Comparative Biochemistry and Physiology, Part B 183 (2015) 49–57

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Molecular characterization of the Chinese alligator follicle-stimulating hormone β subunit (FSHβ) and its expression during the female reproductive cycle Rui Zhang a, Shengzhou Zhang a,⁎, Xue Zhu a, Yongkang Zhou b, Xiaobing Wu a,⁎ a b

Key Laboratory for Conservation and Use of Important Biological Resources of Anhui Province, College of Life Sciences, Anhui Normal University, Wuhu, Anhui 241000, China Alligator Research Center of Anhui Province, Xuanzhou 242000, China

a r t i c l e

i n f o

Article history: Received 29 July 2014 Received in revised form 17 December 2014 Accepted 16 January 2015 Available online 24 January 2015 Keywords: Chinese alligator FSHβ cDNA cloning Homology analysis Gene expression

a b s t r a c t The Chinese alligator Alligator sinensis is an endangered species endemic to China, it has a highly specialized reproductive pattern with low fecundity. Up to date, little is known about the regulation of its female reproductive cycle. Follicle-stimulating hormone (FSH), a glycoprotein hormone, plays a key role in stimulating and regulating ovarian follicular development and egg production. In this study, the complete FSHβ cDNA from the ovary of the Chinese alligator was obtained for the first time, it consists of 843-bp nucleotides, including 120-bp nucleotides of the 5′-untranslated region (UTR), 396-bp of the open reading frame, and 3′-UTR of 327-bp nucleotides. It encodes a 131-amino acid precursor molecule of FSHβ with a signal peptide of 18 amino acids followed by a mature protein of 113 amino acids. Its deduced amino acid sequence shares high identities with the American alligator (100%) and birds (89–92%). Phylogenetic tree analysis of the FSHβ amino acid sequence indicated that alligators cluster into the bird branch. Tissue distribution analyses indicated that FSHβ mRNA is expressed in ovary, intestine and liver with the highest level in the ovary, while not in stomach, pancreas, heart, thymus and thyroid. Expression of FSHβ in ovary increases in May (breeding prophase) and peaks in July (breeding period), it is maintained at high levels through September, then decreases significantly in November (post-reproductive period) and remains relatively low from January to March (hibernating period). These temporal changes of FSHβ expression implicated that it might play an important role in promoting ovarian development during the female reproductive cycle. © 2015 Elsevier Inc. All rights reserved.

1. Introduction The Chinese alligator Alligator sinensis, belonging to the Crocodilia Alligatoridae family, is an endangered species and indigenous to China, and is listed by the Chinese government as a first-level stateprotected species in 1972 (Yan et al., 2005). Nature reserves and artificial farms of the Chinese alligator were set up in the Anhui and Zhejiang Provinces. Though the issues with artificial incubation and breeding of the Chinese alligators have been successfully resolved, the productivity of the Chinese alligator is considerably affected by inherent problems such as lower and highly annual fluctuating egg-laying rate (Cheng et al., 2003). The Chinese alligators start mating in June every year, laying eggs in July, then hatching until September, March to May is the breeding prophase, June to September is the breeding period, September to November is the post-reproductive period (Cheng et al., 2003). Up to this date, little is known about the regulation of its female reproductive cycle. ⁎ Corresponding authors. Tel.: +86 139 5537 0129; fax: +86 553 3836837. E-mail addresses: [email protected] (S. Zhang), [email protected] (X. Wu).

http://dx.doi.org/10.1016/j.cbpb.2015.01.003 1096-4959/© 2015 Elsevier Inc. All rights reserved.

Reproduction in vertebrates is mainly under endocrine control of the hypothalamus–pituitary–gonad axis leading to circulating sexual steroids affecting several peripheral target organs. The folliclestimulating hormone (FSH), a glycoprotein hormone, is the key reproductive hormones involved in gonadal development. FSH belongs to the glycoprotein hormone family along with thyroid-stimulating hormone (TSH), luteinizing hormone (LH) and chorionic gonadotropin (CG) (Liao et al., 2003). They are composed of two different subunits designated as α and β. The α subunit is common among these hormones within a species and is structurally conserved among different species, whereas the β subunit is specific to each hormone and confers biological specificity (Landomiel et al., 2014). FSHβ functions together with LHβ to promote the growth and development of gonads, to control gametogenesis and regulate gonadal endocrine functions (Chauvigné et al., 2012). In females, FSHβ stimulates ovarian follicular development. The follicles receiving insufficient FSHβ support are doomed to atretic degeneration during the critical stage of follicle development (Zhao et al., 2010). The structure, function, and regulation of FSHβ molecules have been investigated most extensively in mammals (Noguchi et al., 2006; Scammell et al., 2008) and fish (So et al., 2005; Hellqvist et al., 2006),

50

R. Zhang et al. / Comparative Biochemistry and Physiology, Part B 183 (2015) 49–57

Table 1 Primers used for cloning cDNA of the Chinese alligator FSHβ. Primer names

Primer sequences

Technique

FS1S FS1R 5′-GSP1 5′-GSP2 5′-GSP3 3′-GSP1 3′-GSP2 YFS2S YFS2R β-act1S β-act1R

5′ TAAGTATCCTCCAGTGTCA 3′ 5′ GCTGAGGATAGCAGGAAT 3′ 5′ CTCTCACAGTACAGTC 3′ 5′ GCATTCTGTAGCCACTGGGTAT 3′ 5′ ACTGTTTCATACACAAGCTCCT 3′ 5′ CAGTGAAGATCCCTGGATGTGGTGACC 3′ 5′ TAGGCCCAAGCTACTGCTCCTTCAGT 3′ 5′ TAAGTATCCTCCAGTGTCA 3′ 5′ TCAGTGCTGTCCGTATCA 3′ 5′ ACCGAAACAAGAACCCAT 3′ 5′ CCGACACGCTAAGACTGC 3′

RT-PCR RT-PCR 5′RACE 5′RACE 5′RACE 3′RACE 3′RACE qRT-PCR qRT-PCR qRT-PCR qRT-PCR

amphibians (Saito et al., 2002), whereas no related work has been reported in the Crocodilian order so far. In this study, the complete cDNA of the Chinese alligator FSHβ cDNA was cloned by RT-PCR and RACE methods. The obtained FSHβ cDNA and the deduced amino acid sequence of the FSHβ were analyzed with web based computer programs. The changes in temporal and spatial expression of FSHβ during the reproductive cycle were analyzed by qRT-PCR. The results could expand our knowledge of FSHβ gene phylogenetic evolution, provide an insight into the mechanisms that regulate reproduction of the Chinese alligator and could also help towards producing recombinant Chinese alligator FSHβ, which may be used in artificial breeding aimed to increase its captive reproductive efficiency.

2. Materials and methods and relatively less in birds (Shen et al., 2006; Zhao et al., 2010) and amphibians (Urbatzka et al., 2006), wherein conservation of the molecular structure of FSHβ was found, while some specific features were also reported in different species. In reptiles, the FSHβ cDNA encoding has been reported recently, for Reeves's turtle (Aizawa and Ishii, 2003) and Chinese soft-shell turtle (Chien et al., 2005), no Crocodilian FSHβ has yet been characterized. Gonadotropins are well known to be expressed by the pituitary (Saito et al., 2002). However, new studies have revealed that FSHβ also showed extrapituitary expression in other tissues. The expression of zebrafish FSHβ could be detected in the ovary, testis, brain, kidney, and liver (So et al., 2005), the extrapituitary expression of FSHβ in tissues such as gonads, brain, kidney, and liver has also been reported in mammals and other fishes, including humans (Parhar et al., 2003) and African catfish (Vischer et al., 2003b). These results suggested that FSHβ may have various physiological functions in different tissues. To pursue the roles of FSHβ in the complex reproductive processes of vertebrate species, changes in ovary FSHβ expression were monitored in female animals at precise stages of oogenesis during a complete reproductive cycle, including mammals (Parhar et al., 2003), fish (Meiri et al., 2004; Utoh et al., 2005), birds (Shen and Yu, 2002) and

2.1. Animals and RNA isolation Sexually mature female Chinese alligators (two animals per season) were obtained from the Xuanzhou Alligator Culturing Centre of Anhui Province. The alligators were anesthetized with an intraperitoneal injection of pentobarbital, the ovary, stomach, intestine, pancreas, liver, heart, thymus and thyroid tissues were excised and immediately kept in RNA-Be-Locker A (Sangon Biotec, Shanghai) and then stored in a − 80 °C refrigerator. The above samples were collected in January, March, May, July, September and November during 2013 to 2014. All procedures were approved by the forestry authorities of China. For the gene cloning and tissue expression experiments, total RNA was extracted from different tissues using a Total RNA Extractor (Sangon Biotec, Shanghai) as in the following steps: taking 100 mg of different tissues and grinding quickly in liquid nitrogen. The rest of the detailed operations was done according to the manufacturer's instructions, RNase-free DNase I (TaKaRa, Dalian, China) was used to remove the genomic DNA contamination. The concentration of total RNA was determined by measuring absorbance at 260 nm, and purity was determined by dividing absorbance at 260 nm by absorbance at 280 nm

Table 2 Species and references of FSHβs used for sequence comparison in this study. Animal class/species

Scientific name

GenBank ID

Reference

Mammals Human Norway rat Sheep Chimpanzee Brush-tailed possum

Homo sapiens Rattus norvegicus Ovis aries Pan troglodytes Trichosurus vulpecula

NM_000510.2 NM_001007597.1 X15493.1 NM_001071814.1 AF008550.1

Benson et al. (2013) Maurer (1987) Mountford et al. (1989) Grigorova et al. (2007) Lawrence et al. (1997)

Birds Quail Chicken Greylag goose

Coturnix japonica Gallus gallus Anser anser

AB086952.1 AB077362.1 KC777370.1

Kikuchi et al. (1998) Shen and Yu (2002) –

Reptiles Chinese alligator American alligator Reeves' s turtle Brown tree snake Chinese softshell turtle

Alligator sinensis Alligator mississippiensis Chinemys reevesii Boiga irregularis Pelodiscus sinensis

This study NM_001287605.1 AB085201.1 AB575985.1 DQ234263.1

This study – Aizawa and Ishii (2003) – Chien et al. (2005)

Amphibians Japanese firebelly newt Japanese toad African clawed frog

Cynops pyrrhogaster Bufo japonicus Xenopus laevis

AB067752.1 AB085668.1 AB175888.1

Saito et al. (2002) Komoike and Ishii (2003) –

Fishes Siberian sturgeon Australian lungfish Grass carp European eel

Acipenser baerii Neoceratodus forsteri Ctenopharyngodon idella Anguilla anguilla

AJ251658.1 AJ578040.1 EF552359 AY169722.1

Quérat et al. (2000) Quérat et al. (2003) Zhou et al. (2010) Degani et al. (2003)

“–” Only sequence was identified in the GenBank, there was no published report.

R. Zhang et al. / Comparative Biochemistry and Physiology, Part B 183 (2015) 49–57

51

Fig. 1. Electrophoresis of PCR products. a shows ordinary PCR product. b shows 5′RACE product. c shows 3′RACE product, M shows the DNA Marker and I shows the sample band.

Fig. 2. Nucleotide and deduced amino acid sequences of the Chinese alligator FSHβ. The upper sequence indicates the amino acids and the lower shows the nucleotide. ATG shows the initiation codon. TGA shows the termination codon. Two putative N-linked glycosylation sites (NIT and NAT) are denoted by rectangles. Motifs of ATTTA in 3′-UTR are denoted by rectangles and gray. The polyadenylational signals (AATAAA) are indicated with open rectangles and black.

52

R. Zhang et al. / Comparative Biochemistry and Physiology, Part B 183 (2015) 49–57

Table 3 Amino acid composition of the Chinese alligator FSHβ. Name of amino acid

Abbreviation

Symbol

Class

Content (%)

Glutamic acid Lysine Aspartic acid Histidine Arginine Cysteine Threonine Serine Valine Tyrosine Leucine Proline Isoleucine Alanine Phenylalanine Glycine Asparagine Glutamine Tryptophan Methionine

Glu Asp His Lys Arg Cys Thr Ser Ala Tyr Val Pro Leu Ile Phe Gly Asn Gln Trp Met

E D H K R C T S A Y V P L I F G N Q W M

Acidic amino acid Acidic amino acid Alkaline amino acid Alkaline amino acid Alkaline amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid Neutral amino acid

8.4 5.3 3.8 1.5 1.5 12.2 10.7 8.4 7.6 6.1 4.6 4.6 4.6 3.8 3.8 3.8 3.8 3.1 1.5 0.8

(A260/A280). Only RNA samples with A260/A280 ratios of 1.8–2.0 were used for RT-PCR. Total RNA was stored at −80 °C until further use. 2.2. Cloning of the encoding region of the Chinese alligator FSHβ cDNA Reverse transcription of mRNA into cDNA was achieved using the PrimeScript 1st cDNA Synthesis Kit (TaKaRa, Dalian). Primers used are shown in Table 1 and were designed around the most highly conserved regions of the FSHβ nucleotide sequence from three different species (American alligator, chicken, quail). The conserved sequence of FSHR cDNA was obtained from NCBI's GenBank. Total cDNA from the ovaries of the Chinese alligator was used as a template for subsequent polymerase chain reactions (PCR) and the partial FSHβ cDNA was obtained using primer pair FS1S and FS1R. Another set of primer pair was designed following the partial FSHβ cDNA for RACE (Table 1). 5′-GSP1, 5′-GSP2 and 5′-GSP3 were used to obtain the 5′RACE product and 3′-GSP1 and 3′-GSP2 were used to obtain the 3′RACE product. All primers used in this study were designed using PrimerPrimer 5.0 and synthesized by Sangon Biotec (Shanghai). The 5′RACE and 3′RACE reactions were performed using the System for Rapid Amplification of cDNA Ends, Version 2.0 (Invitrogen, USA) and a SMARTer™ RACE cDNA Amplification Kit (Clontech, USA) according to the manufacturer's instructions. PCR products were purified using a DNA Gel Extraction Kit (Axygen, Hangzhou), and purification products were sub-cloned into PMD-18T (TaKaRa, Dalian) followed by transformation into DH5α Escherichia coli cells (TransGen, Beijing). Nine to ten positive clones were randomly selected for DNA sequencing by Sangon Biotech (Shanghai). 2.3. Sequence analysis The amplified PCR product was confirmed to be FSHβ based on its high homology compared to FSHβ sequences from other species found in the GenBank via a NCBI Blast program. Then, the partial cDNA of the Chinese alligator FSHβ sequence was aligned and compared with FSHβ of a few representative species using ClustalW (Thompson et al., 1994). Amino acid was deduced using Protein Translation, a web based program at ExPaSy (http://web.expasy.org/translate/). The ORF was found by ORF finder on the NCBI (http://www.ncbi.nlm.nih.gov./ projects/gorf/). Signal peptide was predicted by SignalP 4.1 server (http://www.cbs.cbs.dtu.dk/services/SignalP/) (Bendtsen et al., 2004). Multiple amino acid sequences of different species were aligned with Clustal W. A phylogenetic tree was constructed using neighbor-joining method (MEGA 5.0; Saitou and Nei, 1987). The secondary protein

structure was predicted with SOPMA (http://npsa-pbil.ibcp.fr/cgi-bin/ npsa_automat.pl?page=npsa_sopma.html) (Geourjon and Deléage, 1995). 2.4. Tissue specific expression of FSHβ For the tissue specificity study of FSHβ gene expression, total RNA was isolated, as described above, from various tissues including ovary, stomach, intestine, pancreas, liver, heart, thymus and thyroid tissues. Total RNA (100 ng) from each tissue was reverse transcribed to firststrand DNA, and then subjected to PCR amplification (31 cycles) of the coding region of the Chinese alligator FSHβ cDNA by using the primer pair FS1S and FS1R, and the first strand DNA of each tissue was also subjected to PCR amplification of the Chinese alligator β-actin (β-act1S and β-act1R) (31 cycles) as an internal reference. PCR products were revealed by 1.5% agarose gel electrophoresis and their intensities were quantified densitometrically using Quantity One software. All quantified results were expressed as mean ± standard deviations (mean ± SD) and the variance analysis was carried out with SPSS 13.0 statistical software. Statistical significance was indicated with a P value b 0.05. 2.5. Reproductive cycle changes in FSHβ gene expression To investigate the reproductive cycle changes in FSHβ gene expression, ovary samples (two animals per season) were collected in January, March, May, July, September and November. Total RNA was isolated as described above. The same amount of total RNAs (100 ng) from each ovary sample were reverse transcribed to first-strand DNA. The products were then subjected to qRT-PCR analysis to determine the expression level of the Chinese alligator FSHβ. Each 20 μl PCR mixture contained 10 μl of 2 × iQ™ SYBR Ex Taq™ (Tli RNaseH Plus), 0.4 μl (100 mM) of each primer, and 0.8 μl of cDNA, ddH2O up to 20 μl. The qRT-PCR scheme was as following: after an initial step of denaturation at 95 °C for 30 s, 40 cycles were carried out at 95 °C for 30 s and annealing at a 54 °C temperature for 30 s. A melting curve was constructed to verify that only a single PCR product was amplified. Relative expression levels were normalized to the reference cDNA β-actin. Samples were assayed in triplicate with standard deviations of threshold cycle values not exceeding 1 on a within-run basis. Mixtures were incubated in an iCycler iQ Real-time Detection system (Bio-Rad, Hercules, CA). The data obtained were then analyzed with 2−ΔΔCt and statistical means by one-way ANOVA (Chien et al., 2005). 2.6. Construction of a phylogenetic tree of vertebrate FSHβ A phylogenetic tree of selected vertebrate FSHβs was constructed based on the aligned amino acid sequences, and analyzed by the neighbor-joining method (Molecular Evolutionary Genetic Analysis, MEGA5.0). For deriving the confidence value for this analysis, bootstrap trials were replicated 1000 times. GenBank accession numbers and references of FSHβ sequences analyzed in this study are shown in Table 2. 3. Results 3.1. Cloning of the full-length FSHβ cDNA The total RNA was reverse transcribed to synthesize the cDNA, which was used as a template for the PCR reactions. A single PCR product with the expected size was amplified and resolved by 1.5% agarose gel electrophoresis (Fig. 1a). A 540-bp cDNA fragment was first obtained after sequencing. 5′-GSP1, 5′-GSP2 and 5′-GSP3 (Table 1) were used to obtain the 5′RACE product (Fig. 1b). A DNA fragment of 407-bp was got after sequencing. 3′-GSP1 and 3′-GSP2 (Table 1) were used to obtain the 3′RACE product (Fig. 1c). A DNA fragment of 374-bp was obtained

R. Zhang et al. / Comparative Biochemistry and Physiology, Part B 183 (2015) 49–57

53

Fig. 3. Comparison of FSHβ amino acid sequences between the Chinese alligator and other species. Hyphens/gaps (-) was introduced in order to obtain maximum homology. Conserved residues are indicated by “*” under sequences. “:” and “.” indicated high conservative and weak conservative, respectively.

after sequencing. The results of blasting on NCBI indicated that they were all partial fragments of FSHβ cDNA. 3.2. Sequencing and identification of the cDNA The 5′RACE fragment and the 3′RACE fragment mentioned above were spliced with Software DNASTAR. The overlapping 5′ and 3′RACE fragments yielded a sequence of 843-bp (Fig. 2) which consists of 120-bp nucleotides of the 5′-untranslated region (UTR), 396-bp of the open reading frame, and 3′-UTR of 327-bp nucleotides. One canonical polyadenylation signal (AATAAA) is present at 12-bp upstream of poly(A) trail. One “adenylate + uridylate rich (AU-rich)” AUUUA motif, which is indicated as a signal for rapid mRNA degradation, was found within the 3′-UTR of the Chinese alligator FSHβ cDNA. The

deduced amino acid sequence of the Chinese alligator FSHβ is shown in Fig. 2. It encodes a 131-amino acid precursor molecule of FSHβ with a signal peptide of 18 amino acids followed by a mature protein of 113 amino acids. Two putative N-linked glycosylation sites of FSHβ were found in Asn45 and Asn62. 3.3. Amino acid composition of the Chinese alligator FSHβ The Chinese alligator FSHβ is composed of 20 types of amino acids. Analysis of amino acid composition showed that the content of neutral amino acids is the highest. Some functional amino acids, Glu, Asp, Gly, Ala, Lys and Arg have their higher contents in the amino acid composition of the Chinese alligator FSHβ (Table 3). The FSHβ amino acid sequence of the Chinese alligator was compared to that of birds,

54

R. Zhang et al. / Comparative Biochemistry and Physiology, Part B 183 (2015) 49–57

Fig. 4. SOPMA result for FSHβ of the Chinese alligator. α-Helix (h), extended strand (e), β-turn (t) and random coil (c).

mammals, amphibians, fishes and other reptiles. As indicated in Fig. 3, 12 cysteine residues of the Chinese alligator FSHβ are conserved as for other vertebrates at positions 21, 35, 38, 46, 50, 69, 84, 100, 102, 105,112, and 122. One asparagine-linked glycosylation site, located at position 25 between the 21st cysteine and the 35th cysteine, is conserved in the Chinese alligator and other vertebrates, while the other asparagine-linked glycosylation site, located at position 42 between the 38th cysteine and the 46th cysteine is also conserved in the Chinese alligator and other vertebrates except for Grass carp. The Chinese alligator FSHβ amino acid sequence contains a CSGYC sequence at positions Cys46–Cys50 in which most vertebrates have the unique β-subunit motif CAGYC.

3.4. The Chinese alligator FSHβ structure prediction analysis Location of four secondary structural classes in the Chinese alligator FSHβ was predicted using SOPMA. The Chinese alligator FSHβ contained 24.43% alpha helix and presented in Met1-Tyr7, Trp13-Ala15, Ile20Asn25, Val65-Leu74, Arg115-Gly116, Phe124 and Ser129-Glu131, 25.19% extended strand located in Val8-Cys12, Ile26-Val30, Cys38Trp45, Val75-Lys80, Phe91-Tyr92, Val96-Glu99, Thr113-Val114 and Ser124, 4.58% beta pleated sheet located in Glu33-Glu34, Ser47-Gly48 and Gln126-Asn127, and 45.80% random coil (Fig. 4).

3.5. Homologous and phylogenetic analyses Alignment of FSHβ nucleotide and amino acid sequences between the Chinese alligator and other selected vertebrates indicated that the deduced amino acid sequence of the Chinese alligator FSHβ shares identities of 100% with the American alligator, 89–92% with birds, 62–67% with mammals, 63–66% with amphibians and 44–67% with fishes (Table 4). The phylogenetic tree of the Chinese alligator and other species FSHβ indicated that species for the same animal classes are clustered in groups. The Chinese alligator and American alligator form a branch and then cluster with the birds. The alligator FSHβs are closer to chicken and quail than to the Chinese softshell turtle and Reeves's turtle (Fig. 5). The reptile FSHβs exhibit a closer phylogenetic relationship with those of birds than with those of mammals and amphibians. 3.6. Tissue specificity of FSHβ gene expression To examine the tissue specificity of FSHβ cDNA expression, the relative content of FSHβ mRNA from various tissues was measured by RT-PCR. As shown in Fig. 6a and b, FSHβ was expressed in ovary, intestine and liver with the highest level in the ovary (P b 0.05), while not in stomach, pancreas, heart, thymus and thyroid. 3.7. Reproductive cycle changes in FSHβ gene expression

Table 4 Comparison of the percentage identity of mature protein of FSHβ nucleotide and amino acid sequences between the Chinese alligator and representative species among vertebrates. Species name

Nucleotide (identity, %)

Amino acid (identity, %)

Human Chimpanzee Norway rat Brush-tailed possum Sheep Chicken Greylag goose Quail American alligator Reeves's turtle Chinese softshell turtle Brown tree snake Japanese firebelly newt African clawed frog Japanese toad Grass carp Australian lungfish Siberian sturgeon European eel

75 76 73 75 72 86 86 84 99 93 89 75 71 69 71 NA 76 NA NA

70 69 70 71 74 90 92 89 100 94 92 72 67 62 65 44 67 50 53

Note. NA, nucleotide sequences data not available

The relative content of FSHβ mRNA in the ovary during a reproductive cycle was examined by qRT-PCR. As shown in Fig. 7, The relative content of FSHβ mRNA in January, March, May, July, September and November was 1.00, 1.78, 2.72, 3.93, 3.83 and 0.63 respectively. FSHβ is highly expressed in May (breeding prophase) and reaches a peak in July (breeding period). High expression was maintained through September (post-reproductive period), but decreased significantly in November (post-reproductive period). Lower levels were also maintained from January to March (hibernating period). Statistical analysis revealed that it has a significant difference in July compared with January and November (P b 0.05). 4. Discussion In this study, we have obtained the full-length cDNA sequence of FSHβ from the Chinese alligator for the first time, which contains a 396-bp nucleotide of the open-reading frame encoding a putative precursor protein molecule of 131 amino acids with a signal peptide of 18 amino acids and a mature protein of 113 amino acids. Two conserved N-linked glycosylation sites (Asn-X-Ser/Thr) observed in other vertebrate FSHβs are also found in the Chinese alligator FSHβ (Asn25-Ile-Thr and Asn42-Ala-Thr). The glycosylation of gonadotropin

R. Zhang et al. / Comparative Biochemistry and Physiology, Part B 183 (2015) 49–57

55

Fig. 5. The phylogenetic tree of FSHβ amino acid sequences from the Chinese alligator and other representative vertebrates. The source and references of the selected FSHβ data are indicated in Table 2.

subunits is known to be crucial for biosynthesis, subunit assembly, stability of the heterodimer, and protection against clearance by hepatic asialoglycoprotein receptors (Gen et al., 2000; Swanson et al., 2003), as well as for proper binding to the corresponding receptors (Vischer et al., 2003a; So et al., 2005). The Chinese alligator FSHβ amino acid sequence contains a CSGYC sequence at the same position in which most mammals have the unique β-subunit motif CAGYC, which was considered to be a key structure for binding to common α-subunits (Noguchi et al., 2006). The CSGYC sequence of the Chinese alligator is identical to those in birds (Koide

et al., 1996; Kikuchi et al., 1998; Shen and Yu, 2002) and amphibians (Hayashi et al., 1992; Komoike and Ishii, 2003), while it is different from those in most of mammals and fishes with a different residue in the second position (Gharib et al., 1989; Mountford et al., 1989; So et al., 2005), it seemed that its second residue is not functionally important. The positions of the 12 cysteine residues in FSHβ are all conserved in the Chinese alligator and other species analyzed. Previous studies have demonstrated that the 12 cysteine (Cys) sites of the mature chicken FSHβ subunits could form the disulfide bonds (Zhao et al., 2010), and the regions fold into a ‘seatbelt’ (Chopineau et al., 2001). The sequences

Fig. 6. Tissue specificity of FSHβ gene expression analyzed by semi-quantitative RT-PCR. a: 100 ng of total RNA each from ovary (lane 1), stomach (lane 2), intestine (lane 3), pancreas (lane 4), liver (lane 5), heart (lane 6), thymus (lane 7) and thyroid (lane 8) was subjected to RT-PCR for FSHβ cDNA amplification, with β-actin serving as an internal reference gene. b: Histograms of ratio of expression levels of FSHβ and β-actin, with columns 1–8 corresponding to lanes 1–8, respectively. The histogram marked with different letters indicates a significant difference in the difference between tissues at P b 0.05.

56

R. Zhang et al. / Comparative Biochemistry and Physiology, Part B 183 (2015) 49–57

Fig. 7. Reproductive cycle changes of FSHβ gene expression in the Chinese alligator ovary. There are two Chinese female alligators per season and three biological replicates for the reproductive cycle. Each bar represents mean ± SEM of the three samples. The same letters indicate that the treatments are not significantly different as determined by the one-way ANOVA. Different letters indicate that the treatments are significantly different as determined by the one-way ANOVA (P b 0.05).

of FSH “seat-belt” segment are highly conserved in tetrapodian FSHβ, which is located on the surface of the heterodimer molecule and is believed to interact with its receptor (Fan and Hendrickson, 2005). The biochemical and bioactivity studies show that this region determines the hormonal activity and specificity of the FSH molecule (Cerdà et al., 2008). Alligator and Caiman are two genera in Alligatoridae, the Chinese A. sinensis and American alligator Alligator mississippiensis are the only two living species of the Alligator. There is considerable debate about the classification position of the Chinese alligator and the relationship between the two alligator species, the morphology data of skull suggested a closer relationship between the Chinese alligator and the Caiman crocodiles, while the mitochondrial genome sequence data indicated that the Chinese alligator cluster with the American alligator (Wu et al., 2003). In this study, the sequence alignment showed that the nucleotide sequence of the Chinese alligator FSHβ is slightly different from that of the American alligator, while the amino acid sequences of the two alligators are identical, suggesting a closer relationship between the two alligators. Phylogenetic analysis of the amino acid sequences indicated that the alligator FSHβ is clustered into the bird FSHβ branch. Typically, sequence alignment revealed a higher degree of amino acid identity between the Chinese alligator and every given bird species (89–92%), which supports the hypothesis that the alligator is a sister group to birds (Walker, 1972). Previous studies have demonstrated that FSHβ is mainly secreted by the pituitary gland to regulate gonadal development and function after delivery through the bloodstream (Patsoula et al., 2003; Cui et al., 2009). However, So et al. (2005) found that the FSHβ of zebrafish was also expressed in some extrapituitary tissues, particularly the gonads and brain. In this study, we found that the Chinese alligator FSHβ was expressed not only in ovary, but also in intestine and liver, while not in stomach, pancreas, heart, thymus and thyroid. A similar phenomenon of extrapituitary expression of gonadotropins (FSH) in tissues such as gonads, brain, kidney, and liver has also been reported in mammals and other fishes, including humans (Parhar et al., 2003), African catfish (Vischer et al., 2003b). The FSHβ expression seemed to be stage dependent and was subject to the regulation by the gonadotropin-releasing hormone (GnRH) (Wong and Zohar, 2004), the physiological significance of the nonpituitary gonadotropins remains unknown and will be an interesting issue to address in the future. Previous studies have demonstrated that the expression of Japanese quail FSHβ achieves a high value in its breeding month (July) (Kikuchi et al., 1998). However, in the coho salmon, the expression of FSHβ is low at the beginning, reaches a peak before spawning, but decreases significantly during the spawning period (Swanson et al., 1991). The same variation also exists in the rainbow trout (Gomez et al., 1999), Japanese eel (Suetake et al., 2002) and Japanese conger (Kajimura et al., 2001; Utoh et al., 2005). In this study, we found that FSHβ expression of the Chinese alligator increased significantly during the breeding prophase and reached a peak in the breeding period, then decreased significantly

during the post-reproductive and hibernating periods, which was most similar to the variation of Japanese quail FSHβ expression, but different from that of some fishes (Gomez et al., 1999; Utoh et al., 2005). The temporal changes of FSHβ expression implicated that it might play an important role in promoting the maturation of ovarian follicles of the Chinese alligator during the reproductive cycle. In summary, the complete cDNA of the Chinese alligator FSHβ was obtained for the first time in this study. The amino acid sequence of the Chinese alligator FSHβ is identical to that of the American alligator, the alligator FSHβ exhibits a higher degree of amino acid identity with birds. Although the pituitary gland has been well accepted to be the site where FSH is produced and released, RT-PCR analysis in the Chinese alligator clearly demonstrated that the subunits of gonadotropins were also expressed in extrapituitary tissues, including the intestine and liver. Whether this special distribution has additional effects at the intestine and liver is unknown at this time. The temporal changes of FSHβ expression implicated that it might play an important role in promoting the maturation of ovarian follicles of the Chinese alligator during the reproductive cycle. Knowledge about the structure of FSHβ may aid further studies on its structure–function relationships. Our finding in this study that the Chinese alligator FSHβ has high similarity in structure with birds, suggested that it may be possible to increase FSH levels in the Chinese alligator by using bird FSH, which could stimulate the ovary to produce more estrogen and improve the reproductivity. Acknowledgments This work was supported by National Natural Science Foundation of China (NSFC, Grant No.31272337) and Natural Science Foundation of Anhui Province (Grant No.11040606M75). References Aizawa, Y., Ishii, S., 2003. Cloning of complimentary deoxyribonucleic acid encoding follicle-stimulating hormone and luteinizing hormone beta subunit precursor molecules in Reeves's turtle (Geoclemys reevesii) and Japanese grass lizard (Takydromus tachydromoides). Gen. Comp. Endocrinol. 132, 465–473. Bendtsen, J.D., Nielsen, H., von Heijne, G., Brunak, S., 2004. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340, 783–795. Benson, C.A., Kurz, T.L., Thackray, V.G., 2013. A human FSHβ promoter SNP associated with low FSH levels in men impairs LHX3 binding and basal FSHβ transcription. Endocrinology. 154, 3016–3021. Cerdà, J., Chauvigne, F., Agulleiro, M.J., Marin, E., Halm, S., Martínez-Rodríguez, G., Prat, F., 2008. Molecular cloning of Senegalese sole (Solea senegalensis) follicle-stimulating hormone and luteinizing hormone subunits and expression pattern during spermatogenesis. Gen. Comp. Endocrinol. 156, 470–481. Chauvigné, F., Verdura, S., Mazón, M.J., Duncan, N., Zanuy, S., Gómez, A., Cerdà, J., 2012. Follicle-stimulating hormone and luteinizing hormone mediate the androgenic pathway in Leydig cells of an evolutionary advanced teleost. Biol. Reprod. 87, 35. Cheng, B.H., Hua, T.M., Wu, X.B., 2003. Research on the Chinese Alligator. Shanghai Scientific and Technical Publishers, Shanghai (in Chinese). Chien, J.T., Shen, S.T., Lin, Y.S., Yu, J.Y., 2005. Molecular cloning of the cDNA encoding follicle-stimulating hormone beta subunit of the Chinese soft-shell turtle Pelodiscus sinensis, and its gene expression. Gen. Comp. Endocrinol. 141, 190–200. Chopineau, M., Martinat, N., Galet, C., Guillou, F., Combarnous, Y., 2001. beta-Subunit 102– 104 residues are crucial to confer FSH activity to equine LH/CG but are not sufficient to confer FSH activity to human CG. J. Endocrinol. 169, 55–63. Cui, H.X., Zhao, S.M., Cheng, M.L., Guo, L., Ye, R.Q., Liu, W.Q., Gao, S.Z., 2009. Cloning and expression levels of genes relating to the ovulation rate of the Yunling black goat. Biol. Reprod. 80, 219–226. Degani, G., Goldberg, D., Tzchori, I., Hurvitz, A., Yom Din, S., Jackson, K., 2003. Cloning of European eel (Anguilla anguilla) FSH-beta subunit, and expression of FSH-beta and LH-beta in males and females after sex determination. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 136, 283–293. Fan, Q.R., Hendrickson, W.A., 2005. Structure of human follicle-stimulating hormone in complex with its receptor. Nature 433, 269–277. Gen, K., Okuzawa, K., Senthilkumaran, B., Tanaka, H., Moriyama, S., Kagawa, H., 2000. Unique expression of gonadotropin-I and -II subunit genes in male and female red seabream (Pagrus major) during sexual maturation. Biol. Reprod. 63, 308–319. Geourjon, C., Deléage, G., 1995. Geourjon SOPMA: significant improvements in protein secondary structure prediction by consensus prediction from multiple alignments. Comput. Appl. Biosci. 11, 681–684. Gharib, S.D., Roy, A., Wierman, M.E., Chin, W.W., 1989. Isolation and characterization of the gene encoding the beta-subunit of rat follicle-stimulating hormone. DNA 8, 339–349.

R. Zhang et al. / Comparative Biochemistry and Physiology, Part B 183 (2015) 49–57 Gomez, J.M., Weil, C., Ollitrault, M., Le Bail, P.Y., Breton, B., Le Gac, F., 1999. Growth hormone (GH) and gonadotropin subunit gene expression and pituitary and plasma changes during spermatogenesis and oogenesis in rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 113, 413–428. Grigorova, M., Rull, K., Laan, M., 2007. Haplotype structure of FSHB, the beta-subunit gene for fertility-associated follicle-stimulating hormone: possible influence of balancing selection. Ann. Hum. Genet. 71, 18–28. Hayashi, T., Hanaoka, Y., Hayashi, H., 1992. The complete amino acid sequence of the follitropin beta-subunit of the bullfrog, Rana catesbeiana. Gen. Comp. Endocrinol. 88, 144–150. Hellqvist, A., Schmitz, M., Mayer, I., Borg, B., 2006. Seasonal changes in expression of LHbeta and FSH-beta in male and female three-spined stickleback, Gasterosteus aculeatus. Gen. Comp. Endocrinol. 145, 263–269. Kajimura, S., Yoshiura, Y., Suzuki, M., Aida, K., 2001. cDNA cloning of two gonadotropin beta subunits (GTH-Ibeta and -IIbeta) and their expression profiles during gametogenesis in the Japanese flounder (Paralichthys olivaceus). Gen. Comp. Endocrinol. 122, 117–129. Kikuchi, M., Kobayashi, M., Ito, T., Kato, Y., Ishii, S., 1998. Cloning of complementary deoxyribonucleic acid for the follicle-stimulating hormone-beta subunit in the Japanese quail. Gen. Comp. Endocrinol. 111, 376–385. Koide, Y., Papkoff, H., Kawauchi, H., 1996. Complete amino acid sequences of follitropin and lutropin in the ostrich, Struthio camelus. Eur. J. Biochem. 240, 262–267. Komoike, Y., Ishii, S., 2003. Cloning of cDNAs encoding the three pituitary glycoprotein hormone beta subunit precursor molecules in the Japanese toad, Bufo japonicus. Gen. Comp. Endocrinol. 132, 333–347. Landomiel, F., Gallay, N., Jégot, G., Tranchant, T., Durand, G., Bourquard, T., Crépieux, P., Poupon, A., Reiter, E., 2014. Biased signalling in follicle stimulating hormone action. Mol. Cell. Endocrinol. 382, 452–459. Lawrence, S.B., Vanmontfort, D.M., Tisdall, D.J., McNatty, K.P., Fidler, A.E., 1997. The follicle-stimulating hormone beta-subunit gene of the common brushtail possum (Trichosurus vulpecula): analysis of cDNA sequence and expression. Reprod. Fertil. Dev. 9, 795–801. Liao, M.J., Zhu, M.Y., Zhang, Z.H., Zhang, A.J., Li, G.H., Sheng, F.J., 2003. Cloning and sequence analysis of FSH and LH in the giant panda (Ailuropoda melanoleuca). Anim. Reprod. Sci. 77, 107–116. Maurer, R.A., 1987. Molecular cloning and nucleotide sequence analysis of complementary deoxyribonucleic acid for the beta-subunit of rat follicle stimulating hormone. Mol. Endocrinol. 1, 717–723. Meiri, I., Knibb, W.R., Zohar, Y., Elizur, A., 2004. Temporal profile of beta folliclestimulating hormone, beta luteinizing hormone, and growth hormone gene expression in the protandrous hermaphrodite, gilthead seabream, Sparus aurata. Gen. Comp. Endocrinol. 137, 288–299. Mountford, P.S., Bello, P.A., Brandon, M.R., Adams, T.E., 1989. Cloning and DNA sequence analysis of the cDNA for the precursor of ovine follicle stimulating hormone betasubunit. Nucleic Acids Res. 17, 6391. Noguchi, Y., Takano, K., Koura, M., Uchio-Yamada, K., Matsuda, J., Suzuki, O., 2006. Sequence analysis of cDNA encoding rabbit follicle-stimulating hormone beta-subunit precursor protein. Gen. Comp. Endocrinol. 147, 231–235. Parhar, I.S., Soga, T., Ogawa, S., Sakuma, Y., 2003. FSH and LH-βsubunits in the preoptic nucleus: ontogenic expression in teleost. Gen. Comp. Endocrinol. 132, 369–378. Patsoula, E., Loutradis, D., Drakakis, P., Michalas, L., Bletsa, R., Michalas, S., 2003. Messenger RNA expression for the follicle-stimulating hormone receptor and luteinizing hormone receptor in human oocytes and preimplantation-stage embryos. Fertil. Steril. 79, 1187–1193. Quérat, B., Sellouk, A., Salmon, C., 2000. Phylogenetic analysis of the vertebrate glycoprotein hormone family including new sequences of sturgeon (Acipenser baeri) beta subunits of the two gonadotropins and the thyroid-stimulating hormone. Biol. Reprod. 63, 222–228. Quérat, B., Arai, Y., Henry, A., Akama, Y., Longhurst, T.J., Joss, J.M., 2003. Pituitary glycoprotein hormone beta subunits in the Australian lungfish and estimation of the relative evolution rate of these subunits within vertebrates. Biol. Reprod. 70, 356–363.

57

Saito, A., Suzuki, M., Kano, Y., Tomura, H., Takeda, J., Tanaka, S., 2002. Sequence analysis and expressional regulation of messenger RNAs encoding beta subunits of folliclestimulating hormone and luteinizing hormone in the red-bellied newt, Cynops pyrrhogaster. Biol. Reprod. 66, 1299–1309. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic tree. Mol. Biol. Evol. 4, 406–425. Scammell, J.G., Funkhouser, J.D., Moyer, F.S., Gibson, S.V., Willis, D.L., 2008. Molecular cloning of pituitary glycoprotein alpha-subunit and follicle stimulating hormone and chorionic gonadotropin beta-subunits from New World squirrel monkey and owl monkey. Gen. Comp. Endocrinol. 155, 534–541. Shen, S.T., Yu, J.Y., 2002. Cloning and gene expression of a cDNA for the chicken folliclestimulating hormone (FSH)-beta-subunit. Gen. Comp. Endocrinol. 125, 375–386. Shen, S.T., Cheng, Y.S., Shen, T.Y., Yu, J.Y., 2006. Molecular cloning of follicle-stimulating hormone (FSH)-beta subunit cDNA from duck pituitary. Gen. Comp. Endocrinol. 148, 388–394. So, W.K., Kwok, H.F., Ge, W., 2005. Zebrafish gonadotropins and their receptors: II. Cloning and characterization of zebrafish follicle-stimulating hormone and luteinizing hormone subunits—their spatial-temporal expression patterns and receptor specificity. Biol. Reprod. 72, 1382–1396. Suetake, H., Okubo, K., Sato, N., Yoshiur, Y., Suzuki, Y., Aida, K., 2002. Differential expression of two gonadotropin (GTH) β subunit genes during ovarian maturation induced by repeated injection of salmon GTH in the Japanese eel Anguilla japonica. Fish. Sci. 68, 290–298. Swanson, P., Suzuki, K., Kawauchi, H., Dickhoff, W.W., 1991. Isolation and characterization of two coho salmon gonadotropins, GTH I and GTH II. Biol. Reprod. 44, 29–38. Swanson, P., Dickey, J.T., Campbell, B., 2003. Biochemistry and physiology of fish gonadotropins. Fish Physiol. Biochem. 28, 53–59. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Urbatzka, R., Lutz, I., Opitz, R., Kloas, W., 2006. Luteinizing hormone, follicle stimulating hormone, and gonadotropin releasing hormone mRNA expression of Xenopus laevis in response to endocrine disrupting compounds affecting reproductive biology. Gen. Comp. Endocrinol. 146, 119–125. Utoh, T., Horie, N., Mikawa, N., Okamura, A., Yamada, Y., Akazawa, A., Tanaka, S., Oka, H., 2005. Annual changes in ovarian development and plasma estradiol-17β level in reared female common Japanese conger, Conger myriaster. Fish. Sci. 71, 38–47. Vischer, H.F., Granneman, J.C., Linskens, M.H., Schulz, R.W., Bogerd, J., 2003a. Both recombinant African catfish LH and FSH are able to activate the African catfish FSH receptor. J. Mol. Endocrinol. 31, 133–140. Vischer, H.F., Teves, A.C., Ackermans, J.C., van Dijk, W., Schulz, R.W., Bogerd, J., 2003b. Cloning and spatiotemporal expression of the follicle-stimulating hormone beta subunit complementary DNA in the African catfish (Clarias gariepinus). Biol. Reprod. 68, 1324–1332. Walker, A.D., 1972. New light on the origin of birds and crocodiles. Nature 237, 257–263. Wong, T.T., Zohar, Y., 2004. Novel expression of gonadotropin subunit genes in oocytes of the gilthead seabream (Sparus aurata). Endocrinology 145, 5210–5220. Wu, X.B., Wang, Y.Q., Zhou, K.Y., Zhu, W.Q., Nie, J.S., Wang, C.L., 2003. Complete mitochondrial genome of Chinese alligator and phylogeny of crocodiles. Chin. Sci. Bull. 18, 2050–2054. Yan, P., Wu, X.B., Shi, Y., 2005. Identification of Chinese alligators (Alligator sinensis) meat by diagnostic PCR of the mitochondrial cytochrome b gene. Biol. Conserv. 12, 45–51. Zhao, L.H., Chen, J.L., Xu, H., Liu, J.W., Xu, R.F., 2010. Cloning and expression of FSHb gene and the effect of FSHβ on the mRNA levels of FSHR in the local chicken. Asian Aust. J. Anim. Sci. 23, 292–301. Zhou, Y., Niu, Y., Tao, M., Deng, X.J., Liu, S.J., Liu, Y., Li, J.Z., 2010. Molecular cloning characterization and expression of FSH and LH beta subunits from grass carp (Ctenopharyngodon idella). Fish Physiol. Biochem. 36, 213–221.