Molecular Epidemiology and Identification of a Staphylococcus aureus Clone Causing Food Poisoning Outbreaks in Japan
Updated information and services can be found at: http://jcm.asm.org/content/52/7/2637 These include: SUPPLEMENTAL MATERIAL REFERENCES
CONTENT ALERTS
Supplemental material This article cites 18 articles, 7 of which can be accessed free at: http://jcm.asm.org/content/52/7/2637#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://jcm.asm.org/ on July 3, 2014 by Universitaetsbibliothek Muenchen
Yusuke Sato'o, Katsuhiko Omoe, Ikunori Naito, Hisaya K. Ono, Akio Nakane, Motoyuki Sugai, Norio Yamagishi and Dong-Liang Hu J. Clin. Microbiol. 2014, 52(7):2637. DOI: 10.1128/JCM.00661-14. Published Ahead of Print 23 April 2014.
Molecular Epidemiology and Identification of a Staphylococcus aureus Clone Causing Food Poisoning Outbreaks in Japan Yusuke Sato’o,a,b Katsuhiko Omoe,a,b Ikunori Naito,a Hisaya K. Ono,a,c Akio Nakane,c Motoyuki Sugai,d Norio Yamagishi,a,b Dong-Liang Hue
Molecular characterization of isolates from staphylococcal food poisoning (SFP) outbreaks in Japan showed that the dominant lineage causing SFP outbreaks is clonal complex 81 (CC81), a single-locus variant of sequence type 1, coagulase type VII, positive for sea and/or seb, and positive for seh. Among various CC lineages producing staphylococcal enterotoxin A, CC81 showed the highest toxin productivity.
S
(10). Food handlers carrying enterotoxin-producing S. aureus in their nasal cavities or on their skin are important sources of food contamination during the cooking process (3). Contamination with S. aureus is believed to be associated primarily with improper handling of cooked or processed foods with improper storage under conditions that allow the growth of S. aureus and the production of SEs. Reports concerning the molecular epidemiology and genetic diversity of the isolates from SFP outbreaks are limited when clinical isolates are compared. In this investigation, we ex-
Received 10 March 2014 Accepted 16 April 2014 Published ahead of print 23 April 2014 Editor: G. A. Land Address correspondence to Dong-Liang Hu, [email protected], or Motoyuki Sugai, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /JCM.00661-14. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/JCM.00661-14
Rate (%)
Rate (%)
taphylococcal food poisoning (SFP), one of the most common food-borne diseases, results from the consumption of foods containing toxic amounts of staphylococcal enterotoxins (SEs) (1–4). SFP is associated with toxigenic Staphylococcus aureus strains that produce one or more members of a family of genes encoding heat-stable SEs. Recently, a superfamily of more than 23 different SEs and SE-like toxins (SEls) was studied for their biological activities (4–8). These bacterial toxins are also known as pyrogenic superantigens that stimulate polyclonal T-cell proliferation and can potentially cause toxic shock syndrome (1–4). The genes for SEs and SEls are harbored by various mobile genetic elements and/or genomic islands, including prophages, plasmids, S. aureus pathogenicity islands (SaPIs), and Sa. To date, in addition to the five classical types of SEs (SEA through SEE), 18 new types of SEs and SEls (SEG through SElX) have been described (4–8). Our recent study confirmed the emetic potential of SElK, SElL, SElM, SElN, SElO, SElP, and SElQ in the monkey, and these SEls were renamed SEK, SEL, SEM, SEN, SEO, SEP, and SEQ, respectively (9). Comparing SEs and SEls, SEA is considered the most important SE causing SFP. S. aureus is a common commensal bacterium of the skin and mucosal surfaces of humans, with estimates of 20% persistent and 60% intermittent colonization
FIG 1 Genetic typing of isolates from SFP outbreaks and nasal swabs. The percentages of isolates of the different coagulase types from SFP outbreaks (n ⫽ 42) and nasal swabs (n ⫽ 329) are shown. (A) Coagulase typing. NT, not typeable. (B) SE/SEl genotyping.
July 2014 Volume 52 Number 7
Journal of Clinical Microbiology
p. 2637–2640
jcm.asm.org
2637
Downloaded from http://jcm.asm.org/ on July 3, 2014 by Universitaetsbibliothek Muenchen
Department of Veterinary Medicine, Faculty of Agriculture, Iwate University, Morioka, Iwate, Japana; The United Graduate School of Veterinary Sciences, Gifu University, Gifu City, Gifu, Japanb; Department of Microbiology and Immunology, Hirosaki University Graduate School of Medicine, Hirosaki, Aomori, Japanc; Department of Bacteriology, Hiroshima University Graduate School of Biomedical & Health Sciences, Hiroshima City, Hiroshima, Japand; Department of Zoonoses, Kitasato University School of Veterinary Medicine, Towada, Aomori, Japane
Sato’o et al.
TABLE 1 CC types of the strains isolated from SFP outbreaks and nasal swabs No. (%) of isolates from: SFP outbreaks (n ⫽ 42)
Nasal swabs (n ⫽ 329)
CC5 CC6 CC7 CC8 CC12 CC15 CC20 CC25 CC30 CC59 CC81 CC96 CC97 CC101 CC121 CC188 CC398 CC508 CC509 Others
3 (7.1) 2 (4.8)
28 (8.5) 6 (1.8) 3 (0.9) 27 (8.2) 27 (8.2) 42 (12.8) 13 (4.0) 9 (2.7) 17 (5.2) 4 (1.2) 9 (2.7) 5 (1.5) 7 (2.1) 2 (0.6) 14 (4.3) 41 (12.5) 3 (0.9) 62 (18.8) 5 (1.5) 5 (1.5)
4 (9.5) 2 (4.8)
1 (2.4) 2 (4.8) 23 (54.8) 1 (2.4)
4 (9.5)
amined isolates from SFP outbreaks in Japan to study the molecular epidemiology of S. aureus causing SFP. In this study, 371 S. aureus isolates from different prefectures in Japan were used. Forty-two of them were from SFP outbreaks from 1990 to 2010, and the other 329 were collected from the nasal cavities of healthy humans from 2005 to 2010. Bacterial culture conditions, DNA extraction, coagulase typing, SE/SEl genotyping, and multilocus sequence typing (MLST) were performed as described previously (11–14). SEA production was determined by ELISA according to our previous method (5), with some modification. Briefly, 103 S. aureus cells were inoculated into broth TABLE 2 Relationships between se/sel types and CCs No. (%) of isolates from SFP outbreaksa se/sel type sea sea seb seh sek seq sea seb sek seq sea sec sel sea sec sel tst-1 sea sed selj ser sea seg sei sek sen seq tst-1 sea seg sei sem sen seo sea seg sei sen tst-1 sea seg sen sea seg sen tst-1 sea seg sen sep tst-1 sea seh sek seq sea sei sen tst-1 sea seq tst-1 seb seh seb sep seg sei sem sen seo seg sei sem sen seo sep seg sei selj sem sen seo ser selj ser a
CC5
CC6
CC8
2 (4.8)
2 (4.8)
CC12
CC30
CC59
CC81
CC96
CC508
15 (28.6) 2 (4.8) 1 (2.4) 1 (2.4) 1 (2.4) 1 (2.4)
5 (19.0)
3 (7.1) 2 (4.8) 3 (7.1) 1 (2.4)
1 (2.4) 1 (2.4) 1 (2.4)
Total n ⫽ 42.
2638
jcm.asm.org
Journal of Clinical Microbiology
Downloaded from http://jcm.asm.org/ on July 3, 2014 by Universitaetsbibliothek Muenchen
CC type
medium. SuperSignal ELISA Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific), Wallac 1420 ARVO MX/Light (PerkinElmer), and Varioskan Flash (Thermo Fisher Scientific) were used for measurement of SEA concentrations. Typing of genomic elements by SaPI scanning was performed as previously described (11). In addition, we designed new primer sets for a putative truncated transposon harboring seh, the enterotoxin gene cluster (egc), and Sa3. For the seh transposon, SEHexS (5=ACTAATGTCTCCATTGGTTGTTCTCTATTAAAAGCGCGA T-3=) and SEHexAS (5=-ATATCGTCTTTCGACACGTTGTAAG TGAAGCAGCTAGA-3=) were used. For egc, egcS (5=-TCTTAGA AGAGGATGGCTTCGAAACATTTACAGCG-3=) and egcAS (5=GGTGGTATTGCGATCCCATTAAAAGATATTGAAGATTTA GA-3=) were used. Sa3 was divided into three parts as follows. Sa3RS (5=-GTGAGTTTCGTGATTTCAAAGGTTGGACTAAGA TG-3=) and Sa3RAS (5=-GAC AATAGTGCCAAAGCCGAATCT AAGAAAGATGAT-3=), Sa3CS (5=-ATCTATCCACTCTTTCTC ATCCATATCAATAGGTTTACG-3=) and Sa3CAS (5=-TACGC GTTTAAGCGAGTACAGAGAAAAGAAAACAATAGA-3=), and Sa3LS (5=-GAATCTTCAGATTGTGTATGTGTACCGATAACG T-3=) and Sa3LAS (5=-AACCCGTTGTATCCTTTAGTTTTAAC TACTTCATC AAG-3=) were used to analyze the right, center, and left portions of the Sa3 phage, respectively. PCR-amplified products were analyzed by restriction enzyme (HindIII, EcoRV, or HaeIII) digestion. To determine the biological characteristics of SFP isolates, we first determined their coagulase types and enterotoxin genotypes. More than 70% of the SFP isolates were of coagulase type VII (Fig. 1A). In contrast, the isolates from nasal swabs showed various coagulase types. SE and SEl genotyping showed that all of the SFP isolates and 68.7% of the nasal swab isolates were positive for at least one of the se or sel genes or tst. The SFP isolates showed a significantly higher prevalence of sea (71.4%), followed by seh (54.8%), sek (52.4%), seq (52.4%), and seb (45.2%) (Fig. 1B). Among the SFP isolates, the dominant genotype was sea seb seh sek
The Dominant Lineage from SFP Outbreaks in Japan
CC81 subtype-1
2 (0.6%)
3 (0.9%)
CC81 subtype-2
2 (0.6%) 1 (0.3%) 1 (0.3%)
CC81 subtype-1
SFP 12 (28.6%)
Rates (%)
0
3 (7.1%)
8 (19.0%)
20
40
60
80
100
: sea, seb, seh, sek, seq
subtype-1
: sea, seh, sek, seq
CC81
: seb, seh : sec, seg, sei, sel, sem, sen, seo
subtype-2 : seg, sei, sem, sen, seo
not CC81
FIG 2 Relationship between MLST and SE/SEl types. Percentages of CC81 and its enterotoxin profiles among isolates from SFP and nasal swabs. Isolates harboring sea seb seh sek seq, sea seh sek seq, and seb seh were found in SFP and nasal swab samples (subtype 1). Isolates harboring sec seg sei sel sem sen seo and seg sei sem sen seo were present only in nasal swab samples (subtype 2). A chi-square test comparing CC81 subtype 1 isolates from SFP and nasal swab samples was performed.
seq (28.6%), followed by sea seh sek seq (19.0%) (see Table S1 in the supplemental material). In contrast, the most frequent genotype among the nasal swab isolates was seg sei sem sen seo (18.8%), followed by sep alone (6.1%). To analyze the genetic backgrounds of the SFP isolates, MLST was performed. The data showed that clonal complex 81 (CC81) was the primary CC (54.8%) among the SFP isolates; while this CC was rare (2.7%) among the nasal swab isolates (Table 1). Comparison of the CC types and the se genotype showed two dominant genotypes of SFP isolates, sea seb seh sek seq and sea seh sek seq, that exclusively belonged to CC81 (Table 2). A summary of genotypes in the CC81 lineage is shown in Fig. 2. Genotypes sea seb seh sek seq, sea seh sek seq, and seb seh were present in both SFP and nasal swab isolates. Two genotypes, sec seg sei sel sem sen seo and seg sei sem sen seo, were found only among the nasal swab isolates. To further clarify the genomic characteristics of the isolates belonging to the CC81 lineages, we typed the genomic elements of all of the CC81 isolates (23 from SFP and 9 from nasal swabs) by PCR (11). This showed that CC81 can be classified into two subtypes, 1 and 2 (Table 3). All of the isolates belonging to subtype 1 were of coagulase type VII and positive for the 1.5= seh transposon; whereas those of subtype 2 were of coagulase type VI and negative for the 1.5= seh transposon. The restriction pattern of PCR products of the 9= genomic element was subtype specific, assigned to type A for subtype 1 and type B for subtype 2 (see Fig. S1 in the supplemental material). Some
July 2014 Volume 52 Number 7
isolates of subtype 1 were positive for other mobile elements such at 18=, 19=, 44=, and Sa3, as shown in Table 3. All subtype 1 isolates were negative for egc at 40=. Conversely, subtype 2 isolates were all positive for 40= egc but negative for 19=, 44=, and Sa3. The enterotoxin profiles of subtypes 1 and 2 were totally different. All of the isolates belonging to subtype 1 were positive for sea, seb, or TABLE 3 Genetic backgrounds of two subtypes of CC81 lineages Locus
Genomic element(s)
1.5= 9=
seh transposon Restriction pattern
18=
SaPIs
19=
SaPIs
40=
egc
44= 44= (Sa3)
SaPIs Prophage
Presencea of or version found in: Subtype 1 (n ⫽ 30)b
Subtype 2 (n ⫽ 2)c
⫹ [30] Type A (no SEs/SEls) [30] SaPIishikawa11 (seb) [12] SaPIhhms2 (no SEs/ SEls) [2] ⫺
⫺ Type B (no SEs/SEls) [2] Putative SaPIs (sec sel) [1] ⫺
SaPIno10 (seb) [7] Sa3mw2 (sea sek seq) [25]
⫹ (seg sei sem sen seo) [2] ⫺ ⫺
⫹, positive; ⫺, negative. In brackets is the number of isolates positive. Origins: SFP, n ⫽ 23; nasal swabs, n ⫽ 7. Coagulase type, VII; se/sel type, sea seb seh sek seq. c Both isolates were from nasal swabs. Coagulase type, VI; se/sel type, sec seg sei sel sem sen seo. a b
jcm.asm.org 2639
Downloaded from http://jcm.asm.org/ on July 3, 2014 by Universitaetsbibliothek Muenchen
Nasal swab
SEA production (µg/ml)
Sato’o et al.
*** ***
***
***
CC
5
6
8
30
***
*** 59
81
96
508
FIG 3 SEA production by S. aureus isolates of various CCs. SEA production was evaluated by sandwich ELISA (5). For CC81, 10 isolates were assayed; for others, 2 isolates were assayed. Each isolate was assayed for toxin production in three independent experiments. The data are means ⫾ standard errors. The SEA production of CC81 was compared to that of other CCs isolates by using the Student t test and the Holm method. ***, P ⬍ 0.001.
both; while all of the isolates belonging to subtype 2 were negative for both sea and seb. Of note, all CC81 SFP isolates were classified as subtype 1 and there was a significant difference between the SFP and nasal swab isolates in the rate of CC81 subtype 1 detection (Fig. 2, P ⫽ 6.6E-25), suggesting the CC81 subtype 1 is associated specifically with SFP outbreaks in Japan. CC81 (ST81) is a single-locus variant of CC1 (ST1), to which the typical clinical S. aureus lineages belong, e.g., MW2 and MSSA476 (15, 16). Because CC81 harboring sea is the major lineage of SFP isolates, we further analyzed and compared the SEA production of isolates of the various CC types. As shown in Fig. 3, sea-harboring CC81 isolates produced significantly larger quantities of SEA than other sea-harboring CC types did (Fig. 3). The SEA prophage genotype has been reported to influence SEA production (17), where S. aureus isolates were divided into high and low SEA production types based on prophage genotypes. Cao et al. reported that the genotype Sa3mw2 was a high SEA production type (18), and the sea-harboring CC81 isolates in this study also carry Sa3mw2. The data suggest the high toxin production by the CC81 lineage may be one of the reasons they cause SFP outbreaks more frequently than other isolates. To our knowledge, this is the first report showing that CC81 lineage subtype 1 is closely related to SFP outbreaks in Japan. Genome sequencing and characterization of the mechanism of SEA production by the CC81 lineage are necessary to understand the high production of SEA and its strong association with SFP. ACKNOWLEDGMENTS We thank Jim Nelson for editorial assistance. This study was supported in part by a grant-in-aid for scientific research from the Japan Society for the Promotion of Science (20580338 and 23380177) and a Health Science Research grant from the Ministry of Health, Labor and Welfare, Japan.
REFERENCES 1. Le Loir Y, Baron F, Gautier M. 2003. Staphylococcus aureus and food poisoning. Genet. Mol. Res. 2:63–76. 2. Balaban N, Rasooly A. 2000. Staphylococcal enterotoxins. Int. J. Food Microbiol. 61:1–10. http://dx.doi.org/10.1016/S0168-1605(00)00377-9. 3. Argudín MA, Mendoza MC, Rodicio MR. 2010. Food poisoning and Staphylococcus aureus enterotoxins. Toxins 2:1751–1773. http://dx.doi .org/10.3390/toxins2071751.
2640
jcm.asm.org
Journal of Clinical Microbiology
Downloaded from http://jcm.asm.org/ on July 3, 2014 by Universitaetsbibliothek Muenchen
***
4. Hennekinne JA, De Buyser ML, Dragacci S. 2012. Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiol. Rev. 36:815– 836. http://dx.doi.org/10.1111/j.1574 -6976.2011.00311.x. 5. Omoe K, Imanishi K, Hu DL, Kato H, Fugane Y, Abe Y, Hamaoka S, Watanabe Y, Nakane A, Uchiyama T, Shinagawa K. 2005. Characterization of novel staphylococcal enterotoxin-like toxin type P. Infect. Immun. 73:5540 –5546. http://dx.doi.org/10.1128/IAI.73.9.5540-5546.2005. 6. Thomas DY, Jarraud S, Lemercier B, Cozon G, Echasserieau K, Etienne J, Gougeon ML, Lina G, Vandenesch F. 2006. Staphylococcal enterotoxin-like toxins U2 and V, two new staphylococcal superantigens arising from recombination within the enterotoxin gene cluster. Infect. Immun. 74:4724 – 4734. http://dx.doi.org/10.1128/IAI.00132-06. 7. Ono HK, Omoe K, Imanishi K, Iwakabe Y, Hu DL, Kato H, Saito N, Nakane A, Uchiyama T, Shinagawa K. 2008. Identification and characterization of two novel staphylococcal enterotoxins, types S and T. Infect. Immun. 76:4999 –5005. http://dx.doi.org/10.1128/IAI.00045-08. 8. Wilson GJ, Seo KS, Cartwright RA, Connelley T, Chuang-Smith ON, Merriman JA, Guinane CM, Park JY, Bohach GA, Schlievert PM, Morrison WI, Fitzgerald JR. 2011. A novel core genome-encoded superantigen contributes to lethality of community-associated MRSA necrotizing pneumonia. PLoS Pathog. 7:e1002271. http://dx.doi.org/10.1371 /journal.ppat.1002271. 9. Omoe K, Hu DL, Ono HK, Shimizu S, Takahashi-Omoe H, Nakane A, Uchiyama T, Shinagawa K, Imanishi K. 2013. Emetic potentials of newly identified staphylococcal enterotoxin-like toxins. Infect. Immun. 81: 3627–3631. http://dx.doi.org/10.1128/IAI.00550-13. 10. Kluytmans JA, Wertheim HF. 2005. Nasal carriage of Staphylococcus aureus and prevention of nosocomial infections. Infection 33:3– 8. http: //dx.doi.org/10.1007/s15010-005-4012-9. 11. Sato’o Y, Omoe K, Ono HK, Nakane A, Hu DL. 2013. A novel comprehensive analysis method for Staphylococcus aureus pathogenicity islands. Microbiol. Immunol. 57:91–99. http://dx.doi.org/10.1111/1348-0421 .12007. 12. Sakai F, Takemoto A, Watanabe S, Aoyama K, Ohkubo T, Yanahira S, Igarashi H, Kozaki S, Hiramatsu K, Ito T. 2008. Multiplex PCRs for assignment of staphylocoagulase types and subtypes of type VI staphylocoagulase. J. Microbiol. Methods 75:312–317. http://dx.doi.org/10.1016/j .mimet.2008.07.003. 13. Omoe K, Hu DL, Takahashi-Omoe H, Nakane A, Shinagawa K. 2005. Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiol. Lett. 246:191–198. http://dx.doi.org/10.1016/j.femsle.2005.04.007. 14. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. 2000. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 38:1008 –1015. 15. Baba T, Takeuchi F, Kuroda M, Yuzawa H, Aoki K, Oguchi A, Nagai Y, Iwama N, Asano K, Naimi T, Kuroda H, Cui L, Yamamoto K, Hiramatsu K. 2002. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet 359:1819 –1827. http://dx.doi.org/10 .1016/S0140-6736(02)08713-5. 16. Holden MT, Feil EJ, Lindsay JA, Peacock SJ, Day NP, Enright MC, Foster TJ, Moore CE, Hurst L, Atkin R, Barron A, Bason N, Bentley SD, Chillingworth C, Chillingworth T, Churcher C, Clark L, Corton C, Cronin A, Doggett J, Dowd L, Feltwell T, Hance Z, Harris B, Hauser H, Holroyd S, Jagels K, James KD, Lennard N, Line A, Mayes R, Moule S, Mungall K, Ormond D, Quail MA, Rabbinowitsch E, Rutherford K, Sanders M, Sharp S, Simmonds M, Stevens K, Whitehead S, Barrell BG, Spratt BG, Parkhill J. 2004. Complete genomes of two clinical Staphylococcus aureus strains: evidence for the rapid evolution of virulence and drug resistance. Proc. Natl. Acad. Sci. U. S. A. 29:9786 –9791. http://dx.doi .org/10.1073/pnas.0402521101. 17. Borst DW, Betley MJ. 1994. Phage-associated differences in staphylococcal enterotoxin A gene (sea) expression correlate with sea allele class. Infect. Immun. 62:113–118. 18. Cao R, Zeaki N, Wallin-Carlquist N, Skandamis PN, Schelin J, Rådström P. 2012. Elevated enterotoxin A expression and formation in Staphylococcus aureus and its association with prophage induction. Appl. Environ. Microbiol. 278:4942– 4948. http://dx.doi.org/10.1128/AEM.00803-12.
Updated information and services can be found at: http://jcm.asm.org/content/52/7/2637 These include: SUPPLEMENTAL MATERIAL REFERENCES
CONTENT ALERTS
Supplemental material This article cites 18 articles, 7 of which can be accessed free at: http://jcm.asm.org/content/52/7/2637#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://jcm.asm.org/ on July 3, 2014 by Universitaetsbibliothek Muenchen
Yusuke Sato'o, Katsuhiko Omoe, Ikunori Naito, Hisaya K. Ono, Akio Nakane, Motoyuki Sugai, Norio Yamagishi and Dong-Liang Hu J. Clin. Microbiol. 2014, 52(7):2637. DOI: 10.1128/JCM.00661-14. Published Ahead of Print 23 April 2014.
Molecular Epidemiology and Identification of a Staphylococcus aureus Clone Causing Food Poisoning Outbreaks in Japan Yusuke Sato’o,a,b Katsuhiko Omoe,a,b Ikunori Naito,a Hisaya K. Ono,a,c Akio Nakane,c Motoyuki Sugai,d Norio Yamagishi,a,b Dong-Liang Hue
Molecular characterization of isolates from staphylococcal food poisoning (SFP) outbreaks in Japan showed that the dominant lineage causing SFP outbreaks is clonal complex 81 (CC81), a single-locus variant of sequence type 1, coagulase type VII, positive for sea and/or seb, and positive for seh. Among various CC lineages producing staphylococcal enterotoxin A, CC81 showed the highest toxin productivity.
S
(10). Food handlers carrying enterotoxin-producing S. aureus in their nasal cavities or on their skin are important sources of food contamination during the cooking process (3). Contamination with S. aureus is believed to be associated primarily with improper handling of cooked or processed foods with improper storage under conditions that allow the growth of S. aureus and the production of SEs. Reports concerning the molecular epidemiology and genetic diversity of the isolates from SFP outbreaks are limited when clinical isolates are compared. In this investigation, we ex-
Received 10 March 2014 Accepted 16 April 2014 Published ahead of print 23 April 2014 Editor: G. A. Land Address correspondence to Dong-Liang Hu, [email protected], or Motoyuki Sugai, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /JCM.00661-14. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/JCM.00661-14
Rate (%)
Rate (%)
taphylococcal food poisoning (SFP), one of the most common food-borne diseases, results from the consumption of foods containing toxic amounts of staphylococcal enterotoxins (SEs) (1–4). SFP is associated with toxigenic Staphylococcus aureus strains that produce one or more members of a family of genes encoding heat-stable SEs. Recently, a superfamily of more than 23 different SEs and SE-like toxins (SEls) was studied for their biological activities (4–8). These bacterial toxins are also known as pyrogenic superantigens that stimulate polyclonal T-cell proliferation and can potentially cause toxic shock syndrome (1–4). The genes for SEs and SEls are harbored by various mobile genetic elements and/or genomic islands, including prophages, plasmids, S. aureus pathogenicity islands (SaPIs), and Sa. To date, in addition to the five classical types of SEs (SEA through SEE), 18 new types of SEs and SEls (SEG through SElX) have been described (4–8). Our recent study confirmed the emetic potential of SElK, SElL, SElM, SElN, SElO, SElP, and SElQ in the monkey, and these SEls were renamed SEK, SEL, SEM, SEN, SEO, SEP, and SEQ, respectively (9). Comparing SEs and SEls, SEA is considered the most important SE causing SFP. S. aureus is a common commensal bacterium of the skin and mucosal surfaces of humans, with estimates of 20% persistent and 60% intermittent colonization
FIG 1 Genetic typing of isolates from SFP outbreaks and nasal swabs. The percentages of isolates of the different coagulase types from SFP outbreaks (n ⫽ 42) and nasal swabs (n ⫽ 329) are shown. (A) Coagulase typing. NT, not typeable. (B) SE/SEl genotyping.
July 2014 Volume 52 Number 7
Journal of Clinical Microbiology
p. 2637–2640
jcm.asm.org
2637
Downloaded from http://jcm.asm.org/ on July 3, 2014 by Universitaetsbibliothek Muenchen
Department of Veterinary Medicine, Faculty of Agriculture, Iwate University, Morioka, Iwate, Japana; The United Graduate School of Veterinary Sciences, Gifu University, Gifu City, Gifu, Japanb; Department of Microbiology and Immunology, Hirosaki University Graduate School of Medicine, Hirosaki, Aomori, Japanc; Department of Bacteriology, Hiroshima University Graduate School of Biomedical & Health Sciences, Hiroshima City, Hiroshima, Japand; Department of Zoonoses, Kitasato University School of Veterinary Medicine, Towada, Aomori, Japane
Sato’o et al.
TABLE 1 CC types of the strains isolated from SFP outbreaks and nasal swabs No. (%) of isolates from: SFP outbreaks (n ⫽ 42)
Nasal swabs (n ⫽ 329)
CC5 CC6 CC7 CC8 CC12 CC15 CC20 CC25 CC30 CC59 CC81 CC96 CC97 CC101 CC121 CC188 CC398 CC508 CC509 Others
3 (7.1) 2 (4.8)
28 (8.5) 6 (1.8) 3 (0.9) 27 (8.2) 27 (8.2) 42 (12.8) 13 (4.0) 9 (2.7) 17 (5.2) 4 (1.2) 9 (2.7) 5 (1.5) 7 (2.1) 2 (0.6) 14 (4.3) 41 (12.5) 3 (0.9) 62 (18.8) 5 (1.5) 5 (1.5)
4 (9.5) 2 (4.8)
1 (2.4) 2 (4.8) 23 (54.8) 1 (2.4)
4 (9.5)
amined isolates from SFP outbreaks in Japan to study the molecular epidemiology of S. aureus causing SFP. In this study, 371 S. aureus isolates from different prefectures in Japan were used. Forty-two of them were from SFP outbreaks from 1990 to 2010, and the other 329 were collected from the nasal cavities of healthy humans from 2005 to 2010. Bacterial culture conditions, DNA extraction, coagulase typing, SE/SEl genotyping, and multilocus sequence typing (MLST) were performed as described previously (11–14). SEA production was determined by ELISA according to our previous method (5), with some modification. Briefly, 103 S. aureus cells were inoculated into broth TABLE 2 Relationships between se/sel types and CCs No. (%) of isolates from SFP outbreaksa se/sel type sea sea seb seh sek seq sea seb sek seq sea sec sel sea sec sel tst-1 sea sed selj ser sea seg sei sek sen seq tst-1 sea seg sei sem sen seo sea seg sei sen tst-1 sea seg sen sea seg sen tst-1 sea seg sen sep tst-1 sea seh sek seq sea sei sen tst-1 sea seq tst-1 seb seh seb sep seg sei sem sen seo seg sei sem sen seo sep seg sei selj sem sen seo ser selj ser a
CC5
CC6
CC8
2 (4.8)
2 (4.8)
CC12
CC30
CC59
CC81
CC96
CC508
15 (28.6) 2 (4.8) 1 (2.4) 1 (2.4) 1 (2.4) 1 (2.4)
5 (19.0)
3 (7.1) 2 (4.8) 3 (7.1) 1 (2.4)
1 (2.4) 1 (2.4) 1 (2.4)
Total n ⫽ 42.
2638
jcm.asm.org
Journal of Clinical Microbiology
Downloaded from http://jcm.asm.org/ on July 3, 2014 by Universitaetsbibliothek Muenchen
CC type
medium. SuperSignal ELISA Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific), Wallac 1420 ARVO MX/Light (PerkinElmer), and Varioskan Flash (Thermo Fisher Scientific) were used for measurement of SEA concentrations. Typing of genomic elements by SaPI scanning was performed as previously described (11). In addition, we designed new primer sets for a putative truncated transposon harboring seh, the enterotoxin gene cluster (egc), and Sa3. For the seh transposon, SEHexS (5=ACTAATGTCTCCATTGGTTGTTCTCTATTAAAAGCGCGA T-3=) and SEHexAS (5=-ATATCGTCTTTCGACACGTTGTAAG TGAAGCAGCTAGA-3=) were used. For egc, egcS (5=-TCTTAGA AGAGGATGGCTTCGAAACATTTACAGCG-3=) and egcAS (5=GGTGGTATTGCGATCCCATTAAAAGATATTGAAGATTTA GA-3=) were used. Sa3 was divided into three parts as follows. Sa3RS (5=-GTGAGTTTCGTGATTTCAAAGGTTGGACTAAGA TG-3=) and Sa3RAS (5=-GAC AATAGTGCCAAAGCCGAATCT AAGAAAGATGAT-3=), Sa3CS (5=-ATCTATCCACTCTTTCTC ATCCATATCAATAGGTTTACG-3=) and Sa3CAS (5=-TACGC GTTTAAGCGAGTACAGAGAAAAGAAAACAATAGA-3=), and Sa3LS (5=-GAATCTTCAGATTGTGTATGTGTACCGATAACG T-3=) and Sa3LAS (5=-AACCCGTTGTATCCTTTAGTTTTAAC TACTTCATC AAG-3=) were used to analyze the right, center, and left portions of the Sa3 phage, respectively. PCR-amplified products were analyzed by restriction enzyme (HindIII, EcoRV, or HaeIII) digestion. To determine the biological characteristics of SFP isolates, we first determined their coagulase types and enterotoxin genotypes. More than 70% of the SFP isolates were of coagulase type VII (Fig. 1A). In contrast, the isolates from nasal swabs showed various coagulase types. SE and SEl genotyping showed that all of the SFP isolates and 68.7% of the nasal swab isolates were positive for at least one of the se or sel genes or tst. The SFP isolates showed a significantly higher prevalence of sea (71.4%), followed by seh (54.8%), sek (52.4%), seq (52.4%), and seb (45.2%) (Fig. 1B). Among the SFP isolates, the dominant genotype was sea seb seh sek
The Dominant Lineage from SFP Outbreaks in Japan
CC81 subtype-1
2 (0.6%)
3 (0.9%)
CC81 subtype-2
2 (0.6%) 1 (0.3%) 1 (0.3%)
CC81 subtype-1
SFP 12 (28.6%)
Rates (%)
0
3 (7.1%)
8 (19.0%)
20
40
60
80
100
: sea, seb, seh, sek, seq
subtype-1
: sea, seh, sek, seq
CC81
: seb, seh : sec, seg, sei, sel, sem, sen, seo
subtype-2 : seg, sei, sem, sen, seo
not CC81
FIG 2 Relationship between MLST and SE/SEl types. Percentages of CC81 and its enterotoxin profiles among isolates from SFP and nasal swabs. Isolates harboring sea seb seh sek seq, sea seh sek seq, and seb seh were found in SFP and nasal swab samples (subtype 1). Isolates harboring sec seg sei sel sem sen seo and seg sei sem sen seo were present only in nasal swab samples (subtype 2). A chi-square test comparing CC81 subtype 1 isolates from SFP and nasal swab samples was performed.
seq (28.6%), followed by sea seh sek seq (19.0%) (see Table S1 in the supplemental material). In contrast, the most frequent genotype among the nasal swab isolates was seg sei sem sen seo (18.8%), followed by sep alone (6.1%). To analyze the genetic backgrounds of the SFP isolates, MLST was performed. The data showed that clonal complex 81 (CC81) was the primary CC (54.8%) among the SFP isolates; while this CC was rare (2.7%) among the nasal swab isolates (Table 1). Comparison of the CC types and the se genotype showed two dominant genotypes of SFP isolates, sea seb seh sek seq and sea seh sek seq, that exclusively belonged to CC81 (Table 2). A summary of genotypes in the CC81 lineage is shown in Fig. 2. Genotypes sea seb seh sek seq, sea seh sek seq, and seb seh were present in both SFP and nasal swab isolates. Two genotypes, sec seg sei sel sem sen seo and seg sei sem sen seo, were found only among the nasal swab isolates. To further clarify the genomic characteristics of the isolates belonging to the CC81 lineages, we typed the genomic elements of all of the CC81 isolates (23 from SFP and 9 from nasal swabs) by PCR (11). This showed that CC81 can be classified into two subtypes, 1 and 2 (Table 3). All of the isolates belonging to subtype 1 were of coagulase type VII and positive for the 1.5= seh transposon; whereas those of subtype 2 were of coagulase type VI and negative for the 1.5= seh transposon. The restriction pattern of PCR products of the 9= genomic element was subtype specific, assigned to type A for subtype 1 and type B for subtype 2 (see Fig. S1 in the supplemental material). Some
July 2014 Volume 52 Number 7
isolates of subtype 1 were positive for other mobile elements such at 18=, 19=, 44=, and Sa3, as shown in Table 3. All subtype 1 isolates were negative for egc at 40=. Conversely, subtype 2 isolates were all positive for 40= egc but negative for 19=, 44=, and Sa3. The enterotoxin profiles of subtypes 1 and 2 were totally different. All of the isolates belonging to subtype 1 were positive for sea, seb, or TABLE 3 Genetic backgrounds of two subtypes of CC81 lineages Locus
Genomic element(s)
1.5= 9=
seh transposon Restriction pattern
18=
SaPIs
19=
SaPIs
40=
egc
44= 44= (Sa3)
SaPIs Prophage
Presencea of or version found in: Subtype 1 (n ⫽ 30)b
Subtype 2 (n ⫽ 2)c
⫹ [30] Type A (no SEs/SEls) [30] SaPIishikawa11 (seb) [12] SaPIhhms2 (no SEs/ SEls) [2] ⫺
⫺ Type B (no SEs/SEls) [2] Putative SaPIs (sec sel) [1] ⫺
SaPIno10 (seb) [7] Sa3mw2 (sea sek seq) [25]
⫹ (seg sei sem sen seo) [2] ⫺ ⫺
⫹, positive; ⫺, negative. In brackets is the number of isolates positive. Origins: SFP, n ⫽ 23; nasal swabs, n ⫽ 7. Coagulase type, VII; se/sel type, sea seb seh sek seq. c Both isolates were from nasal swabs. Coagulase type, VI; se/sel type, sec seg sei sel sem sen seo. a b
jcm.asm.org 2639
Downloaded from http://jcm.asm.org/ on July 3, 2014 by Universitaetsbibliothek Muenchen
Nasal swab
SEA production (µg/ml)
Sato’o et al.
*** ***
***
***
CC
5
6
8
30
***
*** 59
81
96
508
FIG 3 SEA production by S. aureus isolates of various CCs. SEA production was evaluated by sandwich ELISA (5). For CC81, 10 isolates were assayed; for others, 2 isolates were assayed. Each isolate was assayed for toxin production in three independent experiments. The data are means ⫾ standard errors. The SEA production of CC81 was compared to that of other CCs isolates by using the Student t test and the Holm method. ***, P ⬍ 0.001.
both; while all of the isolates belonging to subtype 2 were negative for both sea and seb. Of note, all CC81 SFP isolates were classified as subtype 1 and there was a significant difference between the SFP and nasal swab isolates in the rate of CC81 subtype 1 detection (Fig. 2, P ⫽ 6.6E-25), suggesting the CC81 subtype 1 is associated specifically with SFP outbreaks in Japan. CC81 (ST81) is a single-locus variant of CC1 (ST1), to which the typical clinical S. aureus lineages belong, e.g., MW2 and MSSA476 (15, 16). Because CC81 harboring sea is the major lineage of SFP isolates, we further analyzed and compared the SEA production of isolates of the various CC types. As shown in Fig. 3, sea-harboring CC81 isolates produced significantly larger quantities of SEA than other sea-harboring CC types did (Fig. 3). The SEA prophage genotype has been reported to influence SEA production (17), where S. aureus isolates were divided into high and low SEA production types based on prophage genotypes. Cao et al. reported that the genotype Sa3mw2 was a high SEA production type (18), and the sea-harboring CC81 isolates in this study also carry Sa3mw2. The data suggest the high toxin production by the CC81 lineage may be one of the reasons they cause SFP outbreaks more frequently than other isolates. To our knowledge, this is the first report showing that CC81 lineage subtype 1 is closely related to SFP outbreaks in Japan. Genome sequencing and characterization of the mechanism of SEA production by the CC81 lineage are necessary to understand the high production of SEA and its strong association with SFP. ACKNOWLEDGMENTS We thank Jim Nelson for editorial assistance. This study was supported in part by a grant-in-aid for scientific research from the Japan Society for the Promotion of Science (20580338 and 23380177) and a Health Science Research grant from the Ministry of Health, Labor and Welfare, Japan.
REFERENCES 1. Le Loir Y, Baron F, Gautier M. 2003. Staphylococcus aureus and food poisoning. Genet. Mol. Res. 2:63–76. 2. Balaban N, Rasooly A. 2000. Staphylococcal enterotoxins. Int. J. Food Microbiol. 61:1–10. http://dx.doi.org/10.1016/S0168-1605(00)00377-9. 3. Argudín MA, Mendoza MC, Rodicio MR. 2010. Food poisoning and Staphylococcus aureus enterotoxins. Toxins 2:1751–1773. http://dx.doi .org/10.3390/toxins2071751.
2640
jcm.asm.org
Journal of Clinical Microbiology
Downloaded from http://jcm.asm.org/ on July 3, 2014 by Universitaetsbibliothek Muenchen
***
4. Hennekinne JA, De Buyser ML, Dragacci S. 2012. Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiol. Rev. 36:815– 836. http://dx.doi.org/10.1111/j.1574 -6976.2011.00311.x. 5. Omoe K, Imanishi K, Hu DL, Kato H, Fugane Y, Abe Y, Hamaoka S, Watanabe Y, Nakane A, Uchiyama T, Shinagawa K. 2005. Characterization of novel staphylococcal enterotoxin-like toxin type P. Infect. Immun. 73:5540 –5546. http://dx.doi.org/10.1128/IAI.73.9.5540-5546.2005. 6. Thomas DY, Jarraud S, Lemercier B, Cozon G, Echasserieau K, Etienne J, Gougeon ML, Lina G, Vandenesch F. 2006. Staphylococcal enterotoxin-like toxins U2 and V, two new staphylococcal superantigens arising from recombination within the enterotoxin gene cluster. Infect. Immun. 74:4724 – 4734. http://dx.doi.org/10.1128/IAI.00132-06. 7. Ono HK, Omoe K, Imanishi K, Iwakabe Y, Hu DL, Kato H, Saito N, Nakane A, Uchiyama T, Shinagawa K. 2008. Identification and characterization of two novel staphylococcal enterotoxins, types S and T. Infect. Immun. 76:4999 –5005. http://dx.doi.org/10.1128/IAI.00045-08. 8. Wilson GJ, Seo KS, Cartwright RA, Connelley T, Chuang-Smith ON, Merriman JA, Guinane CM, Park JY, Bohach GA, Schlievert PM, Morrison WI, Fitzgerald JR. 2011. A novel core genome-encoded superantigen contributes to lethality of community-associated MRSA necrotizing pneumonia. PLoS Pathog. 7:e1002271. http://dx.doi.org/10.1371 /journal.ppat.1002271. 9. Omoe K, Hu DL, Ono HK, Shimizu S, Takahashi-Omoe H, Nakane A, Uchiyama T, Shinagawa K, Imanishi K. 2013. Emetic potentials of newly identified staphylococcal enterotoxin-like toxins. Infect. Immun. 81: 3627–3631. http://dx.doi.org/10.1128/IAI.00550-13. 10. Kluytmans JA, Wertheim HF. 2005. Nasal carriage of Staphylococcus aureus and prevention of nosocomial infections. Infection 33:3– 8. http: //dx.doi.org/10.1007/s15010-005-4012-9. 11. Sato’o Y, Omoe K, Ono HK, Nakane A, Hu DL. 2013. A novel comprehensive analysis method for Staphylococcus aureus pathogenicity islands. Microbiol. Immunol. 57:91–99. http://dx.doi.org/10.1111/1348-0421 .12007. 12. Sakai F, Takemoto A, Watanabe S, Aoyama K, Ohkubo T, Yanahira S, Igarashi H, Kozaki S, Hiramatsu K, Ito T. 2008. Multiplex PCRs for assignment of staphylocoagulase types and subtypes of type VI staphylocoagulase. J. Microbiol. Methods 75:312–317. http://dx.doi.org/10.1016/j .mimet.2008.07.003. 13. Omoe K, Hu DL, Takahashi-Omoe H, Nakane A, Shinagawa K. 2005. Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiol. Lett. 246:191–198. http://dx.doi.org/10.1016/j.femsle.2005.04.007. 14. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. 2000. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 38:1008 –1015. 15. Baba T, Takeuchi F, Kuroda M, Yuzawa H, Aoki K, Oguchi A, Nagai Y, Iwama N, Asano K, Naimi T, Kuroda H, Cui L, Yamamoto K, Hiramatsu K. 2002. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet 359:1819 –1827. http://dx.doi.org/10 .1016/S0140-6736(02)08713-5. 16. Holden MT, Feil EJ, Lindsay JA, Peacock SJ, Day NP, Enright MC, Foster TJ, Moore CE, Hurst L, Atkin R, Barron A, Bason N, Bentley SD, Chillingworth C, Chillingworth T, Churcher C, Clark L, Corton C, Cronin A, Doggett J, Dowd L, Feltwell T, Hance Z, Harris B, Hauser H, Holroyd S, Jagels K, James KD, Lennard N, Line A, Mayes R, Moule S, Mungall K, Ormond D, Quail MA, Rabbinowitsch E, Rutherford K, Sanders M, Sharp S, Simmonds M, Stevens K, Whitehead S, Barrell BG, Spratt BG, Parkhill J. 2004. Complete genomes of two clinical Staphylococcus aureus strains: evidence for the rapid evolution of virulence and drug resistance. Proc. Natl. Acad. Sci. U. S. A. 29:9786 –9791. http://dx.doi .org/10.1073/pnas.0402521101. 17. Borst DW, Betley MJ. 1994. Phage-associated differences in staphylococcal enterotoxin A gene (sea) expression correlate with sea allele class. Infect. Immun. 62:113–118. 18. Cao R, Zeaki N, Wallin-Carlquist N, Skandamis PN, Schelin J, Rådström P. 2012. Elevated enterotoxin A expression and formation in Staphylococcus aureus and its association with prophage induction. Appl. Environ. Microbiol. 278:4942– 4948. http://dx.doi.org/10.1128/AEM.00803-12.
