Fish & Shellfish Immunology 38 (2014) 101e110
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Molecular cloning and characterization of two types of IkBa orthologues in orange-spotted grouper, Epinephelus coioides Ren Gao a, b, Youhua Huang b, Xiaohong Huang b, Liya Guan b, Shina Wei b, Yongcan Zhou a, **, Qiwei Qin a, b, * a State Key Laboratory Breeding Base for Sustainable Exploitation of Tropical Biotic Resources, College of Marine Science, Hainan University, Haikou 570228, China b Key Laboratory of Tropical Marine Bio-resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 December 2013 Received in revised form 19 February 2014 Accepted 23 February 2014 Available online 2 March 2014
Inhibitors of kappa B (IkBs) are the members of primary regulators of NF-kB, which can inhibit NF-kB activity by blocking the NF-kB in an inactive state in the cytoplasm. In this study, two types of IkBa orthologues (EcIkBaA and EcIkBaB) from orange-spotted grouper, Epinephelus coioides, were cloned and characterized. EcIkBaA and EcIkBaB encoded putative proteins containing 308 and 318 amino acids, which shared 59% and 53% identity to IkBaA and IkBaB of Danio rerio, respectively. Amino acid sequence alignment showed that both EcIkBaA and EcIkBaB contained a conserved degradation motif DSGLDS in the N-terminal region and a PEST sequence in the C-terminal region. In addition, EcIkBaA and EcIkBaB contained 5 and 6 ankyrin repeats, respectively. The genomic DNA of EcIkBaA and EcIkBaB consisted of 6 exons and 5 introns. Both of their transcripts were widely distributed in different tissues, and the expression levels were different in response to various stimuli, including lipopolysaccharide (LPS), Vibrio alginolyticus and Singapore grouper iridovirus (SGIV). Dual-luciferase reporter assay suggested that both EcIkBaA and EcIkBaB were able to inhibit Ecc-Rel and Ecp65 induced NF-kB promoter activity in grouper spleen (GS) cells. Subcellular localization analysis showed that EcIkBaB was present predominantly in the cytoplasm, while EcIkBaA was distributed throughout both the nucleus and the cytoplasm. Furthermore, overexpression of EcIkBaA and EcIkBaB in GS cells inhibited the viral gene transcriptions of MCP, ORF019 and ORF162 of SGIV. Taken together, our findings suggested that both EcIkBaA and EcIkBaB were involved in grouper innate immunity against virus. Ó 2014 Elsevier Ltd. All rights reserved.
Keywords: Epinephelus coioides EcIkBaA EcIkBaB NF-kB SGIV
1. Introduction The nuclear factor kappa-B (NF-kB) pathway belongs to a classical signal pathway that plays a vital role in many biological processes, including innate and adaptive immunity, cellular-stress response, tumorigenesis, inflammation, and apoptosis [1,2]. In normal cells, the inhibitors of NF-kB (IkBs) kept NF-kB in an inactive state in the cytoplasm by blocking the Rel-homology domain (RHD)
* Corresponding author. Key Laboratory of Tropical Marine Bio-resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China. Tel./fax: þ86 20 89023638. ** Corresponding author. State Key Laboratory Breeding Base for Sustainable Exploitation of Tropical Biotic Resources, College of Marine Science, Hainan University, Haikou 570228, China. Tel.: þ86 13078932128. E-mail addresses: [email protected] (Y. Zhou), [email protected] (Q. Qin). http://dx.doi.org/10.1016/j.fsi.2014.02.019 1050-4648/Ó 2014 Elsevier Ltd. All rights reserved.
of NF-kB to mask its nuclear localization signal (NLS) [3e7]. Different stimuli, including UV irradiation, tumor necrosis factor (TNF), lipopolysaccharide (LPS), or viral and bacterial infection could induce the phosphorylation of IkBs and degradation IkBs for NF-kB release from IkB/NF-kB complex [8e10]. The activated NF-kB then transferred into the nucleus to regulate the transcription of specific genes, such as interferon，interleukin, cIAP-2, etc., which were important in the host immune system [11e15]. In mammals, several members of NF-kB family were identified, including RelA (p65), RelB, c-Rel, NF-kB1 (p50/p105), and NF-kB2 (p52/p100) [16,17]. All of them contained a highly evolutionarily conserved domain, the Rel-homology domain (RHD) of approximately 300 amino acids, which mediated DNA binding, dimerization and nuclear translocation of NF-kB. The expression and activation of NF-kB was regulated by its inhibitory protein IkBs, which included IkBa, IkBb, IkBε, IkBg, IkBz, Bcl-3 and Cactus in Drosophila [18e22].
102
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
IkBa was an important member of the large family of IkBs, which could strongly inhibit the activity of the NF-kB heterodimer p65/p50 [23e25]. All IkBa members shared a domain consisting of 5e7 ankyrin (ANK) repeats, which was response for proteineprotein interaction with NF-kB [26,27]. The C-terminal region of IkBa included a PEST (proline (P), glutamate (E), serine (S), and threonine (T)) domain, which not only regulated the degradation of IkBs but also mediated the inhibition of NF-kB/DNA binding [28e30]. In addition, IkBa was also proposed as a shuttle protein, which could enter the nucleus to block the NF-kB/DNA binding process [31e34]. Compared with higher vertebrates, the function of IkBa from marine teleosts in response to pathogens was poorly understood [35]. Grouper, Epinephelus coioides, an important marine food fish, was widely cultured in China and Southeast Asian countries. However, the emergences of viral and bacterial diseases caused great economic losses to the grouper aquaculture industry [36e38]. In the present study, we cloned and identified two types of IkBa orthologues in Epinephelus coioides (named as EcIkBaA and EcIk BaB). The molecular characterization, including genomic structure, subcellular localization and their expression profiles in response to pathogen infection were investigated. Furthermore, we determined the effects of EcIkBaA and EcIkBaB on NF-kB activation and Singapore grouper iridovirus (SGIV) replication. Our results provide a new insight into better understanding of the roles of fish NF-kB signaling pathway in pathogen infection. 2. Material and methods 2.1. Fish, cell lines and viruses Healthy young orange-spotted grouper, E. coioides, about 50 g, were purchased from a fish farm in Hainan province, China. Fish were domesticated in a laboratory recirculating seawater system at 25e30 C for two weeks before the experiment [39]. The samples including spleen, liver, kidney, head kidney, brain, intestine, gill, heart skin and muscle were collected from the sacrificial fish and immediately frozen by liquid nitrogen, stored at 80 C. Grouper spleen (GS) cells were grown and maintained in Leibovitz’s L15 medium that contained 10% fetal bovine serum (Invitrogen, USA) at the temperature of 25 C [40]. Singapore grouper iridovirus (SGIV) was proliferated in GS cells and the collected virus were frozen and thawed three times. The collected SGIV was stored at 80 C until use. 2.2. Cloning the full-length cDNA of two types of IkBa orthologues in E. coioides Total RNA was isolated from healthy head kidney of E. coioides by TRIzol Reagent (Invitrogen, USA) according to the manufacturer’s instructions. The quality of RNA was analyzed by agarose gel electrophoresis. The first-strand cDNAs of E. coioides IkBa orthologues, EcIkBaA and EcIkBaB, were synthesized using the SMARTÔ RACE cDNA amplification kit (Clontech, USA) according to the manufacturer’s instructions. Based on the identified ESTs established by our laboratory [41], specific primers of EcIkBaA and EcIkBaB were designed for rapid amplification of 30 and 50 ends of cDNA (RACE). In detail, the primers EcIkBaA3’GSP1, EcIkBaA5’NGSP1, EcIkBaB3’GSP1, EcIk BaB5’NGSP1 (Table 1) and UPM (supplied by the kit) were used to conduct the first round PCR. The products of first round PCR were diluted 10 times, and then conducted the nested PCR with the specific primers EcIkBaA3’GSP2, EcIkBaA5’NGSP2, EcIkBaB3’GSP2, EcIkBaB5’NGSP2 (Table 1) and NUP (supplied by the kit). The products of RACE PCR were analyzed by agarose gel imaging system, purified by AxyPrepÔ DNA gel extraction kit (Axygen, USA),
Table 1 Sequences of primers used in this study. Primers
Sequence（50 e30 ）
NUP UPM
AAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGCAAGCAGTG GTATCAACGCAGAGT ACCGCGGCTGCAGTTGACGAACTTGATGCC TGGATACCCGCGGTCTTGCTTCTC CGTGTTTGGACTCCATGTTGTCGAAG CCTCCTGGCACGGCAACATTTTCCC CCACCTAGCGGTAATAACGAACCAGGCCG GAGCGCCTCCTGGTAAACGGATGTG AGTCCTTGGCTTCGTGGATGATGGC CATCTTCTGTGATCTGTGTTTTCC TACGAGCTGCCTGACGGACA GGCTGTGATCTCCTTCTGCA ACGCAGAACAGCCAGCAGCACAT CGTGAAGCCGCCGTAGTTCAAGC TGTCATCATAACCCACCTCCTCAT ACACTCCCTTCCACCTCACCTAC CCCTGACCTTTGAGAGAGACTGAGC CATTCACACCAATCATAGTGGACGC GGAGACAACCAAGTGCACCTCGTAC GTCCTTCACCGTCATCATCACAGCC CGGATCCATGGACGTGCACAGAGTG GGAATTCTTACTTTCCGAACTTTATGTCG CGGATCCACATGGACCTCCACCG CGGAATTCCTAATGTCCATTCCACTGAATG GGAATTCTATGGACGTGCACAGAGTG CGGATCCTTACTTTCCGAACTTTATGTC CCTCGAGCTATGGACCTCCACCGGACC GGGGTACCCTAATGTCCATTCCACTGAATGTC GCACGCTTCTCTCACCTTCA AACGGCAACGGGAGCACTA ATTGACGGAAGGGCACCACCAG TCGCTCCACCAACTAAGAACGG GTCAGGGTGGAGAAAACGGGAGTGT CTCAAACAGTAACGTTCCGCAAGCG GAAGGAAACCCTGAAACTTTTGGCG TCTGGCTCTCAAGATTCGTGCGTAC
EcIkBaA3’GSP1 EcIkBaA3’GSP2 EcIkBaA5’NGSP1 EcIkBaB5’NGSP2 EcIkBaB3’GSP1 EcIkBaB3’GSP2 EcIkBaB5’NGSP1 EcIkBaB5’NGSP2 RT-Actin-F RT-Actin-R RT-EcIkBaA-F RT-EcIkBaA-R RT-EcIkBaB-F RT-EcIkBaB-R EcIkBaA-G-F EcIkBaA-G-R EcIkBaB-G eF EcIkBaB-G-R pcDNA-EcIkBaA-F pcDNA-EcIkBaA-R pcDNA-EcIkBaB-F pcDNA-EcIkBaB-R pEGFP-EcIkBaA-F pEGFP-EcIkBaA-R pEGFP-EcIkBaB-F pEGFP-EcIkBaB-R RT-MCP-F RT-MCP-R RT-18SeF RT-18S-R RT-VP19-FP RT-VP19-RP RT-162-FP RT-162-RP
then cloned into the pMD-18T vector (Takara, Japan) and sequenced by Invitigen. 2.3. EcIkBaA and EcIkBaB genomic DNA sequence determination Genomic DNA was isolated from the head kidney of E. coioides using the EzgeneÔ tissue gDNA Kit (Biomiga, USA), according to the manufacturer’s instructions. The genomic DNAs of EcIkBaA and EcIkBaB were amplified using the specific primers EcIkBaA-G-F, EcIkBaA-G-R, EcIkBaB-G-F, and EcIkBaB-G-R (Table 1), and the PCR products were purified and cloned into the pMD18-T vector (Takara, Japan) and sequenced by Invitrigen. 2.4. Bioinformatics analysis of EcIkBaA and EcIkBaB The homology of EcIkBaA and EcIkBaB with IkBa of other species was identified by NCBI BLAST (http://www.ncbi.nlm.nih.gov/ blast) program. Genetyx7.0 software was used to analyze the cDNA and amino acid sequences. The conserved domains of proteins were predicted by the Simple Modular Architecture Research Tool (SMART) version 4.0 (http://smart.embl-heidelberg.de/). The potential PEST sequence of EcIkBaA and EcIkBaB was predicted by the PEST find software (http://www.at.embnet.org/toolbox/ pestfind/). The NES sequence was found by NetNES 1.1 Server (http://www.cbs.dtu.dk/services/NetNES/). The casein kinase II phosohorylation sites of EcIkBaA and EcIkBaB were predicted using KinasePhos 2.0 (http://kinasephos2.mbc.nctu.edu.tw/index.html). Multiple-sequence alignment with other reported IkBa amino acid sequences was performed using ClustalX2.0 and a phylogenetic tree was constructed using the MEGA 5.0 software.
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
103
Fig. 1. The complete cDNA sequence of EcIkBaA (A, GenBank accession no. KF773746) and EcIkBaB (B, GenBank accession no. KF773745). The ORF and amino acid sequence was predicted by NCBI, and the start (ATG) and stop (TAG or TAA) codons were marked by “#” and “*”, respectively. The conserved serine residues of degradation motif sequence were circled. The ankyrin repeats predicted by the SMART program were underlined. The PEST sequence predicted by the PEST find software was light grey shaded. The NES sequence found by NetNES 1.1 Server was boxed. The polyadenylation signal (AATAAA or TATAAA) was bold.
104
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
2.5. Tissue distribution of EcIkBaA and EcIkBaB TRIzol Reagent (Invitrogen, USA) was used to isolate the total RNA from healthy orange-spotted grouper tissues, including spleen, liver, kidney, head kidney, heart, gill, brain, muscle, intestine, and skin according to the manufacturer’s instructions. The expression levels of EcIkBaA and EcIkBaB in different tissues above were analyzed by RT-PCR with the special primers RT-EcIkBaA-F, RTEcIkBaA-R, RT-EcIkBaB-F and RT-EcIkBaB-R, while internal control b-actin was amplified by using primers RT-Actin-F and RT-Actin-R (Table 1). The products of PCR were analyzed on 1.2% agarose gel electrophoresis. 2.6. Plasmid construction The recombinant plasmids including pcDNA-EcIkBaA, pcDNAEcIkBaB, pEGFP-EcIkBaA and pEGFP-EcIkBaB were constructed as described previously [42]. In detail, for construction of pcDNAEcIkBaA and pcDNA-EcIkBaB, the restriction sites of BamHI and EcoRI were incorporated into special primers pcDNA-EcIkBaA-F, pcDNA-EcIkBaA-R, pcDNA-EcIkBaB-F and pcDNA-EcIkBaB-R
(Table 1) to amplify the gene fragments of EcIkBaA and EcIkBaB from total cDNA of E. coioides. Similarly, the restriction sites of EcoRI, BamHI, XhoI and KpnI were used to constructed the plasmids pEGFP-EcIkBaA and pEGFP-EcIkBaB. In addition, the plasmids pcDNA-Ecp65, pcDNA-Ecc-Rel and pRL-TK used in this study were constructed and kept in our lab. 2.7. Subcellular localization The subcellular localization of EcIkBaA and EcIkBaB was examined by fluorescence microscopy as described previously [43]. GS cells grown in a 24-well plate, then transfected with recombinant pEGFP-EcIkBaA or pEGFP-EcIkBaB using LipofectamineTM 2000 Reagent (Invitrogen, USA) according to the manufacture’s protocol, while the pEGFP-C1 vector as a control. After 24 h transfection, GS cells were digested with trypsin and transferred to a 6-well plate with coverslips on it for another 24 h. GS cells were washed with PBS (pH 7.4) and fixed with 4% paraformaldehyde for 30 min, and then stained with 6-diamidino-2-pheny-lindole (DAPI) (1 mg/ml) for 15 min. Cells were observed under fluorescence microscope (Leica, Germany).
Fig. 2. Amino acid sequence alignment of IkBa from Epinephelus coioides and other species. The conserved degradation motif sequence DSGLDS were marked with underline and serine residues are marked with “*”. The ankyrin repeats identities with other species were boxed. The Gene accession numbers of the selected IkBa sequences were listed in Table 2.
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
2.8. Dual-luciferase reporter assay Grouper spleen (GS) cells were seeded to 24-well plates (106 cells/well) for 18 h, then transiently co-transfected with NF-kB luciferase reporter vector (100 ng/well), pRL-TK (50 ng/well), pcDNA-Ecc-Rel (300 ng/well) or pcDNA-Ecp65 (300 ng/well), pcDNA-EcIkBaA (30 ng or 100 ng/well) or pcDNA-EcIkBaB (30 ng or 100 ng/well), and pcDNA3.1 as a control, using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. The luciferase activity was measured using Dual-Luciferase Reporter Assay System (Promega life science, Madison, WI) 36 h after transfection. Relative luciferase activity was normalized to the amount of Renilla luciferase internal control. The experimental results were the average of triplicate independent assays and expressed as fold changes that relative to control vector. 2.9. Fish challenge by LPS, SGIV and Vibrio alginolyticus Lipopolysaccharide (LPS) was purchased from Sigma Corporation (USA). V. alginolyticus E333 and SGIV were kept in our laboratory. For the LPS challenge, each grouper was injected intraperitoneally (i.p.) with 200 ml LPS (1.5 mg/ml, Sigma). For the SGIV challenge, each grouper was injected with 200 ml SGIV (a dose of 2 104 TCID50). For the bacterial challenge, each grouper was injected with 200 ml live V. alginolyticus in PBS (108 CFU/ml). The grouper was injected with 200 ml PBS as a control. Seven fish as a challenge group were collected at 0, 6, 12, 24, 48, 72 and 96 h after injection, and total RNA was isolated from head kidney. 2.10. Expression profiles of EcIkBaA and EcIkBaB After challenge with LPS, SGIV and V. alginolyticus, the expression levels of EcIkBaA and EcIkBaB were examined by qPCR in head kidney with the special primers RT-EcIkBaA-F, RT-EcIkBaA-R, RTEcIkBaB-F and RT-EcIkBaB-R (Table 1), and actin was amplified using primers RT-Actin-F and RT-Actin-R as an internal control. The data was analyzed with triplicate independent assays, and the results were calculated as the folds of the expression level of EcIkBaA and EcIkBaB in different stimulus challenged grouper relative to that in PBS injected grouper at the same time point. Data were expressed as mean SD, and analyzed by SPSS software. 2.11. The effect of EcIkBaA and EcIkBaB overexpression on SGIV replication The GS cells were seeded to 24-well plates (106 cells/well) for 18 h, and then transiently co-transfected with pcDNA-EcIkBaA (800 ng/well) or pcDNA-EcIkBaB (800 ng/well), and pcDNA3.1 (800 ng/well) as a control. After 24 h, the EAGS was infected with SGIV (MOI ¼ 0.1), and then every well was harvested after infected 24 h and 48 h. The expression of major capsid protein (MCP) and some other virus proteins, including ORF019, ORF162 of SGIV was detected by qPCR using primer RT-MCP-F, RT-MCP-R, RT-VP019-F, RT-VP019-R, RT-VP162-F and RT-VP162-R (Table 1), with the 18S rRNA as a control. All Data were expressed as mean SD, and then analyzed by one-way ANOVA, followed analyzed by the Student’s t-test. Differences significant were considered at p < 0.05. 3. Results 3.1. Sequence characterization and phylogenetic analysis of EcIkBa The full length cDNA of EcIkBaA is 1357 bp long with an open reading frame (ORF) of 927 bp, and encodes a putative protein of
105
308 amino acids with a predicted molecular mass of 33.9 kDa. The deduced amino acid sequence of EcIkBaA contains 5 ankyrin (ANK) domains, two PEST sequences, a NES sequence 46LVSEIEEMTL55 and a degradation motif 35DSGLDS40 including two serine residues Ser36 and Ser-40 in N-residues (Fig. 1A), which shared 59% identity to IkBaA of Danio rerio. The full-length cDNA of EcIkBaA contains a 50 UTR of 52 bp and a 30 UTR of 378 bp with a nonstandard polyadenylation signal sequence TATAAA above the poly (A) tail (Fig. 1A). The full-length of EcIkBaA cDNA sequence was deposited in Genbank with accession no. KF773746. The full length cDNA of EcIkBaB is 1573 bp long with an ORF of 957 bp, which encodes a putative protein of 318 amino acids with a predicted molecular mass of 35 kDa. The deduced amino acid sequence of EcIkBaB contains 6 ANK domains, a PEST sequence in the C-terminal region, and a degradation motif 32DSGLDS37 possessing two serine residues Ser-33 and Ser-37 in the N-terminal region (Fig. 1B), which shared 59% identity to IkBaB of D. rerio. The full-length cDNA of EcIkBaB contains a 50 -UTR of 47 bp, and a 30 UTR of 569 bp with a consensus polyadenylation signal sequence ATTAAA above the 25 bp poly (A) tail (Fig. 1B). The full-length of EcIkBaB cDNA sequence was deposited in Genbank with accession no. KF773745. Amino acid alignment of grouper IkBaA and IkBaB with other species IkBa revealed that all IkBa contain a conserved degradation motif DSGLDS including two serine residues in N-residues, 5e6 ANK domains (Fig. 2). Phylogenetic tree was constructed by the Neighbor-Jointing method based on amino acid sequences of IkBa from various species. EcIkBaA showed the closest relationship with IkBa of Siniperca chuats and IkBaA of D. rerio, while EcIkBaB presented the closest relationship with IkBa of Paralichthys olivaceus, Takifugu rubripes, Osmerus mordax and IkBaB of D. rerio (Fig. 3). 3.2. Genomic organization of EcIkBaA and EcIkBaB Based on the cDNA sequences of EcIkBaA and EcIkBaB, we amplified the genomic DNA fragments of them for sequencing and
Table 2 GenBank accession numbers of NF-kappa-B inhibitors used in this study. Protein
Accession no.
Takifugu rubripes IkBa Paralichthys olivaceus IkBa Osmerus mordax IkBa Siniperca chuatsi IkBa Mus musculus IkBa Felis catus IkBa Canis lupus familiaris IkBa Homo sapiens IkBa Xenopus laevis IkBa Danio rerio IkBaA Danio rerio IkBaB Mus musculus IkBb Canis lupus familiaris IkBb Bos taurus IkBb Felis catus IkBb Homo sapiens IkBb Mus sp. IkBg Mus musculus BCL3 Bos taurus BCL3 Homo sapiens BCL3 Felis catus BCL3 Mus musculus IkBz Homo sapiens IkBz Felis catus IkBz Homo sapiens IkBε Felis catus IkBε Mus musculus IkBε
XP_003976022.1 ABO38854.1 ACO09905.1 ABO40445.1 AAA79696.1 XP_003987591.1 XP_537413.3 NP_065390.1 NP_001086998.1 AAO26405.1 AAO26406.1 AAC52166.1 XP_541633.1 NP_001069340.1 XP_004001685.1 NP_002494.2 AAA40415.1 AAC79694.1 NP_001192922.1 EAW57291.1 XP_003997773.1 NP_085115.1 NP_001005474.1 XP_003261807.1 AAC51216.1 XP_003986249.1 AAB97517.1
106
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
Fig. 3. Phylogenetic analysis of EcIkBaA and EcIkBaB with other known IkBs. The phylogenetic tree based on amino acid sequences was constructed by the Neighbor-Jointing method with MEGA 5. The GenBank accession numbers of IkBs are listed in Table 2.
further analysis. The full-length genomic DNA sequences of EcIkBaA (GenBank accession no. KF849803) and EcIkBaB (GenBank accession no. KF849802) were 2239 bp and 4009 bp, respectively. The genomic structures of EcIkBaA and EcIkBaB were elucidated in Fig. 4. Both EcIkBaA and EcIkBaB contain 6 exons and 5 introns, which were similar to IkBa of Siniperca chuatsi and T. rubripes, respectively (Fig. 4). 3.3. Tissue distribution of EcIkBaA and EcIkBaB The RT-PCR results showed that both of their transcripts were widely distributed in different tissues, and they were abundant in liver and spleen, but least in the skin (Fig. 5). 3.4. Expression profiles of EcIkBaA and EcIkBaB after challenge In order to measure the different expression patterns of EcIkBaA and EcIkBaB responding to immune challenges in head kidney of E. coioides, four groups of fish were intraperitoneally injected with LPS, SGIV, V. alginolyticus and PBS. The expression patterns of EcIk BaA and EcIkBaB were determined by qPCR at various time points 0, 6, 12, 24, 48, 72 and 96 h post infection. The expression levels of EcIkBaA and EcIkBaB after LPS, SGIV and V. alginolyticus challenges reached the peak within the first 12 h post infection (Fig. 6). In detail, the expression of EcIkBaA and EcIkBaB increased up to
7.59-fold (p < 0.01) and 2.04-fold (p < 0.01) respectively at 6 h after V. alginolyticus challenge. For LPS challenge, the expression level of EcIkBaA and EcIkBaB increased up to 5.12-fold (p < 0.01) and 1.58fold (p < 0.05) at 12 h after infection. For SGIV challenge, the expression of EcIkBaA increased up to 2.04-fold (p < 0.01) at 6 h but EcIkBaB 1.84-fold (p < 0.05) at 12 h. Following peak expression, the level of EcIkBaA and EcIkBaB mRNA dropped and returned to the original level slowly. 3.5. Subcellular localization of EcIkBaA and EcIkBaB To determine the cellular localization of EcIkBaA and EcIkBaB in vitro, we detected the fluorescence using fluorescence microscopy after transient transfection in GS cells. As shown in Fig. 7, the green fluorescence was observed predominantly in the cytoplasm in pEGFP-EcIkBaB transfected cells (Lower row). Differently, the green fluorescence was observed in both the nucleus and the cytoplasm in pEGFP-EcIkBaA transfected cells (Middle row). In pEGFP-C1 transfected cells, the green fluorescence was observed also throughout the cytoplasm and nucleus (Upper row). 3.6. Effect of EcIkBaA and EcIkBaB on NF-kB activation To detect the effect of EcIkBaA and EcIkBaB on NF-kB activation, we transfected Ecc-Rel and Ecp65 NF-kB from E. coioides in GS cells,
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
107
Fig. 4. Genomic organization of EcIkBaA and EcIkBaB. Exons were represented by the open boxes, introns by lines, while the grey boxes were represented the untranslated regions.
which activated the NF-kB promoter activity about 3.21-fold (Fig. 8A) and 6.08-fold (Fig. 8B) respectively, relative to the control vector pcDNA3.1. The inhibitory activities of EcIkBaA and EcIk BaB on the NF-kB promoter activity induced by Ecc-Rel and Ecp65 NF-kB were detected by co-transfection and dual-luciferase reporter assay. The activity induced by Ecc-Rel was inhibited by 30 ng EcIkBaA to 38%, 100 ng EcIkBaA to 19%, and 30 ng EcIkBaB to 53%, 100 ng EcIkBaB to 21% (Fig. 8A), compared with transfected Ecc-Rel alone, while the activity induced by Ecp65 was inhibited by 30 ng EcIkBaA to 26%, 100 ng EcIkBaA to 11% and 30 ng EcIkBaB to 39%, 100 ng EcIkBaB to 13% (Fig. 8B), compared with only transfected Ecp65. Therefore, we speculated that both IkBaA and IkBaB regulated the activity of Ecc-Rel and Ecp65 NF-kB. 3.7. Overexpression of EcIkBaA and EcIkBaB inhibited SGIV replication in vitro In order to determine the effect of EcIkBaA and EcIkBaB on SGIV replication, pcDNA3.1, pcDNA-EcIkBaA and pcDNA-EcIkBaB plasmids were transfected in EAGS cells. The results showed that the expression of EcIkBaA or EcIkBaB in cells transfected with pcDNA-EcIkBaA or pcDNA-EcIkBaB were increased significantly in comparing to the control cells, respectively (Fig. 9A). In these overexpressing cells, the viral gene transcription, including MCP, ORF162 and ORF019 were all decreased significantly in comparing to the control cells during SGIV infection. In detail, overexpression of EcIkBaA decreased the transcripts of MCP, ORF162 and ORF019 up to 44%, 40% and 55%, respectively. Similarly, overexpression of
EcIkBaB decreased the transcripts of MCP, ORF162 and ORF019 up to 55%, 74% and 78%, respectively. Take together, overexpression of EcIkBaA or EcIkBaB inhibited SGIV replication significantly in GS cells in vitro. 4. Discussion The transcription factor NF-kB has attracted widespread attention due to its central role in growth, development and disease [1,44]. A primary level of NF-kB was controlled via the interactions with IkBs. To date, although multiple types of IkBs, including IkBa, IkBb, IkBε, IkBg, IkBz and Bcl-3 were identified, and the well-studied IkB protein was IkBa. However, the characterization and roles of IkBa from toelests remained largely unknown [45]. In the present study, we cloned and characterized two types of IkBa orthologues, EcIkBaA and EcIkBaB, from E. coioides. Both EcIkBaA and EcIkBaB proteins contained a same conserved degradation motif DSGLDS in their N-terminal region and a PEST sequence in the C-terminal region respectively. Differently, EcIkBaA and EcIkBaB contained 5 and 6 ankyrin (ANK) repeats, respectively. ANK is the characteristic domain of IkBa, which can block the RHD of NF-kB to shield its nuclear localization signal in cytoplasm [3,7,46]. The different numbers of ANK in EcIkBaA and EcIkBaB might affect their affinity with NF-kB [43]. A degradation motif and a PEST region were also necessary for IkBa, they involved in the rapid degradation of IkBa by the ubiquitin proteasome system in response to extracellular stimulations [10]. Both EcIkBaA and EcIkBaB contained a degradation motif which includes two serines residues, and a PEST region in
Fig. 5. Expression profile of EcIkBaA and EcIkBaB in different grouper tissues. M: DL2000 DNA marker; Lane 1: muscle; Lane 2: heart; Lane 3: head kidney; Lane 4: gill; Lane 5: trunk kidney; Lane 6: spleen; Lane 7: intestine; Lane 8: liver; Lane 9: brain; Lane 10: skin.
108
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
Fig. 6. Temporal expression analysis of EcIkBaA and EcIkBaB mRNA in grouper head kidney at 0, 6, 12, 24, 48, 72, 96 h after challenged with LPS, SGIV and Vibrio alginolyticus, respectively. Actin was used as an internal control. The changes in expression of EcIk BaA and EcIkBaB were calculated as the folds relative to that in PBS injected grouper at the same time point. Data were expressed as means SD (n ¼ 6), and significant differences of EcIkBaA and EcIkBaB expression between the challenged and control samples were indicated with an asterisk (*) at P < 0.05 or two asterisks (**) at P < 0.01.
the C-terminal region, but EcIkBaB contained another PEST domain containing a NES sequence in N-terminal. Whether the different number of the PEST region affected their function needed further investigation. It has been demonstrated that IkBa was widely distributed in many tissues of fish [12,35]. RT-PCR showed that the expression of EcIkBaA and EcIkBaB was widely distributed in different tissues, especially in liver, spleen and kidney, suggested that EcIkBa orthologues might be involved in immune regulation. In addition, the subcellular localization of IkBa showed two different forms in vitro, one was cytoplasmic localization [12,42], and the other was in both cytoplasm and nucleus [47,48]. Of note, the epitopic expression of EcIkBaA and EcIkBaB showed different localization. In detail, EcIk BaB was localized predominantly in cytoplasm, while EcIkBaA was distributed in both nucleus and cytoplasm. Whether different location of IkBa affected their functions still remained uncertain. As an inhibitor of NF-kB, overexpression of IkBa in vitro could decrease the NF-kB promoter activity [43,49]. In our study, overexpression of EcIkBaA and EcIkBaB significantly inhibited Ecp65 and Ecc-Rel activated NF-kB promoter activity, and the ability of inhibition was dose-dependent, indicating that both EcIkBaA and EcIkBaB were natural inhibitors of Ecp65 and Ecc-Rel. To clarify the response of EcIkBaA and EcIkBaB against different stimuli, including LPS, SGIV and V. alginolyticus, we detected the expression pattern of EcIkBa in head kidney using qPCR. The results showed that both of EcIkBaA and EcIkBaB were up-regulated at the early stage of stimulation. The difference of the alterations between EcIkBaA and EcIkBaB suggested that they might participate into the immune response against pathogens by different ways. Furthermore, overexpression of EcIkBaA and EcIkBaB in vitro inhibited the viral gene transcription of SGIV significantly. Similar phenomenon was observed in Hendra Virus infection [50]. Given that iridovirus infection always induced the NF-kB activation [51], we speculated that overexpression of EcIkBa decreased SGIV replication might be due to the inhibition of NF-kB activation during virus infection. It has been reported that some virus gene products were capable of
Fig. 7. Intracellular localization of EcIkBaA and EcIkBaB. GS cells were transfected with pEGFP-C1 (Upper row), pEGFP-EcIkBaA (Middle row) or pEGFP-EcIkBaB (Lower row). The localization of the nucleus was shown by DAPI staining.
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
109
Fig. 8. The effects of EcIkBaA and EcIkBaB on NF-kB activity in GS cells. Cells were co-transfected with NF-kB-Luc, pRL-TK, together with pcDNA-Ecc-Rel/pcDNA-Ecp65, pcDNAEcIkBaA/pcDNA-EcIkBaB/pcDNA3.1. Significant difference is indicated with an asterisk (*) at P < 0.05 or two asterisks (**) at P < 0.01.
Fig. 9. Overexpression of EcIkBaA and EcIkBaB contributed to efficient replication of SGIV. (A) Detection of EcIkBaA and EcIkBaB expression in GS cells. The results were normalized relative to 18S rRNA and represented by the means SD (n ¼ 3). The differences were indicated with two asterisks (**) at p < 0.01. (B) Quantitative analysis of the MCP, ORF019 and ORF162 genes expression during SGIV infection. qPCR data were normalized relative to 18S rRNA and represented by the means SD (n ¼ 3). The differences were indicated with an asterisks (*) at p < 0.05.
110
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
evoking NF-kB activation in vitro and affected virus replication by regulating cell apoptosis [52]. Moreover, viral gene expression was relied on NF-kB activity due to the presence of NF-kB binding sites in the viral gene promoter [53]. The detailed roles of EcIkBa on SGIV gene products induced NF-kB activation need further investigation. In conclusion, two types of IkBa orthologues, EcIkBaA and EcIk BaB from orange-spotted grouper, E. coioides, were characterized in this study. EcIkBaA and EcIkBaB showed different subcellular localization and different expression profile in response to stimuli. Overexpression of EcIkBaA and EcIkBaB both significantly inhibited the NF-kB promoter activity and reduced viral gene replication during SGIV infection. Together, our data contributed greatly to the better understanding of the roles of IkBaA and IkBaB in fish innate immunity. Acknowledgments This work was supported by grants from National Basic Research Program of China (973) (2012CB114402, 2012CB114404) and Natural Science Foundation of China (31172437, 31372566, 31330082), and the Knowledge Innovation Program of the Chinese Academy of Sciences (KZCX2-EW-Q213). References [1] Skaug B, Jiang X, Chen ZJ. The role of ubiquitin in NF-kappaB regulatory pathways. Annu Rev Biochem 2009;78:769e96. [2] Vallabhapurapu S, Karin M. Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol 2009;27:693e733. [3] Hayden MS, Ghosh S. Signaling to NF-kB. Genes Dev 2004;18:2195e224. [4] Sachdev S, Hoffmann A, Hannink M. Nuclear localization of IkBa is mediated by the second ankyrin repeat: the IkBa ankyrin repeats define a novel class of cis-acting nuclear import sequences. Mol Biol Cell 1998;18:2524e34. [5] Ernst MK, Dunn LL, Rice NR. The PEST-like sequence of IkBa is responsible for inhibition of DNA binding but not for cytoplasmic retention of c-Rel or RelA homodimers. Mol Cell Biol 1995;15:872e83. [6] Beg AA, Ruben SM, Scheinman RI, Haskill S, Rosen CA, Baldwin Jr AS, et al. IkB interacts with the nuclear localization sequences of the subunits of NF-kB: a mechanism for cytoplasmic retention. Genes Dev 1992;6:1899e913. [7] Ganchi PA, Sun SC, Greene WC, Ballard DW. IkBa/MAD-3 masks the nuclear localization signal of NF-kB p65 and requires the transactivation domain to inhibit NF-kB p65 DNA binding. Mol Biol Cell 1992;3:1339e52. [8] Lauzon NM, Mian F, Ashkar AA. Toll-like receptors, natural killer cells and innate immunity. Adv Exp Med Biol 2007;598:1e11. [9] Medzhitov R. Toll-like receptors and innate immunity. Nat Rev Immunol 2001;1:135e45. [10] Pahl HL. Activators and target genes of Rel/NF-kB transcription factors. Oncogene 1999;18:6853e66. [11] Nam BH, Byon JY, Kim YO, Park EM, Cho YC, Cheong J. Molecular cloning and characterisation of the flounder (Paralichthys olivaceus) interleukin-6 gene. Fish Shellfish Immunol 2007;23:231e6. [12] Yazawa R, Kondo H, Hirono I, Aoki T. Cloning and characterization of the IkBa cDNA from Japanese flounder, Paralychthys olivaceus. Fish Shellfish Immunol 2007;23:808e14. [13] Silverman N, Maniatis T. NF-kappaB signaling pathways in mammalian and insect innate immunity. Genes Dev 2001;15:2321e42. [14] Lee EY, Park HH, Kim YT, Choi TJ. Cloning and sequence analysis of the interleukin8 gene from flounder (Paralichthys olivaceous). Gene 2001;274:237e43. [15] Hirono I, Nam BH, Kurobe T, Aoki T. Molecular cloning, characterization, and expression of TNF cDNA and gene from Japanese flounder Paralychthys olivaceus. J Immunol 2000;165:4423e7. [16] Li Q, Verma IM. NF-kappaB regulation in the immune system. Nat Rev Immunol 2002;2:725e34. [17] Whiteside ST, Israël A. IkB proteins: structure, function and regulation. Semin Cancer Biol 1997;8:75e82. [18] Saranya Revathy K, Umasuthan N, Whang I, Lee Y, Lee S, Oh MJ, et al. A novel acute phase reactant, serum amyloid A-like 1, from Oplegnathus fasciatus: genomic and molecular characterization and transcriptional expression analysis. Dev Comp Immunol 2012;37:294e305. [19] Liu Y, Kimura K, Yanai R, Chikama T, Nishida T. Cytokine, chemokine, and adhesion molecule expression mediated by MAPKs in human corneal fibroblasts exposed to poly (I: C). Invest Ophthalmol Vis Sci 2008;49:3336e44. [20] Bates PW, Miyamoto S. Expanded nuclear roles for IkBs. Sci STKE 2004;254:48. [21] May MJ, Ghosh S. Rel/NF-kB and IkB proteins: an overview. Semin Cancer Biol 1997;8:63e73. [22] Baldwin Jr AS. The NF-kB and IkB proteins: new discoveries and insights. Annu Rev Immunol 1996;14:649e83.
[23] Hayden MS, Ghosh S. Shared principles in NF-kB signaling. Cell 2008;132: 344e62. [24] Chen LF, Greene WC. Shaping the nuclear action of NF-kappaB. Nat Rev Mol Cell Biol 2004;5:392e401. [25] Sen R, Baltimore D. Inducibility of kappa immunoglobulin enhancer-binding protein NF-kappa B by aposttranslational mechanism. Cell 1986;47:921e8. [26] Huxford T, Huang DB, Malek S, Ghosh G. The crystal structure of the IkBa/NFkB complex reveals mechanisms of NF-kB inactivation. Cell 1998;95:759e70. [27] Jacobs MD, Harrison SC. Structure of an IkBa/NF-kB complex. Cell 1998;95: 749e58. [28] Mathes E, O’Dea EL, Hoffmann A, Ghosh G. NF-kB dictates the degradation pathway of IkB. EMBO J 2008;27:1357e67. [29] Phelps CB, Sengchanthalangsy LL, Huxford T, Ghosh G. Mechanism of IkBa binding to NF-kB dimers. J Biol Chem 2000;275:29840e6. [30] Rogers S, Wells R, Rechsteiner M. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 1986;234:364e8. [31] Simeonidis S, Liang S, Chen G, Thanos D. Cloning and functional characterization of mouse IkBε. Proc Natl Acad Sci U S A 1997;94:14372e7. [32] Arenzana-Seisdedos F, Thompson J, Rodriguez MS, Bachelerie F, Thomas D, Hay RT. Inducible nuclear expression of newly synthesized IkB negatively regulates DNA-binding and transcriptional activities of NF-kB. Mol Cell Biol 1995;15:2689e96. [33] Brown K, Park S, Kanno T, Franzoso G, Siebenlist U. Mutual regulation of the transcriptional activator NF-kB and its inhibitor, IkB. Proc Natl Acad Sci U S A 1993;90:2532e6. [34] Sun SC, Ganchi PA, Ballard DW, Greene WC. NF-kB controls expression of inhibitor IkBa: evidence for an inducible autoregulatory pathway. Science 1993;259:1912e5. [35] Wang L, Zhou ZC, Guo CJ, Rao XY, Xiao J, Weng SP, et al. The alpha inhibitor of NF-kB (IkBa) from the mandarin fish binds with p65 NF-kB. Fish Shellfish Immunol 2009;26:473e82. [36] Cheng AC, Cheng SA, Chen YY, Chen JC. Effects of temperature change on the innate cellular and humoral immune responses of orange-spotted grouper Epinephelus coioides and its susceptibility to Vibrio alginolyticus. Fish Shellfish Immunol 2009;26:768e72. [37] Qin QW, Chang SF, Ngoh-Lim GH, Gibson-Kueh S, Shi C, Lam TJ. Characterization of a novel ranavirus isolated from grouper Epinephelus tauvina. Dis Aquat Org 2003;53:1e9. [38] Chang SF, Ngoh-Lim GH, Kueh LF, Qin QW, Seng EK, Sin YM. Initial investigations into two viruses isolated from marine food fish. Vet Rec 2002;150:15e6. [39] Huang X, Huang Y, Cai J, Wei S, Ouyang Z, Qin Q. Molecular cloning, expression and functional analysis of ISG15 in orange-spotted grouper, Epinephelus coioides. Fish Shellfish Immunol 2013;34:1094e102. [40] Huang XH, Huang YH, Sun JJ, Han X, Qin QW. Characterization of two grouper Epinephelus akaara cell lines: application to studies of Singapore grouper iridovirus (SGIV) propagation and virusehost interaction. Aquaculture 2009;292:172e9. [41] Huang Y, Huang X, Yan Y, Cai J, OuYang ZL, Cui HC, et al. Transcriptome analysis of orange-spotted grouper (Epinephelus coioides) spleen in response to Singapore grouper iridovirus. BMC Genomics 2011;556:1e12. [42] Zhang Y, He X, Yu Z. Two homologues of inhibitor of NF-kappa B (IkB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol 2011;30:1354e61. [43] Tam WF, Lee LH, Davis L, Sen R. Cytoplasmic sequestration of rel proteins by IkBa requires CRM1-dependent nuclear Export. Mol Cell Biol; 2000:2269e84. [44] Salminen A, Huuskonen J, Ojala J, Kauppinen A, Kaarniranta K, Suuronen T. Activation of innate immunity system during aging: NF-kB signaling is the molecular culprit of inflamm-aging. Ageing Res Rev 2008;7:83e105. [45] Correa RG, Tergaonkar V, Ng JK, Dubova I, Izpisua-Belmonte JC, Verma IM. Characterization of NF-kappa B/I kappa B proteins in zebra fish and their involvement in notochord development. Mol Cell Biol 2004;24:5257e68. [46] Zabel U, Henkel T, Silva MS, Baeuerle PA. Nuclear uptake control of NF-kB by MAD-3, an IkB protein present in the nucleus. EMBO J 1993;12:201e11. [47] Sachdev S, Hoffmann A, Hannink M. Nuclear localization of IkappaB alpha is mediated by the second ankyrin repeat: the IkappaB alpha ankyrin repeats define a novel class of cis-acting nuclear import sequences. Mol Cell Biol 1998;18:2524e34. [48] Arenzana-Seisdedos F, Turpin P, Rodriguez M, Thomas D, Hay RT, Virelizier JL, et al. Nuclear localization of I kappa B alpha promotes active transport of NFkappa B from the nucleus to the cytoplasm. J Cell Sci 1997;110:369e78. [49] Grumont RJ, Gerondakis S. Alternative splicing of RNA transcripts encoded by the murine p105 NF-kB gene generates IkBa isoforms with different inhibitory activities. Proc Natl Acad Sci U S A 1994;10:4367e71. [50] Stewart CR, Marsh GA, Jenkins KA, Gantier MP, Tizard ML, Middleton D, et al. Promotion of hendra virus replication by microRNA 146a. J Virol 2013;7: 3782e91. [51] Huang YH, Huang XH, Gui JF, Zhang QY. Mitochondrion-mediated apoptosis induced by Rana grylio virus infection in fish cells. Apoptosis 2007;12(9): 1569e77. [52] Huang X, Huang Y, Gong J, Yan Y, Qin Q. Identification and characterization of a putative lipopolysaccharide-induced TNF-alpha factor (LITAF) homolog from Singapore grouper iridovirus. Biochem Biophys Res Commun 2008;373(1):140e5. [53] Griffin GE, Leung K, Folks TM, Kunkel S, Nabel GJ. Activation of HIV gene expression during monocyte differentiation by induction of NF-kappa B. Nature 1989;339:70e3.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Molecular cloning and characterization of two types of IkBa orthologues in orange-spotted grouper, Epinephelus coioides Ren Gao a, b, Youhua Huang b, Xiaohong Huang b, Liya Guan b, Shina Wei b, Yongcan Zhou a, **, Qiwei Qin a, b, * a State Key Laboratory Breeding Base for Sustainable Exploitation of Tropical Biotic Resources, College of Marine Science, Hainan University, Haikou 570228, China b Key Laboratory of Tropical Marine Bio-resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 December 2013 Received in revised form 19 February 2014 Accepted 23 February 2014 Available online 2 March 2014
Inhibitors of kappa B (IkBs) are the members of primary regulators of NF-kB, which can inhibit NF-kB activity by blocking the NF-kB in an inactive state in the cytoplasm. In this study, two types of IkBa orthologues (EcIkBaA and EcIkBaB) from orange-spotted grouper, Epinephelus coioides, were cloned and characterized. EcIkBaA and EcIkBaB encoded putative proteins containing 308 and 318 amino acids, which shared 59% and 53% identity to IkBaA and IkBaB of Danio rerio, respectively. Amino acid sequence alignment showed that both EcIkBaA and EcIkBaB contained a conserved degradation motif DSGLDS in the N-terminal region and a PEST sequence in the C-terminal region. In addition, EcIkBaA and EcIkBaB contained 5 and 6 ankyrin repeats, respectively. The genomic DNA of EcIkBaA and EcIkBaB consisted of 6 exons and 5 introns. Both of their transcripts were widely distributed in different tissues, and the expression levels were different in response to various stimuli, including lipopolysaccharide (LPS), Vibrio alginolyticus and Singapore grouper iridovirus (SGIV). Dual-luciferase reporter assay suggested that both EcIkBaA and EcIkBaB were able to inhibit Ecc-Rel and Ecp65 induced NF-kB promoter activity in grouper spleen (GS) cells. Subcellular localization analysis showed that EcIkBaB was present predominantly in the cytoplasm, while EcIkBaA was distributed throughout both the nucleus and the cytoplasm. Furthermore, overexpression of EcIkBaA and EcIkBaB in GS cells inhibited the viral gene transcriptions of MCP, ORF019 and ORF162 of SGIV. Taken together, our findings suggested that both EcIkBaA and EcIkBaB were involved in grouper innate immunity against virus. Ó 2014 Elsevier Ltd. All rights reserved.
Keywords: Epinephelus coioides EcIkBaA EcIkBaB NF-kB SGIV
1. Introduction The nuclear factor kappa-B (NF-kB) pathway belongs to a classical signal pathway that plays a vital role in many biological processes, including innate and adaptive immunity, cellular-stress response, tumorigenesis, inflammation, and apoptosis [1,2]. In normal cells, the inhibitors of NF-kB (IkBs) kept NF-kB in an inactive state in the cytoplasm by blocking the Rel-homology domain (RHD)
* Corresponding author. Key Laboratory of Tropical Marine Bio-resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China. Tel./fax: þ86 20 89023638. ** Corresponding author. State Key Laboratory Breeding Base for Sustainable Exploitation of Tropical Biotic Resources, College of Marine Science, Hainan University, Haikou 570228, China. Tel.: þ86 13078932128. E-mail addresses: [email protected] (Y. Zhou), [email protected] (Q. Qin). http://dx.doi.org/10.1016/j.fsi.2014.02.019 1050-4648/Ó 2014 Elsevier Ltd. All rights reserved.
of NF-kB to mask its nuclear localization signal (NLS) [3e7]. Different stimuli, including UV irradiation, tumor necrosis factor (TNF), lipopolysaccharide (LPS), or viral and bacterial infection could induce the phosphorylation of IkBs and degradation IkBs for NF-kB release from IkB/NF-kB complex [8e10]. The activated NF-kB then transferred into the nucleus to regulate the transcription of specific genes, such as interferon，interleukin, cIAP-2, etc., which were important in the host immune system [11e15]. In mammals, several members of NF-kB family were identified, including RelA (p65), RelB, c-Rel, NF-kB1 (p50/p105), and NF-kB2 (p52/p100) [16,17]. All of them contained a highly evolutionarily conserved domain, the Rel-homology domain (RHD) of approximately 300 amino acids, which mediated DNA binding, dimerization and nuclear translocation of NF-kB. The expression and activation of NF-kB was regulated by its inhibitory protein IkBs, which included IkBa, IkBb, IkBε, IkBg, IkBz, Bcl-3 and Cactus in Drosophila [18e22].
102
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
IkBa was an important member of the large family of IkBs, which could strongly inhibit the activity of the NF-kB heterodimer p65/p50 [23e25]. All IkBa members shared a domain consisting of 5e7 ankyrin (ANK) repeats, which was response for proteineprotein interaction with NF-kB [26,27]. The C-terminal region of IkBa included a PEST (proline (P), glutamate (E), serine (S), and threonine (T)) domain, which not only regulated the degradation of IkBs but also mediated the inhibition of NF-kB/DNA binding [28e30]. In addition, IkBa was also proposed as a shuttle protein, which could enter the nucleus to block the NF-kB/DNA binding process [31e34]. Compared with higher vertebrates, the function of IkBa from marine teleosts in response to pathogens was poorly understood [35]. Grouper, Epinephelus coioides, an important marine food fish, was widely cultured in China and Southeast Asian countries. However, the emergences of viral and bacterial diseases caused great economic losses to the grouper aquaculture industry [36e38]. In the present study, we cloned and identified two types of IkBa orthologues in Epinephelus coioides (named as EcIkBaA and EcIk BaB). The molecular characterization, including genomic structure, subcellular localization and their expression profiles in response to pathogen infection were investigated. Furthermore, we determined the effects of EcIkBaA and EcIkBaB on NF-kB activation and Singapore grouper iridovirus (SGIV) replication. Our results provide a new insight into better understanding of the roles of fish NF-kB signaling pathway in pathogen infection. 2. Material and methods 2.1. Fish, cell lines and viruses Healthy young orange-spotted grouper, E. coioides, about 50 g, were purchased from a fish farm in Hainan province, China. Fish were domesticated in a laboratory recirculating seawater system at 25e30 C for two weeks before the experiment [39]. The samples including spleen, liver, kidney, head kidney, brain, intestine, gill, heart skin and muscle were collected from the sacrificial fish and immediately frozen by liquid nitrogen, stored at 80 C. Grouper spleen (GS) cells were grown and maintained in Leibovitz’s L15 medium that contained 10% fetal bovine serum (Invitrogen, USA) at the temperature of 25 C [40]. Singapore grouper iridovirus (SGIV) was proliferated in GS cells and the collected virus were frozen and thawed three times. The collected SGIV was stored at 80 C until use. 2.2. Cloning the full-length cDNA of two types of IkBa orthologues in E. coioides Total RNA was isolated from healthy head kidney of E. coioides by TRIzol Reagent (Invitrogen, USA) according to the manufacturer’s instructions. The quality of RNA was analyzed by agarose gel electrophoresis. The first-strand cDNAs of E. coioides IkBa orthologues, EcIkBaA and EcIkBaB, were synthesized using the SMARTÔ RACE cDNA amplification kit (Clontech, USA) according to the manufacturer’s instructions. Based on the identified ESTs established by our laboratory [41], specific primers of EcIkBaA and EcIkBaB were designed for rapid amplification of 30 and 50 ends of cDNA (RACE). In detail, the primers EcIkBaA3’GSP1, EcIkBaA5’NGSP1, EcIkBaB3’GSP1, EcIk BaB5’NGSP1 (Table 1) and UPM (supplied by the kit) were used to conduct the first round PCR. The products of first round PCR were diluted 10 times, and then conducted the nested PCR with the specific primers EcIkBaA3’GSP2, EcIkBaA5’NGSP2, EcIkBaB3’GSP2, EcIkBaB5’NGSP2 (Table 1) and NUP (supplied by the kit). The products of RACE PCR were analyzed by agarose gel imaging system, purified by AxyPrepÔ DNA gel extraction kit (Axygen, USA),
Table 1 Sequences of primers used in this study. Primers
Sequence（50 e30 ）
NUP UPM
AAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGCAAGCAGTG GTATCAACGCAGAGT ACCGCGGCTGCAGTTGACGAACTTGATGCC TGGATACCCGCGGTCTTGCTTCTC CGTGTTTGGACTCCATGTTGTCGAAG CCTCCTGGCACGGCAACATTTTCCC CCACCTAGCGGTAATAACGAACCAGGCCG GAGCGCCTCCTGGTAAACGGATGTG AGTCCTTGGCTTCGTGGATGATGGC CATCTTCTGTGATCTGTGTTTTCC TACGAGCTGCCTGACGGACA GGCTGTGATCTCCTTCTGCA ACGCAGAACAGCCAGCAGCACAT CGTGAAGCCGCCGTAGTTCAAGC TGTCATCATAACCCACCTCCTCAT ACACTCCCTTCCACCTCACCTAC CCCTGACCTTTGAGAGAGACTGAGC CATTCACACCAATCATAGTGGACGC GGAGACAACCAAGTGCACCTCGTAC GTCCTTCACCGTCATCATCACAGCC CGGATCCATGGACGTGCACAGAGTG GGAATTCTTACTTTCCGAACTTTATGTCG CGGATCCACATGGACCTCCACCG CGGAATTCCTAATGTCCATTCCACTGAATG GGAATTCTATGGACGTGCACAGAGTG CGGATCCTTACTTTCCGAACTTTATGTC CCTCGAGCTATGGACCTCCACCGGACC GGGGTACCCTAATGTCCATTCCACTGAATGTC GCACGCTTCTCTCACCTTCA AACGGCAACGGGAGCACTA ATTGACGGAAGGGCACCACCAG TCGCTCCACCAACTAAGAACGG GTCAGGGTGGAGAAAACGGGAGTGT CTCAAACAGTAACGTTCCGCAAGCG GAAGGAAACCCTGAAACTTTTGGCG TCTGGCTCTCAAGATTCGTGCGTAC
EcIkBaA3’GSP1 EcIkBaA3’GSP2 EcIkBaA5’NGSP1 EcIkBaB5’NGSP2 EcIkBaB3’GSP1 EcIkBaB3’GSP2 EcIkBaB5’NGSP1 EcIkBaB5’NGSP2 RT-Actin-F RT-Actin-R RT-EcIkBaA-F RT-EcIkBaA-R RT-EcIkBaB-F RT-EcIkBaB-R EcIkBaA-G-F EcIkBaA-G-R EcIkBaB-G eF EcIkBaB-G-R pcDNA-EcIkBaA-F pcDNA-EcIkBaA-R pcDNA-EcIkBaB-F pcDNA-EcIkBaB-R pEGFP-EcIkBaA-F pEGFP-EcIkBaA-R pEGFP-EcIkBaB-F pEGFP-EcIkBaB-R RT-MCP-F RT-MCP-R RT-18SeF RT-18S-R RT-VP19-FP RT-VP19-RP RT-162-FP RT-162-RP
then cloned into the pMD-18T vector (Takara, Japan) and sequenced by Invitigen. 2.3. EcIkBaA and EcIkBaB genomic DNA sequence determination Genomic DNA was isolated from the head kidney of E. coioides using the EzgeneÔ tissue gDNA Kit (Biomiga, USA), according to the manufacturer’s instructions. The genomic DNAs of EcIkBaA and EcIkBaB were amplified using the specific primers EcIkBaA-G-F, EcIkBaA-G-R, EcIkBaB-G-F, and EcIkBaB-G-R (Table 1), and the PCR products were purified and cloned into the pMD18-T vector (Takara, Japan) and sequenced by Invitrigen. 2.4. Bioinformatics analysis of EcIkBaA and EcIkBaB The homology of EcIkBaA and EcIkBaB with IkBa of other species was identified by NCBI BLAST (http://www.ncbi.nlm.nih.gov/ blast) program. Genetyx7.0 software was used to analyze the cDNA and amino acid sequences. The conserved domains of proteins were predicted by the Simple Modular Architecture Research Tool (SMART) version 4.0 (http://smart.embl-heidelberg.de/). The potential PEST sequence of EcIkBaA and EcIkBaB was predicted by the PEST find software (http://www.at.embnet.org/toolbox/ pestfind/). The NES sequence was found by NetNES 1.1 Server (http://www.cbs.dtu.dk/services/NetNES/). The casein kinase II phosohorylation sites of EcIkBaA and EcIkBaB were predicted using KinasePhos 2.0 (http://kinasephos2.mbc.nctu.edu.tw/index.html). Multiple-sequence alignment with other reported IkBa amino acid sequences was performed using ClustalX2.0 and a phylogenetic tree was constructed using the MEGA 5.0 software.
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
103
Fig. 1. The complete cDNA sequence of EcIkBaA (A, GenBank accession no. KF773746) and EcIkBaB (B, GenBank accession no. KF773745). The ORF and amino acid sequence was predicted by NCBI, and the start (ATG) and stop (TAG or TAA) codons were marked by “#” and “*”, respectively. The conserved serine residues of degradation motif sequence were circled. The ankyrin repeats predicted by the SMART program were underlined. The PEST sequence predicted by the PEST find software was light grey shaded. The NES sequence found by NetNES 1.1 Server was boxed. The polyadenylation signal (AATAAA or TATAAA) was bold.
104
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
2.5. Tissue distribution of EcIkBaA and EcIkBaB TRIzol Reagent (Invitrogen, USA) was used to isolate the total RNA from healthy orange-spotted grouper tissues, including spleen, liver, kidney, head kidney, heart, gill, brain, muscle, intestine, and skin according to the manufacturer’s instructions. The expression levels of EcIkBaA and EcIkBaB in different tissues above were analyzed by RT-PCR with the special primers RT-EcIkBaA-F, RTEcIkBaA-R, RT-EcIkBaB-F and RT-EcIkBaB-R, while internal control b-actin was amplified by using primers RT-Actin-F and RT-Actin-R (Table 1). The products of PCR were analyzed on 1.2% agarose gel electrophoresis. 2.6. Plasmid construction The recombinant plasmids including pcDNA-EcIkBaA, pcDNAEcIkBaB, pEGFP-EcIkBaA and pEGFP-EcIkBaB were constructed as described previously [42]. In detail, for construction of pcDNAEcIkBaA and pcDNA-EcIkBaB, the restriction sites of BamHI and EcoRI were incorporated into special primers pcDNA-EcIkBaA-F, pcDNA-EcIkBaA-R, pcDNA-EcIkBaB-F and pcDNA-EcIkBaB-R
(Table 1) to amplify the gene fragments of EcIkBaA and EcIkBaB from total cDNA of E. coioides. Similarly, the restriction sites of EcoRI, BamHI, XhoI and KpnI were used to constructed the plasmids pEGFP-EcIkBaA and pEGFP-EcIkBaB. In addition, the plasmids pcDNA-Ecp65, pcDNA-Ecc-Rel and pRL-TK used in this study were constructed and kept in our lab. 2.7. Subcellular localization The subcellular localization of EcIkBaA and EcIkBaB was examined by fluorescence microscopy as described previously [43]. GS cells grown in a 24-well plate, then transfected with recombinant pEGFP-EcIkBaA or pEGFP-EcIkBaB using LipofectamineTM 2000 Reagent (Invitrogen, USA) according to the manufacture’s protocol, while the pEGFP-C1 vector as a control. After 24 h transfection, GS cells were digested with trypsin and transferred to a 6-well plate with coverslips on it for another 24 h. GS cells were washed with PBS (pH 7.4) and fixed with 4% paraformaldehyde for 30 min, and then stained with 6-diamidino-2-pheny-lindole (DAPI) (1 mg/ml) for 15 min. Cells were observed under fluorescence microscope (Leica, Germany).
Fig. 2. Amino acid sequence alignment of IkBa from Epinephelus coioides and other species. The conserved degradation motif sequence DSGLDS were marked with underline and serine residues are marked with “*”. The ankyrin repeats identities with other species were boxed. The Gene accession numbers of the selected IkBa sequences were listed in Table 2.
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
2.8. Dual-luciferase reporter assay Grouper spleen (GS) cells were seeded to 24-well plates (106 cells/well) for 18 h, then transiently co-transfected with NF-kB luciferase reporter vector (100 ng/well), pRL-TK (50 ng/well), pcDNA-Ecc-Rel (300 ng/well) or pcDNA-Ecp65 (300 ng/well), pcDNA-EcIkBaA (30 ng or 100 ng/well) or pcDNA-EcIkBaB (30 ng or 100 ng/well), and pcDNA3.1 as a control, using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. The luciferase activity was measured using Dual-Luciferase Reporter Assay System (Promega life science, Madison, WI) 36 h after transfection. Relative luciferase activity was normalized to the amount of Renilla luciferase internal control. The experimental results were the average of triplicate independent assays and expressed as fold changes that relative to control vector. 2.9. Fish challenge by LPS, SGIV and Vibrio alginolyticus Lipopolysaccharide (LPS) was purchased from Sigma Corporation (USA). V. alginolyticus E333 and SGIV were kept in our laboratory. For the LPS challenge, each grouper was injected intraperitoneally (i.p.) with 200 ml LPS (1.5 mg/ml, Sigma). For the SGIV challenge, each grouper was injected with 200 ml SGIV (a dose of 2 104 TCID50). For the bacterial challenge, each grouper was injected with 200 ml live V. alginolyticus in PBS (108 CFU/ml). The grouper was injected with 200 ml PBS as a control. Seven fish as a challenge group were collected at 0, 6, 12, 24, 48, 72 and 96 h after injection, and total RNA was isolated from head kidney. 2.10. Expression profiles of EcIkBaA and EcIkBaB After challenge with LPS, SGIV and V. alginolyticus, the expression levels of EcIkBaA and EcIkBaB were examined by qPCR in head kidney with the special primers RT-EcIkBaA-F, RT-EcIkBaA-R, RTEcIkBaB-F and RT-EcIkBaB-R (Table 1), and actin was amplified using primers RT-Actin-F and RT-Actin-R as an internal control. The data was analyzed with triplicate independent assays, and the results were calculated as the folds of the expression level of EcIkBaA and EcIkBaB in different stimulus challenged grouper relative to that in PBS injected grouper at the same time point. Data were expressed as mean SD, and analyzed by SPSS software. 2.11. The effect of EcIkBaA and EcIkBaB overexpression on SGIV replication The GS cells were seeded to 24-well plates (106 cells/well) for 18 h, and then transiently co-transfected with pcDNA-EcIkBaA (800 ng/well) or pcDNA-EcIkBaB (800 ng/well), and pcDNA3.1 (800 ng/well) as a control. After 24 h, the EAGS was infected with SGIV (MOI ¼ 0.1), and then every well was harvested after infected 24 h and 48 h. The expression of major capsid protein (MCP) and some other virus proteins, including ORF019, ORF162 of SGIV was detected by qPCR using primer RT-MCP-F, RT-MCP-R, RT-VP019-F, RT-VP019-R, RT-VP162-F and RT-VP162-R (Table 1), with the 18S rRNA as a control. All Data were expressed as mean SD, and then analyzed by one-way ANOVA, followed analyzed by the Student’s t-test. Differences significant were considered at p < 0.05. 3. Results 3.1. Sequence characterization and phylogenetic analysis of EcIkBa The full length cDNA of EcIkBaA is 1357 bp long with an open reading frame (ORF) of 927 bp, and encodes a putative protein of
105
308 amino acids with a predicted molecular mass of 33.9 kDa. The deduced amino acid sequence of EcIkBaA contains 5 ankyrin (ANK) domains, two PEST sequences, a NES sequence 46LVSEIEEMTL55 and a degradation motif 35DSGLDS40 including two serine residues Ser36 and Ser-40 in N-residues (Fig. 1A), which shared 59% identity to IkBaA of Danio rerio. The full-length cDNA of EcIkBaA contains a 50 UTR of 52 bp and a 30 UTR of 378 bp with a nonstandard polyadenylation signal sequence TATAAA above the poly (A) tail (Fig. 1A). The full-length of EcIkBaA cDNA sequence was deposited in Genbank with accession no. KF773746. The full length cDNA of EcIkBaB is 1573 bp long with an ORF of 957 bp, which encodes a putative protein of 318 amino acids with a predicted molecular mass of 35 kDa. The deduced amino acid sequence of EcIkBaB contains 6 ANK domains, a PEST sequence in the C-terminal region, and a degradation motif 32DSGLDS37 possessing two serine residues Ser-33 and Ser-37 in the N-terminal region (Fig. 1B), which shared 59% identity to IkBaB of D. rerio. The full-length cDNA of EcIkBaB contains a 50 -UTR of 47 bp, and a 30 UTR of 569 bp with a consensus polyadenylation signal sequence ATTAAA above the 25 bp poly (A) tail (Fig. 1B). The full-length of EcIkBaB cDNA sequence was deposited in Genbank with accession no. KF773745. Amino acid alignment of grouper IkBaA and IkBaB with other species IkBa revealed that all IkBa contain a conserved degradation motif DSGLDS including two serine residues in N-residues, 5e6 ANK domains (Fig. 2). Phylogenetic tree was constructed by the Neighbor-Jointing method based on amino acid sequences of IkBa from various species. EcIkBaA showed the closest relationship with IkBa of Siniperca chuats and IkBaA of D. rerio, while EcIkBaB presented the closest relationship with IkBa of Paralichthys olivaceus, Takifugu rubripes, Osmerus mordax and IkBaB of D. rerio (Fig. 3). 3.2. Genomic organization of EcIkBaA and EcIkBaB Based on the cDNA sequences of EcIkBaA and EcIkBaB, we amplified the genomic DNA fragments of them for sequencing and
Table 2 GenBank accession numbers of NF-kappa-B inhibitors used in this study. Protein
Accession no.
Takifugu rubripes IkBa Paralichthys olivaceus IkBa Osmerus mordax IkBa Siniperca chuatsi IkBa Mus musculus IkBa Felis catus IkBa Canis lupus familiaris IkBa Homo sapiens IkBa Xenopus laevis IkBa Danio rerio IkBaA Danio rerio IkBaB Mus musculus IkBb Canis lupus familiaris IkBb Bos taurus IkBb Felis catus IkBb Homo sapiens IkBb Mus sp. IkBg Mus musculus BCL3 Bos taurus BCL3 Homo sapiens BCL3 Felis catus BCL3 Mus musculus IkBz Homo sapiens IkBz Felis catus IkBz Homo sapiens IkBε Felis catus IkBε Mus musculus IkBε
XP_003976022.1 ABO38854.1 ACO09905.1 ABO40445.1 AAA79696.1 XP_003987591.1 XP_537413.3 NP_065390.1 NP_001086998.1 AAO26405.1 AAO26406.1 AAC52166.1 XP_541633.1 NP_001069340.1 XP_004001685.1 NP_002494.2 AAA40415.1 AAC79694.1 NP_001192922.1 EAW57291.1 XP_003997773.1 NP_085115.1 NP_001005474.1 XP_003261807.1 AAC51216.1 XP_003986249.1 AAB97517.1
106
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
Fig. 3. Phylogenetic analysis of EcIkBaA and EcIkBaB with other known IkBs. The phylogenetic tree based on amino acid sequences was constructed by the Neighbor-Jointing method with MEGA 5. The GenBank accession numbers of IkBs are listed in Table 2.
further analysis. The full-length genomic DNA sequences of EcIkBaA (GenBank accession no. KF849803) and EcIkBaB (GenBank accession no. KF849802) were 2239 bp and 4009 bp, respectively. The genomic structures of EcIkBaA and EcIkBaB were elucidated in Fig. 4. Both EcIkBaA and EcIkBaB contain 6 exons and 5 introns, which were similar to IkBa of Siniperca chuatsi and T. rubripes, respectively (Fig. 4). 3.3. Tissue distribution of EcIkBaA and EcIkBaB The RT-PCR results showed that both of their transcripts were widely distributed in different tissues, and they were abundant in liver and spleen, but least in the skin (Fig. 5). 3.4. Expression profiles of EcIkBaA and EcIkBaB after challenge In order to measure the different expression patterns of EcIkBaA and EcIkBaB responding to immune challenges in head kidney of E. coioides, four groups of fish were intraperitoneally injected with LPS, SGIV, V. alginolyticus and PBS. The expression patterns of EcIk BaA and EcIkBaB were determined by qPCR at various time points 0, 6, 12, 24, 48, 72 and 96 h post infection. The expression levels of EcIkBaA and EcIkBaB after LPS, SGIV and V. alginolyticus challenges reached the peak within the first 12 h post infection (Fig. 6). In detail, the expression of EcIkBaA and EcIkBaB increased up to
7.59-fold (p < 0.01) and 2.04-fold (p < 0.01) respectively at 6 h after V. alginolyticus challenge. For LPS challenge, the expression level of EcIkBaA and EcIkBaB increased up to 5.12-fold (p < 0.01) and 1.58fold (p < 0.05) at 12 h after infection. For SGIV challenge, the expression of EcIkBaA increased up to 2.04-fold (p < 0.01) at 6 h but EcIkBaB 1.84-fold (p < 0.05) at 12 h. Following peak expression, the level of EcIkBaA and EcIkBaB mRNA dropped and returned to the original level slowly. 3.5. Subcellular localization of EcIkBaA and EcIkBaB To determine the cellular localization of EcIkBaA and EcIkBaB in vitro, we detected the fluorescence using fluorescence microscopy after transient transfection in GS cells. As shown in Fig. 7, the green fluorescence was observed predominantly in the cytoplasm in pEGFP-EcIkBaB transfected cells (Lower row). Differently, the green fluorescence was observed in both the nucleus and the cytoplasm in pEGFP-EcIkBaA transfected cells (Middle row). In pEGFP-C1 transfected cells, the green fluorescence was observed also throughout the cytoplasm and nucleus (Upper row). 3.6. Effect of EcIkBaA and EcIkBaB on NF-kB activation To detect the effect of EcIkBaA and EcIkBaB on NF-kB activation, we transfected Ecc-Rel and Ecp65 NF-kB from E. coioides in GS cells,
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
107
Fig. 4. Genomic organization of EcIkBaA and EcIkBaB. Exons were represented by the open boxes, introns by lines, while the grey boxes were represented the untranslated regions.
which activated the NF-kB promoter activity about 3.21-fold (Fig. 8A) and 6.08-fold (Fig. 8B) respectively, relative to the control vector pcDNA3.1. The inhibitory activities of EcIkBaA and EcIk BaB on the NF-kB promoter activity induced by Ecc-Rel and Ecp65 NF-kB were detected by co-transfection and dual-luciferase reporter assay. The activity induced by Ecc-Rel was inhibited by 30 ng EcIkBaA to 38%, 100 ng EcIkBaA to 19%, and 30 ng EcIkBaB to 53%, 100 ng EcIkBaB to 21% (Fig. 8A), compared with transfected Ecc-Rel alone, while the activity induced by Ecp65 was inhibited by 30 ng EcIkBaA to 26%, 100 ng EcIkBaA to 11% and 30 ng EcIkBaB to 39%, 100 ng EcIkBaB to 13% (Fig. 8B), compared with only transfected Ecp65. Therefore, we speculated that both IkBaA and IkBaB regulated the activity of Ecc-Rel and Ecp65 NF-kB. 3.7. Overexpression of EcIkBaA and EcIkBaB inhibited SGIV replication in vitro In order to determine the effect of EcIkBaA and EcIkBaB on SGIV replication, pcDNA3.1, pcDNA-EcIkBaA and pcDNA-EcIkBaB plasmids were transfected in EAGS cells. The results showed that the expression of EcIkBaA or EcIkBaB in cells transfected with pcDNA-EcIkBaA or pcDNA-EcIkBaB were increased significantly in comparing to the control cells, respectively (Fig. 9A). In these overexpressing cells, the viral gene transcription, including MCP, ORF162 and ORF019 were all decreased significantly in comparing to the control cells during SGIV infection. In detail, overexpression of EcIkBaA decreased the transcripts of MCP, ORF162 and ORF019 up to 44%, 40% and 55%, respectively. Similarly, overexpression of
EcIkBaB decreased the transcripts of MCP, ORF162 and ORF019 up to 55%, 74% and 78%, respectively. Take together, overexpression of EcIkBaA or EcIkBaB inhibited SGIV replication significantly in GS cells in vitro. 4. Discussion The transcription factor NF-kB has attracted widespread attention due to its central role in growth, development and disease [1,44]. A primary level of NF-kB was controlled via the interactions with IkBs. To date, although multiple types of IkBs, including IkBa, IkBb, IkBε, IkBg, IkBz and Bcl-3 were identified, and the well-studied IkB protein was IkBa. However, the characterization and roles of IkBa from toelests remained largely unknown [45]. In the present study, we cloned and characterized two types of IkBa orthologues, EcIkBaA and EcIkBaB, from E. coioides. Both EcIkBaA and EcIkBaB proteins contained a same conserved degradation motif DSGLDS in their N-terminal region and a PEST sequence in the C-terminal region respectively. Differently, EcIkBaA and EcIkBaB contained 5 and 6 ankyrin (ANK) repeats, respectively. ANK is the characteristic domain of IkBa, which can block the RHD of NF-kB to shield its nuclear localization signal in cytoplasm [3,7,46]. The different numbers of ANK in EcIkBaA and EcIkBaB might affect their affinity with NF-kB [43]. A degradation motif and a PEST region were also necessary for IkBa, they involved in the rapid degradation of IkBa by the ubiquitin proteasome system in response to extracellular stimulations [10]. Both EcIkBaA and EcIkBaB contained a degradation motif which includes two serines residues, and a PEST region in
Fig. 5. Expression profile of EcIkBaA and EcIkBaB in different grouper tissues. M: DL2000 DNA marker; Lane 1: muscle; Lane 2: heart; Lane 3: head kidney; Lane 4: gill; Lane 5: trunk kidney; Lane 6: spleen; Lane 7: intestine; Lane 8: liver; Lane 9: brain; Lane 10: skin.
108
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
Fig. 6. Temporal expression analysis of EcIkBaA and EcIkBaB mRNA in grouper head kidney at 0, 6, 12, 24, 48, 72, 96 h after challenged with LPS, SGIV and Vibrio alginolyticus, respectively. Actin was used as an internal control. The changes in expression of EcIk BaA and EcIkBaB were calculated as the folds relative to that in PBS injected grouper at the same time point. Data were expressed as means SD (n ¼ 6), and significant differences of EcIkBaA and EcIkBaB expression between the challenged and control samples were indicated with an asterisk (*) at P < 0.05 or two asterisks (**) at P < 0.01.
the C-terminal region, but EcIkBaB contained another PEST domain containing a NES sequence in N-terminal. Whether the different number of the PEST region affected their function needed further investigation. It has been demonstrated that IkBa was widely distributed in many tissues of fish [12,35]. RT-PCR showed that the expression of EcIkBaA and EcIkBaB was widely distributed in different tissues, especially in liver, spleen and kidney, suggested that EcIkBa orthologues might be involved in immune regulation. In addition, the subcellular localization of IkBa showed two different forms in vitro, one was cytoplasmic localization [12,42], and the other was in both cytoplasm and nucleus [47,48]. Of note, the epitopic expression of EcIkBaA and EcIkBaB showed different localization. In detail, EcIk BaB was localized predominantly in cytoplasm, while EcIkBaA was distributed in both nucleus and cytoplasm. Whether different location of IkBa affected their functions still remained uncertain. As an inhibitor of NF-kB, overexpression of IkBa in vitro could decrease the NF-kB promoter activity [43,49]. In our study, overexpression of EcIkBaA and EcIkBaB significantly inhibited Ecp65 and Ecc-Rel activated NF-kB promoter activity, and the ability of inhibition was dose-dependent, indicating that both EcIkBaA and EcIkBaB were natural inhibitors of Ecp65 and Ecc-Rel. To clarify the response of EcIkBaA and EcIkBaB against different stimuli, including LPS, SGIV and V. alginolyticus, we detected the expression pattern of EcIkBa in head kidney using qPCR. The results showed that both of EcIkBaA and EcIkBaB were up-regulated at the early stage of stimulation. The difference of the alterations between EcIkBaA and EcIkBaB suggested that they might participate into the immune response against pathogens by different ways. Furthermore, overexpression of EcIkBaA and EcIkBaB in vitro inhibited the viral gene transcription of SGIV significantly. Similar phenomenon was observed in Hendra Virus infection [50]. Given that iridovirus infection always induced the NF-kB activation [51], we speculated that overexpression of EcIkBa decreased SGIV replication might be due to the inhibition of NF-kB activation during virus infection. It has been reported that some virus gene products were capable of
Fig. 7. Intracellular localization of EcIkBaA and EcIkBaB. GS cells were transfected with pEGFP-C1 (Upper row), pEGFP-EcIkBaA (Middle row) or pEGFP-EcIkBaB (Lower row). The localization of the nucleus was shown by DAPI staining.
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
109
Fig. 8. The effects of EcIkBaA and EcIkBaB on NF-kB activity in GS cells. Cells were co-transfected with NF-kB-Luc, pRL-TK, together with pcDNA-Ecc-Rel/pcDNA-Ecp65, pcDNAEcIkBaA/pcDNA-EcIkBaB/pcDNA3.1. Significant difference is indicated with an asterisk (*) at P < 0.05 or two asterisks (**) at P < 0.01.
Fig. 9. Overexpression of EcIkBaA and EcIkBaB contributed to efficient replication of SGIV. (A) Detection of EcIkBaA and EcIkBaB expression in GS cells. The results were normalized relative to 18S rRNA and represented by the means SD (n ¼ 3). The differences were indicated with two asterisks (**) at p < 0.01. (B) Quantitative analysis of the MCP, ORF019 and ORF162 genes expression during SGIV infection. qPCR data were normalized relative to 18S rRNA and represented by the means SD (n ¼ 3). The differences were indicated with an asterisks (*) at p < 0.05.
110
R. Gao et al. / Fish & Shellfish Immunology 38 (2014) 101e110
evoking NF-kB activation in vitro and affected virus replication by regulating cell apoptosis [52]. Moreover, viral gene expression was relied on NF-kB activity due to the presence of NF-kB binding sites in the viral gene promoter [53]. The detailed roles of EcIkBa on SGIV gene products induced NF-kB activation need further investigation. In conclusion, two types of IkBa orthologues, EcIkBaA and EcIk BaB from orange-spotted grouper, E. coioides, were characterized in this study. EcIkBaA and EcIkBaB showed different subcellular localization and different expression profile in response to stimuli. Overexpression of EcIkBaA and EcIkBaB both significantly inhibited the NF-kB promoter activity and reduced viral gene replication during SGIV infection. Together, our data contributed greatly to the better understanding of the roles of IkBaA and IkBaB in fish innate immunity. Acknowledgments This work was supported by grants from National Basic Research Program of China (973) (2012CB114402, 2012CB114404) and Natural Science Foundation of China (31172437, 31372566, 31330082), and the Knowledge Innovation Program of the Chinese Academy of Sciences (KZCX2-EW-Q213). References [1] Skaug B, Jiang X, Chen ZJ. The role of ubiquitin in NF-kappaB regulatory pathways. Annu Rev Biochem 2009;78:769e96. [2] Vallabhapurapu S, Karin M. Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol 2009;27:693e733. [3] Hayden MS, Ghosh S. Signaling to NF-kB. Genes Dev 2004;18:2195e224. [4] Sachdev S, Hoffmann A, Hannink M. Nuclear localization of IkBa is mediated by the second ankyrin repeat: the IkBa ankyrin repeats define a novel class of cis-acting nuclear import sequences. Mol Biol Cell 1998;18:2524e34. [5] Ernst MK, Dunn LL, Rice NR. The PEST-like sequence of IkBa is responsible for inhibition of DNA binding but not for cytoplasmic retention of c-Rel or RelA homodimers. Mol Cell Biol 1995;15:872e83. [6] Beg AA, Ruben SM, Scheinman RI, Haskill S, Rosen CA, Baldwin Jr AS, et al. IkB interacts with the nuclear localization sequences of the subunits of NF-kB: a mechanism for cytoplasmic retention. Genes Dev 1992;6:1899e913. [7] Ganchi PA, Sun SC, Greene WC, Ballard DW. IkBa/MAD-3 masks the nuclear localization signal of NF-kB p65 and requires the transactivation domain to inhibit NF-kB p65 DNA binding. Mol Biol Cell 1992;3:1339e52. [8] Lauzon NM, Mian F, Ashkar AA. Toll-like receptors, natural killer cells and innate immunity. Adv Exp Med Biol 2007;598:1e11. [9] Medzhitov R. Toll-like receptors and innate immunity. Nat Rev Immunol 2001;1:135e45. [10] Pahl HL. Activators and target genes of Rel/NF-kB transcription factors. Oncogene 1999;18:6853e66. [11] Nam BH, Byon JY, Kim YO, Park EM, Cho YC, Cheong J. Molecular cloning and characterisation of the flounder (Paralichthys olivaceus) interleukin-6 gene. Fish Shellfish Immunol 2007;23:231e6. [12] Yazawa R, Kondo H, Hirono I, Aoki T. Cloning and characterization of the IkBa cDNA from Japanese flounder, Paralychthys olivaceus. Fish Shellfish Immunol 2007;23:808e14. [13] Silverman N, Maniatis T. NF-kappaB signaling pathways in mammalian and insect innate immunity. Genes Dev 2001;15:2321e42. [14] Lee EY, Park HH, Kim YT, Choi TJ. Cloning and sequence analysis of the interleukin8 gene from flounder (Paralichthys olivaceous). Gene 2001;274:237e43. [15] Hirono I, Nam BH, Kurobe T, Aoki T. Molecular cloning, characterization, and expression of TNF cDNA and gene from Japanese flounder Paralychthys olivaceus. J Immunol 2000;165:4423e7. [16] Li Q, Verma IM. NF-kappaB regulation in the immune system. Nat Rev Immunol 2002;2:725e34. [17] Whiteside ST, Israël A. IkB proteins: structure, function and regulation. Semin Cancer Biol 1997;8:75e82. [18] Saranya Revathy K, Umasuthan N, Whang I, Lee Y, Lee S, Oh MJ, et al. A novel acute phase reactant, serum amyloid A-like 1, from Oplegnathus fasciatus: genomic and molecular characterization and transcriptional expression analysis. Dev Comp Immunol 2012;37:294e305. [19] Liu Y, Kimura K, Yanai R, Chikama T, Nishida T. Cytokine, chemokine, and adhesion molecule expression mediated by MAPKs in human corneal fibroblasts exposed to poly (I: C). Invest Ophthalmol Vis Sci 2008;49:3336e44. [20] Bates PW, Miyamoto S. Expanded nuclear roles for IkBs. Sci STKE 2004;254:48. [21] May MJ, Ghosh S. Rel/NF-kB and IkB proteins: an overview. Semin Cancer Biol 1997;8:63e73. [22] Baldwin Jr AS. The NF-kB and IkB proteins: new discoveries and insights. Annu Rev Immunol 1996;14:649e83.
[23] Hayden MS, Ghosh S. Shared principles in NF-kB signaling. Cell 2008;132: 344e62. [24] Chen LF, Greene WC. Shaping the nuclear action of NF-kappaB. Nat Rev Mol Cell Biol 2004;5:392e401. [25] Sen R, Baltimore D. Inducibility of kappa immunoglobulin enhancer-binding protein NF-kappa B by aposttranslational mechanism. Cell 1986;47:921e8. [26] Huxford T, Huang DB, Malek S, Ghosh G. The crystal structure of the IkBa/NFkB complex reveals mechanisms of NF-kB inactivation. Cell 1998;95:759e70. [27] Jacobs MD, Harrison SC. Structure of an IkBa/NF-kB complex. Cell 1998;95: 749e58. [28] Mathes E, O’Dea EL, Hoffmann A, Ghosh G. NF-kB dictates the degradation pathway of IkB. EMBO J 2008;27:1357e67. [29] Phelps CB, Sengchanthalangsy LL, Huxford T, Ghosh G. Mechanism of IkBa binding to NF-kB dimers. J Biol Chem 2000;275:29840e6. [30] Rogers S, Wells R, Rechsteiner M. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 1986;234:364e8. [31] Simeonidis S, Liang S, Chen G, Thanos D. Cloning and functional characterization of mouse IkBε. Proc Natl Acad Sci U S A 1997;94:14372e7. [32] Arenzana-Seisdedos F, Thompson J, Rodriguez MS, Bachelerie F, Thomas D, Hay RT. Inducible nuclear expression of newly synthesized IkB negatively regulates DNA-binding and transcriptional activities of NF-kB. Mol Cell Biol 1995;15:2689e96. [33] Brown K, Park S, Kanno T, Franzoso G, Siebenlist U. Mutual regulation of the transcriptional activator NF-kB and its inhibitor, IkB. Proc Natl Acad Sci U S A 1993;90:2532e6. [34] Sun SC, Ganchi PA, Ballard DW, Greene WC. NF-kB controls expression of inhibitor IkBa: evidence for an inducible autoregulatory pathway. Science 1993;259:1912e5. [35] Wang L, Zhou ZC, Guo CJ, Rao XY, Xiao J, Weng SP, et al. The alpha inhibitor of NF-kB (IkBa) from the mandarin fish binds with p65 NF-kB. Fish Shellfish Immunol 2009;26:473e82. [36] Cheng AC, Cheng SA, Chen YY, Chen JC. Effects of temperature change on the innate cellular and humoral immune responses of orange-spotted grouper Epinephelus coioides and its susceptibility to Vibrio alginolyticus. Fish Shellfish Immunol 2009;26:768e72. [37] Qin QW, Chang SF, Ngoh-Lim GH, Gibson-Kueh S, Shi C, Lam TJ. Characterization of a novel ranavirus isolated from grouper Epinephelus tauvina. Dis Aquat Org 2003;53:1e9. [38] Chang SF, Ngoh-Lim GH, Kueh LF, Qin QW, Seng EK, Sin YM. Initial investigations into two viruses isolated from marine food fish. Vet Rec 2002;150:15e6. [39] Huang X, Huang Y, Cai J, Wei S, Ouyang Z, Qin Q. Molecular cloning, expression and functional analysis of ISG15 in orange-spotted grouper, Epinephelus coioides. Fish Shellfish Immunol 2013;34:1094e102. [40] Huang XH, Huang YH, Sun JJ, Han X, Qin QW. Characterization of two grouper Epinephelus akaara cell lines: application to studies of Singapore grouper iridovirus (SGIV) propagation and virusehost interaction. Aquaculture 2009;292:172e9. [41] Huang Y, Huang X, Yan Y, Cai J, OuYang ZL, Cui HC, et al. Transcriptome analysis of orange-spotted grouper (Epinephelus coioides) spleen in response to Singapore grouper iridovirus. BMC Genomics 2011;556:1e12. [42] Zhang Y, He X, Yu Z. Two homologues of inhibitor of NF-kappa B (IkB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol 2011;30:1354e61. [43] Tam WF, Lee LH, Davis L, Sen R. Cytoplasmic sequestration of rel proteins by IkBa requires CRM1-dependent nuclear Export. Mol Cell Biol; 2000:2269e84. [44] Salminen A, Huuskonen J, Ojala J, Kauppinen A, Kaarniranta K, Suuronen T. Activation of innate immunity system during aging: NF-kB signaling is the molecular culprit of inflamm-aging. Ageing Res Rev 2008;7:83e105. [45] Correa RG, Tergaonkar V, Ng JK, Dubova I, Izpisua-Belmonte JC, Verma IM. Characterization of NF-kappa B/I kappa B proteins in zebra fish and their involvement in notochord development. Mol Cell Biol 2004;24:5257e68. [46] Zabel U, Henkel T, Silva MS, Baeuerle PA. Nuclear uptake control of NF-kB by MAD-3, an IkB protein present in the nucleus. EMBO J 1993;12:201e11. [47] Sachdev S, Hoffmann A, Hannink M. Nuclear localization of IkappaB alpha is mediated by the second ankyrin repeat: the IkappaB alpha ankyrin repeats define a novel class of cis-acting nuclear import sequences. Mol Cell Biol 1998;18:2524e34. [48] Arenzana-Seisdedos F, Turpin P, Rodriguez M, Thomas D, Hay RT, Virelizier JL, et al. Nuclear localization of I kappa B alpha promotes active transport of NFkappa B from the nucleus to the cytoplasm. J Cell Sci 1997;110:369e78. [49] Grumont RJ, Gerondakis S. Alternative splicing of RNA transcripts encoded by the murine p105 NF-kB gene generates IkBa isoforms with different inhibitory activities. Proc Natl Acad Sci U S A 1994;10:4367e71. [50] Stewart CR, Marsh GA, Jenkins KA, Gantier MP, Tizard ML, Middleton D, et al. Promotion of hendra virus replication by microRNA 146a. J Virol 2013;7: 3782e91. [51] Huang YH, Huang XH, Gui JF, Zhang QY. Mitochondrion-mediated apoptosis induced by Rana grylio virus infection in fish cells. Apoptosis 2007;12(9): 1569e77. [52] Huang X, Huang Y, Gong J, Yan Y, Qin Q. Identification and characterization of a putative lipopolysaccharide-induced TNF-alpha factor (LITAF) homolog from Singapore grouper iridovirus. Biochem Biophys Res Commun 2008;373(1):140e5. [53] Griffin GE, Leung K, Folks TM, Kunkel S, Nabel GJ. Activation of HIV gene expression during monocyte differentiation by induction of NF-kappa B. Nature 1989;339:70e3.
