crossmark
Molecular Epidemiology and Genetic Characteristics of Various blaPER Genes in Shanghai, China Lianyan Xie,a Jun Wu,b Fangfang Zhang,a Lizhong Han,a Xiaokui Guo,c Yuxing Ni,a Jingyong Suna Department of Clinical Microbiology, Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, Chinaa; Department of Critical Care Medicine, Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, Chinab; Department of Medical Microbiology and Parasitology, Institutes of Medical Sciences, Shanghai Jiaotong University School of Medicine, Shanghai, Chinac
We describe the genetic characteristics and possible transmission mechanism of blaPER in 25 clinical Gram-negative bacilli in Shanghai. blaPER, including blaPER-1, blaPER-3, and blaPER-4, was located chromosomally or in different plasmids. Tn1213 harboring blaPER-1 was first identified in two Proteus mirabilis isolates in China. The other blaPER variants were preceded by an ISCR1 element inside the complex class 1 integron associated with IS26, Tn21, Tn1696, and a miniature inverted-repeat transposable element.
P
ER-encoding genes have been predominantly detected in nonfermenting Gram-negative bacilli, such as Pseudomonas aeruginosa (1), Acinetobacter baumannii (2), and Alcaligenes faecalis (3), and in clinical Enterobacteriaceae isolates, including Salmonella enterica serotype Typhimurium (4), Klebsiella pneumonia (5), Enterobacter cloacae (6), Providencia stuartii (7), and Proteus mirabilis (8). PER-1, an extended-spectrum -lactamase (ESBL) that was first identified in the P. aeruginosa strain RNL-1, hydrolyzes some oxyimino-cephalosporins and is inhibited by clavulanic acid and tazobactam (9). In total, eight PER variants have been reported worldwide and classified into two groups based on their similarity to PER-1. The first subgroup (PER-3, PER-4, PER-5, PER-7, and PER-8) is formed by replacing one or four amino acids in PER-1, and the other subgroup (PER-2 and PER-6) has only 86% similarity to PER-1 (6). Although PER-1 is prevalent in Europe and Asia (10–12), PER-2 has only been reported in South America, and PER-3, PER-6, and PER-7 have only been found sporadically (13–16). Diverse mechanisms are responsible for the dissemination and acquisition of blaPER. Previous studies reported that blaPER-1 was a part of the composite transposon Tn1213 located in a chromosome or carried by plasmids (17). Recently, the ISCR1 element inside a sul1-type integron structure was found to play a role in the dissemination of blaPER-1, blaPER-3, and blaPER-7 (14, 16, 18). In total, 458 consecutive nonduplicated Gram-negative bacilli resistant to ceftazidime and cefotaxime were isolated from Ruijin Hospital, Shanghai, China, between June 2011 and January 2014 and identified using a Vitek 2 Compact system (bioMérieux, Marcy L’Etoile, France). Among them, 25 (5.5%, 25/458) Gramnegative bacillus isolates (8 P. mirabilis, 6 P. aeruginosa, 6 A. baumannii, 1 Aeromonas hydrophila, 1 Acinetobacter lwoffii, 1 Providencia rettgeri, 1 Morganella morganii, and 1 E. cloacae) were identified as PER-type -lactamase producers by PCR with specific primers (16). The sequencing analysis revealed that 20 (80%) harbored blaPER-1, 1 (4%) harbored blaPER-3, and 4 (16%) harbored blaPER-4 (Table 1). blaPER-1 was previously detected in China in A. baumannii, P. aeruginosa, Acinetobacter johnsonii, Vibrio cholerae, and Vibrio parahaemolyticus isolates (11, 18–20). blaPER-3 was previously detected in Southern Taiwan in 2 Aeromonas caviae blood isolates (21). blaPER-4 was first detected in China and
June 2016 Volume 60 Number 6
was identical to that identified in Bulgaria in Proteus vulgaris (GenBank accession no. EU748544). Pulsed-field gel electrophoresis (PFGE) typing of isolates was then performed using CHEF Mapper XA system (Bio-Rad, Hercules, CA, USA) for 18 h at 14°C. P. mirabilis and A. baumannii were digested with ApaI, P. aeruginosa with SpeI (22, 23), and Salmonella enterica serotype Braenderup H9812 with XbaI, where the latter was used as a molecular size marker. As a result, eight blaPER-harboring P. mirabilis isolates showed seven different PFGE profiles, six blaPER-harboring P. aeruginosa showed four different PFGE profiles (three were considered subtypes of the same profile), and six blaPER-harboring A. baumannii isolates showed three different PFGE profiles (Fig. 1; Table 1). Southern hybridization of S1 digests with blaPER-specific probes was positive for 10 isolates (1 P. mirabilis, 5 P. aeruginosa, 1 A. hydrophila, 1 A. lwoffii, 1 P. rettgeri, and 1 E. cloacae) and negative for the remaining 15 isolates, suggesting that blaPER was located chromosomally. To confirm these results, I-CeuI PFGE profiles were hybridized with blaPER-specific probes and subsequently with 16S rRNA gene probes. The hybridization results corroborated that blaPER in 7 P. mirabilis isolates was located chromosomally. Eight isolates, including 1 P. aeruginosa, 6 A. baumannii, and 1 M. morganii, did not hybridize with S1 or I-CeuI-restricted fragments; they only hybridized with ApaI-, SpeI-, and XbaIrestricted fragments, respectively (Table 1). The conjugational transfer potential of ceftazidime resistance using Escherichia coli J53Azr (sodium azide resistant) as a recipient demonstrated that only P. mirabilis RJ635 transferred the blaPER-harboring plasmid to E. coli J53Azr. In this study, blaPER was either located in a chro-
Received 31 January 2016 Returned for modification 29 February 2016 Accepted 21 March 2016 Accepted manuscript posted online 11 April 2016 Citation Xie L, Wu J, Zhang F, Han L, Guo X, Ni Y, Sun J. 2016. Molecular epidemiology and genetic characteristics of various blaPER genes in Shanghai, China. Antimicrob Agents Chemother 60:3849 –3853. doi:10.1128/AAC.00258-16. Address correspondence to Jingyong Sun, [email protected]. L.X. and J.W. contributed equally to this article. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Antimicrobial Agents and Chemotherapy
aac.asm.org
3849
Xie et al.
TABLE 1 Genetic relatedness and genetic location of blaPER variants identified in clinical Gram-negative bacilli isolated in Shanghai, China Identification no.
Bacterium
Date of isolation (mo/yr)
Departmenta
PER identified by sequencing
PFGEb
Locationc
RJ38 RJ 619 RJ 5 RJ 8 RJ 679 RJ 48 RJ 727 RJ 635 RJ 242 RJ 246 RJ 248 RJ 249 RJ 250 RJ 252 RJ 216 RJ 232 RJ 278 RJ 305 RJ 451 RJ 458 RJ 604 RJ673 RJ 746 RJ 716 RJ 443
P. mirabilis P. mirabilis P. mirabilis P. mirabilis P. mirabilis P. mirabilis P. mirabilis P. mirabilis P. aeruginosa P. aeruginosa P. aeruginosa P. aeruginosa P. aeruginosa P. aeruginosa A. baumannii A. baumannii A. baumannii A. baumannii A. baumannii A. baumannii A. hydrophila A. lwoffii P. rettgeri M. morganii E. cloacae
12/2012 11/2011 6/2012 8/2012 11/2011 2/2012 7/2011 11/2011 2/2012 6/2013 12/2012 10/2012 12/2012 8/2013 12/2013 12/2013 1/2014 1/2014 8/2011 6/2012 10/2013 7/2012 6/2011 6/2012 3/2013
Pneumology Nephrology Transplantation Transplantation Nephrology Emergency Emergency Emergency Neurology SICU RICU RICU RICU SICU Burn surgery Burn surgery Burn surgery Burn surgery Nephrology Burn surgery Emergency Thoracic surgery Emergency Emergency SICU
PER-1 PER-1 PER-4 PER-4 PER-1 PER-1 PER-1 PER-1 PER-4 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-3 PER-1 PER-1 PER-1 PER-4
ApaI-A1 ApaI-A2 ApaI-A3 ApaI-A3 ApaI-A4 ApaI-A5 ApaI-A6 ApaI-A7 SpeI-B1 SpeI-B2 SpeI-B3a SpeI-B3b SpeI-B3b SpeI-B4 ApaI-C1 ApaI-C1 ApaI-C1 ApaI-C1 ApaI-C2 ApaI-C3 ND ND ND ND ND
Chromosome Chromosome Chromosome Chromosome Chromosome Chromosome Chromosome Plasmid Unknown Plasmid Plasmid Plasmid Plasmid Plasmid Unknown Unknown Unknown Unknown Unknown Unknown Plasmid Plasmid Plasmid Unknown Plasmid
Plasmid size (kb)
⬃175 ⬃400 ⬃80 ⬃80 ⬃80 ⬃440
⬃173 ⬃260 ⬃180 ⬃305
a
SICU, surgical intensive care unit; RICU, respiratory intensive care unit. b Pulsed-field gel electrophoresis (PFGE) profiles named by the corresponding restriction endonuclease, a letter, and a consecutive number. ND, not done. c Unknown, blaPER gene neither located in a chromosome nor carried by a plasmid, but hybridized with ApaI-, SpeI-, and XbaI-restricted fragments.
mosome or carried by different plasmids (80 to 440 kb) (Table 1). Only one blaPER-carrying plasmid was transferred by conjugation, suggesting that conjugative plasmids might not be the main channel of gene transmission.
Differences in the genetic environment of blaPER were also observed among the 25 isolates by overlapping PCR with sequencespecific primers (Table 2). The PCR products were purified and sequenced. The nucleotide sequences were compared using
FIG 1 Pulsed-field gel electrophoresis (PFGE) profiles of Proteus mirabilis isolates digested with ApaI (A), Pseudomonas aeruginosa isolates digested with SpeI (B), and Acinetobacter baumannii isolates digested with ApaI (C). M, Salmonella enterica serotype Braenderup H9812 digested with XbaI and used as a molecular size marker.
3850
aac.asm.org
Antimicrobial Agents and Chemotherapy
June 2016 Volume 60 Number 6
blaPER Genes in Shanghai, China
TABLE 2 Sequence-specific primers used in this study to determine the genetic context of blaPER in clinical Gram-negative bacilli isolated in Shanghai, China Target gene or region
Primer name
Primer sequence (5= to 3=)
Reference or source
blaPER
PER-F PER-R
CCTGACGATCTGGAACCTTT GCAACCTGCGCAATGATAGC
16 16
Intl1 Upper blaPER qacE⌬1 Lower blaPER sul1 tnpR of Tn1696
Intl1 PER-UP qacE⌬1-R PER-LOW sul1-R P4
ACGAACCCAGTGGACATAA CGTCTCCCTGATACGCTTT TGCGGATGTTGCGATTACTT CGTATCAGGGAGACGAGTTTAGT TCGCTGGACCCAGATCCTTTA GCCCTTCTTTGACGAACTCCA
This work This work This work This work This work 18
IS26
IS26-F IS26-R
CCTCCCGTCGTAACAGCAAA GAAGGGTTACGCCAGTACCAG
This work This work
MITE catB3 dfrA17 dfrA12 aacC1 aacA4 blaPSE-1 blaIMP8 aadA6 aadA13 blaPER abct
UPMITE-R1 catB3-R dfrA17-R dfrA12-R aacC1-R aacA4-R PSE-1-R IMP8-R aadA6-R aadA13-R P2 P7
TTGTTTGGGATTTGGTCCTC GGGAAAGATGATGCCCAGTC TGGAAGAACACCCATAGAGT CAAAGCGATAGCGTGCGACA GGCTGATGTTGGGAGTAGGTG GGTTTCTTCTTCCCACCATCC TGCGTTCGGTCAAGGTTCTG TGGAAGGCGAGCATCGTTTG CCAAGGGACAACATCACCAT CCAAAGCCACGCTATGTTCT CTCGTCTCCCTGATACGCTTTC CCACCACATACACCATCACATCC
19 This work This work This work This work This work This work This work This work This work 18 18
BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). P. mirabilis RJ38 and RJ619 (Fig. 2, structure A) harbored a blaPER-1-gst-like structure surrounded by ISPa12 and ISPa13 of Tn1213 similar to that in P. aeruginosa RNL-1 (17). This structure has been detected in different pathogens worldwide and appears to be a common mechanism mediating the mobilization of blaPER-1 (5, 24); however, this is the first report on its detection in China. Most blaPER variants were preceded by an ISCR1 element and had genetic environments similar to those previously reported in China (18–20). The ISCR1 element is an unusual insertion sequence belonging to the IS91 family that probably mobilizes adjacent DNA sequences (25). Partridge and Hall confirmed that a small circular molecule containing ISCR1-dfrA10-sul1 could be transposed into a plasmid within the 3=-conserved sequence (CS) of a cloned class 1 integron in vitro (26). Li et al. first identified the circular molecule with ISCR1-blaNDM-1-3=-CS in a clinical E. coli strain by Southern hybridization (27), and Li et al. and Wu et al. reported the existence of ISCR1-blaPER-1-3=-CS in V. cholerae and V. parahaemolyticus using PCR with inverse primers (18, 20). In this study, a free circular molecule bearing the ISCR1-blaPER structure was identified in all ISCR1-related isolates by PCR with a pair of inverse primers (Table 2). All amplicons were purified and sequenced to elucidate the structure of blaPER-ISCR1-qacE⌬1/sul1(3=-CS2)-abct, the same results as our previous report (18). Therefore, ISCR1-blaPER-1-3=-CS might actually mediate formation of the complex class 1 integron. The universal existence of a circular intermediate suggests that it is a powerful genetic vehicle during the dissemination of blaPER. In 18 nonrepetitive isolates, we identified 13 complex class 1 integrons with different arrays of gene cassettes (Fig. 2, structures B to N). Previous studies in China also observed variations in gene cassettes upstream of ISCR1-blaPER (Fig. 2, structures O to R).
June 2016 Volume 60 Number 6
However, the region downstream of the ISCR1 element displayed significant similarity in all isolates. The differences on the righthand side of ISCR1 can be partly attributed to the loss and acquisition of the ISCR1-blaPER-1-3=-CS structure. Recent studies have shown that the complex class 1 integron harboring ISCR1-blaPER-1 is preceded by a miniature invertedrepeat transposable element (MITE) in A. johnsonii XBB1, Tn1696 in non-O1, non-O139 V. cholerae RJ354, and IS26 in V. parahaemolyticus V36 (18–20). These three mobile elements were also detected in our study; 17 isolates were associated with IS26, which can be freely inserted into different sites of Tn21 and intI1, 1 isolate with MITE, and 1 isolate with Tn1696. In particular, P. mirabilis RJ48, RJ727, and RJ635, in which blaPER was either located in a chromosome or carried by plasmids of different sizes, had identical complex class 1 integrons preceded by IS26 inserted into an incomplete Tn21 (Fig. 2, structure C). Moreover, M. morganii RJ716 and P. rettgeri RJ746 had the same complex class 1 integrons mediated by IS26 and tnpM-Tn21 (Fig. 2, structure E), and P. aeruginosa RJ246 and RJ252, which had different PFGE profiles (blaPER carried by different plasmids), had identical complex class 1 integrons with unknown mobile segments (Fig. 2, structure L). These results suggest that diverse mobile genetic elements (IS26, Tn21, MITE, and Tn1696) contribute to the horizontal dissemination of blaPER through the transfer of the complete complex class 1 integrons. In conclusion, blaPER genes are widespread in Gram-negative bacilli in China. Our results indicate that ISCR1 plays a major role in the mobilization of blaPER among clinical bacterial pathogens, forming a circular molecule. Moreover, diverse and complex mobile genetic elements, such as IS26, Tn21, MITE, and Tn1696, may
Antimicrobial Agents and Chemotherapy
aac.asm.org
3851
Xie et al.
FIG 2 Genetic environment of blaPER in clinical Gram-negative bacilli isolated in Shanghai, China. Structure A in Proteus mirabilis RJ38 and RJ619; structure B in Acinetobacter baumannii RJ216, RJ232, RJ278, and RJ305; structure C in P. mirabilis RJ48, RJ727, and RJ635; structure D in Aeromonas hydrophila RJ604; structure E in Morganella morganii RJ716 and Providencia rettgeri RJ746; structure F in Enterobacter cloacae RJ443; structure G in Pseudomonas aeruginosa RJ248, RJ249, and RJ250; structure H in P. mirabilis RJ5 and RJ8; structure I in P. mirabilis RJ679; structure J in Acinetobacter lwoffii RJ673; structure K in P. aeruginosa RJ242; structure L in P. aeruginosa RJ246 and RJ252; structure M in A. baumannii RJ451; structure N in A. baumannii RJ458; structure O in Vibrio cholerae RJ354 (GenBank accession no. KP076293); structure P in Vibrio parahaemolyticus V36 (GenBank accession no. KP688397); structure Q in Acinetobacter johnsonii XBB1 (GenBank accession no. KF017283); and structure R in Aeromonas punctata 159 (GenBank accession no. GQ891757).
3852
aac.asm.org
Antimicrobial Agents and Chemotherapy
June 2016 Volume 60 Number 6
blaPER Genes in Shanghai, China
be involved in the horizontal transfer of blaPER. Additionally, this is the first report of blaPER mediated by Tn1213 in China. Nucleotide sequence accession numbers. Partial nucleotide sequences of all isolates were deposited in the GenBank database under the accession numbers KU133335 to KU133347. ACKNOWLEDGMENT This study was supported by the National Natural Science Foundation of China (grant 81472010 to Y.N.).
FUNDING INFORMATION This work, including the efforts of Yuxing Ni, was funded by National Natural Science Foundation of China (NSFC) (81472010).
REFERENCES 1. Danel F, Hall LM, Gur D, Akalin HE, Livermore DM. 1995. Transferable production of PER-1 beta-lactamase in Pseudomonas aeruginosa. J Antimicrob Chemother 35:281–294. http://dx.doi.org/10.1093/jac/35.2 .281. 2. Naas T, Bogaerts P, Bauraing C, Degheldre Y, Glupczynski Y, Nordmann P. 2006. Emergence of PER and VEB extended-spectrum betalactamases in Acinetobacter baumannii in Belgium. J Antimicrob Chemother 58:178 –182. http://dx.doi.org/10.1093/jac/dkl178. 3. Pereira M, Perilli M, Mantengoli E, Luzzaro F, Toniolo A, Rossolini GM, Amicosante G. 2000. PER-1 extended-spectrum beta-lactamase production in an Alcaligenes faecalis clinical isolate resistant to expanded-spectrum cephalosporins and monobactams from a hospital in Northern Italy. Microb Drug Resist 6:85–90. http://dx.doi.org/10.1089 /mdr.2000.6.85. 4. Bauernfeind A, Stemplinger I, Jungwirth R, Mangold P, Amann S, Akalin E, Ang O, Bal C, Casellas JM. 1996. Characterization of betalactamase gene blaPER-2, which encodes an extended-spectrum class A beta-lactamase. Antimicrob Agents Chemother 40:616 – 620. 5. Bae IK, Jang SJ, Kim J, Jeong SH, Cho B, Lee K. 2011. Interspecies dissemination of the bla gene encoding PER-1 extended-spectrum betalactamase. Antimicrob Agents Chemother 55:1305–1307. http://dx.doi .org/10.1128/AAC.00994-10. 6. Poirel L, Bonnin RA, Nordmann P. 2012. Genetic support and diversity of acquired extended-spectrum beta-lactamases in Gram-negative rods. Infect Genet Evol 12:883– 893. http://dx.doi.org/10.1016/j.meegid.2012 .02.008. 7. Poirel L, Bruderer T, Frei R, Bernabeu S, Graber P, Nordmann P. 2008. Multidrug-resistant Providencia stuartii expressing extended-spectrum beta-lactamase PER-1, originating in Kosovo. J Antimicrob Chemother 61:1392–1393. http://dx.doi.org/10.1093/jac/dkn091. 8. Pagani L, Migliavacca R, Pallecchi L, Matti C, Giacobone E, Amicosante G, Romero E, Rossolini GM. 2002. Emerging extended-spectrum betalactamases in Proteus mirabilis. J Clin Microbiol 40:1549 –1552. http://dx .doi.org/10.1128/JCM.40.4.1549-1552.2002. 9. Nordmann P, Ronco E, Naas T, Duport C, Michel-Briand Y, Labia R. 1993. Characterization of a novel extended-spectrum beta-lactamase from Pseudomonas aeruginosa. Antimicrob Agents Chemother 37:962– 969. http://dx.doi.org/10.1128/AAC.37.5.962. 10. Perilli M, De Santis F, Mugnaioli C, Rossolini GM, Luzzaro F, Stefani S, Mezzatesta ML, Toniolo A, Amicosante G. 2007. Spread of Enterobacteriaceae carrying the PER-1 extended-spectrum beta-lactamase gene as a chromosomal insert: a report from Italy. J Antimicrob Chemother 59:323–324. http://dx.doi.org/10.1093/jac/dkl487. 11. Qing Y, Cao KY, Fang ZL, Huang YM, Zhang XF, Tian GB, Huang X. 2014. Outbreak of PER-1 and diversity of beta-lactamases among ceftazidime-resistant Pseudomonas aeruginosa clinical isolates. J Med Microbiol 63:386 –392. http://dx.doi.org/10.1099/jmm.0.069427-0.
June 2016 Volume 60 Number 6
12. Yong D, Shin JH, Kim S, Lim Y, Yum JH, Lee K, Chong Y, Bauernfeind A. 2003. High prevalence of PER-1 extended-spectrum beta-lactamaseproducing Acinetobacter spp. in Korea. Antimicrob Agents Chemother 47:1749 –1751. http://dx.doi.org/10.1128/AAC.47.5.1749-1751.2003. 13. Pasterán F, Rapoport M, Petroni A, Faccone D, Corso A, Galas M, Vazquez M, Procopio A, Tokumoto M, Cagnoni V. 2006. Emergence of PER-2 and VEB-1a in Acinetobacter baumannii strains in the Americas. Antimicrob Agents Chemother 50:3222–3224. http://dx.doi.org/10.1128 /AAC.00284-06. 14. Al-Hassan L, El Mahallawy H, Amyes SG. 2013. First report of blaPER-3 in Acinetobacter baumannii. Int J Antimicrob Agents 41:93–94. http://dx .doi.org/10.1016/j.ijantimicag.2012.09.010. 15. Girlich D, Poirel L, Nordmann P. 2010. PER-6, an extended-spectrum beta-lactamase from Aeromonas allosaccharophila. Antimicrob Agents Chemother 54:1619 –1622. http://dx.doi.org/10.1128/AAC.01585-09. 16. Opazo A, Sonnevend A, Lopes B, Hamouda A, Ghazawi A, Pal T, Amyes SG. 2012. Plasmid-encoded PER-7 beta-lactamase responsible for ceftazidime resistance in Acinetobacter baumannii isolated in the United Arab Emirates. J Antimicrob Chemother 67:1619 –1622. http://dx.doi.org /10.1093/jac/dks087. 17. Poirel L, Cabanne L, Vahaboglu H, Nordmann P. 2005. Genetic environment and expression of the extended-spectrum beta-lactamase blaPER-1 gene in Gram-negative bacteria. Antimicrob Agents Chemother 49: 1708 –1713. http://dx.doi.org/10.1128/AAC.49.5.1708-1713.2005. 18. Wu J, Xie L, Zhang F, Ni Y, Sun J. 2015. Molecular characterization of ISCR1-mediated blaPER-1 in a non-O1, non-O139 Vibrio cholerae strain from China. Antimicrob Agents Chemother 59:4293– 4295. http://dx.doi .org/10.1128/AAC.00166-15. 19. Zong Z. 2014. The complex genetic context of blaPER-1 flanked by miniature inverted-repeat transposable elements in Acinetobacter johnsonii. PLoS One 9:e90046. http://dx.doi.org/10.1371/journal.pone.0090046. 20. Li R, Wong MH, Zhou Y, Chan EW, Chen S. 2015. Complete nucleotide sequence of a conjugative plasmid carrying blaPER-1. Antimicrob Agents Chemother 59:3582–3584. http://dx.doi.org/10.1128/AAC.00518-15. 21. Wu CJ, Chuang YC, Lee MF, Lee CC, Lee HC, Lee NY, Chang CM, Chen PL, Lin YT, Yan JJ, Ko WC. 2011. Bacteremia due to extendedspectrum-beta-lactamase-producing Aeromonas spp. at a medical center in Southern Taiwan. Antimicrob Agents Chemother 55:5813–5818. http: //dx.doi.org/10.1128/AAC.00634-11. 22. Hu YY, Cai JC, Zhang R, Zhou HW, Sun Q, Chen GX. 2012. Emergence of Proteus mirabilis harboring blaKPC-2 and qnrD in a Chinese hospital. Antimicrob Agents Chemother 56:2278 –2282. http://dx.doi.org/10.1128 /AAC.05519-11. 23. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33:2233–2239. 24. Ranellou K, Kadlec K, Poulou A, Voulgari E, Vrioni G, Schwarz S, Tsakris A. 2012. Detection of Pseudomonas aeruginosa isolates of the international clonal complex 11 carrying the blaPER-1 extended-spectrum beta-lactamase gene in Greece. J Antimicrob Chemother 67:357–361. http://dx.doi.org/10.1093/jac/dkr471. 25. Toleman MA, Bennett PM, Walsh TR. 2006. ISCR elements: novel gene-capturing systems of the 21st century? Microbiol Mol Biol Rev 70: 296 –316. http://dx.doi.org/10.1128/MMBR.00048-05. 26. Partridge SR, Hall RM. 2003. In34, a complex In5 family class 1 integron containing Orf513 and dfrA10. Antimicrob Agents Chemother 47:342– 349. http://dx.doi.org/10.1128/AAC.47.1.342-349.2003. 27. Li J, Lan R, Xiong Y, Ye C, Yuan M, Liu X, Chen X, Yu D, Liu B, Lin W, Bai X, Wang Y, Sun Q, Wang Y, Zhao H, Meng Q, Chen Q, Zhao A, Xu J. 2014. Sequential isolation in a patient of Raoultella planticola and Escherichia coli bearing a novel ISCR1 element carrying blaNDM-1. PLoS One 9:e89893. http://dx.doi.org/10.1371/journal.pone.0089893.
Antimicrobial Agents and Chemotherapy
aac.asm.org
3853
Molecular Epidemiology and Genetic Characteristics of Various blaPER Genes in Shanghai, China Lianyan Xie,a Jun Wu,b Fangfang Zhang,a Lizhong Han,a Xiaokui Guo,c Yuxing Ni,a Jingyong Suna Department of Clinical Microbiology, Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, Chinaa; Department of Critical Care Medicine, Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, Chinab; Department of Medical Microbiology and Parasitology, Institutes of Medical Sciences, Shanghai Jiaotong University School of Medicine, Shanghai, Chinac
We describe the genetic characteristics and possible transmission mechanism of blaPER in 25 clinical Gram-negative bacilli in Shanghai. blaPER, including blaPER-1, blaPER-3, and blaPER-4, was located chromosomally or in different plasmids. Tn1213 harboring blaPER-1 was first identified in two Proteus mirabilis isolates in China. The other blaPER variants were preceded by an ISCR1 element inside the complex class 1 integron associated with IS26, Tn21, Tn1696, and a miniature inverted-repeat transposable element.
P
ER-encoding genes have been predominantly detected in nonfermenting Gram-negative bacilli, such as Pseudomonas aeruginosa (1), Acinetobacter baumannii (2), and Alcaligenes faecalis (3), and in clinical Enterobacteriaceae isolates, including Salmonella enterica serotype Typhimurium (4), Klebsiella pneumonia (5), Enterobacter cloacae (6), Providencia stuartii (7), and Proteus mirabilis (8). PER-1, an extended-spectrum -lactamase (ESBL) that was first identified in the P. aeruginosa strain RNL-1, hydrolyzes some oxyimino-cephalosporins and is inhibited by clavulanic acid and tazobactam (9). In total, eight PER variants have been reported worldwide and classified into two groups based on their similarity to PER-1. The first subgroup (PER-3, PER-4, PER-5, PER-7, and PER-8) is formed by replacing one or four amino acids in PER-1, and the other subgroup (PER-2 and PER-6) has only 86% similarity to PER-1 (6). Although PER-1 is prevalent in Europe and Asia (10–12), PER-2 has only been reported in South America, and PER-3, PER-6, and PER-7 have only been found sporadically (13–16). Diverse mechanisms are responsible for the dissemination and acquisition of blaPER. Previous studies reported that blaPER-1 was a part of the composite transposon Tn1213 located in a chromosome or carried by plasmids (17). Recently, the ISCR1 element inside a sul1-type integron structure was found to play a role in the dissemination of blaPER-1, blaPER-3, and blaPER-7 (14, 16, 18). In total, 458 consecutive nonduplicated Gram-negative bacilli resistant to ceftazidime and cefotaxime were isolated from Ruijin Hospital, Shanghai, China, between June 2011 and January 2014 and identified using a Vitek 2 Compact system (bioMérieux, Marcy L’Etoile, France). Among them, 25 (5.5%, 25/458) Gramnegative bacillus isolates (8 P. mirabilis, 6 P. aeruginosa, 6 A. baumannii, 1 Aeromonas hydrophila, 1 Acinetobacter lwoffii, 1 Providencia rettgeri, 1 Morganella morganii, and 1 E. cloacae) were identified as PER-type -lactamase producers by PCR with specific primers (16). The sequencing analysis revealed that 20 (80%) harbored blaPER-1, 1 (4%) harbored blaPER-3, and 4 (16%) harbored blaPER-4 (Table 1). blaPER-1 was previously detected in China in A. baumannii, P. aeruginosa, Acinetobacter johnsonii, Vibrio cholerae, and Vibrio parahaemolyticus isolates (11, 18–20). blaPER-3 was previously detected in Southern Taiwan in 2 Aeromonas caviae blood isolates (21). blaPER-4 was first detected in China and
June 2016 Volume 60 Number 6
was identical to that identified in Bulgaria in Proteus vulgaris (GenBank accession no. EU748544). Pulsed-field gel electrophoresis (PFGE) typing of isolates was then performed using CHEF Mapper XA system (Bio-Rad, Hercules, CA, USA) for 18 h at 14°C. P. mirabilis and A. baumannii were digested with ApaI, P. aeruginosa with SpeI (22, 23), and Salmonella enterica serotype Braenderup H9812 with XbaI, where the latter was used as a molecular size marker. As a result, eight blaPER-harboring P. mirabilis isolates showed seven different PFGE profiles, six blaPER-harboring P. aeruginosa showed four different PFGE profiles (three were considered subtypes of the same profile), and six blaPER-harboring A. baumannii isolates showed three different PFGE profiles (Fig. 1; Table 1). Southern hybridization of S1 digests with blaPER-specific probes was positive for 10 isolates (1 P. mirabilis, 5 P. aeruginosa, 1 A. hydrophila, 1 A. lwoffii, 1 P. rettgeri, and 1 E. cloacae) and negative for the remaining 15 isolates, suggesting that blaPER was located chromosomally. To confirm these results, I-CeuI PFGE profiles were hybridized with blaPER-specific probes and subsequently with 16S rRNA gene probes. The hybridization results corroborated that blaPER in 7 P. mirabilis isolates was located chromosomally. Eight isolates, including 1 P. aeruginosa, 6 A. baumannii, and 1 M. morganii, did not hybridize with S1 or I-CeuI-restricted fragments; they only hybridized with ApaI-, SpeI-, and XbaIrestricted fragments, respectively (Table 1). The conjugational transfer potential of ceftazidime resistance using Escherichia coli J53Azr (sodium azide resistant) as a recipient demonstrated that only P. mirabilis RJ635 transferred the blaPER-harboring plasmid to E. coli J53Azr. In this study, blaPER was either located in a chro-
Received 31 January 2016 Returned for modification 29 February 2016 Accepted 21 March 2016 Accepted manuscript posted online 11 April 2016 Citation Xie L, Wu J, Zhang F, Han L, Guo X, Ni Y, Sun J. 2016. Molecular epidemiology and genetic characteristics of various blaPER genes in Shanghai, China. Antimicrob Agents Chemother 60:3849 –3853. doi:10.1128/AAC.00258-16. Address correspondence to Jingyong Sun, [email protected]. L.X. and J.W. contributed equally to this article. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Antimicrobial Agents and Chemotherapy
aac.asm.org
3849
Xie et al.
TABLE 1 Genetic relatedness and genetic location of blaPER variants identified in clinical Gram-negative bacilli isolated in Shanghai, China Identification no.
Bacterium
Date of isolation (mo/yr)
Departmenta
PER identified by sequencing
PFGEb
Locationc
RJ38 RJ 619 RJ 5 RJ 8 RJ 679 RJ 48 RJ 727 RJ 635 RJ 242 RJ 246 RJ 248 RJ 249 RJ 250 RJ 252 RJ 216 RJ 232 RJ 278 RJ 305 RJ 451 RJ 458 RJ 604 RJ673 RJ 746 RJ 716 RJ 443
P. mirabilis P. mirabilis P. mirabilis P. mirabilis P. mirabilis P. mirabilis P. mirabilis P. mirabilis P. aeruginosa P. aeruginosa P. aeruginosa P. aeruginosa P. aeruginosa P. aeruginosa A. baumannii A. baumannii A. baumannii A. baumannii A. baumannii A. baumannii A. hydrophila A. lwoffii P. rettgeri M. morganii E. cloacae
12/2012 11/2011 6/2012 8/2012 11/2011 2/2012 7/2011 11/2011 2/2012 6/2013 12/2012 10/2012 12/2012 8/2013 12/2013 12/2013 1/2014 1/2014 8/2011 6/2012 10/2013 7/2012 6/2011 6/2012 3/2013
Pneumology Nephrology Transplantation Transplantation Nephrology Emergency Emergency Emergency Neurology SICU RICU RICU RICU SICU Burn surgery Burn surgery Burn surgery Burn surgery Nephrology Burn surgery Emergency Thoracic surgery Emergency Emergency SICU
PER-1 PER-1 PER-4 PER-4 PER-1 PER-1 PER-1 PER-1 PER-4 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-1 PER-3 PER-1 PER-1 PER-1 PER-4
ApaI-A1 ApaI-A2 ApaI-A3 ApaI-A3 ApaI-A4 ApaI-A5 ApaI-A6 ApaI-A7 SpeI-B1 SpeI-B2 SpeI-B3a SpeI-B3b SpeI-B3b SpeI-B4 ApaI-C1 ApaI-C1 ApaI-C1 ApaI-C1 ApaI-C2 ApaI-C3 ND ND ND ND ND
Chromosome Chromosome Chromosome Chromosome Chromosome Chromosome Chromosome Plasmid Unknown Plasmid Plasmid Plasmid Plasmid Plasmid Unknown Unknown Unknown Unknown Unknown Unknown Plasmid Plasmid Plasmid Unknown Plasmid
Plasmid size (kb)
⬃175 ⬃400 ⬃80 ⬃80 ⬃80 ⬃440
⬃173 ⬃260 ⬃180 ⬃305
a
SICU, surgical intensive care unit; RICU, respiratory intensive care unit. b Pulsed-field gel electrophoresis (PFGE) profiles named by the corresponding restriction endonuclease, a letter, and a consecutive number. ND, not done. c Unknown, blaPER gene neither located in a chromosome nor carried by a plasmid, but hybridized with ApaI-, SpeI-, and XbaI-restricted fragments.
mosome or carried by different plasmids (80 to 440 kb) (Table 1). Only one blaPER-carrying plasmid was transferred by conjugation, suggesting that conjugative plasmids might not be the main channel of gene transmission.
Differences in the genetic environment of blaPER were also observed among the 25 isolates by overlapping PCR with sequencespecific primers (Table 2). The PCR products were purified and sequenced. The nucleotide sequences were compared using
FIG 1 Pulsed-field gel electrophoresis (PFGE) profiles of Proteus mirabilis isolates digested with ApaI (A), Pseudomonas aeruginosa isolates digested with SpeI (B), and Acinetobacter baumannii isolates digested with ApaI (C). M, Salmonella enterica serotype Braenderup H9812 digested with XbaI and used as a molecular size marker.
3850
aac.asm.org
Antimicrobial Agents and Chemotherapy
June 2016 Volume 60 Number 6
blaPER Genes in Shanghai, China
TABLE 2 Sequence-specific primers used in this study to determine the genetic context of blaPER in clinical Gram-negative bacilli isolated in Shanghai, China Target gene or region
Primer name
Primer sequence (5= to 3=)
Reference or source
blaPER
PER-F PER-R
CCTGACGATCTGGAACCTTT GCAACCTGCGCAATGATAGC
16 16
Intl1 Upper blaPER qacE⌬1 Lower blaPER sul1 tnpR of Tn1696
Intl1 PER-UP qacE⌬1-R PER-LOW sul1-R P4
ACGAACCCAGTGGACATAA CGTCTCCCTGATACGCTTT TGCGGATGTTGCGATTACTT CGTATCAGGGAGACGAGTTTAGT TCGCTGGACCCAGATCCTTTA GCCCTTCTTTGACGAACTCCA
This work This work This work This work This work 18
IS26
IS26-F IS26-R
CCTCCCGTCGTAACAGCAAA GAAGGGTTACGCCAGTACCAG
This work This work
MITE catB3 dfrA17 dfrA12 aacC1 aacA4 blaPSE-1 blaIMP8 aadA6 aadA13 blaPER abct
UPMITE-R1 catB3-R dfrA17-R dfrA12-R aacC1-R aacA4-R PSE-1-R IMP8-R aadA6-R aadA13-R P2 P7
TTGTTTGGGATTTGGTCCTC GGGAAAGATGATGCCCAGTC TGGAAGAACACCCATAGAGT CAAAGCGATAGCGTGCGACA GGCTGATGTTGGGAGTAGGTG GGTTTCTTCTTCCCACCATCC TGCGTTCGGTCAAGGTTCTG TGGAAGGCGAGCATCGTTTG CCAAGGGACAACATCACCAT CCAAAGCCACGCTATGTTCT CTCGTCTCCCTGATACGCTTTC CCACCACATACACCATCACATCC
19 This work This work This work This work This work This work This work This work This work 18 18
BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). P. mirabilis RJ38 and RJ619 (Fig. 2, structure A) harbored a blaPER-1-gst-like structure surrounded by ISPa12 and ISPa13 of Tn1213 similar to that in P. aeruginosa RNL-1 (17). This structure has been detected in different pathogens worldwide and appears to be a common mechanism mediating the mobilization of blaPER-1 (5, 24); however, this is the first report on its detection in China. Most blaPER variants were preceded by an ISCR1 element and had genetic environments similar to those previously reported in China (18–20). The ISCR1 element is an unusual insertion sequence belonging to the IS91 family that probably mobilizes adjacent DNA sequences (25). Partridge and Hall confirmed that a small circular molecule containing ISCR1-dfrA10-sul1 could be transposed into a plasmid within the 3=-conserved sequence (CS) of a cloned class 1 integron in vitro (26). Li et al. first identified the circular molecule with ISCR1-blaNDM-1-3=-CS in a clinical E. coli strain by Southern hybridization (27), and Li et al. and Wu et al. reported the existence of ISCR1-blaPER-1-3=-CS in V. cholerae and V. parahaemolyticus using PCR with inverse primers (18, 20). In this study, a free circular molecule bearing the ISCR1-blaPER structure was identified in all ISCR1-related isolates by PCR with a pair of inverse primers (Table 2). All amplicons were purified and sequenced to elucidate the structure of blaPER-ISCR1-qacE⌬1/sul1(3=-CS2)-abct, the same results as our previous report (18). Therefore, ISCR1-blaPER-1-3=-CS might actually mediate formation of the complex class 1 integron. The universal existence of a circular intermediate suggests that it is a powerful genetic vehicle during the dissemination of blaPER. In 18 nonrepetitive isolates, we identified 13 complex class 1 integrons with different arrays of gene cassettes (Fig. 2, structures B to N). Previous studies in China also observed variations in gene cassettes upstream of ISCR1-blaPER (Fig. 2, structures O to R).
June 2016 Volume 60 Number 6
However, the region downstream of the ISCR1 element displayed significant similarity in all isolates. The differences on the righthand side of ISCR1 can be partly attributed to the loss and acquisition of the ISCR1-blaPER-1-3=-CS structure. Recent studies have shown that the complex class 1 integron harboring ISCR1-blaPER-1 is preceded by a miniature invertedrepeat transposable element (MITE) in A. johnsonii XBB1, Tn1696 in non-O1, non-O139 V. cholerae RJ354, and IS26 in V. parahaemolyticus V36 (18–20). These three mobile elements were also detected in our study; 17 isolates were associated with IS26, which can be freely inserted into different sites of Tn21 and intI1, 1 isolate with MITE, and 1 isolate with Tn1696. In particular, P. mirabilis RJ48, RJ727, and RJ635, in which blaPER was either located in a chromosome or carried by plasmids of different sizes, had identical complex class 1 integrons preceded by IS26 inserted into an incomplete Tn21 (Fig. 2, structure C). Moreover, M. morganii RJ716 and P. rettgeri RJ746 had the same complex class 1 integrons mediated by IS26 and tnpM-Tn21 (Fig. 2, structure E), and P. aeruginosa RJ246 and RJ252, which had different PFGE profiles (blaPER carried by different plasmids), had identical complex class 1 integrons with unknown mobile segments (Fig. 2, structure L). These results suggest that diverse mobile genetic elements (IS26, Tn21, MITE, and Tn1696) contribute to the horizontal dissemination of blaPER through the transfer of the complete complex class 1 integrons. In conclusion, blaPER genes are widespread in Gram-negative bacilli in China. Our results indicate that ISCR1 plays a major role in the mobilization of blaPER among clinical bacterial pathogens, forming a circular molecule. Moreover, diverse and complex mobile genetic elements, such as IS26, Tn21, MITE, and Tn1696, may
Antimicrobial Agents and Chemotherapy
aac.asm.org
3851
Xie et al.
FIG 2 Genetic environment of blaPER in clinical Gram-negative bacilli isolated in Shanghai, China. Structure A in Proteus mirabilis RJ38 and RJ619; structure B in Acinetobacter baumannii RJ216, RJ232, RJ278, and RJ305; structure C in P. mirabilis RJ48, RJ727, and RJ635; structure D in Aeromonas hydrophila RJ604; structure E in Morganella morganii RJ716 and Providencia rettgeri RJ746; structure F in Enterobacter cloacae RJ443; structure G in Pseudomonas aeruginosa RJ248, RJ249, and RJ250; structure H in P. mirabilis RJ5 and RJ8; structure I in P. mirabilis RJ679; structure J in Acinetobacter lwoffii RJ673; structure K in P. aeruginosa RJ242; structure L in P. aeruginosa RJ246 and RJ252; structure M in A. baumannii RJ451; structure N in A. baumannii RJ458; structure O in Vibrio cholerae RJ354 (GenBank accession no. KP076293); structure P in Vibrio parahaemolyticus V36 (GenBank accession no. KP688397); structure Q in Acinetobacter johnsonii XBB1 (GenBank accession no. KF017283); and structure R in Aeromonas punctata 159 (GenBank accession no. GQ891757).
3852
aac.asm.org
Antimicrobial Agents and Chemotherapy
June 2016 Volume 60 Number 6
blaPER Genes in Shanghai, China
be involved in the horizontal transfer of blaPER. Additionally, this is the first report of blaPER mediated by Tn1213 in China. Nucleotide sequence accession numbers. Partial nucleotide sequences of all isolates were deposited in the GenBank database under the accession numbers KU133335 to KU133347. ACKNOWLEDGMENT This study was supported by the National Natural Science Foundation of China (grant 81472010 to Y.N.).
FUNDING INFORMATION This work, including the efforts of Yuxing Ni, was funded by National Natural Science Foundation of China (NSFC) (81472010).
REFERENCES 1. Danel F, Hall LM, Gur D, Akalin HE, Livermore DM. 1995. Transferable production of PER-1 beta-lactamase in Pseudomonas aeruginosa. J Antimicrob Chemother 35:281–294. http://dx.doi.org/10.1093/jac/35.2 .281. 2. Naas T, Bogaerts P, Bauraing C, Degheldre Y, Glupczynski Y, Nordmann P. 2006. Emergence of PER and VEB extended-spectrum betalactamases in Acinetobacter baumannii in Belgium. J Antimicrob Chemother 58:178 –182. http://dx.doi.org/10.1093/jac/dkl178. 3. Pereira M, Perilli M, Mantengoli E, Luzzaro F, Toniolo A, Rossolini GM, Amicosante G. 2000. PER-1 extended-spectrum beta-lactamase production in an Alcaligenes faecalis clinical isolate resistant to expanded-spectrum cephalosporins and monobactams from a hospital in Northern Italy. Microb Drug Resist 6:85–90. http://dx.doi.org/10.1089 /mdr.2000.6.85. 4. Bauernfeind A, Stemplinger I, Jungwirth R, Mangold P, Amann S, Akalin E, Ang O, Bal C, Casellas JM. 1996. Characterization of betalactamase gene blaPER-2, which encodes an extended-spectrum class A beta-lactamase. Antimicrob Agents Chemother 40:616 – 620. 5. Bae IK, Jang SJ, Kim J, Jeong SH, Cho B, Lee K. 2011. Interspecies dissemination of the bla gene encoding PER-1 extended-spectrum betalactamase. Antimicrob Agents Chemother 55:1305–1307. http://dx.doi .org/10.1128/AAC.00994-10. 6. Poirel L, Bonnin RA, Nordmann P. 2012. Genetic support and diversity of acquired extended-spectrum beta-lactamases in Gram-negative rods. Infect Genet Evol 12:883– 893. http://dx.doi.org/10.1016/j.meegid.2012 .02.008. 7. Poirel L, Bruderer T, Frei R, Bernabeu S, Graber P, Nordmann P. 2008. Multidrug-resistant Providencia stuartii expressing extended-spectrum beta-lactamase PER-1, originating in Kosovo. J Antimicrob Chemother 61:1392–1393. http://dx.doi.org/10.1093/jac/dkn091. 8. Pagani L, Migliavacca R, Pallecchi L, Matti C, Giacobone E, Amicosante G, Romero E, Rossolini GM. 2002. Emerging extended-spectrum betalactamases in Proteus mirabilis. J Clin Microbiol 40:1549 –1552. http://dx .doi.org/10.1128/JCM.40.4.1549-1552.2002. 9. Nordmann P, Ronco E, Naas T, Duport C, Michel-Briand Y, Labia R. 1993. Characterization of a novel extended-spectrum beta-lactamase from Pseudomonas aeruginosa. Antimicrob Agents Chemother 37:962– 969. http://dx.doi.org/10.1128/AAC.37.5.962. 10. Perilli M, De Santis F, Mugnaioli C, Rossolini GM, Luzzaro F, Stefani S, Mezzatesta ML, Toniolo A, Amicosante G. 2007. Spread of Enterobacteriaceae carrying the PER-1 extended-spectrum beta-lactamase gene as a chromosomal insert: a report from Italy. J Antimicrob Chemother 59:323–324. http://dx.doi.org/10.1093/jac/dkl487. 11. Qing Y, Cao KY, Fang ZL, Huang YM, Zhang XF, Tian GB, Huang X. 2014. Outbreak of PER-1 and diversity of beta-lactamases among ceftazidime-resistant Pseudomonas aeruginosa clinical isolates. J Med Microbiol 63:386 –392. http://dx.doi.org/10.1099/jmm.0.069427-0.
June 2016 Volume 60 Number 6
12. Yong D, Shin JH, Kim S, Lim Y, Yum JH, Lee K, Chong Y, Bauernfeind A. 2003. High prevalence of PER-1 extended-spectrum beta-lactamaseproducing Acinetobacter spp. in Korea. Antimicrob Agents Chemother 47:1749 –1751. http://dx.doi.org/10.1128/AAC.47.5.1749-1751.2003. 13. Pasterán F, Rapoport M, Petroni A, Faccone D, Corso A, Galas M, Vazquez M, Procopio A, Tokumoto M, Cagnoni V. 2006. Emergence of PER-2 and VEB-1a in Acinetobacter baumannii strains in the Americas. Antimicrob Agents Chemother 50:3222–3224. http://dx.doi.org/10.1128 /AAC.00284-06. 14. Al-Hassan L, El Mahallawy H, Amyes SG. 2013. First report of blaPER-3 in Acinetobacter baumannii. Int J Antimicrob Agents 41:93–94. http://dx .doi.org/10.1016/j.ijantimicag.2012.09.010. 15. Girlich D, Poirel L, Nordmann P. 2010. PER-6, an extended-spectrum beta-lactamase from Aeromonas allosaccharophila. Antimicrob Agents Chemother 54:1619 –1622. http://dx.doi.org/10.1128/AAC.01585-09. 16. Opazo A, Sonnevend A, Lopes B, Hamouda A, Ghazawi A, Pal T, Amyes SG. 2012. Plasmid-encoded PER-7 beta-lactamase responsible for ceftazidime resistance in Acinetobacter baumannii isolated in the United Arab Emirates. J Antimicrob Chemother 67:1619 –1622. http://dx.doi.org /10.1093/jac/dks087. 17. Poirel L, Cabanne L, Vahaboglu H, Nordmann P. 2005. Genetic environment and expression of the extended-spectrum beta-lactamase blaPER-1 gene in Gram-negative bacteria. Antimicrob Agents Chemother 49: 1708 –1713. http://dx.doi.org/10.1128/AAC.49.5.1708-1713.2005. 18. Wu J, Xie L, Zhang F, Ni Y, Sun J. 2015. Molecular characterization of ISCR1-mediated blaPER-1 in a non-O1, non-O139 Vibrio cholerae strain from China. Antimicrob Agents Chemother 59:4293– 4295. http://dx.doi .org/10.1128/AAC.00166-15. 19. Zong Z. 2014. The complex genetic context of blaPER-1 flanked by miniature inverted-repeat transposable elements in Acinetobacter johnsonii. PLoS One 9:e90046. http://dx.doi.org/10.1371/journal.pone.0090046. 20. Li R, Wong MH, Zhou Y, Chan EW, Chen S. 2015. Complete nucleotide sequence of a conjugative plasmid carrying blaPER-1. Antimicrob Agents Chemother 59:3582–3584. http://dx.doi.org/10.1128/AAC.00518-15. 21. Wu CJ, Chuang YC, Lee MF, Lee CC, Lee HC, Lee NY, Chang CM, Chen PL, Lin YT, Yan JJ, Ko WC. 2011. Bacteremia due to extendedspectrum-beta-lactamase-producing Aeromonas spp. at a medical center in Southern Taiwan. Antimicrob Agents Chemother 55:5813–5818. http: //dx.doi.org/10.1128/AAC.00634-11. 22. Hu YY, Cai JC, Zhang R, Zhou HW, Sun Q, Chen GX. 2012. Emergence of Proteus mirabilis harboring blaKPC-2 and qnrD in a Chinese hospital. Antimicrob Agents Chemother 56:2278 –2282. http://dx.doi.org/10.1128 /AAC.05519-11. 23. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33:2233–2239. 24. Ranellou K, Kadlec K, Poulou A, Voulgari E, Vrioni G, Schwarz S, Tsakris A. 2012. Detection of Pseudomonas aeruginosa isolates of the international clonal complex 11 carrying the blaPER-1 extended-spectrum beta-lactamase gene in Greece. J Antimicrob Chemother 67:357–361. http://dx.doi.org/10.1093/jac/dkr471. 25. Toleman MA, Bennett PM, Walsh TR. 2006. ISCR elements: novel gene-capturing systems of the 21st century? Microbiol Mol Biol Rev 70: 296 –316. http://dx.doi.org/10.1128/MMBR.00048-05. 26. Partridge SR, Hall RM. 2003. In34, a complex In5 family class 1 integron containing Orf513 and dfrA10. Antimicrob Agents Chemother 47:342– 349. http://dx.doi.org/10.1128/AAC.47.1.342-349.2003. 27. Li J, Lan R, Xiong Y, Ye C, Yuan M, Liu X, Chen X, Yu D, Liu B, Lin W, Bai X, Wang Y, Sun Q, Wang Y, Zhao H, Meng Q, Chen Q, Zhao A, Xu J. 2014. Sequential isolation in a patient of Raoultella planticola and Escherichia coli bearing a novel ISCR1 element carrying blaNDM-1. PLoS One 9:e89893. http://dx.doi.org/10.1371/journal.pone.0089893.
Antimicrobial Agents and Chemotherapy
aac.asm.org
3853
