Molecular and Biochemical Parasitology, 42 (1990) 165-174

165

Elsevier MOLBIO 01384

Molecular cloning and expression of an immunodominant 53-kDa excretory-secretory antigen from Trichinella spiralis muscle larvae Dante S. Zarlenga and H. R a y G a m b l e Biosystematic Parasitology and Helminthic Diseases Laboratories ARS-USDA, Beltsville, MD, U.S.A.

(Received 6 October 1989; accepted 10 April 1990)

A Trichinella spiralis cDNA expression library was constructed in Agtl I from muscle larvae mRNA and immunologically screened to identify genes encoding previously described immunodiagnostic excretory-secretory (ES) antigens. Screening the library with T. spiralis infection serum from swine or rabbit antiserum to T. spiralis ES antigen identified one clone, designated TsA-12, that contains a cDNA transcript 539 bp in length and codes for an apparent 123-kDa/3-galactosidase fusion protein that does not cross-react with Trichuris suis or Ascaris suum infection serum. Western blots of T. spiralis extracts and immunoperoxidase staining of tissue sections from muscle larvae using antibodies to purified TsA-12 demonstrate homology between TsA-12 and the 53 kDa diagnostic antigen from ES products (designated Ts.53) and localize the homologous native antigen to the stichocyte cells of the parasite. ELISA tests using TsA-12 as antigen, detected antibodies to T. spiralis in experimentally-infected mice as early as 14 days post-inoculation with maximum antibody titers being reached at 28 days post-inoculation. The TsA-12 dscDNA hybridizes to mRNA sequences expressed in both the muscle larvae and adult stages; however, concomitant expression of the native antigen is not observed within adult ES products. Southern blots of homologous and heterologous genomic DNAs probed with 32p-labeled TsA-12 dscDNA fragments verify TsA-12 as a T. spiralis specific sequence that is present in multiple copies within the parasite genome.

Key words: Trichinellosis; Swine; Gene cloning; ES antigen; Parasite diagnosis

Introduction

Trichinellosis, caused by the nematode parasite

Trichinella spiralis is an important zoonotic disease of world wide distribution which results from the ingestion of raw or undercooked meat containing the infective larval stage of the parasite. A variety of serological tests have been developed for detecting trichinellosis in swine, the most recent of which is the enzyme-linked immunosorbent assay (ELISA) [1-3]. Initial ELISA tests were performed with crude extracts of T. spiralis muscle larvae as antigen and resulted in a high number Correspondence address: Dante S. Zarlenga, U.S. Department of Agriculture, ARS, Biosystematic Parasitology laboratory, LPSI, Bldg. 1180, BARC-East, Beltsville, MD 20705, U.S.A. Note: Nucleotide sequence data reported in this paper have been submitted to the GenBankTM data base with the accession number M33386. Abbreviations: ES, excretory-secretory; ELISA, enzyme-linked immunosorbent assay.

of false-positive reactions apparently due to crossreactions with other parasite infections [4-6]. Subsequent replacement of the crude antigen preparation with biochemically purified stichocyte antigens [7], culture-derived ES antigens [8] or antibody affinity-purified ES antigens [9] resulted in elimination of most false-positive reactions. Among the T. spiralis proteins that form the basis of the present ELISA test are the 45-, 49- and 53-kDa ES antigens that collectively account for greater than 50% of the protein mass secreted by in vitro cultivated muscle larvae. These antigens, which can be antibody-affinity purified from muscle larvae culture media [9] and used for immunodiagnosis, have been shown to be immunologically cross-reactive with each other and as such are believed to derive from the same antigen. The cost to produce culture-derived antigens combined with inconsistencies in the quality and amount of ES protein obtained by these procedures are major drawbacks to the application of

0166-6851/90/$03.50 © Elsevier Science Publishers B.V. (Biomedical Division)

166 ELISA testing of swine sera. To obviate these problems, we have endeavored to clone and express the gene(s) which encode the immunodiagnostic ES antigens to determine if a recombinant antigen can be useful for the immunodiagnosis of trichinellosis. Herein we report the construction and immunological screening of a cDNA library from T. spiralis muscle larvae mRNA, the identification of a cDNA clone which codes in part for the 53-kDa ES antigen and the initial characterization of the cDNA fragment and its corresponding fusion protein. Materials and Methods

Parasites. T. spiralis muscle larvae were maintained by serial passage in female Sprague-Dawley rats and recovered 30--40 days post-infection [9]. Adult parasites were obtained from rat intestine 6 days post-inoculation with infective larvae. Newborn larvae were recovered by incubating 6-day adults in modified Dulbecco's media for 24 h followed by selective sieving procedures [10]. Ascaris suum second stage larvae and Trichuris suis adult parasites that were used for extracting genomic DNA were gifts from J. Urban and B. Stewart, respectively. Isolation of parasite DNA and RNA. High molecular weight genomic DNA and total RNA were isolated from T. spiralis muscle larvae, adult parasite and newborn larvae by SDS:proteinase K digestion followed by isopycnic centrifugation in guanidinium isothiocyanate and cesium trittuoroacetate [11]. Poly(A) mRNA was purified by oligo-dT cellulose chromatography [12]. Genomic DNA from A. suum, T. suis and mouse liver was extracted by SDS:proteinase K digestion then treated with DNase-free RNase prior to phenol:chloroform extraction and ethanol precipitation. Construction and immunological screening of the cDNA library. Double-stranded cDNA was synthesized from 10 #g of purified poly(A) mRNA according to the method of Gubler and Hoffman [13] as modified by Watson and Jackson [14] using EcoRI linkers. 10% of the dscDNA was ligated to 1 #g of )~gtl 1 arms and the cDNA li-

brary packaged in vitro [15]. Escherichia coli strain Y1090 was infected with the packaged cDNA library then induced and bound to nitrocellulose with /3-0thiogalactopyranoside (IPTG)-saturated nitrocellulose filter discs according to Young and Davis [15,16]. Filters were removed from the plates after overnight incubation, blocked in immunowash buffer (IWB) (0.15 M sodium chloride, 50 mM Tris, pH 7.8, 0.05% Tween-20, 5% non-fat dried milk) and screened with a 1:200 dilution of serum from a pig experimentally infected with 2500 T. spiralis muscle larvae. Rabbit anti-swine IgG (1.0 #g m1-1) and 125I-labeled goat anti-rabbit IgG (2 × 106 cpm/filter) were used as second and third antibodies, respectively, and positive clones identified by autoradiography. Positive clones were picked and rescreened as described above using rabbit antiserum to parasite ES antigen (diluted 1:200) as primary antibody. Positive plaques were purified and lysogenized into E. coli Y1089 [16,17].

Purification of TsA-12 antigen and preparation of rabbit antisera. Bacterial lysogens were prepared as described [ 17]. Pelleted cells were resuspended in 10 mM MgClz, 50 mM Tris, pH 8.0 containing 25 /zg ml-~ of lysozyme, then incubated on ice for 30 min and frozen. Lysed bacteria were treated with DNAse (5 /zg ml-~), pelleted then washed twice with 10 vols. of phosphate buffered saline (PBS) for 2 h followed by two additional washes with 10 ml of 1.5% n-octyl-/3-D-glucopyranoside (OGP). The final pellet was resuspended in 6 M urea, 10 mM dithiothreitol and agitated overnight to extract the recombinant antigen. Rabbits were immunized subcutaneously on days 1 and 8 with sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) purified recombinant antigen using gel slices emulsified in Freund's incomplete adjuvant. A third immunization was given on day 15 in the ear vein in the absence of adjuvant using fusion protein that had been allowed to diffuse from gel slices for 24-48 h prior to injection. Rabbits were bled 5 days later by heart puncture. Western blot analysis and immunoperoxidase staining. Protein samples (1-10 #g) were electrophoresed on 10% SDS-polyacrylamide gels

167 [18] then either stained with Coomassie Blue or electrophoretically transferred to nitrocellulose [19]. Blots were incubated overnight in IWB with a 1:200 dilution of the appropriate rabbit antiserum followed by peroxidase-labeled goat antirabbit IgG (0.2 #g/ml). Bound enzyme was visualized in H202 and 4-chloro-l-napthol. Immunoperoxidase staining was performed as described [9] on glutaraldehyde fixed tongue tissue prepared from T. spiralis infected mice. Sections were incubated with a 1:1000 dilution of either rabbit anti-TsA-12 or rabbit anti-3galactosidase sera. Slides were processed using the Vectastain ABC immunoperoxidase kit (Vector Laboratories) according to the manufacturer's protocol.

ELISA with TsA-12 fusion protein. Purified TsA12 fusion protein was diluted to 1 #g ml -~ in 0.1 M carbonate buffer (pH 9.6) and bound to microtiter plates. ELISA tests were performed as outlined elsewhere [9] using a l:100 dilution of sera from pigs experimentally infected with A. suum, T. suis or T. spiralis. Bound enzyme was quantitated by the addition of H202 and 2',2'azino-di[3-ethyl-benzthiazoline sulfate]. To determine the kinetics of antibody responses to TsA-12, a group of 25 Swiss-Webster mice were each orally inoculated with 150 T. spiralis muscle larvae. Serum was collected from 5 uninoculated mice on day 0 and from 5 infected mice on days 7, 14, 21, 28, and 35 postinoculation. Collected sera was diluted l: 100 and tested by ELISA using 1 #g ml - l TsA-12 to coat plates. Goat anti-mouse IgG and IgM (1.0 #g ml-1) and peroxidase labeled rabbit anti-goat (0.1 /zg m1-1) were used as second and third antibody reagents, respectively. Isolation of TsA-12 ~ DNA and subcloning of the cDNA insert. Bacteriophage DNA containing the TsA-12 cDNA sequence (designated A TsA 12) was extracted from CsCI gradient purified phage particles obtained from plate lysates [20] of Y1090 bacterial cells. The EcoRI sites of A TsA 12 were not regenerated during library construction as verified by the inability to digest the cloned sequence with EcoRI endonuclease. Consequently, the cDNA insert was excised by di-

gesting A TsA 12 with KpnI and SstI creating a 2.5-kb A:dscDNA hybrid fragment containing the dscDNA insert plus 1 kb of A DNA flanking each side of the dscDNA sequence. The 2.5-kb fragment was subcloned into KpnI:SstI site of pUC 19 DNA and sequenced using SequenaseTM (US Biochemical) and both forward and reverse Agtl 1 primers (New England Biolabs). The subcloned fragment was also radiolabelled by nick translation and used as a probe to identify a homologous cDNA clone according to Grunstein and Hogness [21] from a plasmid library constructed in the PstI site of pUC 9 DNA by G:C tailing [13,20]. A positively hybridizing clone, designated pTsA 12.1, was identified and plasmid DNA isolated [22].

Southern and Northern blot analysis and preparation of DNA probes. Genomic DNA samples (10 #g) for Southern blot analysis were digested with the appropriate enzymes (10 U #g-~ DNA) and separated on 0.8% agarose gels. Total RNA (15/zg) for Northern blots was electrophoresed on 1% formaldehyde gels then washed for 30 min to remove traces of formaldehyde. Separated DNA and RNA were transferred to Nytran filters according to Southern [23] and hybridized overnight to DNA probes prepared by nick translation [24] or random priming [25] using [a- 32p]dCTP. DNA fragments from each end of the pTsA 12.1 cDNA insert were prepared by digesting plasmid DNA successively with HindlII which cuts within the multiple cloning site of pUC 9 and midway within the cDNA sequence, followed by PstI which also digests pUC 9 DNA within the multiple cloning site. The two fragments, designated 3' and 5'-end fragments (relative to the noncoding strand), respectively, were purified from each other and from plasmid DNA by agarose gel electrophoresis then radiolabelled using random primers [25] and used to probe Southern blots of T. spiralis genomic DNA. Results

Primary screening of the cDNA expression library (160-200000 plaques) with immune pig serum resulted in over 50 positive clones. Plaques producing the most intense signals were picked and rescreened with sera from pigs experimen-

168

tally infected with 500 muscle larvae or rabbit antiserum to T. spiralis ES antigens. One clone, designated TsA-12, reacted strongly with all sera and expressed a fusion protein with an apparent molecular mass of 123 kDa as determined by SDS-PAGE. Rabbit antibodies raised against polyacrylamide gel electrophoresis purified TsA-12 were used to screen Western blots of T. spiralis muscle larvae crude worm extract (CWE), total ES protein and monoclonal antibody affinity-purified Ts.49 and Ts.53 antigens. In all cases, rabbit anti-TsA-12 serum reacted exclusively with a doublet in the 53-kDa range as well as with the fusion protein and fl-galactosidase positive controls (Fig. 1). Repeat screenings failed to generate antibody binding to other ES antigens. Normal rabbit sera did not bind to T. spiralis antigens (data not shown). Some reaction was observed when TsA-12 antiserum was used to screen extracts of other stages of T. spiralis; however, antibody binding was not consistent with that observed in muscle larvae ES (Fig. 2). Two weak bands migrating at 60 kDa and 78 kDa were observed in adult parasite extract and a doublet greater than 180 kDa bound antibodies in newborn larval extract. The homology of TsA-12 to the 53-kDa ES antigen was further verified by using rabbit anti-

1

92K 66K

1'

2

2'

3

2

3

11 21

,

200K 116K 92K 66K 45K 31K 21K Fig. 2. Western blot analysis of TsA-12 antisera specificity for antigens in T. spiralis muscle larval, adult or newborn larval extracts. Protein samples were boiled in SDS-sample buffer, separated on a 10% SDS-polyacrylamide gel and visualized with Coomassie blue staining (lanes 1-3) or blotted onto nitrocellulose and screened with rabbit anti-TsA-12 serum (lanes 1'-3'). Lanes 1 and 1', T. spiralis ES protein; lanes 2 and 2', T. spiralis adult extract, and; lanes 3 and 3 ~, T. spiralis newborn larval extract.

serum to affinity-purified antigens Ts.49 and Ts.53 to screen western blots of TsA-12 fusion protein, ES antigen and fl-galactosidase (Fig. 3). This antiserum, which bound to antigens Ts.45, Ts.49 and

3'

4

4'

5

5'

'~ 92K '~ 66K

45K

"~ 4 5 K

31K

~31K

Fig. 1. Western blot analysis of purified TsA-12 fusion protein and T. spiralis antigens using rabbit antiserum to TsA-12 fusion protein. Protein samples were boiled in SDS-sample buffer, separated on a 10% SDS-polyacrylamide gel and visualized by Coomassie Blue staining (lanes 1-5) or blotted to nitrocellulose and screened with rabbit anti-TsA-12 serum (lanes 1'-5'). Lanes 1 and V, purified fl-galactosidase; lanes 2 and 2', TsA-12; lanes 3 and 3', T. spiralis muscle larvae CWE; lanes 4 and 4', T. spiralis muscle larvae ES protein, and; lanes 5 and 5', monoclonal antibody affinity-purified antigens Ts.49 and Ts.53.

169 KD

1

2

3

1'

2'

3'

116 92 66

45

21

Fig. 3. Westem blot analysis of fl-galactosidase (lanes 1,1'), TsA-12 (lanes 2,2') and ES proteins (lanes 3,3') using rabbit

antiserum to monoclonalantibody-purifiedTs.49 and Ts.53 ES antigens. Protein samples were denatured by boiling in SDSsample buffer, separated on a 10% SDS polyacrylamidegel then either stained with CoomassieBlue (lanes 1, 2 and 3) or screened with rabbit anti-Ts.49, Ts.53 serum (lanes lt,2' and 3'). Ts.53 in ES preparations also interacted with the TsA-12 fusion protein. Additional binding was observed with several lower molecular weight bands in the TsA-12 preparation at 48 kDa, 66 kDa and 95 kDa, albeit with less intensity. Antibodies to purified ES antigens did not bind to purified /3galactosidase nor did TsA-12 interact with normal serum controls (data not shown). Rabbit anti-TsA-12 serum was also used to localize the homologous T. spiralis antigen in glutaraldehyde fixed tissue sections by immunoperoxidase staining. Tissue sections from infected mice were screened with either anti-TsA-12 serum or rabbit anti-/3-galactosidase serum as a negative control. Intense staining with TsA-12 antiserum was localized within the stichocyte cells of the muscle larvae only (Fig. 4B). Control antiserum to/~-galactosidase did not stain parasite sections (Fig. 4A). No binding of TsA-12 antiserum was observed with the parasite surface. Sera from pigs experimentally infected with A. suum, T. suis or T. spiralis were used to evaluate the specificity of TsA-12 for T. spiralis infection sera by ELISA. An absorbance ratio greater than 4:1 (0.176:0.039) was obtained for T. spiralis infection serum as compared to normal serum controls (0.039), whereas no absorbance values

Fig.4. Immunoperoxidase staining of T. spiralis muscle larvae from infected mouse tongue. Deparaffinized and hydrated tissue sections were incubated overnight with a 1:1000 dilution of rabbit anti-~-galactosidase serum (A) or rabbit anti-TsA-12 serum (B) then visualized using the Vectastain TM ABC immunoperoxidase staining kit. Arrows indicate regions of the stichocyte where TsA-12 antibody bound antigen.

above normal serum controls were observed with A. suum (0.027) or T. suis (0.037) infection sera. Likewise, ELISA readings using sera from infected pigs to screen purified/3-galactosidase control antigen did not increase above background controls. Studies performed with mice inoculated with T. spiralis muscle larvae demonstrated an antibody response to TsA-12 as early as 14 days postinoculation with antibody titers increasing with time and peaking at 28-35 days post-inoculation (Fig. 5). Results demonstrated an increase in ELISA values over a 28-day period of 3.5 times background controls (pre-bled mice).

170 0.4

0.3

¸

o 0.2 "It

o* ~e~0 . 1 ,¢

0

I 7

I I I 14 21 28 Days After Infection

! 35

Fig. 5. ELISA detection of antibodies to TsA- 12 in mice inoculated with 150 T. spiralis muscle larvae and bled at various times after inoculation. Each time point reflected ELISA readings from 5 infected mice.

A TsA 12 insert DNA was digested with KpnI and SstI which flank the EcoRI site within Agtl 1. This digestion generates a 2,0-kb fragment in wild-type A DNA; however, the excised sequence was 2.5 kb in ATsA 12 indicating the dscDNA insert to be approximately 0.5 kb. Sequence analysis verified the cloned fragment to be 539 bp in length containing both a poly(A) tail and a stop codon (Fig. 6). The open reading frame, however, was only 119 bp in length but corresponded reasonably well with the predicted value from the size of the fusion protein. For ease of manipulation, a homologous cDNA clone (pTsA 12.1) containing a 0.81-kb insert was identified from a plasmid library for use as a probe in Southern and Northern blot analyses. In Southern blots, T. spiralis genomic DNA gave rise to multiple bands when digested with HindlII, PstI, EcoRV, XbaI or EcoRI and a single hybridizing band migrating at 11 kb when digested with Sail (Fig. 7A). On the other hand, the TsA 12.1 dscDNA sequence contained a single recognition site for HindlII only, which occurred mid-

way within the sequence, dscDNA sequences did not contain sites for PstI, EcoRV, XbaI or EcoRI (data not shown). No discernible hybridization was observed with EcoRI-treated A. suum, T. suis or mouse liver DNAs (Fig. 7A). To determine the origin of the multiple bands observed in the T. spiralis genomic DNA, two DNA fragments purified from opposite ends of pTsA 12.1 were used as probes to screen duplicate Southern blots of restriction enzyme digested genomic DNA (Fig. 8A). Blots screened with the 0.41-kb 3'-end (Fig. 8B) and 0.40-kb 5'end (Fig. 8C) generated fragments which were indistinguishable from one another and from those screened with pTsA 12.1 (see Fig. 7) except for the presence of a 2.0-kb band in EcoRV digested DNA screened with the 5~-end fragment. Also, the 5~-end fragment hybridized to three separate bands migrating at 2.2 kb, 4.3 kb and 4.5 kb in HindlII digested DNA whereas the 3'-end fragment hybridized to only one 0.8-kb band indicating that no regions of sequence homology existed between the two probes (Fig. 8B and C, lanes 1). Northern blots of total RNA from muscle larvae, newborn larvae and adult parasite screened with pTsA 12.1 demonstrated a single hybridizing mRNA species migrating at 1.4 kb in muscle larvae RNA (Fig. 7B). No positively hybridizing sequences were observed in RNA from newborn larvae following extended exposure times. A similar, yet slightly faster migrating band was observed in adult total RNA. This small difference in migration between muscle larvae and adult parasite RNA was reproducible in repeat Northern blot analyses. Discussion

The specific diagnosis of trichinellosis relies on the recognition of antigens found in secretory products of the muscle larvae [7,8]. Homologous immunodominant epitopes in these ES products are found on proteins of 45, 49, and 53 kDa (Ts.45, Ts.49, Ts.53). Antigens Ts.49 and Ts.53 have been isolated by antibody affinity chromatography and used for immunodiagnosis [9]. In the present study, we demonstrated that the fusion protein TsA-12 is structurally related to at least one of these proteins, namely antigen Ts.53. Fur-

171

Agtll

|

59

GCTATTTTCAGGAAAAATGGTAAAACTACTGAGGTTCTATCTCTTATAAATGCAAATGAT A I F R K N G K T T E V L S L I N A N D 60 119 TCAATAGAAATCCCGAAGTTTTTGTTACAAATCCAATTCAGAAGCCATTTGGTGATGAAA S I E I P K F L L Q I Q F R S H L V M K 120 TAGATCGTATTTTAAGAAAAGCTTTTGATACCATGGAATTAAGCAATTCTGACAAAGAAG

179

180 ATAAACTTCAAAAGCTGTACAATGCAACAATTAGCACTAAAGTTAAACACAGAGCAACAC

239

240 CGTATGATACGGACGATGCTTACGTAATAACTGAAGTAGCCGGAGTGTTCGATGAAAACA

299

300 AAGAGCACATTGGCAGCATTGATAAATTTCC

359 CAGTGATGGAAACATTCAGATTGGTTGGA

360 AGGAGGCTGATAAATCGGCACTACGTTTAAAGCGCTTTGCAAAGCCC 420 TCCAACATGTTTTTTCAGAAC

419 CCAAAAGGGTTTT

479 TACAGTTGTTGTTC TAAATC CAGCAGAAATTATAGC TTC

480

539

TTTAAGCAATCTATCTATCAGTAAAGTTTTCAAACTGTAAAAAACAAAAAAAAAAAAAAA Fig. 6. DNA sequence and deduced amino acid sequence for TsA-12 which codes, in part, for the 53-kDa T, spiralis ES antigen. Arrow indicates beginning of eDNA clone where the first amino acid utilizes the G residue from Agtl1. The translational stop codon is underlined. ther, rabbit antibodies raised to purified TsA-12 antigen bound to the stichocyte cells, the known source of antigens Ts.45, 49 and 53. Antibodies to T. spiralis can be detected in experimentally infected animals by ELISA using TsA-12 antigen. Serum antibody titers increased in a fashion consistent with studies on antibody titers to ES antigens in pigs [8]. It is generally accepted that while the ES antigens are seen by the host for a short time following the ingestion of muscle larvae, the most pronounced antibody responses are not observed in the host until the newborn larvae have migrated to the muscle tissue and encysted within the muscle cells. This process occurs in as little as 17 days and is generally complete within 35-40 days. The ELISA results

presented here are thus consistent with the kinetics of ES antigen production. Strong cross-reactivity has been observed between T. spiralis antigens from CWE and sera from animals infected with other nematode parasites, most notably T. suis [8], which has a stichosome structure similar to that of T. spiralis. ELISA results indicated that recombinant antigen TsA-12 is unique to T. spiralis by its inability to bind serum antibodies from animals experimentally infected with A. suum or T. suis. The existence of a non-antigenic form of TsA- 12 in T. suis or A. suum is unlikely since no hybridization was observed between pTsA 12.1 and Southern blots of A, suum or T. suis genomic DNAs. Currently, studies are being conducted to assess, by more ex-

172

A 1

2 3 4 5 6

B

789

kb

kb

1

9.49

--

23.1 -

7.46

--

9.4-

4.40

--

6.6-

3.37

--

4.4-

1.35

--

0.24

--

2

3

2.3-2.0-

0.6Fig. 7. Northern and Southern blot analyses of cDNA sequences encoding the 53-kDa ES antigen from T. spiralis muscle larvae. All blots were screened with 32p-labeled pTSA 12.1 insert DNA. (A) 10 #g of total DNA was digested with the appropriate enzyme, separated on a 0.8% agarose gel and transferred to a Nytran membrane. T. spiralis DNA (lanes 1-6) was digested as follows; (1) HindlII; (2) PstI; (3) Sail; (4) EcoRV; (5) Xbal and; (6) EcoRI. DNA from A. suum (lane 7), T. suis (lane 8) and mouse liver (lane 9), were each digested with EcoRI. (B) Total RNA (15 #g) from muscle larvae (lane 1), newborn larvae (lane 2) and adult parasite (lane 3) were separated on a 1% formaldehyde gel then blotted onto Nytran.

tensive testing, the application of TsA-12 antigen in the diagnosis of swine trichinellosis. It has been demonstrated that antigens of 50-55 kDa (homologous to Ts.49 and Ts.53) are secreted from the c~-stichocytes of the muscle larvae whereas antigens of lower molecular weight (48 kDa = Ts.45) are present within the/3-stichocytes located at the anterior portion of the stichosome [26]. It is not clear whether this difference in location within the stichosome stems from a structural distinction between these antigens or reflects a common precursor protein that undergoes differential post-translational processing within the various regions of the stichosome. If commonly derived, the inability of TsA- 12 antibodies to bind Ts.45 or Ts.49 may result from the cloning of a truncated cDNA transcript (119-bp open reading

frame) that does not represent the 5'-region of the mRNA (1.4 kb) causing initiation of translation within the TsA 12 gene to occur downstream relative to the translation start site of the native protein. This may indeed be the case given the relatively small size of the open reading frame within TsA-12. This would further suggest either that the region of Ts.53 that binds TsA-12 antibodies is processed out in Ts.45 and Ts.49 or that Ts.45 and Ts.49 are by-products of Ts.53 metabolism. Multiple bands observed in Southern blots of T. spiralis genomic DNA indicate that more than one copy of the TsA-12 gene is present within the genome. These results do not preclude the existence of introns; however, a difference in the hybridization patterns of the 3' and 5'-end fragments of pTsA 12.1 to the multiple genomic bands

173

A 3'

Hind III ,, J

0 . 4 0 kb

I

I

pUC 9 -

Pst I

Hind III 0.41 kb

I

I

5'-end fragment

3'-end fragment

[

pTsA

12.1

C

B 1

2

3

4

, oUC 9

5

6

1

2

3

4

5

6

kb

-

23.1

-

-

9.4

-

-

6.6

-

-

4.4

-

-

2.3 2.0

-

-

0.6

-

-

probe: 3'-end

fragment

probe: 5'-end

fragment

Fig. 8. Southern blot analysis of eDNA sequences encoding the 53-kDa ES antigen using purified fragments of pTsA 12.1 as probes. (A) Fragments of pTsA 12.1 were separated from plasmid DNA by successive digestions with HindlII and PstI followed by agarose gel eleetrophoresis of the respective fragment after each digestion. Both fragments were radiolabelled and used-to screen Southern blots of T. spiralis genomic DNA. (B and C) T. spiralis DNA (10 #g) was digested with the appropriate enzyme, separated on 0.8% agarose then transferred to Nytran membranes and screened with the Y-end fragment (B) or the 5'-end fragment (C) of pTsA 12.1. Genomic DNA was digested as follows: (1) HindlII; (2) PstI; (3) Sail; (4) EcoRV; (5) XbaI; and (6) EcoRI.

would have been observed if introns were the only contributing factor. A single hybridizing band in Sa/I-digested DNA further demonstrates that these genes are likely to be located on the same chromosome and within 11 kb of one another. With the existence of multiple copies of the gene encoding TsA-12, the possibility cannot be

ruled out that these genes are not 100% homologous. Ts.45, Ts.49 and Ts.53, though antigenically related, may be synthesized from these different genes and it is the difference in primary structure that results in the absence of binding TsA- 12 antibodies to Ts.45 and Ts.49. Southern blots clearly show that sequence homology exists between the TsA-12 genes; however, single base changes or deletions within a multiple gene family can result in the translation of antigens which are only partially homologous with respect to antibody binding as is the case with antigens Ts.45, Ts.49 and Ts.53. Results from Northern blots indicate that TsA12 mRNA sequences are transcribed in both the muscle larvae and adult stages of the parasite whereas Western blots demonstrate that the antigenic determinant on the 53-kDa muscle larval antigen or possibly the 53-kDa antigen itself, is not produced during the adult stage. One explanation for this discrepancy is that the mRNA is not translated in the adult stage of the parasite; however, the multiple genes may alternatively encode antigenically distinct Ts.53 proteins that are differentially expressed during the various stages of the T. spiralis life cycle. The slight, but reproducible difference in migration between TsA-12 mRNA sequences from muscle larvae (1.4 kb) and adult parasite (1.3 kb) are consistent with this hypothesis. Because of the strong immune response that is generated against the ES antigens, the synthesis of a functional, non-antigenic form of the protein may be required during the early part of the infection process (adult stage) to allow the parasite to establish itself within the host prior to eliciting such a response. The intensity and rapid development of the immune response to the ES antigens has been demonstrated by the expulsion of the parasite after ingestion by previously infected animals [27]. At present, studies are in progress to clone and characterize genomic sequences corresponding to TsA-12 in order to better understand the association between the multiple gene copies and ES antigen production within T. spiralis as well as assess the genetic relationship between the immunodominant ES antigens.

174

References 1 Ruitenberg, E.J., Steerenberg, P.A., Brosi, J.M. and Buys, J. (1974) Serodiagnosis of Trichinella spiralis infections in pigs by enzyme-linked immunosorbant assays. Bull. WHO 51, 108-109. 2 Ruitenberg, E.J. and Van Knapen, F. (I977) Enzymelinked immunosorbant assay (ELISA) as a diagnostic method for Trichinella spiralis infections in pigs. Vet. Parasitol. 3, 317-326. 3 Kagan, I.G. (1976) Serodiagnosis of trichinosis. In: Immunology of Parasitic Infections (Cohen, S. and Sadum, E.H., eds.), pp. 143-151, Blackwell, London. 4 Clinard, E.H. (1979) Serum fractions associated with positive and false positive reactions in the ELA test for trichinellosis in swine. In: Proceedings, 4 ~ Int. Conf. Trichinellosis, (Kim, C.W. and Pawlowski, Z.S., eds.), pp. 507-517, University Press of New England, Hanover, NH. 5 Clinard, E.H. (1979) Identification and distribution of swine serum immunoglobulins that react with Trichinella spiralis antigens and may interfere with the enzymelabeled antibody test for trichinosis. Am. J. Vet. Res. 40, 1558-1563. 6 Taylor, S.M., Kenny, J., Mallon, T. and Davidson, W.B. (1980) The micro-ELISA for antibodies to Trichinella spiralis: elimination of false positive reactions by antigen fractionation and technical improvements. Zentralbl. Veterin~irrned. 27, 764-772. 7 Seawright, G.L., Zimmerman, W.J., Isenstein, R.A. and Despommier, D.D. (1983) Enzyme immunoassay for swine trichinellosis using antigens purified by immunoaffinity chromatography. Am. J. Trop. Med. Hyg. 32, 1275-1284. 8 Gamble, H.R., Anderson, W.R., Graham, C.E. and Murrell, K.D. (1983) Diagnosis of swine trichinosis by enzyme-linked immunosorbant assay (ELISA) using an excretory-secretory antigen. Vet. Parasitol. 13,349-361. 9 Gamble, H.R. and Graham, C.E. (1984) Monoclonal antibody-purified antigen for immunodiagnosis of trichinosis. Am. J. Vet. Res. 46, 67-74. 10 Marti, H.P. and Murrell, K.D. (1986) Trichinella spiralis anti-fecundity and anti-newborn larvae immunity in swine. Exp. Parasitol. 62, 370-375. 11 Zarlenga, D.S. and Gamble, H.R. (1987) Simultaneous isolation of preparative amounts of RNA and DNA from Trichinella spiralis by cesium trifluoroacetate isopycnic centrifugation. Anal. Biochem. 162, 569-574. 12 Aviv, H. and Leder, P. (1972) Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose. Proc. Natl. Acad. Sci. USA 69, 1408-1412.

13 Gubler, U. and Hoffman, B.J. (1983) A simple and very efficient method for generating cDNA libraries. Gene 25, 263-269. 14 Watson, C.J. and Jackson, J.F. (1985) An alternative procedure for the synthesis of double-stranded cDNA for cloning in phage and plasmid vectors. In: DNA Cloning, Vol I, (Glover, D.M., ed.), pp. 79-88, IRL Press, Oxford. 15 Young. R.A. and Davis, R.W. (1983) Yeast RNA polymerase II genes: isolation with antibody probes. Science 222, 778-782. 16 Young, R.A. and Davis, R.W. (1983) Efficient isolation of genes by using antibody probes. Proc. Natl. Acad. Sci. USA 80, 1194-1198. 17 Huynh, T.V., Young, R.A. and Davis, R.W. (1985) Constructing and screening cDNA libraries in Agtl0 and Agtl 1. In: DNA Cloning, Vol I, (Glover, D.M., ed.), pp. 49-78, IRL Press, Oxford. 18 Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680--685. 19 Towbin, H., Staehelin, T. and Gordin, J. (1979) Electrophoretic transfer of protein from polyacrylamide gels to nitrocellulose sheets; procedures and some applications. Proc. Natl. Acad. Sci. USA 76, 4350-4354. 20 Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 21 Grunstein, M. and Hogness, D. (1975) Colony hybridization: a method for isolation of cloned DNAs that contain a specific gene. Proc. Natl. Acad. Sci. USA 72, 3961-3965. 22 Sadhu, C. and Gedamu, L. (1988) A procedure for the preparation of RNA free plasmid DNA. Biotechniques 6, 20-21. 23 Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-577. 24 Rigby, P.W.J., Diekman, M., Rhodes, C. and Berg, P. (1977) Labeling deoxyribonucleic acids to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 113, 237-251. 25 Feinberg, A.P. and Vogelstein, B. (1983) A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13 26 Silberstein, D.S. and Despommier, D.D. (1984) Antigens from Trichinella spiralis that induce a protective response in the mouse. J. Immunol. 132, 898-904. 27 Appleton, J.A., Schain, L.R. and McGregor, D.D. (1988) Rapid expulsion of Trichinella spiralis in suckling rats: mediation by monoclonal antibodies. Immunology 65, 487-492.