Molecular Brain Research, 16 (1992) 365-370

365

© 1992 Elsevier Science Publishers B.V. All rights reserved 0169-328x/92/$05.00 BRESM 80151

Molecular cloning and characterisation of a human brain A 1 adenosine receptor c D N A Andrea Townsend-Nicholson and John Shine Garvan Institute of Medical Research, Sydney (Australia)

(Accepted 8 September 1992)

Key words: Molecularcloning; G protein-coupled receptor; Adenosine; Adenosine A 1 receptor; Expression (mammalian);

Adenylate cyclase; DPCPX

Using the sequence conservation in the G protein-coupled receptor superfamily, we have isolated an adenosine A I receptor cDNA from a human hippocampal cDNA library by homologyscreening. When expressed in mammalian CHO.K1 cells, the protein encoded by this cDNA binds the Al-specific antagonist 8-cyclopentyl-l,3-dipropylxanthine(DPCPX)with high affinity (Kd = 0.56+ 0.11 nM) and, functionally, is able to inhibit cAMP production upon receptor activation with the Al-specific agonist N6-cyclopentyladenosine(CPA) (> 80% inhibition at 10 7M CPA). The binding and functional characteristics of the expressed cDNA demonstrate that we have isolated a human brain adenosine receptor cDNA of the A 1 subtype.

The purine nucleoside adenosine plays a fundamental role in a diversity of physiological systems. Intracellularly, the interconversion between adenosine and A T P is central to cellular energy metabolism 2°. Adenosine released from cells acts locally at cell surface receptors to affect a large variety of physiological parameters including blood flow, cardiac contractility and neurotransmitter release 2°'27. Adenosine modulates the function of almost all of the organ systems of the body. Biochemical studies have identified two distinct classes of receptor upon which adenosine acts, A 1 and A~ '31. Both receptor classes modulate intracellular cAMP levels by either inhibiting (A~) or stimulating (A 2) adenylate cyclase activity. The A~ and A 2 receptors can also be pharmacologically differentiated from each other based on the potency order of a limited series of agonists and antagonists 14'28. However, the A ~ / A 2 classification of adenosine receptors is likely to be an oversimplification as there have been reports suggesting additional receptor subtypes 4'9'18'24. Furthermore, adenosine receptors have been reported to couple to effectors other than adenylate cyclase, including ion channels, phospholipases A 2 and C, guanylate cy-

clase and transporters 3'14. Most of these receptors have been shown to display pharmacological profiles of the A t type, although it is not yet clear whether they are identical to the adenylate cyclase-associated receptors and are able to differentially couple to different transduction systems, or whether there is molecular heterogeneity of A 1 receptors. The receptors at which adenosine acts are members of the G protein-coupled receptor superfamily: cell surface receptors that transduce extraceilular signals through specific G proteins to intracellular effector systems. G protein-coupled receptors share a common proposed tertiary structure consisting of a single polypeptide chain with seven hydrophobic membranespanning domains 1°. The significant degree of sequence homology amongst members of this receptor superfamily has been instrumental in the isolation of receptors of this class which bind a diversity of ligands including neurotransmitters, neuropeptides, inflammatory mediators, photons and olfactory molecules 26,29. In order to address the issue of A t adenosine receptor heterogeneity, we undertook the molecular cloning of an A 1 adenosine receptor from human brain.

Correspondence: A. Townsend-Nicholson,Garvan Institute of Medical Research, 384 Victoria Street, Darlinghurst, NSW, 2010 Sydney,Australia.

Fax: (61) (2) 332-4876.

366 CGCAGGATGGTGCTTGCCTCGTGCCCCTTGGTGCCCGTCTGCTGATGTGCCCAGCCTGTGCCCGCC

-I

A T G C C G C C C T C C A T C T C A G C T T T C C A G G C C G C C TAC A T C G G C A T C G A G G T G Met P r o P r o S e r Ile Ser A l a P h e G l n A l a A l a Tyr Ile G l y Ile G l u V a l

51 17

CTC ATC GCC CTG GTC TCT GTG CCC GGG AAC GTG CTG GTG ATC TGG GCG GTG Leu I l e A l a L e u V a l S e t V a l P r o G l y A s n V a l Leu Val Ile T r p A l a V a l

102 34

A A G G T G A A C C A G G C G C T G C G G G A T G C C A C C T T C TGC T T C A T C G T C Lys V a l A s n G l n A l a Leu A r g A s p A l a T h r P h e C y s Phe Ile V a l

TCG CTG Ser Leu

153 51

GCG GTG GCT GAT GTG GCC GTG GGT GCC CTG GTC ATC CCC CTC GCC ATC CTC A l a V a l A l a A s p V a l A l a V a l G l y A l a Leu V a l Ile P r o Leu A l a Ile Leu

204 68

ATC AAC ATT GGG CCA CAG ACC TAC TTC CAC ACC TGC CTC ATG GTT GCC TGT Ile A s n Ile G l y P r o G l n T h y T y r P h e H i s T h r Cys Leu M e t V a l A l a C y s

255 85

CCG GTC CTC ATC CTC ACC CAG AGC TCC ATC CTG GCC CTG CTG GCA ATT GCT P r o V a l Leu Ile Leu T h r G l n S e r Ser Ile Leu A l a Leu Leu A l a Ile A l a

306 102

GTG GAC CGC TAC CTC CGG GTC AAG ATC CCT CTC CGG TAC AAG ATG GTG GTG V a l A s p A r g T y r Leu A r g V a l Lys Ile P r o Leu A r g Tyr Lys M e t Val V a l

357 119

A C C C C C C G G A G G G C G G C G G T G G C C A T A G C C G G C TGC T G G A T C C T C T C C T T C T h r P r o A r g A r g A l a A l a V a l A l a Ile A l a G l y Cys T r p Ile Leu Set P h e

408 136

GTG GTG GGA CTG ACC CCT ATG TTT GGC TGG AAC AAT CTG AGT GCG GTG GAG Val V a l G l y Leu T h r P r o M e t P h e G l y T r p A s n Asn Leu Ser A l a Val G l u

459 153

C G G G C C T G G G C A G C C A A C G G C A G C A T G G G G G A G C C C G T G A T C A A G TGC G A G Arg A l a T r p A l a A l a A s n G l y S e r Met G l y G l u Pro Val Ile Lys Cys G l u

510 170

TTC G A G A A G G T C A T C A G C A T G G A G TAC A T G G T C TAC TTC A A C T T C TTT G T G Phe G l u Lys V a l Ile Ser M e t G l u Tyr M e t V a l Tyr Phe A s h P h e P h e V a l

561 187

TGG GTG CTG CCC CCG CTT CTC CTC ATG GTC CTC ATC TAC CTG GAG GTC TTC T r p V a l Leu P r o P r o Leu Leu Leu Met V a l Leu Ile Tyr Leu G l u V a l P h e

612 204

TAC CTA ATC CGC AAG CAG CTC AAC AAG AAG GTG TCG GCC TCC TCC GGC GAC T y r Leu Ile A r g Lys G l n Leu A s h Lys Lys V a l Ser A l a Set Ser G l y A s p

663 221

CCG CAG AAG TAC TAT GGG AAG GAG CTG AAG ATC GCC AAG TCG CTG GCC CTC P r o G l n Lys T y r T y r G l y Lys G l u Leu Lys Ile A l a Lys S e r Leu Ala Leu

714 238

A T C C T C TTC C T C T T T G C C C T C A G C T G G C T G C C T T T G C A C A T C C T C A A C T G C Ile Leu Phe Leu P h e A l a Leu S e t T r p Leu Pro Leu His Ile Leu Ash C y s

765 255

A T C A C C C T C T T C T G C C C G T C C T G C C A C A A G C C C A G C ATC C T T A C C Ile T h r Leu P h e C y s P r o Ser C y s His Lys P r o Set Ile Leu T h r

TAC A T T Tyr Ile

816 272

G C C A T C TTC C T C A C G C A C G G C A A C T C G G C C A T G A A C C C C A T T G T C T A T G C C A l a Ile P h e Leu T h r His G l y A s h Ser A l a Met A s h Pro Ile V a l Tyr A l a

867 289

TTC CGC ATC CAG AAG P h e A r g Ile G l n Lys

TTC C G C G T C A C C T T C C T T A A G A T T T G G A A T G A C C A T Phe A r g V a l Thr P h e Leu Lys Ile T r p A s h A s p His

918 306

T T C C G C TGC C A G C C T G C A C C T C C C A T T G A C G A G G A T C T C C C A G A A G A G A G G P h e A r g Cys G l n P r o A l a P r o P r o Ile A s p G l u A s p Leu P r o G l u Glu A r g

969 323

CCT GAT GAC TAG ACCCCGCCTTCCGCTCCCACCAGCCCACATCCAGTGGGGTCTCAGTCCAGT P h e A s p A s p ***

1032 326

CCTCACATGCCCGCTGTCCCAGGGGTCTCCCTGAGCCTGCCCCAGCTGGGCTGTTGGCTGGGGGCAT

1165

GGGGGAGGCTCTGAAGAGATACCCACAGAGTGTGGTCCCTCCACTAGGAGTTAACTACCCTACACCT

1232

CTGGGCCCTGCAGGAGGCCTGGGAGGGAAGGGTCCTACGGAGGGACCAGGTGTCTAGA

1290

367 N HUMAN

Terminus

TM

MPPSISAFQA

BOVINE

. . . . . .

DOG



° ° A

RAT



. ° Y .

AYIGIEVLIA

.o

. . . .

.

.

°°

. . . . .

TM

.

.

.

.

° ° °

.

.

.

.

.

° o °

. . . . . .

o

.

.

.

. . . .

.

I

ICL

LVSVPGNVLV

.

.

°

.

.

.

.

.

°°

.

. . . . . .

.

°°

IWAVKVNQAL .

.

° ° °

. . . . .

TI~ TQSSILALLA

.

.

.

°.

.

°°

°°

. . . . .

ICL IAVDRYLRVK

. . . .

° . . ° . ° °

i

TM

RDATFCFIVS .

.

.

. . . .

.

.

°°

.

.

.

° . ° ° ° °

.

.

.

.

.

.

.

.

.

° ° . . . ° .

. . . . . . .

.

°.

2

TM

....................................

T .........................

RAT

....................................

T...

HUMAN

SMGEPVIKCE

FEKVISMEYM

BOVINE

.V . . . . . E . Q

..............................

DOG

.G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

RAT

° V ° . ° . ° o o o

° . . ° ° ° ° . . °

° ° ° ° ° ° ° . ° °

HILNCITLFC

PSCHKPSILT

VI

ECL

FLFALSWLPL

BOVINE

........................

DOG

.......................

RAT

.....................

HUMAN

EERPDD

BOVINE

A .....

DOG

..A.H.

RAT

..KAE.

Q ..............

3

M.R..I

R ..... M T.Q ..... I

. . . .

.

.

.

R . ° . ° ° °

°°

o R ° ° ° ° ° .

°°

° . ° . ° . ° °

TPMFGWNNLS L .... R.G

LNKKVSASSG

D.L... EAQ ....... V..QD.R...

3

TM DPQKYYGKEL

KIAKSLALIL

S ............................

R.

.G . . . . . . . . . . . . . . . . . . . . . . . . . . . . ° ° ° ° o ° ° ° o o

° ° ° ° ° ° ° , ° °

RIQKFRVTFL

KIWNDHFRCQ

VII SAMNPIVYAF

2

AVERAWAANG

M ..........

. ° ° ° ° . ° o o °

TM YIAIFLTHGN

.

..

L .............. ICL

LEVFYLIRKQ

° ° . o ° ° o . . .

.

.........................

V PPLLLMVLIY

.

ECL

.K . . . . . . . . . . . . . . . . . .

TM

.

. . . . .

i

IGPQTYFHTC

IV

CWILSFVVGL

V...T

. . . . .

. ° . ° ° °

o ° ° °

DOG

VYFNFFVWVL

.

. . . .

BOVINE

T .......

°°

° ° °

LMVACPVLIL

M ...............

PRRAAVAIAG

ECL LVIPLAILIN

° . ° o ° ° ° .

HUMAN

HUMAN

IPLRYKMVVT

II

LAVADVAVGA

C

° ° . ° ° ° o o ° °

Terminus

...... S .........................................

PAPPIDEDLP A.

.........................................

T..V...P.

......................

K ........

H ..................

Fig. 2. A comparison of the deduced amino acid sequence of the h u m a n A 1 adenosine receptor with the bovine m'3°, dog 12,13 and rat 17'23 A l adenosine receptors. Dots represent identical amino acids and differences are indicated at the position at which they occur. The t r a n s m e m b r a n e domains are overlined and numbered. ICL, intracellular loop; ECL, extracellular loop.

Two oligonucleotides were designed to correspond to segments of nucleotide sequence from the third intracellular and second extracellular domains of the canine thyroid A t adenosine receptor 12'~3 and were synthesised with one oligonucleotide identical to the non-coding and the other identical to the coding D N A strand: 5' C C C G T A G T A C T T C T G C G G G T C G C C A G A G G A G G C C G A C A C C T r C T T G C C 3' 5' G A G G C G C A G C G G G C C T G G G C G G C C A A C G G C A G C G G C G G C G A G C C C G T G 3' These oligonucleotides were used as probes in the screening of a human hippocampal cDNA library (Stratagene). Approximately 5 X 10 s plaques were plated and lifted onto Hybond-N + membranes (Amersham, UK). The D N A was denatured and alkali fixed to the membranes according to conditions recommended by the manufacturer. The membranes were hybridised for 12 h at 45°C in 50% formamide, 6 x SSPE 25, 5 x Denhardt's solution s, 0.5% SDS, 50 mM

NaPO 4, 100 / z g / m l sheared and denatured salmon sperm DNA with a mixture of 10 pmol of each oligonucleotide radiolabelled with y-[32p]ATP. After hybridisation, the membranes were washed to a final stringency of 0.1 x SSC, 0.1% SDS for 15 min at 45°C. Positively hybridising clones were isolated and purified and the corresponding cDNA insert-bearing pBluescript phagemids were in vivo excised from the Lambda ZAP II vector according to the manufacturer's protocol. More than twenty independent clones of varying hybridisation intensity were isolated from the human hippocampal cDNA library. From sequence analysis, at least three of these cDNAs, varying only in the length of 5' and 3' untranslated sequence present, were identified as encoding the A 1 adenosine receptor by the presence of seven hydrophobic domains in the putative protein sequence and by the striking sequence conservation with the canine thyroid A~ adenosine receptor ~2'13. The nucleotide sequence from - 6 6 to

Fig. 1. T h e nucleotide and predicted amino acid sequence of the h u m a n brain A l adenosine receptor cDNA. 66 nucleotides of 5' and 243 nucleotides of 3' flanking sequence are shown.

368 + 1290 (with respect to the initiator A T G codon) as well as the deduced amino acid sequence of the brain A~ adenosine receptor c D N A is shown in Fig. 1. The human A l receptor is 326 amino acids in length and contains features conserved in many of the G protein-coupled receptors including the Asp in the second transmembrane domain (TM II), the triplet of Asp-Arg-Tyr found at the start of the second intracellular loop and the tyrosine residue in TM VII 22. To date, A l adenosine receptors have now been cloned from dog thyroid 12'~3, rat brain 17'23 and bovine brain ~9.30. A comparison of the amino acid sequences of the human, bovine, rat and dog A 1 receptors is shown in Fig. 2. All of the A~ receptors isolated thus far have the N-linked glycosylation acceptor site sequence AsnGlu-Ser in the second extracellular domain of the protein. The human A~ receptor shows 95% sequence identity to the rat A l receptor and 94% identity to the dog and bovine A 1 receptors. In addition, there is also 65% sequence identity to the human A2a 7 and 60% identity to the human A2b 2~ adenosine receptors in the transmembrane domains. The portion of the nucleotide sequence of the human A l adenosine receptor shown in Fig. 1 was subcloned into the m a m m a l i a n expression vector p c D N A 1 N E O (Invitrogen, USA). The resultant con-

30,000

struct was transfected 2 into Chinese Hamster Ovary K1 cells (CHO.K1) (ATCC, USA) and selection for stable transformants was carried out with the neomycin analogue G418 at a concentration of 800 n g / m l over a period of 4 weeks. Clonal cell lines were then established and used in radioligand binding assays and cyclic A M P functional assays. Initial whole cell equilibrium binding assays of l0 t' cells per point were performed for 90 rain at room temperature in a Tris ions buffer 7 in the presence of 2 I U / m l adenosine deaminase (ADA) (Sigma, USA) as described 7. Specific binding was not observed in untransfected CHO.K1 cells, but was observed in transfected CHO.K1 cells in response to the A l-specific ligands 8-cyclopentyl-l,3-dipropylxanthine (DPCPX) 1 (NEN Dupont, Australia; RBI, USA) and 2-chloroN6-cyclopentyladenosine (CCPA) t5 (NEN Dupont, Australia; RBI, USA) but not in response to the A2~r specific ligand 2-[4-(2-carboxyethyl)phenethylamino]-5'N-ethylcarboxamido adenosine (CGS-21680) ~l (NEN Dupont, Australia; RBI, USA)(data not shown). D P C P X is a highly specific antagonist for the A~ adenosine receptor (approximately 700 fold specificity for the A l over the A 2 receptor) ~. The response of the transfected ceils to the A j-specific antagonist D P C P X is both highly specific and saturable as shown in Fig. 3.

l

A ~X

E r~

-c]

lO, O00 []

[]

0 0

i

[]I 2

3

4

6

7

8

Dpcp× (riM) Fig. 3. Representative saturation isotherm of [3HIDPCPX binding to transfected cells (o). Non-specific binding ([]) was determined in the presence of 1 /xM unlabelled DPCPX. Total binding is indicated by the open triangles ( ~, ). Each point is the mean of triplicate samples.

369 Analysis of the binding experiments (InPlot, GraphPad, USA; all values are expressed as the mean + S.E.M.) performed in the Tris ions buffer reveals a single class of binding sites with a dissociation constant ( K d) of 0.56 + 0.11 nM and a Bmax of 46589 + 10985 binding sites/cell, n = 3). Binding assays were also performed for 30 min at room temperature in a modified Krebs buffer 7 with 2 I U / m l ADA. Saturation binding experiments of DPCPX in this buffer yield a single class of binding site with a K d of 0.96 + 0.20 nM with a Bmax of 71128 + 9841 binding sites/cell (n = 2). These experiments demonstrate that DPCPX binds to the expressed A~ receptor with high affinity yielding K d values in the range of those observed previously for binding to rat brain membranes ( K d = 0.42 nM) 1 and for binding in whole cell assays to guinea pig DDT~ MF-2 vas deferens cells ( K d = 0.93 + 0.30 nM) 8. The binding characteristics are in agreement with those of an adenosine receptor of the A~ subtype. Another characteristic of A~ adenosine receptors is their capacity to inhibit cAMP production upon receptor stimulation. Cyclic AMP production was assayed in intact ceils using the [3H] pre-labelling technique 6. Cells were plated out in a 24 well plate and allowed to grow to confluence after which they were loaded with [3H]8-adenine at 2 /zCi/well for 2 h at 37°C. After loading, the cells were washed well and all further incubations took place in modified Krebs buffer with the non-xanthine phosphodiesterase inhibitor Ro 201724 (RBI, USA) present at a final concentration of 10 /xM. cAMP levels were stimulated with the addition of 10 /zM forskolin (RBI, USA). The effect of the A~specific agonist N6-cyclopentyladenosine (CPA, 100 nM) (RBI, USA) upon cAMP levels was tested in the presence and the absence of 100 nM DPCPX. The reactions were allowed to proceed for 10 min at 37°C (after a 30 min pre-incubation with DPCPX where appropriate) and were then stopped with the addition of 50 /xl of concentrated (35%) HC1. The [3H]cAMP generated was isolated by Dowex-alumina sequential chromotography 6. Column efficiency was normalised with the addition of [lnc]cAMP (1.25 nCi/sample). As shown in Fig. 4, the addition of 100 nM CPA was able to effect an inhibition of forskolin-stimulated cAMP production in the transfected ceils by more than 80% as would be expected for an A 1 adenosine receptor. This inhibition was reduced to 50% in the presence of 100 nM DPCPX. No significant inhibition of forskolin-stimulated cAMP production was observed in untransfected CHO.K1 ceils or in vector transfected cells in response to CPA (data not shown). The human brain receptor described here exhibits sequence identity with A~ adenosine receptors cloned

100 z

8O

o F--

(.9 D

o

60

C]

rY r]

m

40

0

~

20

0 t-

C

ox.

0

L_ o

t.t~O

~E

~" --1

o

oo

¢0

(.9 c" 0

t.. /'1 4--O f--3 O ~" "1

r0

ooo_

c" 0

Fig. 4. Representative experiment demonstrating the effect of the Al-Specific agonist CPA on cAMP production in transfected cells and the ability of the specific antagonist DPCPX to inhibit the CPA-mediated response. Each point is the mean of quadruplicate samples. Control (untreated) cAMP production was 1.8% of the forskolin-stimulated cAMP production.

from other species. Binding assays have established that the human receptor exhibits saturable, high affinity binding for Al-specific ligands and that the pharmacology of the functional response is consistent with that observed for other A~ adenosine receptors. When transfected into CHO.K1 cells, the human receptor is able to functionally couple to inhibit cAMP production. By these criteria, we conclude that the human brain cDNA described here encodes an A 1 adenosine receptor. Further characterisation of this receptor will help to address current questions concerning the capacity of A 1 adenosine receptors to couple to different signal transduction systems. Acknowledgements. We gratefully acknowledge the technical assistance of Marjorie Liu, Robert Daniels and Peter Adams. We would also like to thank Tim Furlong, Steve Hill, Kerrie Pierce, Lisa Selbie and Rob Vandenberg for valuable discussion during the course of this project. This work was supported by the National Health and Medical Research Council (NH&MRC), Australia and by the Department of Industry, Technology and Commerce (DITAC), Australia. 1 Bruns, R.F., Fergus, J.H., Badger, E.W., Bristol, J.A., Santay, L.A., Hartman, J.D., Hays, S.J. and Huang, C.C., Binding of the Al-selective adenosine antagonist 8-cyclopentyl-l,3 dipropylxanthine to rat brain membranes, Naunyn-Schmiedeberg's Arch. Pharmacol., 335 (1987) 59-63. 2 Chen, C. and Okayama, H., High-efficiency transformation of mammalian cells by plasmid DNA, Mol. Cell. Biol., 7 (1987) 2745-2752.

370 3 Cooper, D.M.F. and Caldwell, K.K., Signal transduction mechanisms for adenosine. In M. Williams (Ed.), Adenosine andAdenosine Receptors, Humana Press, Clifton, NJ, 1990, pp. 105-141. 4 Cornfield, L.J., Hu, S. and Sills, M.A., The novel binding site labeled by [3H] CV 1808 is associated with potassium channel activation, FASEB J., 6 (1992) A1008. 5 Denhardt, D.T., A membrane filter technique for the detection of complementary DNA, Biochem. Biophys. Res. Commun., 23 ( 19661 641-646. 6 Donaldson, J., Brown, A.M. and Hill, S.J., Influence of rolipram on the cyclic 3',5'-adenosine monophosphate response to histamine and adenosine in slices of guinea-pig cerebral cortex, Biochem. Pharmacol., 37 (1988) 715-723. 7 Furlong, T.J., Pierce, K.D., Selbie, L.A. and Shine J., Molecular characterization of a human brain adenosine A~ receptor, Mol. Brain Res., 15 (19921 62-66. 8 Gerwins, P., Nordstedt, C. and Fredholm, B.B., Characterization of adenosine A1 receptors in intact DDT1 MF-2 smooth muscle cells, Mol. Pharmacol., 38 (1990) 660-666. 9 Gustaffson, L.E., Wiklund, C.U., Wiklund, N.P. and Stelius, L., Subclassification of neuronal adenosine receptors. In K.A. Jacobson, J.W. Daley, V. Manganiello (Eds.) Purines in Cellular Signaling: Targets for New Drugs, Springer, Berlin, 1990, pp. 200-205. 111 lismaa, T,P. and Shine, J., G protein-coupled receptors, Current Opin. Cell Biol., 4 (1992) 195-202. 11 Jarvis, M.F., Schulz, R. Hutchisorl, A.J., Do, U.H., Sills, M.A. and Williams, M., [3H]CGS 21680, a selective A2 adenosine receptor agonist directly labels A2 receptors in rat brain, J. Pharmacol. Exp. Ther., 251 (19891 888-893. 12 Libert, F., Parmentier, M., Lefort, A., Dinsart, C., vanSande, J., Maenhaut, C., Simons, M.-J., Dumont, J.E. and Vassart, G., Selective amplification and cloning of four new members of the G protein-coupled receptor family, Science, 244 (1989) 569-572. 13 Libert, F., Schiffman, S.N., Lefort, A., Parmentier, M., G&ard, C., Dumont, J.E., Vanderhaeghen, J.-J. and Vassart, G., The orphan receptor eDNA RDC7 encodes an A1 adenosine receptor, EMBO J., 10 (1991) 1677-1682. 14 Linden, J., Structure and function of AI adenosine receptors, FASEB J., 5 (1991) 2668-2676. 15 Lohse, M.J., Klotz, K.N., Schwabe, U., Cristalli, G., Vittori, S. and Grifantini, M., 2-chloro-N6-cyclopentyladenosine: a highly selective agonist at A t adenosine receptors, Naunyn-Schmiedeberg's Arch. PharmacoL, 337 (1988) 687-689. 16 Londos, C., Cooper, D.M.F. and Wolff, J., Subclasses of external adenosine receptors, Proc. Nat. Acad. Sci. USA, 77 (19801 25512554.

17 Mahan, L.C., McVittie, L.D., Smyk-Randall, E.M., Nakata, 11., Monsma Jr., F.J., Gerfen, C.R. and Sibley, D.R., Cloning and expression of an A1 adenosine receptor from rat brain. Mol. Pharmacol., 40 (1991) 1 7. 18 Martin, P., Evidence that adenosine receptors in the dog left atrium are not of the typical AI or A2 adenosine receptor subtypes, Eur. J. Pharmacol., 214 (1992) t99-205. 19 Olah, M.E., Ren, H., Ostrowski, J., Jacobson, K.A. and Stiles, G.L., Cloning, expression, and characterization of the unique bovine AI adenosine receptor, J. Biol. (hem., 267 (19921 1076410770. 20 Olsson, R.A. and Pearson, J.D., Cardiovascular purinoceptors, Physiol. Rev., 70 (19901 761-845. 21 Pierce, K.D., Furlong, T.J., Selbie, L.A. and Shine, J., Molecular cloning and expression of an adenosine A2b receptor from human brain, Biochem. Biophys. Res. Commun., 187 (1992) 86-93. 22 Probst, W.C., Snyder, L.A., Schuster, D.I., Brosius, J. and Sealfon, S.C., Sequence alignment of the G-protein coupled receptor superfamily, DNA Cell Biol., 11 (1992) I-2(/. 23 Reppert, S.M., Weaver, D R . , Stehle, J.H. and Rivkees. S.A., Molecular cloning and characterization of a rat Al-adenosine receptor that is widely expressed in brain and spinal cord, Mol. Endocrinol. 5 (1991) 1037-1048. 24 Ribeiro, J.A. and Sebastiao, A.M., Adenosine receptors and calcium: Basis for proposing a third (A3) adenosine receptor, Prog. Neurobiol., 26 (1986) 179-2(19. 25 Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning,: A Laboratory Manual, 2nd edn., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. 26 Savarese, T.M. and Fraser, C.M., In vitro mutagenesis and the search for structure-function relationships among G protein-coupled receptors, Biochem..L, 283 (1992) 1 19. 27 Stiles, G.L.. Adenosine receptors: structure, function and regulation, Trends PharrnacoL Sci., 7 (1986) 486-490. 28 Stiles, G.L., Adenosine receptors, J. BioL Chem., 267 (19921 6451-6454. 29 Strosberg, A.D., Structure/function relationship of proteins belonging to the family of receptors coupled to GTP-binding proteins, Eur. Z Biochem., 196 (1991) 1 10. 3(1 Tucker, A.L., Linden, J., Robeva. A.S.. D'Angelo, D.D. and Lynch, K.R. Cloning and expression of a bovine adenosine AI receptor eDNA, FEBS Lett., 297 (1992) 1[17-11 l. 31 van Calker, D., Miiller, M. and Hamprecht, B., Adenosine rcgw ]ates via two different types of receptors, the accumulation of cyclic AMP in cultured brain cells, .L Neurochem., 33 (19791 999 10115.

Molecular cloning and characterisation of a human brain A1 adenosine receptor cDNA.

Using the sequence conservation in the G protein-coupled receptor superfamily, we have isolated an adenosine A1 receptor cDNA from a human hippocampal...
468KB Sizes 0 Downloads 0 Views