understand the potential role of LvAV in L. vannamei, we measured LvAV expression in the hepatopancreas after injection with WSSV and V. parahaemolyticus. After infection with WSSV, LvAV expression was significantly upregulated 2 hrs p.i.(P < 0.05). Surprisingly, relative expression of LvAV was significantly lower than the control treatment by 12 hrs p.i. (P < 0.05), but this was followed by a return to similar LvAV between treatment groups by 24 hrs and 48 hrs p.i. (P > 0.05). WSSV load was unchanged during the first 2 hrs, but then increased from 101 to approx. 103 copies by 6 hrs p.i. WSSV load remained stable until 48 hrs p.i., at which point viral copies increased significantly from 103 to 106. The relative expression level of LvAV when infected with V. parahaemolyticus was not significantly different at 6 h as compared to the control (P > 0.05), but this was followed by an obvious change at 8 hrs p.i. The expression of LvAV was significantly lower than that in the control at 12 hrs and 24 hrs p.i. (P < 0.05), followed by higher but not significant expression than in the control at 48 h after injection (Fig. 5) (P > 0.05). 3.5. Effect of rLvAV The recombinant plasmid (pET32-LvAV) was transformed into E.coli BL21. After IPTG induction for 14 h at 20 °C, the whole cell lysate was analyzed by SDS-PAGE and a distinct band was revealed with a molecular mass of 35.5 kDa in accordance with the predicted molecular mass of recombinant LvAV protein with Histag in the N-terminal and the successful expression of recombinant was purified. Based on highest purity, we selected one of three replicate protein preparations for subsequent use in experiments (Fig. 6). 3.6. The function of LvAV in WSSV infection To further explore the function of LvAV, we infected shrimp with WSSV following exposure to dsRNA LvAV, rLvAV or PBS. We first
Fig. 2. LvAV alignment with other C-type Lectins. The asterisk indicates the putative cysteine residues forming disulfide bridges and the boxed letter indicates the carbohydrate binding site across different lectins. FiAV-like: Fenneropenaeus indicus, antiviral-like C-type Lectin, ADV17348.1; LvLectin-1: L.vannamei, C-type lectin-1, ADW08726.1; LvLectin-2: L.vannamei, C-type lectin-2, ADW08727.1; MjLectin C: Marsupenaeus japonicas, lectin C, ADG85667.1; FcLectin: Fenneropenaeus chinensis, C-type lectin 1, ABA54612.1; EsLectin: Eriocheir sinensis, lectin, ADB10837.1; XtLectin: Xenopus (Silurana) tropicalis, hepatic lectin-like, XP_002933953.1; AfLectin: Azumapecten farreri, C-type lectin 5, ADF87943.1; AiLectin: Argopecten irradians, C-type lectin, ADL27440.1.
52
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
Fig. 3. Neighbor-joining phylogenetic tree. The box indicates the position of LvAV. PtLP: Portunus trituberculatus; PpCTL: Portunus pelagicus; HsCTL: Homo sapiens; SsCTL: Salmo salar; DrCTL: Danio rerio; CgCTL: Crassostrea gigas;DmCTL: Drosophila melanogaster; CeCTL: Caenorhabditis elegans; SpMBP: Scylla paramamosain; PpMBP: Portunus pelagicus; PlMBP: Pacifastacus leniusculus; PcMBP: Procambarus clarkii.
investigated the efficiency of silencing by dsRNA in L. vannamei (Fig. 7) and recorded both LvAV expression and WSSV load (Fig. 8). The dsRNA injection, which significantly decreased expression of LvAV in shrimp, showed lower LvAV expression than the control at all 4 timepoints. Injection with rLvAV also resulted in reduced LvAV expression, although this difference was not significant across all timepoints. WSSV copies following dsRNA LvAV injection was significantly higher than for the rLvAV and PBS treatments at 12 hrs p.i., with 105 copies vs. approx. 103 viral copies, respectively (P < 0.05). Interestingly, WSSV copy number in the LvAV dsRNA group then decreased dramatically at 24 hrs p.i. and by 48 hrs p.i., WSSV load in the LvAV dsRNA group (approx. 102 copies) was significantly lower than both rLvAV (105 copies) and PBS (106 copies) groups (P < 0.05).
Fig. 4. The tissue distribution of LvAV in L.vannamei. O, ovary; G, gill; He, hemocyte; Hp, hepatopancreas; M, muscle; ES, eyestalk; In, intestine. The expression of LvAV in intestine was set to 1 and data in different tissues (n = 3; mean ± SE) with different letters indicating significantly different comparisons (p < 0.05).
4. Discussion WSSV is a common virus that severely affects shrimp production globally, but there are currently no effective methods to control
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
53
Fig. 5. The expression pattern of LvAV in hetopancreas after infection with pathogens. (a) Expression of LvAV at 0, 2, 6, 12, 24 and 48 h after infection with WSSV and the change of WSSV copies in gill of shrimp at the corresponding timepoint. (b) Expression of LvAV at 2, 4, 6, 8, 12, 24 and 48 h after injection with Vibrio parahaemolyticus. The expressions of LvAV at all timepoints with injection of PBS were set to 1. Asterisks indicate significantly different expression between PBS-injected and pathogen injected-shrimp.
its spread. In particular, knowledge of how WSSV infects and replicates within shrimp hosts remains unclear. In the present study, we explored the interaction between WSSV and its shrimp host to understand underlying mechanisms of infection. We cloned LvAV and conducted controlled WSSV infection experiments to investigate its potential role in shrimp immunity. Shrimp AV gene was first discovered in Peneaus monodon (termed PmAV; Luo et al., 2003), and was later classified as a C-type Lectin (Wang and Wang, 2013). In this study, we describe its probable gene homologue in L. vannamei. It contains 6 more amino acids and we predict the presence of a signal peptide sequence. Both LvAV and PmAV have a CTLD domain and Ca2+ binding site. Our phylogenetic analysis suggests a close relationship between LvAV, PmAV, and an antiviral-like C-type Lectin from F. indicus. Previous studies indicate that PmAV has no pathogen binding activity (Luo et al., 2003), and we postulate a similar non-binding role for LvAV due to its amino acid similarity to PmAV. The successful purification of PmAV from shrimp hemolymph (Luo et al., 2003), alongside our prediction of a signal peptide, indicates that LvAV functions as an extracellular factor. We found that its expression was tissue specific, and highly expressed in the hepatopancreas, which has an important role in
Fig. 6. Purification of rLvAV in 10% PAGE gel. M: protein molecular weight marker (Low); Replications 1–3 are indicated.
metabolism and immunity, with similar functions to the liver and pancreas of mammals, or fat body of insects (Gibson and Barker, 1979; Wang and Wang, 2013). In shrimp hepatopancreas, many proteins involved in stress and immunity are expressed (Jiang et al., 2009). It is the source of many CTLs (Gross et al., 2001), including LvAV. Its specific expression in hepatopancreas further indicates that it is involved in shrimp immunity. We quantified virus copy number to estimate infection severity (Rahman et al., 2008; Sun et al., 2013a; You et al., 2010). We focused on virus quantification in gill tissue as both virulence (You et al., 2010) and total pathogen load are positively correlated with WSSV copy number in the gill (Sun et al., 2013a). We combined virus load estimated from gill tissues with LvAV expression patterns in hepatopancreas of L.vannamei following experimental infection with WSSV. Our results show that expression of LvAV is broadly negatively correlated with infection severity, but that the relationship between LvAV expression and viral load is complex. LvAV expression shortly after infection is typically high (Fig. 5; 6 hrs p.i.). This might be induced by the initial recognition of WSSV particles (Sun et al., 2013a), suggesting an early defensive role for LvAV. However, a subsequent drop in LvAV expression at 24 hrs p.i. is followed by a dramatic increase in viral load at 48 hrs p.i. (Fig. 5) pointing to a deteriorating or ineffective immune response to the virus, in turn indicating that WSSV may be able to adopt effective mechanisms to avoid host immune clearance, thereby facilitating viral propagation in the later stages of infection (Luo et al., 2003; Sun et al.,
Fig. 7. The expression of LvAV after injection of PBS and dsRNA. The expressions of LvAV at all timepoints were set to 1 and the asterisks indicate the significantly different expression between PBS-injected shrimp and dsRNA-injected shrimp.
54
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
Fig. 8. Change of WSSV copies after (a) injection with PBS, rLvAV and alongside (b) the expression of LvAV at corresponding timepoints. The line indicates the WSSV copies in gill of shrimp after infection with virus and the bar indicated the expression of LvAV where the expression of LvAV at 6 hours after WSSV infection in the PBS-injected group was set to 1. As before, asterisks indicate the significant difference in expression.
2013a). The expression of LvAV then increases at 48 hrs p.i., potentially as a delayed response to increased viral load. To explore the particular role of LvAV in WSSV infection, we employed rLvAV and dsRNA LvAV to enhance or silence LvAV expression in L. vannamei. Compared to the PBS treatment, rLvAV injection led to delayed propagation of WSSV during the initial and later stage of infection. A previous study has also analyzed the efficiency of different rPmAV forms against WSSV, finding that injection of rPmAV could be an effective molecule to control WSSV infection (Pathan et al., 2013). This confirms results that show recombinant PmAV to harbor high antiviral activity in vitro (Luo et al., 2003). We argue that LvAV plays a similar role in shrimp against WSSV infection, although research to understand LvAV antiviral activity in vitro is required. We found that dsRNA LvAV effectively silenced expression of LvAV. However, its role is complex: injection of dsRNA initially led to significantly increased virus load, indicating a role for an LvAV in minimizing WSSV propagation during the early phase of infection. Surprisingly, however, we found a significant decline of viral load in LvAV dsRNA-treated shrimp in the late phase of infection. Our finding implies that LvAV could play a dual role in the host– pathogen interaction, with WSSV subverting LvAV to further facilitate replication. Since AV reportedly does not bind to WSSV directly (Luo et al., 2003), and we predict that it contains a signal peptide, we postulate that AV is involved in a signal pathway or protein complex that functions in extracellular shrimp immunity. Mannose-binding lectins have recently been reported to perform dual functions in defending against disease (Ibernon et al., 2014) and the complement system, of which mannose-binding lectin is a component, may be a double-edged sword during human immunodeficiency virus infection (Ballegaard et al., 2014). While our data indicate that AV may delay propagation of WSSV in both L. vannamei and P. monodon (Pathan et al., 2013), the underlying molecular mechanisms remain unclear. Our findings indicate a complex role for LvAV during viral infection, and further research is required to understand its full role in shrimp immunity. Finally, expression changes of LvAV associated with bacterial infection (V. parahaemolyticus) also demonstrate that this antiviral gene may play a general role in shrimp immunity. Acknowledgments Comments from Dino Mcmahon and anonymous reviewers have greatly improved the manuscript. This work was supported by the Agricultural Science and Technology Achievement Transformation Fund Project of Ministry of Science and Technology, China (no. 2012GB2E200361), the National Fundamental Research Program,
China (no. 2006AA10A406), the Key Laboratory of Marine Biology, Institute of Oceanology, Chinese Academy of Sciences and the Northwest A&F University experimental demonstration station (base) and innovation of science and technology achievement transformation project (no. XNY2013-4). References Alcivar-Warren, A., Meehan-Meola, D., Park, S.W., Xu, Z., Delaney, M., Zuniga, G., 2007. ShrimpMap: a low-density, microsatellite-based linkage map of the pacific whiteleg shrimp, Litopenaeus vannamei: identification of sex-linked markers in linkage group 4. J. Shellfish Res. 26, 1259–1277. Artimo, P., Jonnalagedda, M., Arnold, K., Baratin, D., Csardi, G., De Castro, E., et al., 2012. ExPASy: SIB bioinformatics resource portal. Nucleic Acids Res. 40, W597– W603. Ballegaard, V., Haugaard, A.K., Garred, P., Nielsen, S.D., Munthe-Fog, L., 2014. The lectin pathway of complement: advantage or disadvantage in HIV pathogenesis? Clin. Immunol. 154, 13–25. de Oliveira Cesar, J.R., Zhao, B., Malecha, S., Ako, H., Yang, J., 2006. Morphological and biochemical changes in the muscle of the marine shrimp Litopenaeus vannamei during the molt cycle. Aquaculture 261, 688–694. Drickamer, K., 1999. C-type lectin-like domains. Curr. Opin. Struct. Biol. 9, 585–590. Feizi, T., 2000. Carbohydrate-mediated recognition systems in innate immunity. Immunol. Rev. 173, 79–88. Flegel, T.W., Lightner, D.V., Lo, C., Owens, L., 2008. Shrimp Disease Control: Past, Present and Future. Diseases in Asian Aquaculture VI. Fish Health Section. Asian Fisheries Society, Manila, Philippines, pp. 355–378. Gibson, R., Barker, P.L., 1979. The decapod hepatopancreas.Oceanoger. Mar. Biol. Ann. Rev. 17, 285–346. Gross, P.S., Bartlett, T.C., Browdy, C.L., Chapman, R.W., Warr, G.W., 2001. Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L. setiferus. Dev. Comp. Immunol. 25, 565–577. Holmblad, T., Söderhäll, K., 1999. Cell adhesion molecules and antioxidative enzymes in a crustacean, possible role in immunity. Aquaculture 172, 111–123. Ibernon, M., Moreso, F., Serón, D., 2014. Innate immunity in renal transplantation: the role of mannose-binding lectin. Transplant. Rev. 28, 21–25. Jiang, H., Li, F., Xie, Y., Huang, B., Zhang, J., Zhang, J., et al., 2009. Comparative proteomic profiles of the hepatopancreas in Fenneropenaeus chinensis response to hypoxic stress. Proteomics 9, 3353–3367. Jiravanichpaisal, P., Sricharoen, S., Söderhäll, I., Söderhäll, K., 2006. White spot syndrome virus (WSSV) interaction with crayfish haemocytes. Fish Shellfish Immunol. 20, 718–727. Labreuche, Y., Warr, G.W., 2012. Insights into the antiviral functions of the RNAi machinery in penaeid shrimp. Fish Shellfish Immunol. 34, 1002–1010. Liu, H.P., Soderhall, K., Jiravanichpaisal, P., 2009. Antiviral immunity in crustaceans. Fish Shellfish Immunol. 27, 79–88. Luo, T., Zhang, X., Shao, Z., Xu, X., 2003. PmAV, a novel gene involved in virus resistance of shrimp Penaeus monodon. FEBS Lett. 551, 53–57. Moss, S.M., Arce, S.M., Moss, D.R., Otoshi, C.A., 2006. Disease Prevention Strategies for Penaeid Shrimp Culture. The Oceanic Institute, Hawaii USA. Namikoshi, A., Wu, J.L., Yamashita, T., Nishizawa, T., Nishioka, T., Arimoto, M., et al., 2004. Vaccination trials with Penaeus japonicus to induce resistance to white spot syndrome virus. Aquaculture 229, 25–35. Pathan, M., Gireesh-Babu, P., Pavan-Kumar, A., Jeena, K., Sharma, R., Makesh, M., et al., 2013. In vivo therapeutic efficacy of recombinant Penaeus monodon antiviral protein (rPmAV) administered in three different forms to WSSV infected Penaeus monodon. Aquaculture 376–379, 64–67.
S. He et al./Developmental and Comparative Immunology 51 (2015) 48–55
Petersen, T.N., Brunak, S., von Heijne, G., Nielsen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8, 785–786. Rahman, M.M., Corteel, M., Escobedo-Bonilla, C.M., Wille, M., Alday-Sanz, V., Pensaert, M.B., et al., 2008. Virulence of white spot syndrome virus (WSSV) isolates may be correlated with the degree of replication in gills of Penaeus vannamei juveniles. Dis. Aquat. Organ. 79, 191–198. Rout, N., Kumar, S., Jaganmohan, S., Murugan, V., 2007. DNA vaccines encoding viral envelope proteins confer protective immunity against WSSV in black tiger shrimp. Vaccine 25, 2778–2786. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Schultz, J., Milpetz, F., Bork, P., Ponting, C.P., 1998. SMART, a simple modular architecture research tool: identification of signaling domains. PNAS 95, 5857– 5864. Söderhäll, K., 1999. Special issue: invertebrate immunity. Dev. Comp. Immunol. 23, 263. Sun, Y., Li, F., Xiang, J., 2013a. Analysis on the dynamic changes of the amount of WSSV in Chinese shrimp Fenneropenaeus chinensis during infection. Aquaculture 376–379, 124–132. Sun, Y., Li, F., Chi, Y., Xiang, J., 2013b. Enhanced resistance of marine shrimp Exopalamon carincauda Holthuis to WSSV by injecting live VP28-recombinant bacteria. Acta Oceanologica Sinica 32, 52–58.
55
Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596– 1599. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Wakida-Kusunoki, A.T., Amador-del Angel, L.E., Alejandro, P.C., Brahms, C.Q., 2011. Presence of Pacific white shrimp Litopenaeus vannamei (Boone, 1931) in the Southern Gulf of Mexico. Aquat. Invasions 6, S139–S142. Wang, X.W., Wang, J.X., 2013. Diversity and multiple functions of lectins in shrimp immunity. Dev. Comp. Immunol. 39, 27–38. Witteveldt, J., Cifuentes, C.C., Vlak, J.M., van Hulten, M.C.W., 2004. Protection of Penaeus monodon against white spot syndrome virus by oral vaccination. J. Virol. 78, 2057–2061. You, X.X., Su, Y.Q., Mao, Y., Liu, M., Wang, J., Zhang, M., et al., 2010. Effect of high water temperature on mortality, immune response and viral replication of WSSV-infected Marsupenaeus japonicus juveniles and adults. Aquaculture 305, 133–137. Zhang, Y., Qiu, L., Song, L., Zhang, H., Zhao, J., Wang, L., et al., 2009. Cloning and characterization of a novel C-type lectin gene from shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 26, 183–192.
