Journal of Medical Microbiology Papers in Press. Published March 26, 2015 as doi:10.1099/jmm.0.000058
Journal of Medical Microbiology Molecular detection of genes related to biofilm formation in multidrug-resistant Acinetobacter baumannii isolated from clinical settings --Manuscript Draft-Manuscript Number:
JMM-D-14-00108R2
Full Title:
Molecular detection of genes related to biofilm formation in multidrug-resistant Acinetobacter baumannii isolated from clinical settings
Short Title:
Detection of genes related to biofilm formation
Article Type:
Standard
Section/Category:
Clinical microbiology and virology
Corresponding Author:
Fereshteh Shahcheraghi Pasteur Institute of Iran Tehran, IRAN (ISLAMIC REPUBLIC OF)
First Author:
Farzad Badmasti
Order of Authors:
Farzad Badmasti Seyed Davar Siadat Saeid Bouzari Soheila Ajdary Fereshteh Shahcheraghi
Abstract:
Acinetobacter baumannii is a Gram-negative bacteria associated with hospitalacquired infections. Definitely, antimicrobial resistance and biofilm formation capabilities of clinical isolates have threading potential to persistence in the hospital environment and colonization on medical equipments. Twenty seven multidrugresistant clinical isolates were selected from a collection of A. baumannii samples isolated from clinical settings. PCR assays showed the frequencies of genes which related to biofilm formation were as follows: ompA (100%), bap (30%) and blaPER-1 (44%). Polyclonal antibodies against recombinant AbOmpA(8-346) and Bap(1-487aa) proteins were obtained by mouse immunization method. Western blotting revealed all isolates expressed AbOmpA and only eight isolates were positive to Bap factor. Two strains that their bap gene disrupted with ISAba125 did not expressed Bap protein. Our findings showed all double negative bap/blaPER-1 isolates were recovered from bloodstream and had low biofim formation capabilities which mostly belong to type D morphology of wrinkled colony. However, isolates extracted from throat of patients were blaPER-1 positive and had a great capacity to biofilm formation and also mostly belong to type C morphology.
Powered by Editorial Manager® and ProduXion Manager® from Aries Systems Corporation
Manuscript Including References (Word document) Click here to download Manuscript Including References (Word document): Badmasti et al.docx
3
Molecular detection of genes related to biofilm formation in multidrug-resistant Acinetobacter baumannii isolated from clinical settings
4 5
Farzad Badmasti,1 Seyed Davar Siadat,1 Saeid Bouzari,2 Soheila Ajdary,3 and Fereshteh Shahcheraghi 1*
6
1
1 2
7
Department of Bacteriology, Pasteur Institute of Iran, Tehran, Iran
2
Department of Molecular Biology, Pasteur Institute of Iran, Tehran, Iran
8
3
9
*Correspondence
Department of Immunology, Pasteur Institute of Iran, Tehran, Iran
10
Fereshteh Shahcheraghi
11
[email protected]
12
Tel: +98 21 66405535
13
Fax: +98 21 66405535
14
Running title: Detection of genes related to biofilm formation
15 16
ABSTRACT
17 18 19 20 21 22 23 24 25 26 27 28 29
Acinetobacter baumannii is a Gram-negative bacteria associated with hospital-acquired infections. Definitely, antimicrobial resistance and biofilm formation capabilities of clinical isolates have threading potential to persistence in the hospital environment and colonization on medical equipments. Twenty seven multidrug-resistant clinical isolates were selected from a collection of A. baumannii samples isolated from clinical settings. PCR assays showed the frequencies of genes which related to biofilm formation were as follows: ompA (100%), bap (30%) and blaPER-1 (44%). Polyclonal antibodies against recombinant AbOmpA(8-346) and Bap(1-487aa) proteins were obtained by mouse immunization method. Western blotting revealed all isolates expressed AbOmpA and only eight isolates were positive to Bap factor. Two strains that their bap gene disrupted with ISAba125 did not expressed Bap protein. Our findings showed all double negative bap/blaPER-1 isolates were recovered from bloodstream and had low biofim formation capabilities which mostly belong to type D morphology of wrinkled colony. However, isolates extracted from throat of patients were blaPER-1 positive and had a great capacity to biofilm formation and also mostly belong to type C morphology.
30
Keywords: Biofilm formation, multidrug-resistant (MDR), OmpA of Acinetobacter baumannii
31
(AbOmpA), Biofilm-associated protein (Bap), Beta-lactamase PER-1 (blaPER-1) 1
32
INTRODUCTION
33 34 35 36 37 38 39 40 41 42 43
Acinetobacter baumannii is a Gram-negative bacteria associated with hospital-acquired infection, particularly in the intensive care unit (ICU) where it causes infections that include bacteremia, pneumonia, urinary tract infection, meningitis and wound infection (Munoz-Price & Weinstein 2008). Usually serious infections caused by A. baumannii are cured by imipenem as an efficient drug of choice. However, reports of imipenem-resistant A. baumannii strains have been rising significantly during the past few years, and these isolates are often multidrugresistant (Perez et al. 2007). The MDR A. baumannii isolates have a devastating capacity to persist and circulate in the hospital environment and their ability to induce biofilm formation on both biotic and abiotic surfaces is a great help to this issue, due to the surface colonization of hospital equipment and medical devices, such as urinary catheters, central venous catheters, endotracheal tubes, etc (Dijkshoorn et al. 2007).
44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62
According to the multi-factorial nature of biofilm formation, a number of gene products such as OmpA of A. baumannii (AbOmpA), biofilm-associated protein (Bap) and beta-lactamase PER-1 (blaPER-1) have been reported to play important roles in adhesiveness and biofilm formation of A. baumannii (Longo et al. 2014). AbOmpA is a porin and one of the major proteins in the outer membrane with a molecular mass of 38 kDa. Data have shown this protein plays a role in biofilm formation on plastic and also interaction of the human epithelial cells and Candida albicans filaments (Gaddy et al. 2009). Bap is a group of surface proteins which have high molecular weight with tandem repeats of domains involving in intercellular adhesion. Loehfelm et al. (2008) characterized a large protein (854 kDa) in a bloodstream isolate of A. baumannii as Bap and suggested the development and thickness of the mature biofilm structure associated with this protein (Loehfelm et al. 2008). The other factor is the extended-spectrum Beta-lactamase (ESBL) blaPER-1 gene which confers resistance to penicillins, cefotaxime, ceftibuten, ceftazidime, and the monobactam, but reduces resistance to carbapenems and cephamycins (Poirel et al. 2005). Sechi et al. (2004) have shown that adhesion of A. baumannii to both bronchial epithelial cells, and to plastic surfaces is enhanced by the presence and expression of the blaPER-1 gene (Sechi et al. 2004). However its mechanism is unclear so far. Our goals in this study are detection of ompA, bap and blaPER-1 genes in multidrug-resistant clinical isolates and investigation of relatedness between biofilm formation and presence or absence of these genes.
63 64
MATERIAL AND METHODS
65 66 67 68
Bacterial isolates and disk diffusion method. Twenty seven multidrug-resistant clinical isolates as shown in Table 2, were selected from a collection of 100 imipenem-resistant A. baumannii samples which have previously been characterized (Shahcheraghi et al. 2011). Clinical isolates that were absolutely resistant to these antibiotics, considered as multi-drug 2
69 70 71 72
resistant A. baumannii. The Clinical and Laboratory Standards Institute (CLSI, 2012) for the disk diffusion method was used to determine the susceptibility of isolates to imipenem, ciprofloxacin, and gentamicin (MAST Laboratories Ltd., Merseyside, UK). E.coli reference strain ATCC 25922 was used as a control in antibiotic susceptibility testing.
73 74 75 76
PCR detection of ompA, bap, and blaPER-1genes. DNA genomes from multidrug-resistant isolates were extracted by QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) and Polymerase Chain Reaction (PCR) was used to amplify ompA, bap, and blaPER-1genes according to Table 1.
77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92
Production of recombinant AbOmpA(8-346) and Bap(1-487aa) proteins. Genomic DNA was purified from 10 ml of an overnight culture of the A. baumannii ATCC 19606 strain using the QIAmp DNA Mini Kit (Qiagen, Hilden, Germany). The DNA PCR products of ompA and bap were obtained by primers as described in Table 1 with AccuPower® Pfu PCR Pre Mix enzyme (Bioneer, Inc. Seoul). Forward and reverse primers had 5´-end EcoRI and HindIII restriction sites respectively (underlined). The purified PCR products were digested with EcoRI and HindIII and ligateded into the pET28a (+) vector and then were transformed into E. coli DH5α. The transformants were grown in Luria Bertani agar containing 50µg/ml kanamycin. Plasmid sequencing was carried out using 23 ABI 3730XLs automatic sequencer at Macrogen Inc. (Seoul, Korea). After confirmation of sequences, the recombinant plasmids were transformed into E. coli BL21 (DE3) and were induced with 1 mM IPTG until OD600nm reached 0.5 and then incubated 4 h in 37°C. The rAbOmpA(8-346aa) and rBap(1-487aa) proteins were analyzed by SDSPAGE 10% and transferred to nitrocellulose for western blotting with a 1:5000 dilution of an Cterminal specific anti-6xHis antibody (Invitrogen , Carlsbad, CA).The lysate of cell pellets were applied to a Ni-NTA agarose affinity column and purified as previously described (Fattahian et al. 2011; McConnell & Pachón 2011).
93 94 95 96 97 98 99
Mouse immunization. Polyclonal antibodies against rAbOmpA(8-346aa) and rBap(1-487aa) proteins were obtained. For each recombinant protein, 3 to 5 C57BL/6 mice 6-8 weeks old were immunized. We prepared an emulsion containing 30 µg antigen and complete freund's adjuvant in equal volumes. Subcutaneous administrations were done and boosting of mice was carried out after 2 weeks with antigen and incomplete freund's adjuvant. Fourteen days after second immunization, serum was isolated from blood of mice and the titers of antibodies were determined by enzyme-linked immunosorbent assay (ELISA).
100 101 102 103 104
Western blotting. Western blotting was performed as previously described (Goh et al. 2013). Cell lysate of each clinical isolate was transferred from SDS-PAGE 10% to PVDF membrane. A 1:200 and 1:1000 dilution of Bap and AbOmpA -specific antibodies were used as primary serum respectively. The secondary antibody was horse radish peroxidase (HRP) conjugated rabbit antimouse IgG (Abcam; 1:1000 dilution).
3
105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120
Biofilm formation test. Biofilms were carried out using the crystal violet method in 96-well polystyrene microtiter plate. Briefly, A. baumannii strains were grown overnight in Luria Bertani broth + 0.25% glucose (LBG) at 37°C. Next day the culture was diluted 1:50 in freshly prepared LBG pre-warmed to 37°C. Later, 200 µl of this suspension was used to inoculate sterile 96-well polystyrene micro titer plate and incubated at 37 °C for 72 h. After three washes with PBS, any remaining biofilm was stained with crystal violet 1% (w/v) for 30 min and washed with PBS again. The dye bound to the adherent cells was re-solublized with 200 µl ethanol/acetone 80:20 (V/V) and quantified in OD570nm using ELISA reader (BioTek Synergy4, Winooski, USA). Each assay was performed in triplicate and repeated three times. The adherence capabilities of the test strains were classified into four categories as follows: Three standard deviations above the OD mean of the negative control (contained broth only) were considered as cut-off optical density (ODc). Isolates were classified as follows: If OD ≤ ODc, the bacteria were non-adherent; if ODc < OD ≤ 2 x ODc, the bacteria were weakly adherent; if 2 x OD c < OD ≤ 4 x ODc, the bacteria were moderately adherent; and if 4 x ODc < OD, the bacteria were strongly adherent. Biofilm formation characterized to four manners namely non-adherence tendency (-), weak (+), medium (++) and strong (+++).
121 122 123 124 125 126 127 128 129
Biofilm formation using wrinkled colony development. We performed a modified protocol as described previously (Ray et al. 2012). Briefly, clinical isolates of A. baumannii were cultured overnight on LB agar. Next day a single colony was inoculated in LB broth and shaked at 180 rpm in 37°C until OD600nm reached to 0.2. Five micro liters of LB broth containing Bacteria were spotted on LB agar and incubated in 18°C for 24 h. The morphologies of wrinkled colonies were assessed by light microscope and obtained micrographs of them. We categorized wrinkled colonies to four morphology types (A, B, C and D). The classification was according to background of colonies in the presence of light, ground state of bacteria involved in molecular matrix and thickness of surrounding colonies (refer to Fig. 2).
130 131
RESULTS
132
Prevalence of ompA, bap and blaPER-1 gene in multidrug-resistant isolates
133 134 135 136 137 138 139 140
The ompA gene was detected in all clinical isolates. PCR analyses of eight multidrug-resistant isolates (30%) were positive to bap gene. The bapF and bapR primers that were used to amplify bap genes yielded a DNA band of 1449 bp molecular weight but AB-22 and AB-122 strains had a ~2500 bpDNA bands. DNA sequencing revealed the bap gene was disrupted by ISAba125 in AB-22 and AB-122 strains (Sequenced DNA has been deposited in GenBank database under accession number KM874805). Twelve isolates were blaPER-1 positive gene (44%) and seven isolates had neither bap nor blaPER-1 genes (26%). The presence or absence of genes related to biofilm formation has been shown in Table 2.
141 4
142
Immunoblotting of Bap and AbOmpA in clinical isolates
143 144 145 146 147
Immunoblotting revealed the expression of AbOmpA (38 kDa) was positive in all clinical isolates (refer to Fig. 1a) and Bap-specific antiserum reacted with a ~200-kDa protein that previously were characterized by Goh et al. (2013). This protein was present in only eight isolates (refer to Fig. 1b). AB-22 and AB-122 strains that their bap gene disrupted with ISAba125 did not expressed Bap protein. Data of each isolate were presented in Table 2.
148
Wrinkled colony morphology typing
149 150 151 152 153 154 155 156 157 158 159 160 161
Wrinkled colony morphology typing of clinical isolates has been categorized into four types (A, B, C, and D). The background of colonies in the presence of light, ground state of bacteria involved in molecular matrix and thickness of colonies were different among clinical isolates (refer to Fig. 2). Type A had a sandy background with dense and compact colonies surrounding the inoculation site. Five clinical isolates (19%) belong to this type. Nine isolates (33%) had type B of morphology. The characteristics of this type were grained background with wider surrounding so that the bacteria were involved in a more molecular matrix. The characteristics of type C were dark context with most dens surrounding. The morphology of this colony was similar to pellicle form. Only three (13%) of clinical isolates had a morphology like this. A light and smooth context with smaller wrinkled colony was displayed by the nine isolates (33%) formed a wide halo of colony surrounding the inoculation site named as type D. The information of wrinkled colony typing and biofilm formation capacity of clinical isolates were presented in Table 2.
162 163
DISCUSSION
164 165 166 167 168 169 170 171 172 173 174 175 176 177
The highly metabolic versatility of A. baumannii could contribute to its biofilm formation on hospital equipments and in patients. Biofilm formation and antibiotic resistance capabilities would probably provide a niche for the bacteria that give rise to respiratory-tract or bloodstream infections in hospitalized patients (Dijkshoorn, Nemec et al. 2007; Munoz-Price & Weinstein 2008). It is becoming evident that biofilm-forming ability can be considered as one of the main virulence factors common to a large number of A. baumannii clinical isolates. However, biofilm formation ability and its related genes have no important roles during bloodstream infection because iron-acquisition mechanisms, serum resistance and newly antibiotic resistance are attributes that enable the organism to survive in the bloodstream (Dijkshoorn, Nemec et al. 2007). The bacteremia due to A. baumannii in susceptible patients can occur through various routes, of which the using of invasive devices or surgical ICU are thought to be the most common (Jung et al. 2010). Our findings showed all double negative bap/blaPER-1 clinical isolates were recovered from bloodstream and had low biofim formation capabilities which mostly belong to type D of wrinkled colony morphology. However, presence and expression of 5
178 179 180 181
genes associated with biofilm formation are critical for adherence to epithelial cell surface during respiratory-tract infections (Obeidat et al. 2014). Clinical isolates extracted from throat of patients were blaPER-1 positive and had a great capacity to biofilm formation and also mostly belong to type C morphology of wrinkled colony.
182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209
AbOmpA has been shown to play a role in a number of interactions with the host during infection including adherence/invasion to epithelial cells, induction of apoptosis in host cells, and differentiation of host immune cells (Choi et al. 2005; Lee et al. 2007; Choi et al. 2008). We detected that the ompA gene was positive in all clinical isolates and its expression in each isolate was confirmed by western blotting. This finding presents AbOmpA has a critical role in pathogenesis of A. baumannii. Several families of Insertion sequence (IS) in A. baumannii have been associated with antimicrobial resistance (Moffatt et al. 2011; Hamidian et al. 2013). In this study we have for the first time characterized ISAba125 inserted into and disrupt the coding region of biofilm-associated protein (Bap) that is not related to antibiotic resistance. These findings confirm ISs in DNA repertoire of A. baumannii play a role as a tool for inactivation or even over-expression of genes not only in genes associated with antimicrobial resistance but also genes related to biofilm formation (Adams et al. 2008). Investigation showed the adhesion of A. baumannii to both biotic and abiotic surfaces is enhanced by presence and expression of blaPER1 (Sechi, Karadenizli et al. 2004). However, an independent study found that only 2 out of 11 human isolates carrying the blaPER-1 gene are able to form a robust biofilm compared with isolates lacking this genetic determinant (Lee et al. 2008). We believe presence or expression of blaPER-1 is not directly associated with biofilm formation in A. baumanni. Our In silico analysis revealed blaPER-1 gene in A. baumannii is carried on plasmids and related to class I integrons and transposons. These mobile genetic elements carry various antimicrobial and sometimes metabolic gene cassettes that altogether are transferred to other bacteria by horizontal gene transfer mechanism. We found an annotated ABC transporter ATP-binding protein near blaPER1 gene on a retrotransposon ISCR1 which probably can help to biofilm formation (refer to accession number GU944725-1). Previous studies have shown the members of the ABC transporter protein class to be essential for biofilm formation in Bacillus subtilis, Pseudomonas fluorescens, Streptococcus gordonii and Haemophilus Influenzae (Gallaher et al. 2006). We analyze linkage between blaPER-1 and ABC transporter ATP-binding protein via PCR assay. Only two clinical isolates with grate biofilm formation capability had such desired linkage (data not been shown).
210 211 212 213 214 215 216
Biofilm-forming ability in A. baumannii involves a range of bacterial factors, multiple cell signals and environmental conditions. Some factors such as OmpA, Bap, BlaPER-1, CsuA/BABCDE usher-chaperone assembly system and O-glycosylation machinery (pglC locus) have been characterized as genes related to biofilm formation and adhesiveness (Longo, Vuotto et al. 2014). Presence or absence of these genes and analysis of their transcriptional level can render a comprehensive view about biofilm formation and adhesiveness. It seems factors associated with biofilm formation have various roles in the development of biofilm apparatus 6
217 218 219 220 221
such as signaling, helping to cell-to-cell interaction or scaffolding roles which must be studied more and more (Gaddy & Actis 2009; Gaddy, Tomaras et al. 2009; Brossard & Campagnari 2012). Indeed, the quantitative differences in biofilm formation among clinical isolates, in association with the epidemicity of strains and the kind of infections, have been poorly investigated. Our project is just a little study about this important issue.
222 223
CONFLICTS OF INTEREST
224
None of the authors have any conflicts of interest to this article.
225 226
ACKNOWLEDGMENTS
227 228 229
This project has been funded with support from the Pasteur Institute of Iran. We would like to acknowledge Shahryar Abdoli for his assistance in performing the experiments and appreciate the editing contribution of Zahra Aliabadi.
230 231
REFERENCES
232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253
Adams, M. D., K. Goglin, N. Molyneaux, K. M. Hujer, H. Lavender, J. J. Jamison, I. J. MacDonald, K. M. Martin, T. Russo, A. A. Campagnari other authors (2008). "Comparative genome sequence analysis of multidrug-resistant Acinetobacter baumannii." J Bacteriol 190(24), 8053-8064. Brossard, K. A. & A. A. Campagnari (2012). "The Acinetobacter baumannii biofilmassociated protein plays a role in adherence to human epithelial cells." Infect Immun 80(1), 228-233. Choi, C. H., E. Y. Lee, Y. C. Lee, T. I. Park, H. J. Kim, S. H. Hyun, S. A. Kim, S. K. Lee & J. C. Lee (2005). "Outer membrane protein 38 of Acinetobacter baumannii localizes to the mitochondria and induces apoptosis of epithelial cells." Cell Microbiol 7(8), 11271138. Choi, C. H., J. S. Lee, Y. C. Lee, T. I. Park & J. C. Lee (2008). "Acinetobacter baumannii invades epithelial cells and outer membrane protein A mediates interactions with epithelial cells." BMC Microbiol 8, 216. Dijkshoorn, L., A. Nemec & H. Seifert (2007). "An increasing threat in hospitals: multidrugresistant Acinetobacter baumannii." Nat Rev Microbiol 5(12), 939-951. Fattahian, Y., I. Rasooli, S. L. Mousavi Gargari, M. R. Rahbar, S. Darvish Alipour Astaneh & J. Amani (2011). "Protection against Acinetobacter baumannii infection via its functional deprivation of biofilm associated protein (Bap)." Microb Pathog 51(6), 402-406. Gaddy, J. A. & L. A. Actis (2009). "Regulation of Acinetobacter baumannii biofilm formation." Future Microbiol 4(3), 273-278. 7
254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298
Gaddy, J. A., A. P. Tomaras & L. A. Actis (2009). "The Acinetobacter baumannii 19606 OmpA protein plays a role in biofilm formation on abiotic surfaces and in the interaction of this pathogen with eukaryotic cells." Infect Immun 77(8), 3150-3160. Gallaher, T. K., S. Wu, P. Webster & R. Aguilera (2006). "Identification of biofilm proteins in non-typeable Haemophilus Influenzae." BMC Microbiol 6, 65. Goh, H. M., S. A. Beatson, M. Totsika, D. G. Moriel, M. D. Phan, J. Szubert, N. Runnegar, H. E. Sidjabat, D. L. Paterson, G. R. Nimmo other authors (2013). "Molecular analysis of the Acinetobacter baumannii biofilm-associated protein." Appl Environ Microbiol 79(21), 6535-6543. Hamidian, M., D. P. Hancock & R. M. Hall (2013). "Horizontal transfer of an ISAba125activated ampC gene between Acinetobacter baumannii strains leading to cephalosporin resistance." J Antimicrob Chemother 68(1), 244-245. Jung, J. Y., M. S. Park, S. E. Kim, B. H. Park, J. Y. Son, E. Y. Kim, J. E. Lim, S. K. Lee, S. H. Lee, K. J. Lee other authors (2010). "Risk factors for multi-drug resistant Acinetobacter baumannii bacteremia in patients with colonization in the intensive care unit." BMC Infect Dis 10, 228. Lee, H. W., Y. M. Koh, J. Kim, J. C. Lee, Y. C. Lee, S. Y. Seol & D. T. Cho (2008). "Capacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to form biofilm and adhere to epithelial cell surfaces." Clin Microbiol Infect 14(1), 49-54. Lee, J. S., J. C. Lee, C. M. Lee, I. D. Jung, Y. I. Jeong, E. Y. Seong, H. Y. Chung & Y. M. Park (2007). "Outer membrane protein A of Acinetobacter baumannii induces differentiation of CD4+ T cells toward a Th1 polarizing phenotype through the activation of dendritic cells." Biochem Pharmacol 74(1), 86-97. Loehfelm, T. W., N. R. Luke & A. A. Campagnari (2008). "Identification and characterization of an Acinetobacter baumannii biofilm-associated protein." J Bacteriol 190(3), 1036-1044. Longo, F., C. Vuotto & G. Donelli (2014). "Biofilm formation in Acinetobacter baumannii." New Microbiol 37(2), 119-127. McConnell, M. J. & J. Pachón (2011). "Expression, purification, and refolding of biologically active Acinetobacter baumannii OmpA from Escherichia coli inclusion bodies." Protein Expr Purif 77(1), 98-103. Moffatt, J. H., M. Harper, B. Adler, R. L. Nation, J. Li & J. D. Boyce (2011). "Insertion sequence ISAba11 is involved in colistin resistance and loss of lipopolysaccharide in Acinetobacter baumannii." Antimicrob Agents Chemother 55(6), 3022-3024. Munoz-Price, L. S. & R. A. Weinstein (2008). "Acinetobacter infection." N Engl J Med 358(12), 1271-1281. Obeidat, N., F. Jawdat, A. G. Al-Bakri & A. A. Shehabi (2014). "Major biologic characteristics of Acinetobacter baumannii isolates from hospital environmental and patients' respiratory tract sources." Am J Infect Control 42(4), 401-404. Perez, F., A. M. Hujer, K. M. Hujer, B. K. Decker, P. N. Rather & R. A. Bonomo (2007). "Global challenge of multidrug-resistant Acinetobacter baumannii." Antimicrobial agents and chemotherapy 51(10), 3471-3484. Poirel, L., L. Cabanne, H. Vahaboglu & P. Nordmann (2005). "Genetic environment and expression of the extended-spectrum beta-lactamase blaPER-1 gene in gram-negative bacteria." Antimicrob Agents Chemother 49(5), 1708-1713.
8
299 300 301 302 303 304 305 306 307 308 309
Ray, V. A., A. R. Morris & K. L. Visick (2012). "A semi-quantitative approach to assess biofilm formation using wrinkled colony development." J Vis Exp(64), e4035. Sechi, L. A., A. Karadenizli, A. Deriu, S. Zanetti, F. Kolayli, E. Balikci & H. Vahaboglu (2004). "PER-1 type beta-lactamase production in Acinetobacter baumannii is related to cell adhesion." Med Sci Monit 10(6), BR180-184. Shahcheraghi, F., M. Abbasalipour, M. Feizabadi, G. Ebrahimipour & N. Akbari (2011). "Isolation and genetic characterization of metallo-β-lactamase and carbapenamase producing strains of Acinetobacter baumannii from patients at Tehran hospitals." Iran J Microbiol 3(2), 68-74.
310
Figure legends
311 312 313
Fig. 1. Western blot obtained using AbOmpA and Bap-specific antiserum showing expression of AbOmpA (38kDa) and Bap (~200 kDa) in A. baumannii from whole-cell lysates which have been showed in Fig. 1a and Fig. 1b respectively.
314 315 316
FIG. 2. Wrinkled colony morphology typing of clinical isolates has been categorized into four types (A, B, C, and D) as have been tagged in figures. The background of colonies in the presence of light, ground state of bacteria involved in molecular matrix and thickness of colony surrounding are different among clinical isolates.
317 318
Table. 1 The primers list was used in this study Primer name
Sequence (5ʹ →3ʹ ) *
Position†
Annealing temperature (°C)
DNA amplicon size (bp)
ompAF ompAR
GCTACTATGCTTGTTGCTGCT CGCTTCTTGACCAGGTTGAAC
25-45 1027 -1047
60
1023
This study This study
bapF bapR
ATGCCTGAGATACAAATTAT GTCAATCGTAAAGGTAACG
1-20 1431-1449
59
1449
This study This study
blaPER1F blaPER1R
CATTATAAAAGCTGTAGTTACTG TTTATGTGCGACCACAGTAC
9 -31 698 -717
55
709
This study This study
AbOmpF AbOmpR
ATTCGAATTCGCTACTATGCTTGTTGCTGCT ATGTAAGCTTCGCTTCTTGACCAGGTTGAAC
25-45 1027 -1047
62
1043
This study This study
BapF BapR
GTCGAGAATTCATGCCTGAGATACAAATTAT TGACAAGCTTGTCAATCGTAAAGGTAACG
1-20 1431-1449
61
1470
This study This study
Reference
319
* Forward and reverse primers of AbOmp and Bap had underlined 5´-end EcoRI and HindIII restriction sites respectively.
320 321
†ompA was according to accession number AY485227; bap was according to accession number EU117203.1; blaPER-1 was according to accession number EF535600.1 in GenBank database (http://www.ncbi.nlm.nih.gov/genbank/).
322 323 324 9
325 326
Table 2. The information of 27 multidrug-resistant clinical isolates selected from a collection of Acinteobacter baumannii samples Strain
Clinical region/ Date
Isolation source/ Gender
Wrinkled colony type
Biofilm formation
ompA/bap/blaPER1 gene
Bap expression†
AbOmpA expression
AB-7 AB-20 AB-22 AB-26 AB-27 AB-44 AB-47 AB-64 AB-66 AB-74 AB-79 AB-83 AB-89 AB-94 AB-98 AB-99 AB-100 AB-101 AB-107 AB-122 AB-123 AB-124 AB-127 AB-130 AB-132 AB-133 AB-136
A/2008 B/2008 C/2008 C/2008 C/2008 C/2008 A/2008 B/2008 C/2008 C/2008 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009
Blood/Female Blood/Male Throat/Male Urine/Female Blood/Male Blood/Female Blood/Male Throat/Male Blood/Male Sputum/Male Blood/Male Blood/Male Throat/Female Throat/Male Sputum/Male Throat/Female Sputum/Male Blood/Female Blood/Male Wound/Female Blood/Female Blood/Male Blood/Female Blood/Male Throat/Male Throat/Male Blood/Female
D B C D B B D B A A D B D B A C D D D C D B B A C A B
+ + +++ + ++ + ++ + ++ + ++ +++ + + +++ ++ ++ +++ ++ ++
+/-/+ +/+/+/-*/+ +/+/+/-/+ +/+/+/-/+/-/+ +/-/+ +/+/+/-/+/-/+ +/-/+ +/+/+/-/+ +/-/+ +/-/+ +/-/+/-/+/-*/+ +/+/+/-/+/-/+/-/+/-/+ +/+/+/+/-
ND + + ND + ND ND ND + ND ND ND + ND ND ND ND ND + ND ND ND ND + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + +
327
* bap gene was disrupted by ISAba125.
328
† ND means not determined.
10
Figure 1a Click here to download Figure: Fig 1a.tif
Figure 1b Click here to download Figure: Fig 1b.tif
Figure 2a Click here to download Figure: Fig 2a.tif
Figure 2b Click here to download Figure: Fig 2b.tif
Figure 2c Click here to download Figure: Fig 2c.tif
Figure 2d Click here to download Figure: Fig 2d.tif
Journal of Medical Microbiology Molecular detection of genes related to biofilm formation in multidrug-resistant Acinetobacter baumannii isolated from clinical settings --Manuscript Draft-Manuscript Number:
JMM-D-14-00108R2
Full Title:
Molecular detection of genes related to biofilm formation in multidrug-resistant Acinetobacter baumannii isolated from clinical settings
Short Title:
Detection of genes related to biofilm formation
Article Type:
Standard
Section/Category:
Clinical microbiology and virology
Corresponding Author:
Fereshteh Shahcheraghi Pasteur Institute of Iran Tehran, IRAN (ISLAMIC REPUBLIC OF)
First Author:
Farzad Badmasti
Order of Authors:
Farzad Badmasti Seyed Davar Siadat Saeid Bouzari Soheila Ajdary Fereshteh Shahcheraghi
Abstract:
Acinetobacter baumannii is a Gram-negative bacteria associated with hospitalacquired infections. Definitely, antimicrobial resistance and biofilm formation capabilities of clinical isolates have threading potential to persistence in the hospital environment and colonization on medical equipments. Twenty seven multidrugresistant clinical isolates were selected from a collection of A. baumannii samples isolated from clinical settings. PCR assays showed the frequencies of genes which related to biofilm formation were as follows: ompA (100%), bap (30%) and blaPER-1 (44%). Polyclonal antibodies against recombinant AbOmpA(8-346) and Bap(1-487aa) proteins were obtained by mouse immunization method. Western blotting revealed all isolates expressed AbOmpA and only eight isolates were positive to Bap factor. Two strains that their bap gene disrupted with ISAba125 did not expressed Bap protein. Our findings showed all double negative bap/blaPER-1 isolates were recovered from bloodstream and had low biofim formation capabilities which mostly belong to type D morphology of wrinkled colony. However, isolates extracted from throat of patients were blaPER-1 positive and had a great capacity to biofilm formation and also mostly belong to type C morphology.
Powered by Editorial Manager® and ProduXion Manager® from Aries Systems Corporation
Manuscript Including References (Word document) Click here to download Manuscript Including References (Word document): Badmasti et al.docx
3
Molecular detection of genes related to biofilm formation in multidrug-resistant Acinetobacter baumannii isolated from clinical settings
4 5
Farzad Badmasti,1 Seyed Davar Siadat,1 Saeid Bouzari,2 Soheila Ajdary,3 and Fereshteh Shahcheraghi 1*
6
1
1 2
7
Department of Bacteriology, Pasteur Institute of Iran, Tehran, Iran
2
Department of Molecular Biology, Pasteur Institute of Iran, Tehran, Iran
8
3
9
*Correspondence
Department of Immunology, Pasteur Institute of Iran, Tehran, Iran
10
Fereshteh Shahcheraghi
11
[email protected]
12
Tel: +98 21 66405535
13
Fax: +98 21 66405535
14
Running title: Detection of genes related to biofilm formation
15 16
ABSTRACT
17 18 19 20 21 22 23 24 25 26 27 28 29
Acinetobacter baumannii is a Gram-negative bacteria associated with hospital-acquired infections. Definitely, antimicrobial resistance and biofilm formation capabilities of clinical isolates have threading potential to persistence in the hospital environment and colonization on medical equipments. Twenty seven multidrug-resistant clinical isolates were selected from a collection of A. baumannii samples isolated from clinical settings. PCR assays showed the frequencies of genes which related to biofilm formation were as follows: ompA (100%), bap (30%) and blaPER-1 (44%). Polyclonal antibodies against recombinant AbOmpA(8-346) and Bap(1-487aa) proteins were obtained by mouse immunization method. Western blotting revealed all isolates expressed AbOmpA and only eight isolates were positive to Bap factor. Two strains that their bap gene disrupted with ISAba125 did not expressed Bap protein. Our findings showed all double negative bap/blaPER-1 isolates were recovered from bloodstream and had low biofim formation capabilities which mostly belong to type D morphology of wrinkled colony. However, isolates extracted from throat of patients were blaPER-1 positive and had a great capacity to biofilm formation and also mostly belong to type C morphology.
30
Keywords: Biofilm formation, multidrug-resistant (MDR), OmpA of Acinetobacter baumannii
31
(AbOmpA), Biofilm-associated protein (Bap), Beta-lactamase PER-1 (blaPER-1) 1
32
INTRODUCTION
33 34 35 36 37 38 39 40 41 42 43
Acinetobacter baumannii is a Gram-negative bacteria associated with hospital-acquired infection, particularly in the intensive care unit (ICU) where it causes infections that include bacteremia, pneumonia, urinary tract infection, meningitis and wound infection (Munoz-Price & Weinstein 2008). Usually serious infections caused by A. baumannii are cured by imipenem as an efficient drug of choice. However, reports of imipenem-resistant A. baumannii strains have been rising significantly during the past few years, and these isolates are often multidrugresistant (Perez et al. 2007). The MDR A. baumannii isolates have a devastating capacity to persist and circulate in the hospital environment and their ability to induce biofilm formation on both biotic and abiotic surfaces is a great help to this issue, due to the surface colonization of hospital equipment and medical devices, such as urinary catheters, central venous catheters, endotracheal tubes, etc (Dijkshoorn et al. 2007).
44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62
According to the multi-factorial nature of biofilm formation, a number of gene products such as OmpA of A. baumannii (AbOmpA), biofilm-associated protein (Bap) and beta-lactamase PER-1 (blaPER-1) have been reported to play important roles in adhesiveness and biofilm formation of A. baumannii (Longo et al. 2014). AbOmpA is a porin and one of the major proteins in the outer membrane with a molecular mass of 38 kDa. Data have shown this protein plays a role in biofilm formation on plastic and also interaction of the human epithelial cells and Candida albicans filaments (Gaddy et al. 2009). Bap is a group of surface proteins which have high molecular weight with tandem repeats of domains involving in intercellular adhesion. Loehfelm et al. (2008) characterized a large protein (854 kDa) in a bloodstream isolate of A. baumannii as Bap and suggested the development and thickness of the mature biofilm structure associated with this protein (Loehfelm et al. 2008). The other factor is the extended-spectrum Beta-lactamase (ESBL) blaPER-1 gene which confers resistance to penicillins, cefotaxime, ceftibuten, ceftazidime, and the monobactam, but reduces resistance to carbapenems and cephamycins (Poirel et al. 2005). Sechi et al. (2004) have shown that adhesion of A. baumannii to both bronchial epithelial cells, and to plastic surfaces is enhanced by the presence and expression of the blaPER-1 gene (Sechi et al. 2004). However its mechanism is unclear so far. Our goals in this study are detection of ompA, bap and blaPER-1 genes in multidrug-resistant clinical isolates and investigation of relatedness between biofilm formation and presence or absence of these genes.
63 64
MATERIAL AND METHODS
65 66 67 68
Bacterial isolates and disk diffusion method. Twenty seven multidrug-resistant clinical isolates as shown in Table 2, were selected from a collection of 100 imipenem-resistant A. baumannii samples which have previously been characterized (Shahcheraghi et al. 2011). Clinical isolates that were absolutely resistant to these antibiotics, considered as multi-drug 2
69 70 71 72
resistant A. baumannii. The Clinical and Laboratory Standards Institute (CLSI, 2012) for the disk diffusion method was used to determine the susceptibility of isolates to imipenem, ciprofloxacin, and gentamicin (MAST Laboratories Ltd., Merseyside, UK). E.coli reference strain ATCC 25922 was used as a control in antibiotic susceptibility testing.
73 74 75 76
PCR detection of ompA, bap, and blaPER-1genes. DNA genomes from multidrug-resistant isolates were extracted by QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) and Polymerase Chain Reaction (PCR) was used to amplify ompA, bap, and blaPER-1genes according to Table 1.
77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92
Production of recombinant AbOmpA(8-346) and Bap(1-487aa) proteins. Genomic DNA was purified from 10 ml of an overnight culture of the A. baumannii ATCC 19606 strain using the QIAmp DNA Mini Kit (Qiagen, Hilden, Germany). The DNA PCR products of ompA and bap were obtained by primers as described in Table 1 with AccuPower® Pfu PCR Pre Mix enzyme (Bioneer, Inc. Seoul). Forward and reverse primers had 5´-end EcoRI and HindIII restriction sites respectively (underlined). The purified PCR products were digested with EcoRI and HindIII and ligateded into the pET28a (+) vector and then were transformed into E. coli DH5α. The transformants were grown in Luria Bertani agar containing 50µg/ml kanamycin. Plasmid sequencing was carried out using 23 ABI 3730XLs automatic sequencer at Macrogen Inc. (Seoul, Korea). After confirmation of sequences, the recombinant plasmids were transformed into E. coli BL21 (DE3) and were induced with 1 mM IPTG until OD600nm reached 0.5 and then incubated 4 h in 37°C. The rAbOmpA(8-346aa) and rBap(1-487aa) proteins were analyzed by SDSPAGE 10% and transferred to nitrocellulose for western blotting with a 1:5000 dilution of an Cterminal specific anti-6xHis antibody (Invitrogen , Carlsbad, CA).The lysate of cell pellets were applied to a Ni-NTA agarose affinity column and purified as previously described (Fattahian et al. 2011; McConnell & Pachón 2011).
93 94 95 96 97 98 99
Mouse immunization. Polyclonal antibodies against rAbOmpA(8-346aa) and rBap(1-487aa) proteins were obtained. For each recombinant protein, 3 to 5 C57BL/6 mice 6-8 weeks old were immunized. We prepared an emulsion containing 30 µg antigen and complete freund's adjuvant in equal volumes. Subcutaneous administrations were done and boosting of mice was carried out after 2 weeks with antigen and incomplete freund's adjuvant. Fourteen days after second immunization, serum was isolated from blood of mice and the titers of antibodies were determined by enzyme-linked immunosorbent assay (ELISA).
100 101 102 103 104
Western blotting. Western blotting was performed as previously described (Goh et al. 2013). Cell lysate of each clinical isolate was transferred from SDS-PAGE 10% to PVDF membrane. A 1:200 and 1:1000 dilution of Bap and AbOmpA -specific antibodies were used as primary serum respectively. The secondary antibody was horse radish peroxidase (HRP) conjugated rabbit antimouse IgG (Abcam; 1:1000 dilution).
3
105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120
Biofilm formation test. Biofilms were carried out using the crystal violet method in 96-well polystyrene microtiter plate. Briefly, A. baumannii strains were grown overnight in Luria Bertani broth + 0.25% glucose (LBG) at 37°C. Next day the culture was diluted 1:50 in freshly prepared LBG pre-warmed to 37°C. Later, 200 µl of this suspension was used to inoculate sterile 96-well polystyrene micro titer plate and incubated at 37 °C for 72 h. After three washes with PBS, any remaining biofilm was stained with crystal violet 1% (w/v) for 30 min and washed with PBS again. The dye bound to the adherent cells was re-solublized with 200 µl ethanol/acetone 80:20 (V/V) and quantified in OD570nm using ELISA reader (BioTek Synergy4, Winooski, USA). Each assay was performed in triplicate and repeated three times. The adherence capabilities of the test strains were classified into four categories as follows: Three standard deviations above the OD mean of the negative control (contained broth only) were considered as cut-off optical density (ODc). Isolates were classified as follows: If OD ≤ ODc, the bacteria were non-adherent; if ODc < OD ≤ 2 x ODc, the bacteria were weakly adherent; if 2 x OD c < OD ≤ 4 x ODc, the bacteria were moderately adherent; and if 4 x ODc < OD, the bacteria were strongly adherent. Biofilm formation characterized to four manners namely non-adherence tendency (-), weak (+), medium (++) and strong (+++).
121 122 123 124 125 126 127 128 129
Biofilm formation using wrinkled colony development. We performed a modified protocol as described previously (Ray et al. 2012). Briefly, clinical isolates of A. baumannii were cultured overnight on LB agar. Next day a single colony was inoculated in LB broth and shaked at 180 rpm in 37°C until OD600nm reached to 0.2. Five micro liters of LB broth containing Bacteria were spotted on LB agar and incubated in 18°C for 24 h. The morphologies of wrinkled colonies were assessed by light microscope and obtained micrographs of them. We categorized wrinkled colonies to four morphology types (A, B, C and D). The classification was according to background of colonies in the presence of light, ground state of bacteria involved in molecular matrix and thickness of surrounding colonies (refer to Fig. 2).
130 131
RESULTS
132
Prevalence of ompA, bap and blaPER-1 gene in multidrug-resistant isolates
133 134 135 136 137 138 139 140
The ompA gene was detected in all clinical isolates. PCR analyses of eight multidrug-resistant isolates (30%) were positive to bap gene. The bapF and bapR primers that were used to amplify bap genes yielded a DNA band of 1449 bp molecular weight but AB-22 and AB-122 strains had a ~2500 bpDNA bands. DNA sequencing revealed the bap gene was disrupted by ISAba125 in AB-22 and AB-122 strains (Sequenced DNA has been deposited in GenBank database under accession number KM874805). Twelve isolates were blaPER-1 positive gene (44%) and seven isolates had neither bap nor blaPER-1 genes (26%). The presence or absence of genes related to biofilm formation has been shown in Table 2.
141 4
142
Immunoblotting of Bap and AbOmpA in clinical isolates
143 144 145 146 147
Immunoblotting revealed the expression of AbOmpA (38 kDa) was positive in all clinical isolates (refer to Fig. 1a) and Bap-specific antiserum reacted with a ~200-kDa protein that previously were characterized by Goh et al. (2013). This protein was present in only eight isolates (refer to Fig. 1b). AB-22 and AB-122 strains that their bap gene disrupted with ISAba125 did not expressed Bap protein. Data of each isolate were presented in Table 2.
148
Wrinkled colony morphology typing
149 150 151 152 153 154 155 156 157 158 159 160 161
Wrinkled colony morphology typing of clinical isolates has been categorized into four types (A, B, C, and D). The background of colonies in the presence of light, ground state of bacteria involved in molecular matrix and thickness of colonies were different among clinical isolates (refer to Fig. 2). Type A had a sandy background with dense and compact colonies surrounding the inoculation site. Five clinical isolates (19%) belong to this type. Nine isolates (33%) had type B of morphology. The characteristics of this type were grained background with wider surrounding so that the bacteria were involved in a more molecular matrix. The characteristics of type C were dark context with most dens surrounding. The morphology of this colony was similar to pellicle form. Only three (13%) of clinical isolates had a morphology like this. A light and smooth context with smaller wrinkled colony was displayed by the nine isolates (33%) formed a wide halo of colony surrounding the inoculation site named as type D. The information of wrinkled colony typing and biofilm formation capacity of clinical isolates were presented in Table 2.
162 163
DISCUSSION
164 165 166 167 168 169 170 171 172 173 174 175 176 177
The highly metabolic versatility of A. baumannii could contribute to its biofilm formation on hospital equipments and in patients. Biofilm formation and antibiotic resistance capabilities would probably provide a niche for the bacteria that give rise to respiratory-tract or bloodstream infections in hospitalized patients (Dijkshoorn, Nemec et al. 2007; Munoz-Price & Weinstein 2008). It is becoming evident that biofilm-forming ability can be considered as one of the main virulence factors common to a large number of A. baumannii clinical isolates. However, biofilm formation ability and its related genes have no important roles during bloodstream infection because iron-acquisition mechanisms, serum resistance and newly antibiotic resistance are attributes that enable the organism to survive in the bloodstream (Dijkshoorn, Nemec et al. 2007). The bacteremia due to A. baumannii in susceptible patients can occur through various routes, of which the using of invasive devices or surgical ICU are thought to be the most common (Jung et al. 2010). Our findings showed all double negative bap/blaPER-1 clinical isolates were recovered from bloodstream and had low biofim formation capabilities which mostly belong to type D of wrinkled colony morphology. However, presence and expression of 5
178 179 180 181
genes associated with biofilm formation are critical for adherence to epithelial cell surface during respiratory-tract infections (Obeidat et al. 2014). Clinical isolates extracted from throat of patients were blaPER-1 positive and had a great capacity to biofilm formation and also mostly belong to type C morphology of wrinkled colony.
182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209
AbOmpA has been shown to play a role in a number of interactions with the host during infection including adherence/invasion to epithelial cells, induction of apoptosis in host cells, and differentiation of host immune cells (Choi et al. 2005; Lee et al. 2007; Choi et al. 2008). We detected that the ompA gene was positive in all clinical isolates and its expression in each isolate was confirmed by western blotting. This finding presents AbOmpA has a critical role in pathogenesis of A. baumannii. Several families of Insertion sequence (IS) in A. baumannii have been associated with antimicrobial resistance (Moffatt et al. 2011; Hamidian et al. 2013). In this study we have for the first time characterized ISAba125 inserted into and disrupt the coding region of biofilm-associated protein (Bap) that is not related to antibiotic resistance. These findings confirm ISs in DNA repertoire of A. baumannii play a role as a tool for inactivation or even over-expression of genes not only in genes associated with antimicrobial resistance but also genes related to biofilm formation (Adams et al. 2008). Investigation showed the adhesion of A. baumannii to both biotic and abiotic surfaces is enhanced by presence and expression of blaPER1 (Sechi, Karadenizli et al. 2004). However, an independent study found that only 2 out of 11 human isolates carrying the blaPER-1 gene are able to form a robust biofilm compared with isolates lacking this genetic determinant (Lee et al. 2008). We believe presence or expression of blaPER-1 is not directly associated with biofilm formation in A. baumanni. Our In silico analysis revealed blaPER-1 gene in A. baumannii is carried on plasmids and related to class I integrons and transposons. These mobile genetic elements carry various antimicrobial and sometimes metabolic gene cassettes that altogether are transferred to other bacteria by horizontal gene transfer mechanism. We found an annotated ABC transporter ATP-binding protein near blaPER1 gene on a retrotransposon ISCR1 which probably can help to biofilm formation (refer to accession number GU944725-1). Previous studies have shown the members of the ABC transporter protein class to be essential for biofilm formation in Bacillus subtilis, Pseudomonas fluorescens, Streptococcus gordonii and Haemophilus Influenzae (Gallaher et al. 2006). We analyze linkage between blaPER-1 and ABC transporter ATP-binding protein via PCR assay. Only two clinical isolates with grate biofilm formation capability had such desired linkage (data not been shown).
210 211 212 213 214 215 216
Biofilm-forming ability in A. baumannii involves a range of bacterial factors, multiple cell signals and environmental conditions. Some factors such as OmpA, Bap, BlaPER-1, CsuA/BABCDE usher-chaperone assembly system and O-glycosylation machinery (pglC locus) have been characterized as genes related to biofilm formation and adhesiveness (Longo, Vuotto et al. 2014). Presence or absence of these genes and analysis of their transcriptional level can render a comprehensive view about biofilm formation and adhesiveness. It seems factors associated with biofilm formation have various roles in the development of biofilm apparatus 6
217 218 219 220 221
such as signaling, helping to cell-to-cell interaction or scaffolding roles which must be studied more and more (Gaddy & Actis 2009; Gaddy, Tomaras et al. 2009; Brossard & Campagnari 2012). Indeed, the quantitative differences in biofilm formation among clinical isolates, in association with the epidemicity of strains and the kind of infections, have been poorly investigated. Our project is just a little study about this important issue.
222 223
CONFLICTS OF INTEREST
224
None of the authors have any conflicts of interest to this article.
225 226
ACKNOWLEDGMENTS
227 228 229
This project has been funded with support from the Pasteur Institute of Iran. We would like to acknowledge Shahryar Abdoli for his assistance in performing the experiments and appreciate the editing contribution of Zahra Aliabadi.
230 231
REFERENCES
232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253
Adams, M. D., K. Goglin, N. Molyneaux, K. M. Hujer, H. Lavender, J. J. Jamison, I. J. MacDonald, K. M. Martin, T. Russo, A. A. Campagnari other authors (2008). "Comparative genome sequence analysis of multidrug-resistant Acinetobacter baumannii." J Bacteriol 190(24), 8053-8064. Brossard, K. A. & A. A. Campagnari (2012). "The Acinetobacter baumannii biofilmassociated protein plays a role in adherence to human epithelial cells." Infect Immun 80(1), 228-233. Choi, C. H., E. Y. Lee, Y. C. Lee, T. I. Park, H. J. Kim, S. H. Hyun, S. A. Kim, S. K. Lee & J. C. Lee (2005). "Outer membrane protein 38 of Acinetobacter baumannii localizes to the mitochondria and induces apoptosis of epithelial cells." Cell Microbiol 7(8), 11271138. Choi, C. H., J. S. Lee, Y. C. Lee, T. I. Park & J. C. Lee (2008). "Acinetobacter baumannii invades epithelial cells and outer membrane protein A mediates interactions with epithelial cells." BMC Microbiol 8, 216. Dijkshoorn, L., A. Nemec & H. Seifert (2007). "An increasing threat in hospitals: multidrugresistant Acinetobacter baumannii." Nat Rev Microbiol 5(12), 939-951. Fattahian, Y., I. Rasooli, S. L. Mousavi Gargari, M. R. Rahbar, S. Darvish Alipour Astaneh & J. Amani (2011). "Protection against Acinetobacter baumannii infection via its functional deprivation of biofilm associated protein (Bap)." Microb Pathog 51(6), 402-406. Gaddy, J. A. & L. A. Actis (2009). "Regulation of Acinetobacter baumannii biofilm formation." Future Microbiol 4(3), 273-278. 7
254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298
Gaddy, J. A., A. P. Tomaras & L. A. Actis (2009). "The Acinetobacter baumannii 19606 OmpA protein plays a role in biofilm formation on abiotic surfaces and in the interaction of this pathogen with eukaryotic cells." Infect Immun 77(8), 3150-3160. Gallaher, T. K., S. Wu, P. Webster & R. Aguilera (2006). "Identification of biofilm proteins in non-typeable Haemophilus Influenzae." BMC Microbiol 6, 65. Goh, H. M., S. A. Beatson, M. Totsika, D. G. Moriel, M. D. Phan, J. Szubert, N. Runnegar, H. E. Sidjabat, D. L. Paterson, G. R. Nimmo other authors (2013). "Molecular analysis of the Acinetobacter baumannii biofilm-associated protein." Appl Environ Microbiol 79(21), 6535-6543. Hamidian, M., D. P. Hancock & R. M. Hall (2013). "Horizontal transfer of an ISAba125activated ampC gene between Acinetobacter baumannii strains leading to cephalosporin resistance." J Antimicrob Chemother 68(1), 244-245. Jung, J. Y., M. S. Park, S. E. Kim, B. H. Park, J. Y. Son, E. Y. Kim, J. E. Lim, S. K. Lee, S. H. Lee, K. J. Lee other authors (2010). "Risk factors for multi-drug resistant Acinetobacter baumannii bacteremia in patients with colonization in the intensive care unit." BMC Infect Dis 10, 228. Lee, H. W., Y. M. Koh, J. Kim, J. C. Lee, Y. C. Lee, S. Y. Seol & D. T. Cho (2008). "Capacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to form biofilm and adhere to epithelial cell surfaces." Clin Microbiol Infect 14(1), 49-54. Lee, J. S., J. C. Lee, C. M. Lee, I. D. Jung, Y. I. Jeong, E. Y. Seong, H. Y. Chung & Y. M. Park (2007). "Outer membrane protein A of Acinetobacter baumannii induces differentiation of CD4+ T cells toward a Th1 polarizing phenotype through the activation of dendritic cells." Biochem Pharmacol 74(1), 86-97. Loehfelm, T. W., N. R. Luke & A. A. Campagnari (2008). "Identification and characterization of an Acinetobacter baumannii biofilm-associated protein." J Bacteriol 190(3), 1036-1044. Longo, F., C. Vuotto & G. Donelli (2014). "Biofilm formation in Acinetobacter baumannii." New Microbiol 37(2), 119-127. McConnell, M. J. & J. Pachón (2011). "Expression, purification, and refolding of biologically active Acinetobacter baumannii OmpA from Escherichia coli inclusion bodies." Protein Expr Purif 77(1), 98-103. Moffatt, J. H., M. Harper, B. Adler, R. L. Nation, J. Li & J. D. Boyce (2011). "Insertion sequence ISAba11 is involved in colistin resistance and loss of lipopolysaccharide in Acinetobacter baumannii." Antimicrob Agents Chemother 55(6), 3022-3024. Munoz-Price, L. S. & R. A. Weinstein (2008). "Acinetobacter infection." N Engl J Med 358(12), 1271-1281. Obeidat, N., F. Jawdat, A. G. Al-Bakri & A. A. Shehabi (2014). "Major biologic characteristics of Acinetobacter baumannii isolates from hospital environmental and patients' respiratory tract sources." Am J Infect Control 42(4), 401-404. Perez, F., A. M. Hujer, K. M. Hujer, B. K. Decker, P. N. Rather & R. A. Bonomo (2007). "Global challenge of multidrug-resistant Acinetobacter baumannii." Antimicrobial agents and chemotherapy 51(10), 3471-3484. Poirel, L., L. Cabanne, H. Vahaboglu & P. Nordmann (2005). "Genetic environment and expression of the extended-spectrum beta-lactamase blaPER-1 gene in gram-negative bacteria." Antimicrob Agents Chemother 49(5), 1708-1713.
8
299 300 301 302 303 304 305 306 307 308 309
Ray, V. A., A. R. Morris & K. L. Visick (2012). "A semi-quantitative approach to assess biofilm formation using wrinkled colony development." J Vis Exp(64), e4035. Sechi, L. A., A. Karadenizli, A. Deriu, S. Zanetti, F. Kolayli, E. Balikci & H. Vahaboglu (2004). "PER-1 type beta-lactamase production in Acinetobacter baumannii is related to cell adhesion." Med Sci Monit 10(6), BR180-184. Shahcheraghi, F., M. Abbasalipour, M. Feizabadi, G. Ebrahimipour & N. Akbari (2011). "Isolation and genetic characterization of metallo-β-lactamase and carbapenamase producing strains of Acinetobacter baumannii from patients at Tehran hospitals." Iran J Microbiol 3(2), 68-74.
310
Figure legends
311 312 313
Fig. 1. Western blot obtained using AbOmpA and Bap-specific antiserum showing expression of AbOmpA (38kDa) and Bap (~200 kDa) in A. baumannii from whole-cell lysates which have been showed in Fig. 1a and Fig. 1b respectively.
314 315 316
FIG. 2. Wrinkled colony morphology typing of clinical isolates has been categorized into four types (A, B, C, and D) as have been tagged in figures. The background of colonies in the presence of light, ground state of bacteria involved in molecular matrix and thickness of colony surrounding are different among clinical isolates.
317 318
Table. 1 The primers list was used in this study Primer name
Sequence (5ʹ →3ʹ ) *
Position†
Annealing temperature (°C)
DNA amplicon size (bp)
ompAF ompAR
GCTACTATGCTTGTTGCTGCT CGCTTCTTGACCAGGTTGAAC
25-45 1027 -1047
60
1023
This study This study
bapF bapR
ATGCCTGAGATACAAATTAT GTCAATCGTAAAGGTAACG
1-20 1431-1449
59
1449
This study This study
blaPER1F blaPER1R
CATTATAAAAGCTGTAGTTACTG TTTATGTGCGACCACAGTAC
9 -31 698 -717
55
709
This study This study
AbOmpF AbOmpR
ATTCGAATTCGCTACTATGCTTGTTGCTGCT ATGTAAGCTTCGCTTCTTGACCAGGTTGAAC
25-45 1027 -1047
62
1043
This study This study
BapF BapR
GTCGAGAATTCATGCCTGAGATACAAATTAT TGACAAGCTTGTCAATCGTAAAGGTAACG
1-20 1431-1449
61
1470
This study This study
Reference
319
* Forward and reverse primers of AbOmp and Bap had underlined 5´-end EcoRI and HindIII restriction sites respectively.
320 321
†ompA was according to accession number AY485227; bap was according to accession number EU117203.1; blaPER-1 was according to accession number EF535600.1 in GenBank database (http://www.ncbi.nlm.nih.gov/genbank/).
322 323 324 9
325 326
Table 2. The information of 27 multidrug-resistant clinical isolates selected from a collection of Acinteobacter baumannii samples Strain
Clinical region/ Date
Isolation source/ Gender
Wrinkled colony type
Biofilm formation
ompA/bap/blaPER1 gene
Bap expression†
AbOmpA expression
AB-7 AB-20 AB-22 AB-26 AB-27 AB-44 AB-47 AB-64 AB-66 AB-74 AB-79 AB-83 AB-89 AB-94 AB-98 AB-99 AB-100 AB-101 AB-107 AB-122 AB-123 AB-124 AB-127 AB-130 AB-132 AB-133 AB-136
A/2008 B/2008 C/2008 C/2008 C/2008 C/2008 A/2008 B/2008 C/2008 C/2008 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009 C/2009
Blood/Female Blood/Male Throat/Male Urine/Female Blood/Male Blood/Female Blood/Male Throat/Male Blood/Male Sputum/Male Blood/Male Blood/Male Throat/Female Throat/Male Sputum/Male Throat/Female Sputum/Male Blood/Female Blood/Male Wound/Female Blood/Female Blood/Male Blood/Female Blood/Male Throat/Male Throat/Male Blood/Female
D B C D B B D B A A D B D B A C D D D C D B B A C A B
+ + +++ + ++ + ++ + ++ + ++ +++ + + +++ ++ ++ +++ ++ ++
+/-/+ +/+/+/-*/+ +/+/+/-/+ +/+/+/-/+/-/+ +/-/+ +/+/+/-/+/-/+ +/-/+ +/+/+/-/+ +/-/+ +/-/+ +/-/+/-/+/-*/+ +/+/+/-/+/-/+/-/+/-/+ +/+/+/+/-
ND + + ND + ND ND ND + ND ND ND + ND ND ND ND ND + ND ND ND ND + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + +
327
* bap gene was disrupted by ISAba125.
328
† ND means not determined.
10
Figure 1a Click here to download Figure: Fig 1a.tif
Figure 1b Click here to download Figure: Fig 1b.tif
Figure 2a Click here to download Figure: Fig 2a.tif
Figure 2b Click here to download Figure: Fig 2b.tif
Figure 2c Click here to download Figure: Fig 2c.tif
Figure 2d Click here to download Figure: Fig 2d.tif
