Volatile 27t*, mt!~ber I, 127 -130 FI'.'I~S 0~321 I~,~,q i,¢der~lio~ of l!uropcat~ llioehclui¢.d S~¢i¢ti¢~ tXII.|5%L1'~1 $L50 ,4 DtLVIS tXJ1457,~J~ l troo)7 I!
Jat tuary I ¢.~91
Molecular cloning and sequence analysis of the cDNA encoding the human acrosin-trypsin inhibitor (HUSI-II) Annemarie M6ritz t. H a n s Lilja 2 a n d Edwin Fink t t lhv~¢u'tmt'n t of Clinical Clwmistry amlCIinical Biochemistry, University o.fMunieh, Nusslmumstrafle 20, D.,~¢O00Afnnidl 2, Germany arid "~D~y~artment ql'C'linical Chemistrt', University o f Land, Malmii General tIospital. S.21401 Afalm6, Sa'edeH Received 12 November 1990 A complete eDNA clone encodinl~ tile human a~.'rosin.trypsin inhibitor IIUSI-II has been i~olated from a eDNA library of human testis and com. pletcly sequenced. The eDNA el, 594 bp contained an open reading frame of 252 base pairs, The deduced amino acid sequence comprised the colnplete mlfiao acid sequence of rlUSI-II [I] and a putative sig,nal Ixptide, Northern blotting antdysi~ revealed that IlUSI-II is synthesit.¢d in testis, epididymis and seminal vesicle, but not ill the prostate gland. Kazld.tyl~ inhibitor; Acrosin.trypsin inhibitor (human seminal plasma): Pancreatic secretory trypsin inhibitor (hualan)
1, I N T R O D U C T I O N The acrosin.trypsin inhibitor HUSI-II of human s e m i n a l p l a s m a [1] b e l o n g s t ° t h e f a m i l y o f K a z a l - t y p e s e r i n e p r o t e i n a s e i n h i b i t o r s [2,3]. T h e p h y s i o l o g i c a l f u n c t i o n o f H U S I - I I is believed to b e the b l o c k i n g o f deleterious degradation of proteins by aerosin released f r o m s p e r m a t o z o a . T h e a m i n o acid s e q u e n c e o f H U S I II w a s e l u c i d a t e d r e c e n t l y [1], b u t n o t h i n g was k n o w n o n t h e p r e c u r s o r f o r m o f H U S I - I I , o n the o r g a n i s a t i o n o f its gene a n d on the r e g u l a t i o n o f its p r o d u c t i o n , In t h e course o f o u r s t u d i e s o n these a s p e c t s o f H U S I - I I a n d o t h e r K a z a l - t y p e i n h i b i t o r s we i s o l a t e d a n d characterized the eDNA of HUSI-II. 2. M A T E R I A L S
AND METHODS
Restriction and modification enzymes were from Gibco/BRL or Boehringer. 3ap. or '~S-labeled dATP, dCTP and ATP were from Amersham, Nylon filters were purchased from Pall, nitrocellulose filters from Schleicher and Schuell. Oli8onucleotides used for screening and sequencing were synthesized on a Pharmacia Gene Assembler, All methods employed were according to [4] or to the instructions of the kit manufacturers,
2.2. Sequence analysis Both strands of eDNA subclones in pTZI9R were completely ~cqneuced by tile ditleoxy chain termination method using doublestranded DNA and a T7 polymerase sequencing kit (Pharmacia), Sequence data were analyzed using tile MicroGenie sequence analysis program, version 5.0 (Beckman). 2,3 Northern blot analysis Ri~adonfiy primed ~-~P-labelcdfull-length or partial eDNA was used to probe Northern blots oq nylon membrane of RNA from human prostate, seminal vesicle, epidydimis and testis, For size estimation of the transcript, RNA markers from Gibco/BRL were used, 2,4. GetAomic Southern blot analysis Genomic DNA from human placenta (20 i~g) was restricted with EcoRI or Hindlll, electrophoresed through 0,80/0 Agarose/TAE gels and blotted on nylon membranes, The blots were hybridized with the '~'P-labeled insert of the full-length eDNA clone; 3. R E S U L T S
AND DISCUSSION
Corecspor~denee a#dress: E. Fink, Department of Clinical Chemistry and Clinical Biochemistry, University of Munich, Nassbaumstr.~6'e 20, D.8000 Munich 2, Germany
A 6 8 - m e t o l i g o n u c l e o t i d e o f the a n t i s e n s e s e q u e n c e c o r r e s p o n d i n g to a m i n o acids + 2 2 t o + 4 6 o f t h e H U S I - I I ([1],Fig. 1) w a s d e s i g n e d f o l l o w i n g t h e s u g g e s t i o n s o f L a t h e [6] ( 5 ' A T T T T C A T G C A C A G G G T G C ACTCGTTGGCATAGGTGGACATGTCAGAGCCACACACAGGATTGAAGTG3'). When a human s e m i n a l vesicle e D N A l i b r a r y in L a m b d a g t l l w a s s c r e e n e d t w i c e using this p r o b e , o n l y a single, inc o m p l e t e e D N A clone c o u l d be i s o l a t e d w h i c h c o n t a i n ed a n i n s e r t ( S V i ) c o r r e s p o n d i n g t o n u d e o t i d e s 225 t o 594 in F i g . 1. By s u b s e q u e n t N o r t h e r n b l o t a n a l y s i s o f R N A f r o m h u m a n p r o s t a t e , testis, s e m i n a l vesicle a n d e p i d y d i m i s u s i n g SV1 as a p r o b e ( F i g . 2) t h e s t r o n g e s t h y b r i d i z a t i o n s i g n a l w a s o b t a i n e d w i t h p o l y A + - R N A o f testis ind i c a t i n g t h a t H U S I - I I m R N A is m o s t a b u n d a n t in t h i s o r g a n . T h e r e f o r e , a h u m a n testis e D N A l i b r a r y w a s
Published by Elsevier Science Publishers B.V. (Biomedical Division)
127
2,1. Screening of eDNA libraries A eDNA library of human seminal vesicle mRNA in Lambda gtl 1 [5] was screened with a Y-labeled 68-met oligonu¢leotide deduced from the amino acid sequence of HUSI-II [11. One positive clone could be isolated, its insert was subcloned into the EcoRl site of pTZIPR (Pharmacia, Freiburg). The randomly primed (kit from Boehringer, Mannheim) ~2P-labeled eDNA-insert of the seminal vesicle clone was used to screen a testis eDNA library (Genofit, HeidelberD, 11 positive clones were isolated and subcloned as above.
ATC T
AGG d
GAA GOT L Q
GOT Go
AAT El
CCC 8;
AAA CGC CM K I\ Q
CAT II
ART N
ATT fi
MA X
ACT T
‘ITI 1.:
ATC 2
C’PC I,
ATC ATT! CGA $j I n
AAT N ‘;+ (d
CC,T Tc,C P s*!
391 36lJ
CCTTT%TCTCTTTTCCTGTGTTTCTTTACATTTaTG~AGGTATG ‘Wl’GAA’l’ATCA
459 379 QMTCCTTGTTTCTTGGCTTTTGCTC
CTGGRGTTAAGC’lPTACTGCCCAGG~GACTTGTGCATTGCTTTATTTAGTTGA~~,~~~~TCAGCATT
I. Aligmc~~l
a 00
TnGAGCAGTTTACAGNAGA~QATGGAGAQACCACCT~CACTGGCAGACTA~~~~RaTTGGATTTCC GhACCAAC(I’~T’DTGAhr*\TCCCA’1’CAGGTChCCGCChGGCCTGAC1’GCCC’~PA’P’~CT’~G~nRTG’~A
GAAGAC?AGCCATGTGTAGTGATGGATARTTTAARGANUVIRR
[I
‘I’GA
527 591
of Ills cI>NA :uid amino ncitl sequ~ccs of I-IlJSl-II with lh~sc of the IItIItliIII l)iIIICrCCItiC scorctory trypsin inhibitor (EIPSTI, signnls ere irridrrlincd. ;I madificd, non-furiciional ~~Ol~i~d~ll~li~li~~llsignal in I~IUSI-II is prinicd in lowmxsc Icttcrs; anihn ncitls whisli arc itlcniical in mnlurc HUSI-II and moturc IWSTI arc shaded.
I, Id]). I’olyetlcllylntioll
screened with insert SVl as a probe. Eleven positive clones could be isolated. Two of these had i&mica1 cDNA inserts with an overall length of 594 bp, This length is in gooci agreement with the mRNA size of about 0.4 kb estimated by the Northern hybridization (Fig. 2), indicating that the cDNA clone is of full length. Besides these 2 full length clones 7 additional cDNA clones were characteriaed. The inserts of 4 clones were incomplete and 3 clones contained inserts with additional (intron) sequences, obviously representing insompletely sylisecl species of HUSI-II transcripts. The same phenomenon has been reported for cDNA qw.%.s of the bovine pancreatic trypsin inhibitor IS]. The ciedused amino acid sequence is presented in Fig. 1. The sequence I- 1 to + 61 is identisal with the I-WSIII amino acid sequence published recently [l]. In addition, the deducecl sequence reveals a putative signal peptide, -f iG -23 in Fig, 1. According to the statistical evaluation by Heijne [S) of known signal peptidase cleavage sites the cIeavage between - 1 and I- 1. (1Fig.l) has a relatively low probability. However, for 128
two reasons wc propose this cleavage site: (i) when WUSI-II is isolated from seminal plasma, multiple, partly proteolysed forms are obtained and the longest form ever characterized starts at glutamine + 1 [ 11; (ii) in all known genomic structures of Kazal-type proteinase inhibitors the first intron is localized within the signal peptide 14 nucleotides upstream of the codon of the N-terminal amino acid of the mature protein [9-12). According to our preliminary analysis of the MUSI-II gene (unpublished data) the first intron is between nucleotides 123 and I.24 which is 14 bases upstream of the suggested signal peptidasc cleavage site. Tl8 cBNA sequence al50 contained a 68 bp 5’ noncoding sequence and a 274 bp 3 ’ untranslated region with a canonical polyadenylation signal (AATAAA; [13]) 15 nuclcotides upstream ofthe 3’-end of the clone. A sequence GATAAA (lowercase letters in Fig. 1) similar to the polyadenylation signal is found 53 bases downstream of the stop codon. In the human pancreatic secretory trypsin inhibitor gene, the functional polyadenylation signal is localized in nearly that same distance from the stop codon (Fig. I, [l I]).
9.1
Fig. 2. Northern bin! hvbridization
of RNA from human nrostn~c
The results of genomic Southern blot analysis using the full-length cDNA clone as a probe, arc shown in Fig. 3. &SRI cleaved human genomic DNA gave rise to two bands of 8.8 and 6.8 kb, whereas ElirzdIlI cleavage of the DNA yielded bands of 9.1 and 4.2 kb. The same hybridization experiment done with the partial cDNA clone SVl results in hybridization of the smaller fragments only, indicating that the 8.8 and 9.1 fragments contain those parts of the gene upstream of the sequence of SYl. The results suggest that I-IIJSI-II is encc3ded by a single gene. The amino acid sequence of MIJSI-II deduced from the cDNA sequence revealed the presence of a typical signal sequence thus clearly identifying the inhibitor as a secretory protein. The Northern blot analysis demonstrated that the polypeptide is synthesized in testis, epididymis and seminal vesicles, but not in prostate gland. This result is fully consistent with data obtained by radioimmunoassay studies on the presence sf immunoreactive I-IIJSI-II in various tissues (unpublished). More extended studies on expression and localization of MIJSI-II in various tissues are part of our cur-
rent investigations I-IIJSI-II.
on
the
biological
function
of
Acknowledgements: This work was supported by the Sondcrforschungsbcreich 207 of the University of Muni~:lt.
REFERENCES (11Fink, E., Hehlcin-Fink, E. and Eulitz, M. (1990) FEHS Lett. 270, 222-224.
El Laskowski,Jr., M. and I&to, I. (1980)Annu. Rev. Biochern. 49, 593-626. 131 Laskowski,Jr.,
M. (1986) in: Nutritional and Toxicological Significance of Enzyme Inhibitors in Foods (Friedman, M. ed.) Plenum, New York, pp, 1-19. [41 Sambrook, .I., Fritsch, E.F. and Mania&, T. (1989) Molecular Cloning - A Laboratory Manual, Cold Spring Harbor press, New York [51 Lilja, H., Abrabamsson, P.-h. and Lundwall, A. (1989) J. Biol. Chem. 264, 1894-1900. [61 Lathe, R. (1985) J. Mol. Biol. 183, I-12. c71 Creighton, TX. and Charles, LG. (1987) J. Mol. Biol. 194, 1 l-22.
I%9
Vohilll~ 2"lfi, illllnb~r I
I~t]ItS I . E I ' T [ ( i t S
1111 Voil I lci,jn~, (;, (l~l~16t Nlicl~ic A~id~ It¢~, 1.1, .lt~ltJ,..tf~tl:l,
Jailiial'7 1991
~lfl~ffa, K, ll~)i~5 ') l~io~h~Im lli~ph~, 14~, (Ymm~m~, l,|~J.
I'~1 $1etli, J,P,, (-~llllCfllll, ,I,1".. I~ri~lo, 1~,i MCalll+ A.l,t, :ii/d (]',~lall~', lt.W, II~tll0i C¢11 ~i, ~1.6t~?, Illi~kllby, (-',~,, I~alO, I., Kohl', W,J,, l,a~kow~ki,Jr., kt.. T~ai, M.,J. liild O'M;lll¢% II,W, t1~)117).1, 11iol, Ch¢lt, 262, 5899-~!)07, fill Horii, A., Kobaya~hi, T., Tomiia, N , Yamamolo, T,, Fuki~lligc, S.. Mlii'ol~u, i+., ()ga~':t M,, Mori. T. alld Mal.
II01 ~cm~, ~i,l,,
130
I) ~] Tan, T., (,iiPlmcr,{'. m~d l~'illk.I!. (1!t~,~) lli~l,Chore, lloppv. Styler 3(foLidf~ol, 'I',].(I~)~14)l'rcnd~ (.;¢II¢I,.I, 2.1)-2.1~, I141 II111'I+II,I),C',, Sh:ipanka, llt. and Greene, l,,J, (1977) ,+%l'+lh l]io+h+m, l+iophy,~. 17,~, i8'~,, I!)').
Jat tuary I ¢.~91
Molecular cloning and sequence analysis of the cDNA encoding the human acrosin-trypsin inhibitor (HUSI-II) Annemarie M6ritz t. H a n s Lilja 2 a n d Edwin Fink t t lhv~¢u'tmt'n t of Clinical Clwmistry amlCIinical Biochemistry, University o.fMunieh, Nusslmumstrafle 20, D.,~¢O00Afnnidl 2, Germany arid "~D~y~artment ql'C'linical Chemistrt', University o f Land, Malmii General tIospital. S.21401 Afalm6, Sa'edeH Received 12 November 1990 A complete eDNA clone encodinl~ tile human a~.'rosin.trypsin inhibitor IIUSI-II has been i~olated from a eDNA library of human testis and com. pletcly sequenced. The eDNA el, 594 bp contained an open reading frame of 252 base pairs, The deduced amino acid sequence comprised the colnplete mlfiao acid sequence of rlUSI-II [I] and a putative sig,nal Ixptide, Northern blotting antdysi~ revealed that IlUSI-II is synthesit.¢d in testis, epididymis and seminal vesicle, but not ill the prostate gland. Kazld.tyl~ inhibitor; Acrosin.trypsin inhibitor (human seminal plasma): Pancreatic secretory trypsin inhibitor (hualan)
1, I N T R O D U C T I O N The acrosin.trypsin inhibitor HUSI-II of human s e m i n a l p l a s m a [1] b e l o n g s t ° t h e f a m i l y o f K a z a l - t y p e s e r i n e p r o t e i n a s e i n h i b i t o r s [2,3]. T h e p h y s i o l o g i c a l f u n c t i o n o f H U S I - I I is believed to b e the b l o c k i n g o f deleterious degradation of proteins by aerosin released f r o m s p e r m a t o z o a . T h e a m i n o acid s e q u e n c e o f H U S I II w a s e l u c i d a t e d r e c e n t l y [1], b u t n o t h i n g was k n o w n o n t h e p r e c u r s o r f o r m o f H U S I - I I , o n the o r g a n i s a t i o n o f its gene a n d on the r e g u l a t i o n o f its p r o d u c t i o n , In t h e course o f o u r s t u d i e s o n these a s p e c t s o f H U S I - I I a n d o t h e r K a z a l - t y p e i n h i b i t o r s we i s o l a t e d a n d characterized the eDNA of HUSI-II. 2. M A T E R I A L S
AND METHODS
Restriction and modification enzymes were from Gibco/BRL or Boehringer. 3ap. or '~S-labeled dATP, dCTP and ATP were from Amersham, Nylon filters were purchased from Pall, nitrocellulose filters from Schleicher and Schuell. Oli8onucleotides used for screening and sequencing were synthesized on a Pharmacia Gene Assembler, All methods employed were according to [4] or to the instructions of the kit manufacturers,
2.2. Sequence analysis Both strands of eDNA subclones in pTZI9R were completely ~cqneuced by tile ditleoxy chain termination method using doublestranded DNA and a T7 polymerase sequencing kit (Pharmacia), Sequence data were analyzed using tile MicroGenie sequence analysis program, version 5.0 (Beckman). 2,3 Northern blot analysis Ri~adonfiy primed ~-~P-labelcdfull-length or partial eDNA was used to probe Northern blots oq nylon membrane of RNA from human prostate, seminal vesicle, epidydimis and testis, For size estimation of the transcript, RNA markers from Gibco/BRL were used, 2,4. GetAomic Southern blot analysis Genomic DNA from human placenta (20 i~g) was restricted with EcoRI or Hindlll, electrophoresed through 0,80/0 Agarose/TAE gels and blotted on nylon membranes, The blots were hybridized with the '~'P-labeled insert of the full-length eDNA clone; 3. R E S U L T S
AND DISCUSSION
Corecspor~denee a#dress: E. Fink, Department of Clinical Chemistry and Clinical Biochemistry, University of Munich, Nassbaumstr.~6'e 20, D.8000 Munich 2, Germany
A 6 8 - m e t o l i g o n u c l e o t i d e o f the a n t i s e n s e s e q u e n c e c o r r e s p o n d i n g to a m i n o acids + 2 2 t o + 4 6 o f t h e H U S I - I I ([1],Fig. 1) w a s d e s i g n e d f o l l o w i n g t h e s u g g e s t i o n s o f L a t h e [6] ( 5 ' A T T T T C A T G C A C A G G G T G C ACTCGTTGGCATAGGTGGACATGTCAGAGCCACACACAGGATTGAAGTG3'). When a human s e m i n a l vesicle e D N A l i b r a r y in L a m b d a g t l l w a s s c r e e n e d t w i c e using this p r o b e , o n l y a single, inc o m p l e t e e D N A clone c o u l d be i s o l a t e d w h i c h c o n t a i n ed a n i n s e r t ( S V i ) c o r r e s p o n d i n g t o n u d e o t i d e s 225 t o 594 in F i g . 1. By s u b s e q u e n t N o r t h e r n b l o t a n a l y s i s o f R N A f r o m h u m a n p r o s t a t e , testis, s e m i n a l vesicle a n d e p i d y d i m i s u s i n g SV1 as a p r o b e ( F i g . 2) t h e s t r o n g e s t h y b r i d i z a t i o n s i g n a l w a s o b t a i n e d w i t h p o l y A + - R N A o f testis ind i c a t i n g t h a t H U S I - I I m R N A is m o s t a b u n d a n t in t h i s o r g a n . T h e r e f o r e , a h u m a n testis e D N A l i b r a r y w a s
Published by Elsevier Science Publishers B.V. (Biomedical Division)
127
2,1. Screening of eDNA libraries A eDNA library of human seminal vesicle mRNA in Lambda gtl 1 [5] was screened with a Y-labeled 68-met oligonu¢leotide deduced from the amino acid sequence of HUSI-II [11. One positive clone could be isolated, its insert was subcloned into the EcoRl site of pTZIPR (Pharmacia, Freiburg). The randomly primed (kit from Boehringer, Mannheim) ~2P-labeled eDNA-insert of the seminal vesicle clone was used to screen a testis eDNA library (Genofit, HeidelberD, 11 positive clones were isolated and subcloned as above.
ATC T
AGG d
GAA GOT L Q
GOT Go
AAT El
CCC 8;
AAA CGC CM K I\ Q
CAT II
ART N
ATT fi
MA X
ACT T
‘ITI 1.:
ATC 2
C’PC I,
ATC ATT! CGA $j I n
AAT N ‘;+ (d
CC,T Tc,C P s*!
391 36lJ
CCTTT%TCTCTTTTCCTGTGTTTCTTTACATTTaTG~AGGTATG ‘Wl’GAA’l’ATCA
459 379 QMTCCTTGTTTCTTGGCTTTTGCTC
CTGGRGTTAAGC’lPTACTGCCCAGG~GACTTGTGCATTGCTTTATTTAGTTGA~~,~~~~TCAGCATT
I. Aligmc~~l
a 00
TnGAGCAGTTTACAGNAGA~QATGGAGAQACCACCT~CACTGGCAGACTA~~~~RaTTGGATTTCC GhACCAAC(I’~T’DTGAhr*\TCCCA’1’CAGGTChCCGCChGGCCTGAC1’GCCC’~PA’P’~CT’~G~nRTG’~A
GAAGAC?AGCCATGTGTAGTGATGGATARTTTAARGANUVIRR
[I
‘I’GA
527 591
of Ills cI>NA :uid amino ncitl sequ~ccs of I-IlJSl-II with lh~sc of the IItIItliIII l)iIIICrCCItiC scorctory trypsin inhibitor (EIPSTI, signnls ere irridrrlincd. ;I madificd, non-furiciional ~~Ol~i~d~ll~li~li~~llsignal in I~IUSI-II is prinicd in lowmxsc Icttcrs; anihn ncitls whisli arc itlcniical in mnlurc HUSI-II and moturc IWSTI arc shaded.
I, Id]). I’olyetlcllylntioll
screened with insert SVl as a probe. Eleven positive clones could be isolated. Two of these had i&mica1 cDNA inserts with an overall length of 594 bp, This length is in gooci agreement with the mRNA size of about 0.4 kb estimated by the Northern hybridization (Fig. 2), indicating that the cDNA clone is of full length. Besides these 2 full length clones 7 additional cDNA clones were characteriaed. The inserts of 4 clones were incomplete and 3 clones contained inserts with additional (intron) sequences, obviously representing insompletely sylisecl species of HUSI-II transcripts. The same phenomenon has been reported for cDNA qw.%.s of the bovine pancreatic trypsin inhibitor IS]. The ciedused amino acid sequence is presented in Fig. 1. The sequence I- 1 to + 61 is identisal with the I-WSIII amino acid sequence published recently [l]. In addition, the deducecl sequence reveals a putative signal peptide, -f iG -23 in Fig, 1. According to the statistical evaluation by Heijne [S) of known signal peptidase cleavage sites the cIeavage between - 1 and I- 1. (1Fig.l) has a relatively low probability. However, for 128
two reasons wc propose this cleavage site: (i) when WUSI-II is isolated from seminal plasma, multiple, partly proteolysed forms are obtained and the longest form ever characterized starts at glutamine + 1 [ 11; (ii) in all known genomic structures of Kazal-type proteinase inhibitors the first intron is localized within the signal peptide 14 nucleotides upstream of the codon of the N-terminal amino acid of the mature protein [9-12). According to our preliminary analysis of the MUSI-II gene (unpublished data) the first intron is between nucleotides 123 and I.24 which is 14 bases upstream of the suggested signal peptidasc cleavage site. Tl8 cBNA sequence al50 contained a 68 bp 5’ noncoding sequence and a 274 bp 3 ’ untranslated region with a canonical polyadenylation signal (AATAAA; [13]) 15 nuclcotides upstream ofthe 3’-end of the clone. A sequence GATAAA (lowercase letters in Fig. 1) similar to the polyadenylation signal is found 53 bases downstream of the stop codon. In the human pancreatic secretory trypsin inhibitor gene, the functional polyadenylation signal is localized in nearly that same distance from the stop codon (Fig. I, [l I]).
9.1
Fig. 2. Northern bin! hvbridization
of RNA from human nrostn~c
The results of genomic Southern blot analysis using the full-length cDNA clone as a probe, arc shown in Fig. 3. &SRI cleaved human genomic DNA gave rise to two bands of 8.8 and 6.8 kb, whereas ElirzdIlI cleavage of the DNA yielded bands of 9.1 and 4.2 kb. The same hybridization experiment done with the partial cDNA clone SVl results in hybridization of the smaller fragments only, indicating that the 8.8 and 9.1 fragments contain those parts of the gene upstream of the sequence of SYl. The results suggest that I-IIJSI-II is encc3ded by a single gene. The amino acid sequence of MIJSI-II deduced from the cDNA sequence revealed the presence of a typical signal sequence thus clearly identifying the inhibitor as a secretory protein. The Northern blot analysis demonstrated that the polypeptide is synthesized in testis, epididymis and seminal vesicles, but not in prostate gland. This result is fully consistent with data obtained by radioimmunoassay studies on the presence sf immunoreactive I-IIJSI-II in various tissues (unpublished). More extended studies on expression and localization of MIJSI-II in various tissues are part of our cur-
rent investigations I-IIJSI-II.
on
the
biological
function
of
Acknowledgements: This work was supported by the Sondcrforschungsbcreich 207 of the University of Muni~:lt.
REFERENCES (11Fink, E., Hehlcin-Fink, E. and Eulitz, M. (1990) FEHS Lett. 270, 222-224.
El Laskowski,Jr., M. and I&to, I. (1980)Annu. Rev. Biochern. 49, 593-626. 131 Laskowski,Jr.,
M. (1986) in: Nutritional and Toxicological Significance of Enzyme Inhibitors in Foods (Friedman, M. ed.) Plenum, New York, pp, 1-19. [41 Sambrook, .I., Fritsch, E.F. and Mania&, T. (1989) Molecular Cloning - A Laboratory Manual, Cold Spring Harbor press, New York [51 Lilja, H., Abrabamsson, P.-h. and Lundwall, A. (1989) J. Biol. Chem. 264, 1894-1900. [61 Lathe, R. (1985) J. Mol. Biol. 183, I-12. c71 Creighton, TX. and Charles, LG. (1987) J. Mol. Biol. 194, 1 l-22.
I%9
Vohilll~ 2"lfi, illllnb~r I
I~t]ItS I . E I ' T [ ( i t S
1111 Voil I lci,jn~, (;, (l~l~16t Nlicl~ic A~id~ It¢~, 1.1, .lt~ltJ,..tf~tl:l,
Jailiial'7 1991
~lfl~ffa, K, ll~)i~5 ') l~io~h~Im lli~ph~, 14~, (Ymm~m~, l,|~J.
I'~1 $1etli, J,P,, (-~llllCfllll, ,I,1".. I~ri~lo, 1~,i MCalll+ A.l,t, :ii/d (]',~lall~', lt.W, II~tll0i C¢11 ~i, ~1.6t~?, Illi~kllby, (-',~,, I~alO, I., Kohl', W,J,, l,a~kow~ki,Jr., kt.. T~ai, M.,J. liild O'M;lll¢% II,W, t1~)117).1, 11iol, Ch¢lt, 262, 5899-~!)07, fill Horii, A., Kobaya~hi, T., Tomiia, N , Yamamolo, T,, Fuki~lligc, S.. Mlii'ol~u, i+., ()ga~':t M,, Mori. T. alld Mal.
II01 ~cm~, ~i,l,,
130
I) ~] Tan, T., (,iiPlmcr,{'. m~d l~'illk.I!. (1!t~,~) lli~l,Chore, lloppv. Styler 3(foLidf~ol, 'I',].(I~)~14)l'rcnd~ (.;¢II¢I,.I, 2.1)-2.1~, I141 II111'I+II,I),C',, Sh:ipanka, llt. and Greene, l,,J, (1977) ,+%l'+lh l]io+h+m, l+iophy,~. 17,~, i8'~,, I!)').
