Proc. Nati. Acad. Sci. USA Vol. 88, pp. 9789-9793, November 1991

Biochemistry

mRNA leader length and initiation codon context determine alternative AUG selection for the yeast gene MOD5 (bifunctional mRNA/Saccharomyces cereviiae/tRNA modifcation/nmtochondrial protein)

LESLIE B. SLUSHER*t, EDWIN C. GILLMAN*, NANCY C. MARTINS, AND ANITA K. HOPPER*§ *Department of Biological Chemistry, The Milton S. Hershey Medical Center of The Pennsylvania State University, Hershey, PA 17033; and tDepartment of

Biochemistry, University of Louisville School of Medicine, Louisville, KY 40292

Communicated by Fred Sherman, July 26, 1991 (received for review January 3, 1991)

ABSTRACT MODS, a nuclear gene of Saccharomyces cerevisiae, encodes two isozymic forms of a tRNA-modification enzyme. These enzymes modify both cytoplasmic and mitochondrial tRNAs. Two inframe ATGs of the MODS gene are used for initiation of translation, and the form of the protein translated from the first AUG is imported into mitochondria. Protein translated from the second AUG functions in the cytoplasm. Since all transcripts contain both of these translational start sites and two proteins are made, the question arises as to the factors that influence the translation start-site choice. Extending the 5' ends of the MOD5 mRNA to include leader sequences of the ADH1 (alcohol dehydrogenase defective) transcript produces signficant changes in the choice of AUGs. This suggests that for wild-type MOD5 transcripts, the length or structure of the leader sequence plays a role in AUG choice. The nucleotides surrounding the first ATG of MODS also have an effect on translation initiation. Altering these nucleotides changes initiation choice and suggests that ribosomal bypass of a suboptimal AUG is another mechanism controlling the alternate use of two initiation codons. Our data support the model that at least one MOD5 transcript is able to produce two proteins with different N-terminal sequences. There exists a class of genes that encode proteins able to localize and function in more than one subcellular compartment (1-11). One is MOD5, a gene of Saccharomyces cerevisiae that encodes the tRNA-modifying enzyme A2isopentenyl pyrophosphate:tRNA isopentenyltransferase (EC 2.5.1.8; IPP transferase). The product of this gene catalyzes the formation of N6-(A2-isopentenyl)adenosine (i6A), found at the anticodon loop in both cytoplasmic and mitochondrial tRNA (4). The MOD5 coding sequence contains two inframe ATGs at codons 1 (ATG1) and 12 (ATG2) (12). Alteration of each ATG demonstrated their involvement in the generation of two distinct forms of IPP transferase, designated IPPI-I and IPPT-H. Translation from the first AUG (AUG1) yields a protein (IPPT-I) containing an N-terminal extension that resembles known mitochondrial-targeting sequences (13-16) and is necessary to localize the protein to the mitochondria. The shorter form (IPPT-II) generated from the second AUG (AUG2) lacks mitochondrial-targeting information and resides in the cytoplasm/nucleus. Therefore, alternative initiation at these two inframe AUGs allows for differential cellular localization (17). The mechanism dictating translation start site selection for MOD5 is different than for other genes that encode two proteins. Yeast genes TRMI (3), SUC2 (8), LEU4 (5), and HTSI (2) encode transcripts with heterogeneous 5' ends. Yeast translation initiation occurs by the scanning mechanism (18, 19). Therefore, it is thought that transcripts of these The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 9789

genes with ends mapping 5' to the first AUG generate proteins with an N-terminal extension. Short proteins are produced from transcripts with 5' ends falling between the two AUGs. As determined by S1 nuclease and primer extension analyses, MOD5 mRNAs have 5' ends in two clusters at positions +1 to -4 and -11 to -14 upstream ofthe first AUG (12). One model to account for the production of two proteins would be that the shorter transcripts would generate the protein initiating at AUG2, and the longer transcripts would generate protein initiating at AUG1. However, there are examples of yeast mRNAs with little or no leaders that initiate translation at the first AUG (20-22). Therefore, it is possible that for MOD5, both long and short mRNAs are bifunctional. More complex mechanisms may control ribosome initiation in MOD5-encoded transcripts than for other genes encoding multiple isozymes. Parameters influencing translation initiation have been investigated in a large number of organisms (18, 19, 23-36). In mRNAs of higher eukaryotes, the length and secondary structure as well as the context of the nucleotides surrounding AUGs affect initiation. For yeast, the secondary structure of mRNA leaders influence translation initiation (25), but neither changes in length nor changes in the AUG context have been shown to dramatically influence initiation (18, 19, 26). To gain an understanding of how MOD5 encodes two products, we analyzed proteins generated by mutant MOD5 genes. For these mutants the length of the leader preceding the AUG1 or the context sequence surrounding this AUG was altered. Our data lead us to conclude that the length or structure of the MOD5 mRNA leader as well as context of the initiation codon are important to expression of MOD5 products. These data suggest that at least some of the MOD5 mRNAs produce more than one protein and are bifunctional.

MATERIALS AND METHODS Yeast and Escherchia coli Strains. The yeast strain with a disrupted MOD5 gene was MT-8 (MATa SUP7 trpl ura3-1 leu2-3,112 canl-100 ade2-1 modS::TRPJ hisS-2 or his4-519 or both lysl-2 or lys2-1 or both) (17). E. coli strains were JM101 (37) and HB101 (38). Transformation. Yeasts were transformed by using an alkali metal procedure (39). E. coli were transformed as described by Maniatis et al. (40). Plasmid Constructions. The MOD5 promoter region was replaced with the ADHI (alcohol dehydrogenase defective) promoter (41) (Fig. 1A) by subcloning the SnaBI-Nae I fragment of MOD5 into pMac561 (42) at the unique EcoRI site Abbreviations: IPP transferase, A2-isopentenyl pyrophosphate:tRNA isopentenyltransferase; i6A, N6-(A2-isopentenyl)adenosine; ATG1 and ATG2, ATGs at codons 1 and 12. tPresent address: Department of Biology, West Chester University, West Chester, PA 19383. §To whom reprint requests should be addressed.

Proc. NatL. Acad. Sci. USA 88 (1991)

Biochemistry: Slusher et al.

9790

that had been filled with the Klenow fragment (Promega). To avoid the complications caused by variable copy number plasmids, the ADHJ promoter/MODS coding sequence fusion was subcloned as a BamHI-HindIII fragment into the centromere containing plasmid YCp5O (43) to generate YCpADHMOD5. As a control the Bgl II fragment of the wild-type MOD5 gene was subcloned into YCf5O (17), a derivative of YCp5O, to yield YCfMOD5. Oligonucleotide Mutagenesis. The BamHI-EcoRI fragment of YCpADHMOD5 subcloned in Mp8 (37) and an oligonucleotide, 5'-GCTAAAGGGATCCGCTTAAA-3', were used to create a + 1 shift in the ribosomal reading frame (Fig. 1A) and a BamHI site between the two ATGs of MODS. After mutagenesis, the Sph I-Nsi I fragment [307 base pairs (bp) of MODS and 400 bp of the DNA providing the ADHI promoter] was used to replace the wild-type sequence of YCpADHMOD5 to generate YCpADHmod5fs. As a control, the same oligonucleotide was used to introduce a + 1 frameshift of the MOD5 gene under the control of its own promoter. The DNA mutated was a 1498-bp EcoRI fragment of MOD5 cloned into YCf5O. After mutagenesis, the 986-bp EcoRI Nsi I fragment containing 450 bp of MOD5 sequence was used to replace the MOD5 sequence of YCfMOD5 to generate YCfmod5fs. To construct context mutants, oligonucleotides 5'GAACCAAAAATCAAAATGTTAAAGGGACCG'-3 and

5'-GAACCAAAAATGTCCATGCTAAAGGGACCG-3' were used (44, 45). The first, cm2, differed from wild type at nucleotides -3, -2, -1, and +4. The second, el, differed from wild type at nucleotides -4 and -2. The DNA mutated was the 1498-bp EcoRI fragment of MOD5 used to create YCfmod5fs. The EcoRI-Nsi I fragments, which contained the mutant sequences, were cloned into YCfMOD5 as for

YCfmod5fs. The three plasmids, YCfmod5fs, YCfmod5cm2, and YCfmod5el, were sequenced through the region of MOD5 subjected to mutagenesis. YCpADHmod5fs was sequenced through 215 bp of the ADHI promoter and the entire 307 bp of MODS subject to mutagenesis. Sequencing was by the

chain-termination method (46) with a kit from United States Biochemical. RNA Isolation and Primer Extension. Total RNA was isolated from yeast as described by Najarian et al. (12). The 5' ends of the MOD5 wild-type and mutant mRNAs were mapped by using the protocol of Domdey et al. (47). 5'CCTACTCCTGTTGTACCAGC-3', complementary to positions +77 to +57 on the DNA sequence, was used as a primer. To quantitate the transcripts initiating at -11, -10, and +1 of the MOD5 gene, autoradiograms were scanned (digital analysis software from Molecular Dynamics Scanner and Protein Databases, Sunnyvale, CA). The percentage of transcripts initiating at -10 and -11 as compared with the total were calculated. Yeast Protein Extracts and Protein Blot Analysis. Total protein extracts were obtained as described (17) except that the extraction buffer was 0.05 M sodium phosphate, pH 7.1/0.005 M EDTA. To achieve relatively equal amounts of MOD5 and RNA1 antigens in each lane, extracts from cells known to overproduce the MODS products were diluted 1:10 with extracts from cells with a deletion-disruption allele of MOD5. The proteins were resolved on a SDS gel (17), transferred to membranes, and treated sequentially with a 1:500-dilution affinity-purified MOD5-specific antibody (17) and a 1:5000-dilution anti-RNA1 serum (48). Affinity-purified alkaline phosphatase-conjugated goat anti-rabbit antibody (1:5000 dilution; The Jackson Laboratory) was the second antibody. The blot was quantitated by laser scanning (above), and the ratio of MOD5-specific isozymes to RNA1 protein was calculated. The data expressed are the values obtained when standardized to the YCfMOD5/RNA1 ratio, which we defined as 1.0.

RESULTS MODS mRNA 5' Leader Length Infuences Choice of AUG. To test the effect of leader length, the promoter region of the ADHI gene (41), known to give rise to transcripts with extended leader sequences (49), was placed upstream of the MOD5 coding region in the centromere-containing plasmid

Construct

II SnaBI I TAC^CATATCTTTTGTAAATAGAACCAAAATCTTC2LTG CTA AAG GGA CCG CTT AAA GGT TGC TTA ART ATG TCT AAA MET Leu Lys Gly Pro Lou Lys Gly Cys Lou Asn MET Ser Lys

A YCf1oD5

1

YCpAMODS

AAGCTA^hCCAAGCATACAATCAAGGTTGTACATATCTTTTGTAAATAGAACCAAAAATCT

CATG CTA AAG GGA CCG CTT AAA GGT TGC TTA AAT ATG TCT AAA MET Lou Lys Gly Pro Leu Lys Gly Cys Leu Asn MET Sor Lys 1 ; CTA AAG

YCfADhmod5fs and YCfmodSfs

B

SnaBI

YCfMODs

YCftodScm2

TAXAZ=CATATCTTTTGTAA&TAGAACCAAAAATCTTCATG ;CTA

MET Lou

CAAAAATCAAAA= TTA C!C T

SER

MET

CONSENSUS

AAG GGA CCG CTT AAA GGT TGC TTA AAT ATG TCT AAA Pro Lou Lys Gly Cys Lou Asn MET Sor Lys

Lou Lys Gly

CONSENSUS

YCfmodSel

U =:G CTT AAA

=S

CTC

MET Lou Lys Gly Pro CTA AAG GGA CCG

GAACCAAIATCCATG C T

CTC

Mutations and alterations of the 5' region of the MOD5 gene. (A) The wild-type MOD5 and ADHMOD5 sequences are shown as used to make YCfmod5fs and YCpADHmod5fs frameshift mutants. ADHI promoter sequences are indicated by adouble underline. Arrows indicate the 5' transcript ends. Restriction sites are indicated by a single underline. (B) The altered sequence used to create YCfmod5cm2 is indicated under the wild-type sequence. Altered nucleotides are marked with an asterisk. The altered sequence is compared to the yeast consensus sequence, which is aligned with ATG1. The oligonucleotide used to generate YCfmod5el is presented. The yeast consensus sequence is aligned with the new ATG that initiates two codons upstream of ATG1.

FIG.

1.

are the oligonucleotides

Biochemistry: Slusher et al.

Proc. Natl. Acad. Sci. USA 88 (1991)

YCpMOD5 (Fig. 1A). This plasmid, YCpADHMOD5, was transformed into the MODS deletion-disruption strain, MT-8. We used primer extension analysis to map the 5' end of the MOD5 transcripts. In close agreement with our previous results (12), about 30% of the transcripts from YCfMOD5 initiated at -10 and -11 with respect to AUG1 and about 70%o initiated at + 1 (Fig. 2, lanes 4 and 7). In contrast, the 5' ends of transcripts from YCpADHMOD5 mapped to -47, -55, and -65 (Fig. 2, lane 2). Therefore, YCpADHMOD5 provides MOD5 transcripts with untranslated leaders that are at least 36 nucleotides longer than those from the wild-type MODS gene. The influence of the length of the leader sequence on protein distribution was determined by immunoblotting (17). Cells lacking a copy of the MODS gene produced no MOD5 protein (Fig. 3, lane 1). Cells with a wild-type MODS gene produced -5-10% of the long mitochondrial form of IPP transferase (IPPT-I) and 90-95% of the short cytoplasmic form (IP1PT-II; Fig. 3, lanes 3 and 10). MODS genes with a mutant ATG2 produced only IPPT-I, and MODS genes with a mutation at ATG1 produced only IPPT-II (Fig. 3, lanes 9 and 8). In contrast to wild-type cells, cells transformed with the YCpADHMOD5 plasmid produced IPPT-I but no detectable shorter isozyme, IPPT-II (Fig. 3, lane 6). Changing the 5' leader resulted in an -9-fold increase in initiation from AUGI and a concomitant decrease in use of AUG2. To determine the effect this alteration has on tRNA modification, i6A modification of cytoplasmic and mitochondrial tRNATyr was determined with a previously described RIA (17). Mitochondrial levels of i6A found on tRNATYr from YCpADHMOD5 cells were essentially identical to levels found on tRNATYr of YCfMOD5 cells (Table 1). Cytoplasmic tRNA from YCpADHMOD5 cells had only 35% of the i6A found on cytoplasmic tRNA from YCfMOD5 cells. The small but functional pool of IPPT-I in the cytosol (17) was probably responsible for some of the cytoplasmic tRNA modification seen in YCpADHMOD5 cells, and the level was consistent with the distribution of IPP transferase isozyme forms. The combined data suggest that MOD5 transcripts with extended leaders preferentially initiate translation at the first AUG. Long mRNA Leaders Do Not Predude Use of an Internal AUG. To determine if a long leaderper se precludes the use of AUG2, a frameshift mutation was introduced into the region 1

GATC 2

GATC 34

GA TC67 8

5

tAw -a - -5

N

1

2

3

4

8

9

10

IPPT-I1

FIG. 3. Immunoblot of the IPP transferase isozymes. Total cell extracts were from MT-8 cells disrupted for MODS (lane 1) and MT-8 cells transformed with YCfmod5cm2 (lane 2), YCfMOD5 (lane 3),

YCfmod5el (lane 4), YCfmod5fs (lane 5), YCpADHMOD5 (lane 6), and YCpADHmod5fs (lane 7). Extracts of MT-8 cells containing mutant and wild-type MODS genes on high-copy plasmids (17) were run as controls: pJDBMOD5 (lane 10); a MODS gene in which only the second ATG is functional-pJDBmod5-M1 (lane 8); and a MODS gene in which only the first ATG is functional-pJDBmod5M2 (lane 9). All lanes contained 5 tug of total protein. For lanes 6, 8, 9, and 10 that contain extracts from MOD5-overproducing cells, 4.5 gg of cell extract of the deletion strain, MT-8, was added to 0.5 ,ug of extract from plasmid-containing cells. Lines on the left mark the positions of the MODS isozymes. The unmarked band migrating slower than MOD5 isozymes is RNA1 protein.

between the two ATGs of YCpADHMOD5 (Fig. 1A). Analysis of the 5' ends of the YCpADHmod5fs mRNA revealed that, as for YCpADHMOD5, there were three major transcripts initiating at -47, -55, and -65 (Fig. 2, lane 1). For cells containing YCpADHmod5fs, active IPP transferase will be made only if translation occurs from AUG2, as the frameshift mutation will terminate protein translation from AUG1. The effect of the frameshift mutation was determined by immunoblot analyses. Compared with cells harboring YCpADHMOD5, cells harboring YCpADHmod5fs generated less MOD5 protein. Cells containing YCpADHMOD5 overproduced MOD5 protein -9-fold, but cells containing YCpADHmod5fs produced less MOD5 protein than did wild-type cells (0.7-fold, Table 1; Fig. 3, compare lanes 6 and 7). In contrast to YCpADHMOD5-containing cells, the vast majority of the protein encoded by YCpADHmod5fs was IPPT-II (Fig. 3, lane 7); no IPPT-I was detected. The level of i6A modification found on cytoplasmic tRNATYr extracted from YCpADHmod5fs cells was 72% of that found on tRNAT~' extracted from cells containing the wild-type

___o Plasmid YCfWO YCfMODS YCpADHMODS

rw _

+1

7

Table 1. Effects of mutations on MODS

Ni

-10

6

IPPT-I

ft.F-

_

5

9791

a- -10

'wem- +1

FIG. 2. Mapping of the MODS 5' mRNA termini. mRNA was extracted from MT-8 cells transformed with YCpADHmodSfs (lane 1), YCpADHMODS (lane 2), no plasmid (lane 3), YCpMODS (lane 4), YCpmod5fs (lane 5), YCpmod5cm2 (lane 6), YCpMODS (lane 7), and YCpmod5el (lane 8). The G, A, T, C sequence obtained by DNA elongation ofthe oligonucleotide is also shown. Each lane was loaded with 1 x 105 cpm. Exposure of the autoradiograms was adjusted for the overproducing plasmids such that all transcript ends can be seen.

Relative amount of total MOD5 protein*

% moicain tRNA with i6A

modificationt Mitochondria Cytoplasm 0 ± 5.3 1.4 ± 6.9 100 100 99 ± 1.2 35 ± 1.8 17 ± 3.0 72 ± 10.2 6.3 ± 0.7 97 ± 1.9 99 82 103 72

0 1.0 >8.7 0.7 YCpADHmodSfs YCfmod5fs 0.7 YCfmod5cm2 1.0 YCfmod5el 1.1 >10.0 ND pJDBMODS ND >8.7 pJDBmodS-M1 ND ND pJDBmod5-M2 6.3 ND ND *The immunoblot in Fig. 3 was scanned, and the ratio of IPPT-I plus IPPT-II relative to RNA1 protein was calculated and defined as 1.0 for YCfMODS. All values are expressed relative to YCfMODS. tData are expressed as a mean percentage ± SD of the YCfMOD5 i6A, which is assumed to be 100%o. For YCfSO and YCpADHMOD5, the means are derived from four triplicate independent determinations; for YCpADHmod5fs, from 2 duplicate independent determinations; and for YCfmod5cm2 and YCfmod5el, from two duplicate

samples.

9792

Biochemistry: Slusher et al.

plasmid YCfMOD5. This level was substantially greater than that found on tRNATYr from cells containing YCpADHMODS. These results show that even though there is a reduced level of MOD5 protein from YCpADHmod5fs, a long leader does not prevent the use of AUG2. An experiment with a construct encoding a MODS mRNA with a long leader and lacking AUG1 would provide a definite test of the function of AUG2 in the presence of this leader. These data also show that an upstream AUG does not prevent the use of the downstream AUG. Examination of the mutant sequence revealed that the open reading frame continued in the + 1 frame for four codons before terminating 14 nucleotides 5' of the ATG2. Use of AUG2 in mRNAs encoded by YCpADHmod5fs can be explained in at least two ways. If AUG2 were "hidden" in the wild-type situation by elongating ribosomes but not hidden by ribosomes in the frameshift situation because of translation termination, then AUG2 could become available for "leaky" scanning in YCpADHmod5fs when it would not be available in YCpADHMOD5. Alternatively, the increased use of AUG2 of YCpADHmod5fs mRNA as compared with YCpADHMOD5 mRNA could be due to reinitiation of ribosomes at AUG2. Based on previous reports for yeast (18, 29, 30), reinitiation at this second AUG would be unanticipated, as efficiency of reinitiation increases with greater separation between the stop codon of the upstream reading frame and the coding sequences on the mRNA (28-30). At present, a distinction cannot be made between these possible mechanisms. Cells with a MODS frameshift mutant under the control of the MODS promoter yielded no IPPT-I (Fig. 3, lane 5). For YCpmod5fs as for YCpADHmodSfs, a low level of mitochondrial tRNA modification was obtained (Table 1). Although we have no direct evidence, this modification may have been due to a low level of frameshift suppression. Cytoplasmic tRNA i6A in cells expressing YCpmod5fs was comparable to wild-type levels (Table 1). Context Surrounding the First AUG Influences Translation Initiation. The context of an AUG can dictate the efficiency with which it is used in initiation (32, 33). Nucleotides surrounding AUG1 of MOD5 mRNA do not conform to the yeast consensus [5'-AAAAAUGUCU-3' (26)]. If AUG codon context plays a role in MOD5 mRNA translation, then ribosomes scanning the MOD5 transcripts might bypass AUG1 and initiate at AUG2 whose context sequence more closely matches the consensus sequence (Fig. 1). Inefficient initiation at AUG1 would yield small amounts of IPPT-I. Ribosomes bypassing AUG1 would initiate translation efficiently at AUG2, giving rise to the shorter isozyme of IPP transferase, IPPT-II. To test this model we generated YCpmod5cm2 with a sequence context of ATG1 resembling the consensus sequence for yeast initiator regions and the wild-type MOD5 protein sequence (Fig. 1B). Analysis of the 5' transcript ends showed that the altered sequence shifted the transcript ends to -25, -10, and +7 with respect to ATG1 of this mutant gene (Fig. 2, lane 6). Since analyses of mRNA from cells containing YCpADHMOD5 indicated that alterations in the 5' leader sequence influence the distribution of isozymes, a plasmid containing a second context mutant, YCfmod5el, was constructed. We used the nucleotides at -7 to -9 that already resembled the yeast consensus sequence. Mutating a C to G at position -4 introduced a new ATG two codons 5' to the initial first wild-type ATG (ATG1). The mutant also contained an A-to-T change at position -2 so that the new codon encoded serine, which is found more commonly in mitochondrial-targeting sequences than is phenylalanine

(Fig. 1B). Analysis of the 5' transcripts encoded by YCfmod5el indicates that the ends are at -10, -11, and +1 as in

Proc. Natl. Acad. Sci. USA 88 (1991)

wild-type MOD5 RNA (Fig. 2, lane 8). Therefore, any change in i6A of cytoplasmic or mitochondrial tRNATYr or in the distribution of the IPP transferase isozymes should reflect changes in translation initiation of the long transcripts. The short transcripts, with ends at +1, do not contain any mutated sequence and are unaffected. The effect of the altered context sequences on IPP transferase isozymes for both YCfmod5cm2 and YCfmod5el was determined by immunoblotting. Both generated approximately the same level of product as the wild-type MODS sequence (Table 1). However, comparison of extracts of YCfmod5cm2 and YCfmodSel cells to YCfMOD5 cells revealed a change in distribution of isozymes. In YCfMOD5 cells, IPPT-II predominated (-90%), whereas in cells carrying the mutant plasmids the distribution of the two isozymes was approximately equal (Fig. 3, compare lanes 2, 3, and 4). That the total amount of MOD5 antigen is the same for YCfMOD5, YCfmod5el, and YCfMOD5cm2 cells and the proportion of IPPT-I vs. IPPT-II changes from =5-10% to -50%, indicates that the mutation causes a 5- to 10-fold increase in use of AUG1. To determine the biological consequences of the shift in IPP transferase forms, i6A was measured. The level of i6A on cytoplasmic tRNA from YCfmod5cm2 and YCfmod5el cells was 82% and 72%, respectively, of the level found on cytoplasmic tRNA from YCfMOD5 cells (Table 1). The i6A on mitochondrial tRNA extracted from YCfmod5cm2 and YCfmodSel cells was equivalent to that found on mitochondrial tRNA from YCfMOD5 cells (Table 1). Therefore, the redistribution of IPP transferase isozyme in cells containing YCfmod5cm2 and YCfMODSel cells leads to reduced i6A on cytoplasmic tRNATYr. Although we cannot unambiguously interpret the results from the modS-cm2 mutation because of altered transcription initiation, the levels of i6A in the modS-el cells suggest that altering the context of AUG1 of MODS RNA to conform to the yeast consensus results in an increase of translation from that AUG and a concomitant decrease in the short form. DISCUSSION Previously we proposed that MODS mRNA generates IPPI-I and IPPT-II by differential initiation of translation (17). Formally, an alternative model in which translation initiates only at the first AUG and IPPT-II is produced by processing of IPPT-I at the second methionine could account for much of our data. That the MODS sequence of YCpADHMODS is wild-type but yields only IPPT-I argues against the idea that IPPT-II is a product of proteolytic cleavage of IPPT-I and supports our conclusions that translation starts at the first and second AUGs to generate the MOD5 isozymes. We used mutant MODS genes to define factors that influence ribosomal choice of alternate AUGs for the wild-type MODS gene. The results indicate that the mechanisms controlling translation initiation may differ considerably from those previously reported for other yeast genes. For MODS, increasing the length of the 5' untranslated leader sequence alters translation initiation such that only the long form of IPP transferase is detected. There are at least two interpretations of these results. An assumption of the first is, in accordance with other studies of yeast translation initiation (18, 25), that mRNA structure is important in MOD5 translation. The mRNAs with the short leaders (0-4 nucleotides) and perhaps even the longer leaders (10-14 nucleotides) may form secondary structures that preclude efficient utilization of AUG1. The presence of the additional >36 nucleotides in YCpADHMODS could disrupt this putative structure, allowing efficient use of AUG1 and preventing use of AUG2. Although we cannot eliminate this model, we favor an alternate explanation that mRNA leader length per se influences translation efficiency. Accordingly,

Biochemistry: Slusher et al. for wild-type transcripts, the 0-4, and perhaps 10-14, mRNA leaders may be too short for efficient initiation at AUG1, at least when in the wild-type sequence context. Lengthening this to >47 nucleotides would overcome this inefficiency. Changes in translation initiation have been observed for yeast genes when the sequence surrounding the ATG is altered, particularly at the -3 and +4 nucleotides (18, 25). These changes have been small. Therefore, it has been reported that the sequence surrounding the AUG is of minimal importance for translation initiation in yeast (18). However, for MODS, creation of a new ATG surrounded by nucleotides resembling the consensus sequence, leads to a 5to 10-fold increase in translation initiation at AUG1 that ultimately results in reduced levels of i6A on cytoplasmic tRNA and a decrease in nonsense suppression (not shown). The decrease in cytoplasmic tRNA modification is not as great as for YCpADHMOD5 or for mutants that have the ATG2 removed (17). Thus, in cells containing YCfmod5cm2 or YCfmod5el, a significant number of ribosomes must still initiate at AUG2. This can occur from the -10, -11, or +1 transcripts, and the contribution of each to IPPT-II is not known. Since the changes in YCfmod5el affect only the long set of transcripts, some ribosomes scanning the wild-type MOD5 transcripts must bypass AUG1. We propose, therefore, that at least the transcripts initiating at -10 or -11 of MOD5 are bifunctional. Since none of the constructs generated transcripts initiating at +1 in the absence of initiation at -10 or -11, we cannot address whether the short transcripts are also bifunctional. Examples of bifunctional mRNAs have been documented for viruses (see ref. 35) and for a nucleus-encoded chloroplast protein (36) and suggested by a study of in vitro translation products of a rat probasin nuclear gene (11) but not for yeast. Thus, initiation of translation of MOD5 mRNAs is different in several respects from that for other yeast mRNAs, such as HIS4 and CYC1: the length of 5' leaders are unusually short, translation is quite sensitive to AUG context, and at least some transcripts are bifunctional. Why is MOD5 mRNA different? Perhaps the difference is due to mRNA leader length. Yeast mRNAs with no leaders (20) or leaders as short as 2 (21) or 7 (22) nucleotides are able to initiate at their first AUG. However, short leaders are less efficient in initiation than are the average-size leaders of 20-60 nucleotides (22, 26, 27). When leaders 5' to the first AUG of MOD5 are the average size (i.e., ADHMOD5), then the first AUG is used predominately and initiation is not sensitive to AUG context. That is, MOD5 mRNAs with leaders > 47 nucleotides behave like CYC1 and HIS4 mRNAs. The implication is that for yeast mRNAs, there is some critical leader length such that ribosomes initiate at the first AUG encountered regardless of context. Studies of the effect of AUG context with varying leader length will be needed to test this hypothesis. Note Added in Proof. In a recent report, Kozak (50) has shown that MRNAs with short leaders can initiate translation in vitro at a second AUG codon. Oligonucleotides were obtained from the Hershey Medical Center Macromolecular Core Facility. We thank D. Stanford for help with graphics and Drs. C. W. Hill, J. E. Hopper, and D. Stanford for comments of the manuscript and F. Cramer for manuscript preparation. This work has been supported by a National Institutes of Health postdoctoral fellowship to L.B.S., National Science Foundation grants to A.K.H. and N.C.M., and more recently, a National Institutes of Health grant to N.C.M. 1. Hopper, A. K., Furukawa, A. H., Pham, H. D. & Martin, N. C. (1982) Cell 28, 543-550. 2. Natsoulis, G., Hilger, F. & Fink, R. (1986) Cell 46, 235-243. 3. Ellis, S. R., Hopper, A. K. & Martin, N. C. (1987) Proc. NatI. Acad. Sci. USA 84, 5172-5176. 4. Dihanich, M. E., Najarian, D., Clark, R., Gillman, E. C., Martin, N. C. & Hopper, A. K. (1987) Mol. Cell. Biol. 7, 177-184.

Proc. NatL. Acad. Sci. USA 88 (1991)

9793

5. Beltzer, J., Morris, S. & Kohlhaw, G. B. (1988) J. Biol. Chem. 263, 368-374. 6. Chatton, B. P., Walter, P., Ebel, J.-P., Lacroute, F. & Fasiolo, F. (1988) J. Biol. Chem. 263, 52-57. 7. Oda, T., Funai, T. & Ichiyama, A. (1990) J. Biol. Chem. 265, 7513-7519. 8. Carlson, M. & Botstein, D. (1982) Cell 28, 145-154. 9. Strubin, M., Long, E. 0. & Mach, B. (1986) Cell 47, 619-625. 10. Soldati, T., Schafer, B. W. & Perriard, J.-C. (1990) J. Biol. Chem. 265, 4498-4506. 11. Spence, A. M., Sheppard, P. C., Davie, J. R., Matuo, Y., Nishi, N., McKeehan, W. L., Dodd, J. G. & Matusik, R. J. (1989) Proc. Natl. Acad. Sci. USA 86, 7843-7847. 12. Najarian, D., Dihanich, M. E., Martin, N. C. & Hopper, A. K. (1987) Mol. Cell. Biol. 7, 185-191. 13. Schatz, G. & Butow, R. A. (1983) Cell 32, 316-318. 14. Douglas, M. G., Geller, B. L. & Emr, S. D. (1984) Proc. Natl. Acad. Sci. USA 81, 3983-3987. 15. Hurt, E. C., Pedsold-Hurt, B. & Schatz, G. (1984) EMBO J. 3, 3149-3156. 16. Hurt, E. C. & van Loon, A. P. G. M. (1986) Trends Biochem. Sci. 11, 204-207. 17. Gillman, E. C., Slusher, L. B., Martin, N. C. & Hopper, A. K. (1991) Mol. Cell. Biol. 11, 2382-2390. 18. Cigan, A. M., Pabich, E. K. & Donahue, T. F. (1988) Mol. Cell. Biol. 8, 2964-2975. 19. Sherman, F. & Stewart, J. W. (1982) in Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, eds. Strathern, J. N., Jones, E. W. & Broach, J. R. (Cold Spring Harbor Lab., Cold Spring Harbor, NY), pp. 301-333. 20. Maicas, E., Shago, M. & Friesen, J. D. (1990) Nucleic Acids Res. 18, 5823-5828. 21. Ellis, S. R., Hopper, A. K. & Martin, N. C. (1987) Proc. Natl. Acad. Sci. USA 84, 5172-5176. 22. van den Heuvel, J. J., Bergkamp, R. J., Planta, R. J. & Raue, H. A. (1989) Gene 79, 83-95. 23. Kozak, M. (1989) J. Cell Biol. 108, 229-241. 24. Sedman, S. A., Gelembiuk, G. W. & Mertz, J. E. (1990) J. Virol. 64, 453-457. 25. Baim, S. B. & Sherman, F. (1988) Mol. Cell. Biol. 8, 1591-1601. 26. Cigan, A. M. & Donahue, T. F. (1987) Gene 59, 1-18. 27. Kelley, D. E., Coleclough, C. & Perry, R. P. (1982) Cell 29, 681-689. 28. Kozak, M. (1987) Mol. Cell. Biol. 7, 3438-3445. 29. Miller, P. F. & Hinnebusch, A. G. (1989) Genes Dev. 3, 1217-1225. 30. Abastado, J.-P., Miller, P. F., Jackson, B. M. & Hinnebusch, A. G. (1991) Mol. Cell. Biol. 11, 486-496. 31. Kozak, M. (1978) Cell 15, 1109-1123. 32. Kozak, M. (1984) Nature (London) 308, 241-246. 33. Kozak, M. (1986) Cell 44, 283-292. 34. Lomedico, P. T. & McAndrew, S. J. (1982) Nature (London) 299, 221-226. 35. Kozak, M. (1986) Cell 47, 481-483. 36. Giese, K. & Subramanian, A. R. (1990) Biochemistry 29, 1056210566. 37. Messing, J. (1983) Methods Enzymol. 101, 20-78. 38. Bolivar, F. & Backman, K. (1979) Methods Enzymol. 68, 245-267. 39. Ito, H., Fukuda, Y., Murata, K. & Kimura, A. (1983) J. Bacteriol. 153, 163-168. 40. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY), p. 250. 41. Bennetzen, J. L. & Hall, B. D. (1982) J. Biol. Chem. 257, 30183025. 42. McKnight, G. & McConaughy, B. (1983) Proc. Natl. Acad. Sci. USA 80, 4412-4416. 43. Kuo, C.-L. & Campbell, J. L. (1983) Mol. Cell. Biol. 3, 1730-1737. 44. Kunkel, T. (1985) Proc. Natl. Acad. Sci. USA 82, 488-492. 45. Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987) Methods Enzymol. 154, 367-382. 46. Sanger, F. S., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 47. Domdey, H., Apostol, B., Lin, R.-J., Newman, A., Brody, E. & Abelson, J. (1984) Cell 39, 611-621. 48. Hopper, A. K., Traglia, H. M. & Dunst, R. W. (1990) J. Cell Biol. 111, 309-321. 49. Sentenac, A. & Hall, B. (1982) in Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, eds. Strathern, J. N., Jones, E. W. & Broach, J. R. (Cold Spring Harbor Lab., Cold Spring Harbor, NY), pp. 561-606. 50. Kozak, M. (1991) Gene Expression 1, 111-115.