YMPEV 5006

No. of Pages 10, Model 5G

6 September 2014 Molecular Phylogenetics and Evolution xxx (2014) xxx–xxx 1

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev 5 6

Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia

3 4 7 8 9 10 12 11 13 1 2 5 9 16 17 18 19 20 21 22 23 24 25 26 27 28

Q1

Maikel Reck-Kortmann a, Gustavo Adolfo Silva-Arias a, Ana Lúcia Anversa Segatto a, Geraldo Mäder a, Sandro Luis Bonatto b, Loreta Brandão de Freitas a,⇑ a b

Laboratory of Molecular Evolution, Department of Genetics, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS 91501-970, Brazil Laboratory of Genomic and Molecular Biology, Pontifícia Universidade Católica do Rio Grande do Sul, Porto Alegre, RS 90610-001, Brazil

a r t i c l e

i n f o

Article history: Received 28 March 2014 Revised 18 August 2014 Accepted 22 August 2014 Available online xxxx Keywords: Petunia Phylogenetic tree Speciation Southern South America Subtropical grasslands Southern Brazilian Plateau

a b s t r a c t The phylogeny of Petunia species has been difficult to resolve, primarily due to the recent diversification of the genus. Several studies have included molecular data in phylogenetic reconstructions of this genus, but all of them have failed to include all taxa and/or analyzed few genetic markers. In the present study, we employed the most inclusive genetic and taxonomic datasets for the genus, aiming to reconstruct the evolutionary history of Petunia based on molecular phylogeny, biogeographic distribution, and character evolution. We included all 20 Petunia morphological species or subspecies in these analyses. Based on nine nuclear and five plastid DNA markers, our phylogenetic analysis reinforces the monophyly of the genus Petunia and supports the hypothesis that the basal divergence is more related to the differentiation of corolla tube length, whereas the geographic distribution of species is more related to divergences within these main clades. Ancestral area reconstructions suggest the Pampas region as the area of origin and earliest divergence in Petunia. The state reconstructions suggest that the ancestor of Petunia might have had a short corolla tube and a bee pollination floral syndrome. Ó 2014 Elsevier Inc. All rights reserved.

30 31 32 33 34 35 36 37 38 39 40 41 42 43 44

45 46

1. Introduction

47

Phylogenetic analysis is frequently used as a preliminary investigation of the evolutionary diversity of groups, especially those that have proven taxonomically challenging using traditional taxonomic methods (Moritz, 1994). This approach is demonstrably effective in discovering cryptic and difficult to distinguish species (Bickford et al., 2006; Dasmahapatra et al., 2010). Compared with traditional morphological characters, genetic data facilitate the delimitation of species that are morphologically indistinguishable, providing valuable information about processes related to speciation (Hey, 2010), recent or ancient gene flow, and the relationships between potential species (Nielsen and Wakeley, 2001; Hey and Nielsen, 2007; Hey, 2010). However, ancestral polymorphism and processes such as incomplete lineage sorting or horizontal gene transfer between species can hamper the phylogenetic reconstruction of recent lineages (Avise and Wollenberg, 1997; Maddison, 1997; Funk and Omland, 2003; Knowles and Carstens, 2007).

48 49 50 51 52 53 54 55 56 57 58 59 60 61 62

⇑ Corresponding author. Address: Department of Genetics, UFRGS, P.O. Box 15053, Porto Alegre, RS 91501-970, Brazil. Fax: +55 51 3308 9823. E-mail address: [email protected] (L.B. de Freitas).

The use of a large number of DNA fragments can provide better phylogenetic resolution, allowing the determination of previously unresolved relationships (López-Fernández et al., 2010; Rowe et al., 2011). This occurs because the inclusion of multiple loci allows the differentiation of forces that have affected all loci from those that have acted on individual loci (e.g., natural selection) (Hilton and Hey, 1997). Therefore, the use of multigenic data has been suggested to produce strongly supported phylogenetic estimates (Chen and Li, 2001; Rokas et al., 2003; Gadagkar et al., 2005; Rokas and Carroll, 2005; Smith et al., 2009; Robertson et al., 2011). Adaptive radiation has been proposed as an explanation for the high diversification presented by several plant species in some regions, especially on islands (e.g., Hou et al., 2011; Rowe et al., 2011), but has also likely occurred in areas that have experienced rapid climatic or geologic changes (Hughes and Eastwood, 2006). The species complexes that originated from these instable areas are of particular interest for evolutionary studies, as they represent ongoing speciation and often include rare taxa. Petunia Juss. (Solanaceae) is an endemic genus from South America that is suggested to have undergone a rapid diversification process during the Pleistocene climatic changes (Lorenz-Lemke et al., 2010). These species are known worldwide through the

http://dx.doi.org/10.1016/j.ympev.2014.08.022 1055-7903/Ó 2014 Elsevier Inc. All rights reserved.

Please cite this article in press as: Reck-Kortmann, M., et al. Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. (2014), http://dx.doi.org/10.1016/j.ympev.2014.08.022

63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85

YMPEV 5006

No. of Pages 10, Model 5G

6 September 2014 2 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151

M. Reck-Kortmann et al. / Molecular Phylogenetics and Evolution xxx (2014) xxx–xxx

commercial garden petunia, an artificial interspecific hybrid cultivated since the nineteenth century (Stout, 1952; Sink, 1975). The distribution of Petunia species is delimited into three main areas according to altitudinal zones: the lowlands between 0 and 500 m above sea level (m a.s.l.), which form the Pampas region located in Uruguay, some provinces in western Argentina, and part of Rio Grande do Sul, Brazil; the southern Brazilian Plateau, between 500 and 900 m a.s.l. in the Brazilian states of Rio Grande do Sul and Santa Catarina; and the subtropical highland grasslands, at elevations higher than 900 m a.s.l. in the southern Brazilian Plateau located in the Brazilian states of Rio Grande do Sul, Santa Catarina, and Paraná. Additionally, three isolated taxa are distributed in disjunct areas: P. axillaris ssp. subandina, distributed in the Sub-Andean region of Argentina; P. occidentalis, occurring in the Sub-Andean regions of Bolivia and Argentina; and P. mantiqueirensis, occurring in tropical highland grasslands in Atlantic Rainforest in Minas Gerais, southeast Brazil (Stehmann et al., 2009). The morphological circumscription of species within the genus is not easy, and there is no agreement about the number of Petunia taxa. Over time, differences in habitat, geographic distribution, and minor details in floral and vegetative structures have led to many changes in the genus’s taxonomy, ranging from 19 (Ando et al., 2005) to 18 (Stehmann et al., 2009) taxa but with different synonyms. Table 1 presents taxa names with authorities considering all different morphological species or subspecies. The species may be classified into two groups according to corolla tube length: a short tube group that includes purple-flowered and bee-pollinated species and a long tube group that comprises three species: P. exserta, which presents red flowers and an ornithophilous floral syndrome (Stehmann, 1987; Lorenz-Lemke et al., 2006); P. axillaris, with white flowers pollinated by hawkmoths (Galetto and Bernardello, 1993; Ando et al., 2001); and P. secreta, a bee-pollinated pinkish-flowered species (Stehmann and Semir, 2005). Recently, several studies have included molecular data in phylogenetic reconstructions of Petunia, but all of these studies have failed to include all taxa (Ando et al., 2005; Kulcheski et al., 2006; Chen et al., 2007) and/or have analyzed few genetic markers (Chen et al., 2007; Lorenz-Lemke et al., 2010). A common result in these analyses is short genetic distances observed between taxa and, consequently, poorly resolved phylogenies, indicating recent diversification of the genus. The genetic variability in both plastid and nuclear markers is low, and several markers have failed to differentiate species (Kulcheski et al., 2006) or individuals within species (Lorenz-Lemke et al., 2010). Nevertheless, when based on plastid markers (Ando et al., 2005; Lorenz-Lemke et al., 2010), phylogenetic analysis detected two major groups: one corresponding to species that occur in areas more than 500 m a.s.l. and another composed of species that live in areas up to 500 m a.s.l. On the other hand, based on the nuclear marker Hf1 gene, Chen et al. (2007) also found two major clusters that were not necessarily associated with the elevation of their geographic distributions. The Tnt1-related mobile elements (Kriedt et al., 2014) found in Petunia species present an evolutionary history compatible with the Hf1 gene tree obtained by Chen et al. (2007), and the two main clades of elements correspond to species that present short and long (+P. occidentalis) corolla tubes. Despite several phylogenetic studies of the genus Petunia, the relationships among many of the species remain unclear. Phylogeographic approaches used in particular comparisons have obtained partial success. Lorenz-Lemke et al. (2006) studied P. exserta and P. axillaris ssp. axillaris, considering three plastid intergenic spacers, and established the closeness of these taxa despite the differences in their morphologies and pollination syndromes. Segatto et al. Q2 (2014a) improved the sample sizes for the same species and included nuclear markers, confirming the genetic proximity of taxa

and identifying natural hybrids by their morphological and genetic traits. Lorenz-Lemke et al. (2010) evaluated two combined plastid sequences in seven species from highland open fields, and the principal result obtained was an ancestral polymorphism shared among the species. Longo et al. (2014) studied plastid markers and the internal transcribed spacers of the nuclear ribosomal DNA (ITS) in five taxa of the P. integrifolia group, which could be considered ochlospecies (Ando et al., 2005), and were able to confirm only three evolutionary lineages. Natural interspecific hybrids have not been described for Petunia except between P. exserta and P. axillaris ssp. axillaris, based on molecular and morphological data (Lorenz-Lemke et al., 2006; Segatto et al., 2014a), and between two subspecies of P. axillaris, based on morphological traits (Kokubun et al., 1997). In this study, we employed the most inclusive genetic and taxonomic datasets for the genus, aiming to reconstruct the evolutionary history of Petunia based on molecular phylogeny, biogeographic distribution, and character evolution.

152

2. Materials and methods

170

2.1. Sample collection and DNA extraction

171

We included all 20 Petunia morphological species or subspecies in these analyses. Samples were preferably collected from the type localities or at least from nearby places, and all exhibited the canonical morphology reported in their original descriptions. The geographic coordinates of samples were obtained using the Global Positioning System (GPS), and one plant of each taxon was deposited at the BHCB (Universidade Federal de Minas Gerais, Belo Horizonte, Brazil) herbarium (acronyms according to Thiers, 2010). We extracted the total genomic DNA from silica-dried leaves following the basic procedures of the CTAB (cetyl-trimethyl ammonium bromide)-based method described by Roy et al. (1992). Additionally, we included samples of three Calibrachoa species representing two subgenera (Fregonezi et al., 2012) as outgroups as well as sequences of Petunia from the literature. Table 1 provides voucher information and GenBank accession numbers for each taxon analyzed.

172

2.2. Polymerase chain reaction (PCR) amplification and sequencing

188

New sequences were obtained for six nuclear regions: glyceraldehyde 3-phosphate dehydrogenase gene (G3PDH); microsatelliteflanking regions PID1D6 and PID3C4; and nuclear introns of genes WOX1, WOX4, and WUS. Three nuclear and five plastid DNA markers were obtained from the literature and included in this study: ITS (Kulcheski et al., 2006); the Hf1 gene (Chen et al., 2007); the PolA1 gene (Zhang et al., 2008); plastid gene spacers trnH-psbA (Kulcheski et al., 2006; Lorenz-Lemke et al., 2006, 2010), trnS-trnG (Lorenz-Lemke et al., 2006, 2010), and trnL-trnF (Kulcheski et al., 2006); the trnL intron (Kulcheski et al., 2006); and the matK gene (Chen et al., 2007). The collection and molecular criteria used here were the same as in Kulcheski et al. (2006) and Lorenz-Lemke et al. (2006, 2010). Primers and PCR conditions are cited in Table 2. Where previous studies did not include all morphological species or subspecies of the genus, we completed the matrix, amplifying the missing taxa using the same protocols and primers previously described, except for the Hf1 gene, for which a new primer set developed from sequences available in GenBank (AB242220– AB242238) was used (Pet_Hf1a and Pet_Hf1b). All PCR products were purified using 20% polyethyleneglycol (Dunn and Blattner, 1987) followed by amplification with a DYEnamic ET Terminator Sequencing Premix Kit (GE Healthcare BioSciences Corp., Piscataway, NY, USA), which employs dideoxy chain

189

Please cite this article in press as: Reck-Kortmann, M., et al. Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. (2014), http://dx.doi.org/10.1016/j.ympev.2014.08.022

153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169

173 174 175 176 177 178 179 180 181 182 183 184 185 186 187

190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211

YMPEV 5006

No. of Pages 10, Model 5G

6 September 2014 3

M. Reck-Kortmann et al. / Molecular Phylogenetics and Evolution xxx (2014) xxx–xxx Table 1 GenBank accession and voucher references (represented by superscript number). Sequences obtained in this study are in bold. Species P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P.

trnH-psbA

altiplana T. Ando & Hashim axillaris ssp. axillaris (Lam.) Britton, Sterns and Poggenb axillaris ssp. parodii (Steere) Cabrera axillaris ssp. subandina T. Ando bajeensis T. Ando and Hashim bonjardinensis T. Ando & Hashim integrifolia ssp. depauperata R. E. Fr exserta Stehmann guarapuavensis T. Ando and Hashim. inflata R. E. Fr integrifolia (Hook.) Schinz and Thell interior T. Ando and Hashim littoralis L. B. Sm. & Downs mantiqueirensis T. Ando & Hashim occidentalis R. E. Fr reitzii L. B. Sm. & Downs riograndensis T. Ando and Hashim

P. saxicola L. B. Sm. & Downs P. secreta Stehmann & Semir P. scheideana L. B. Sm. & Downs C. parviflora (Juss.) D’Arcy C. linoides (Sendtn.) Wijsman C. excellens (R.E. Fr.) Wijsman G3pdh P. altiplana P. axillaris ssp. axillaris P. axillaris ssp. parodii P. axillaris ssp. subandina P. bajeensis P. bonjardinensis P. integrifolia ssp. depauperata P. exserta P. guarapuavensis P. inflata P. integrifolia P. interior. P. littoralis P. mantiqueirensis. P. occidentalis P. reitzii P. riograndensis P. saxicola P. secreta P. scheideana C. parviflora C. linoides C. excellens

KJ507367 KJ507368 KJ507369 KJ507370 KJ507371 KJ507372 KJ507373 KJ507374 KJ507375 – KJ507376 KJ507377 – KJ507378 KJ507379 KJ507380 KJ507381 KJ507382 KJ507383 – KJ507384 – –

PolA1 KJ507351 AB3694049 AB3694089 AB3694069 KJ507352 KJ507353 KJ507354 KJ507355 KJ507356 AB3694109 AB3694129 KJ507357 KJ507358 KJ507359 KJ507360 KJ507365 KJ507361 KJ507362 KJ507364 KJ507363 KJ507366 – –

trnS-trnG 1

trnL-trnF

DQ791926 JF9175592 JF9178062 JF9178632 KJ024581 DQ7920101 KJ024582 DQ2256661 DQ7921831 DQ2081513 DQ2081103 KJ024583 DQ2081563 DQ7920591 KJ024584 DQ7920821 DQ2081023

1

DQ792201 JF9181162 JF918364 2 JF918421 2 KJ024576 DQ792285 1 KJ024577 DQ225424 1 DQ7924581 DQ2080203 DQ2079803 KJ024578a KJ024579 DQ7923341 KJ024580 DQ7923571 DQ2079723

DQ7921061 AY7728974 DQ7921261 JX1786545 JX1786485 JX1786435

DQ7923811 KC8329156 DQ7924011 DQ2080293 JN5658347 JN5658307

PID3C4 KJ507304 KJ507305 KJ507306 KJ507307 KJ507308 KJ507309 KJ507310 KJ507311 KJ507312 KJ507313 KJ507314 KJ507315 KJ507316 KJ507317 KJ507318 KJ507319 KJ507320 KJ507321 KJ507323 KJ507322 – – –

PID1D6 KJ507324 KJ507325 KJ507326 KJ507327 KJ507328 KJ507329 KJ507330 KJ507331 KJ507332 KJ507333 KJ507334 KJ507335 KJ507336 KJ507337 KJ507338 KJ507339 KJ507340 KJ507341 KJ507343 KJ507342 – – KJ507350

trnL intron 4

matK

ITS

AY772868 AY7728774 KJ024594 KJ024595 KJ024596 AY7728714 KJ024597 AY7728784 KJ024598 KJ024599 KJ024600 KJ024601 AY7728744 AY7728724 KJ024602 AY7728754 AY7728734

4

AY772839 AY772844 4 KJ024585 KJ024586 KJ024587 AY772842 4 KJ024589 AY772843 4 KJ024590 KJ024588 KJ024591 KJ024592 AY7728374 AY7728414 KJ024593 AY7728384 AY7728354

AB262052 AB2620538 AB2620548 AB2620558 AB2620568 AB2620578 AB2620628 AB2620588 AB2620598 AB2620608 AB2620618 AB2620638 AB2620648 AB2620658 AB2620668 AB2620678 AB2620688

AY7728694 AY7728764 AY7728704 JN5657897 JN5657847 KJ024603

AY7728364 AY7728454 AY7728404 JN5658147 JN5658097 JN5658057

AB2620698 KJ507344 AB2620708 KJ507347 KJ507346 KJ507345

Hf1

WUS 8

AB244220 AB2442228 AB2442288 AB2442218 AB2442238 AB2442248 AB2442258 AB2442298 AB2442308 AB2442278 AB2442268 AB2442318 AB2442328 AB2442338 AB2442348 AB2442358 AB2442368 AB2442378 KJ507348 AB2442388 KJ507349 – KJ507350

8

AY7729314 KJ200348 6 KJ200350 6 KJ200351 6 KJ200353 6 AY772932/AY7728524 KJ200357 6 KJ200349 6 KJ200356 6 DQ2080813 DQ2080473 KJ200354 6 DQ2080913 AY772934/AY7728544 KJ200355 6 AY772935/AY7728554 AY772933/AY772827/ AY7728534 AY7729364 AY7729374 KJ200352 6 – KJ200358 KJ200359

WOX1 10

KF928399 KF92840310 KF92842010 KF92841210 KF92840610 KF92841610 – KF92840110 KF92839310 KF92839410 KF92841510 KF92841710 KF92841410 KF92839710 KF92840510 KF92840810 KF92839510 KF92840710 KF92840010 KF92841010 KF92840910 – –

Voucher⁄

WOX4 10

KF928347 KF92835110 KF92835210 KF92836010 KF92835410 KF92836410 – KF92834910 KF92834110 KF92834210 KF92836310 KF92836510 KF92836210 KF92834510 KF92835310 KF92835610 KF92834310 KF92835510 KF92834810 KF92835810 KF92835710 – –

10

KF928372 KF92837610 KF92837710 KF92838510 KF92837910 KF92838910 – KF92837410 KF92836610 KF92836710 KF92838810 KF92839010 KF92838710 KF92837010 KF92837810 KF92838110 KF92836810 KF92838010 KF92837310 KF92838310 – – KF92839210

BHCB 79906 ICN 164594 ICN164581 BHCB 140429 BHCB 102127 BHCB 80085 LEM_depa123 ICN158643 BHCB 96623 BHCB 87295 BHCB 79869 BHCB 156817 BHCB 80104 BHCB 78269 LEM_occi BHCB 80069 BHCB 75139 BHCB 80065 BHCB 80082 BHCB 80046 CESJ45735 LEM_lino04 LEM_exce133

References: 1 – Lorenz-Lemke et al. (2010); 2 – Turchetto et al. (2014); 3 – Longo et al. (2014); 4 – Kulcheski et al. (2006); 5 – Fregonezi et al. (2013); 6 – M. Reck-Kortmann (Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil, unpubl. data); 7 – Fregonezi et al. (2012); 8 – Chen et al. (2007); 9 – Zhang et al. (2008); 10 – A.L.A. Segatto (Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil, unpubl. data); ICN – Herbarium of Institute of Biosciences, Universidade Federal do Rio Grande do Sul, Brazil; BHCB – Herbarium of Institute of Biosciences, Universidade Federal de Minas Gerais, Brazil; LEM – collector number, Laboratory of Molecular Evolution, Department of Genetics, Universidade Federal do Rio Grande do Sul, Brazil. ⁄ Voucher for present work and references 1–7 and 10.

213

termination fluorescent labeling, and thereafter sequenced in a MEGABACE 1000 automatic sequencer (GE Healthcare).

214

2.3. Sequence alignment

215

We assembled and edited the sequences using the software CHROMAS 2.0 (Technelysium, Helensvale, Australia). Alignments were prepared separately for each plastid and nuclear molecular marker and edited manually in MEGA 6 (Tamura et al., 2013). Contiguous insertion/deletion (indels) events involving more than one base pair (bp) were coded and treated as one mutational event (Simmons and Ochoterena, 2000). Ambiguous sites of nuclear markers were treated according to Mäder et al. (2010) and were not included in the matrix. For the Hf1 alignment only, partial sequences of Chen et al. (2007) were used in the analysis (frag-

212

216 217 218 219 220 221 222 223 224

ments from 396 to 1054 nt and from 3842 to 4617 nt, corresponding to sequences obtained for the new taxa using the primers Pet_Hf1a and Pet_Hf1b). The sequences of Hf1 were trimmed to minimize missing characters.

225

2.4. Genetic diversity and phylogenetic analysis

229

Basic information on genetic variability across the taxa and markers was estimated in MEGA. Phylogenetic relationships were inferred using the Bayesian inference (BI) species tree model (⁄BEAST, Heled and Drummond, 2010) as implemented in BEAST 1.8.0 (Drummond et al., 2012). Because the method requires a priori designation of species or populations, all 20 species or subspecies were used as terminal taxa (see Table 1). Each gene segment (partition) was used with its independent site, clock, and tree (in

230

Please cite this article in press as: Reck-Kortmann, M., et al. Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. (2014), http://dx.doi.org/10.1016/j.ympev.2014.08.022

226 227 228

231 232 233 234 235 236 237

YMPEV 5006

No. of Pages 10, Model 5G

6 September 2014 4

M. Reck-Kortmann et al. / Molecular Phylogenetics and Evolution xxx (2014) xxx–xxx

Table 2 Primer sequences, PCR conditions and references. Name

Primer forward

Sequence (50 –30 )

Primer reverse

Sequence (50 –30 )

GTTATGCATGAACGTAATGCTC GCC GCT TTA GTC CAC TCA GC

trnH g

GGTTCAAGTCCCTCTATCCC CGAATCGGTAGACGCTACG

Size (pb)

TA (°C)

Elongation Primer and time (min) amplification reference

449 756

58 54

1 0.45

Sang et al. (1997) Hamilton (1999)

f d

CGCGCATGGTGGATTCACAAAT GAA CGA ATC ACA CTT TTA CCA C ATTTGAACTGGTGACACGAG GGGGATAGAGGGACTTGAAC

355 471

52 56

1 0.45

Taberlet et al. (1991) Taberlet et al. (1991)

CGATCTATTCATTCAATATTTC

matK 1326

TCTAGCACACGAAAGTCGAAGT

866

56

1

Johnson and Soltis (1994)

WUS

ITS75 GPDX7 19ex5p 20ex5p F F Hf1a–F Hf1b–F Wus–L

TATGCTTAAACTCAGCGGG GATAGATTTGGAATTGTTGAGG CTCGCTGGACGGGGTGAGATGAAT TCAAGACAAGCTCGGAATCAGTGG CTGAAGGTTGTTGCCTGTTG TGGCTATAGAGGAACATACCAATAG TGCAGGTGYTGTATGTKCTAGA TTTGTTCACWGCYGGTACGG AGATGGTAGCAACAAAAACAACAG

ITS92 GPDX9R 20ex3p 21ex3p R R Hf1a–R Hf1b–R Wus-R

AAGGTTTCCGTAGGTGAAC AAGCAATTCCAGCCTTGG ACCATCCCCATAATCCATCTCATC ATACTTTCTTTGCAGCTTTTGGG CATCCCCTGTGTATGGAAATG CTGCTAAACATTTGGACATGG TTAGCATCACTTGWCCGATCA TARAAGGGCKGAACAACAAA ACTGCTAGGACACCATGAGAAGA

532 572 652 302 178 239 652 773 205

55 57 53 55 56 56 57 57 55

1.30 2 1 1 1 1 2 2 0.35

WOX1

Wox1-L

ATGTGGATGATGGGTTACAAT

Wox 1-R

AATTGTTACGGGACTGCTCATC

202

55

0.35

WOX4

Wox 4-L CTACTCCCTCACTCTCACTTGGTT

Wox-R

GACTATGGCTGGTGGTGTTCTTG

343

60/55 0.30

Desfeux and Lejeune (1996) Olsen and Schaal (1999) Zhang et al. (2008) Zhang et al. (2008) Kriedt et al. (2013); This study Kriedt et al. (2013); This study This study This study Segatto et al. (not published data) Segatto et al. (not published data) Segatto et al. (not published data)

Plastidial trnH-psbA psbA trnS-trnG s trnl-trnF e trnL c intron matK matK 390 Nuclear ITS G3pdh PolA1 PID3C4 PID1D6 Pet_Hf1

261

the latter case, the cpDNA segments were linked in a single partition tree) model. For the species tree prior, we used the Yule process. For all partitions, we used HKY substitution model based on jModelTest (Darriba et al., 2012) with six gamma categories as well as the strict clock. We ran two independent one-billion-generation chains sampled every 10,000 generations. We assessed MCMC convergence and determined burn-in by examining effective sample size values (ESS > 200) and likelihood plots in the program TRACER 1.6 (Rambaut et al., 2013). Giving the difficulty for the runs to stabilize, the first 90% of the trees were discarded as burn-in (that is, only the last 10,000 sampled trees were used) in TreeAnnotator to generate a maximum clade credibility tree. Bayesian Posterior Probabilities (PP) were used as a measure of clade support (PP; Rannala and Yang, 1996). We used FigTree 1.4.0 (Rambaut, 2008) to draw the phylogenetic tree. Maximum likelihood (ML) analysis of the concatenated dataset was performed using the online version of PhyML 3.0 (Guindon et al., 2010) on the South of France bioinformatics platform (http://www.atgc-montpellier.fr/phyml/). We implemented the HKY model selected for the combined unpartitioned dataset. Bootstrap values were calculated based on 1000 replicates, starting with a single BIONJ tree moved by nearest-neighbor interchange (NNI) (Gascuel, 1997). ML phylogenetic tree was rooted using homologous sequences derived from three Calibrachoa species.

262

2.5. Ancestral area reconstructions

263

Petunia species present clear patterns of distribution along the elevation gradient occupied by the genus. All species, except two, are restricted to a specific elevation range. This pattern was used to identify four main areas of endemism that were used for the biogeographic reconstructions (Fig. 1; Table S1): (A) Pampas grasslands (species distributed below 500 m); (B) plateau grasslands (species distributed between 500 and 900 m); (C) subtropical highland grasslands (species distributed above 900 m); and (D) eastern sub-Andean grasslands (species distributed above 500 m in the eastern slopes of the Andean Cordilleras). We used Statistical Dispersal-Vicariance analysis (S-DIVA; Yu et al., 2010) and Bayesian Binary Markov chain Monte Carlo (BBM) as implemented in RASP

238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260

264 265 266 267 268 269 270 271 272 273 274

Q5

software (Yu et al., 2013) to reconstruct the ancestral ranges of Petunia on the maximum clade credibility tree obtained with BI analysis. To account for uncertainties in both tree topologies, the frequencies of ancestral ranges at nodes were averaged over all the post-burn-in trees sampled in the BI analysis. The analyses were implemented using default parameters in RASP except for the number of maximum areas, which was kept at 2. For BBM analysis, two MCMC chains were run simultaneously for 500,000 generations. The state was sampled every 1000 generations. To evaluate the influence of the root distribution assumption on the BBM analysis, we conducted six analyses with alternative ancestral areas enforced, two with null and wide distributions and four in which the root was assumed to have occurred in each of the biogeographical areas delimited for this analysis. Additionally, we performed a parsimony reconstruction in MESQUITE 2.75 software (Maddison and Maddison, 2010). We based character state reconstructions on the topology of the Bayesian species tree. Ancestral states were then summarized on the maximum clade credibility tree.

275

2.6. Ancestral state reconstruction

294

Ancestral states for two characters were reconstructed in MESQUITE using a parsimony model with characters treated as unordered. We based ancestral state reconstructions on the topology of the Bayesian species tree. The character states observed were ‘‘corolla tube length’’ [(1) short tube and (2) long tube] and ‘‘pollination syndrome’’ [(1) melittophily, (2) sphingophily, and (3) ornithophily]. The species were scored based on published studies, personal communications, and observations and floral traits of field or herbarium specimens. The characters of each taxon are listed in Supplementary Table S1.

295

3. Results

305

3.1. Alignment characterization

306

In the species phylogenetic analysis, the data matrix included 7633 characters, of which 577 (7.6%) were variable and 230 (3%)

307

Please cite this article in press as: Reck-Kortmann, M., et al. Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. (2014), http://dx.doi.org/10.1016/j.ympev.2014.08.022

276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293

296 297 298 299 300 301 302 303 304

308

YMPEV 5006

No. of Pages 10, Model 5G

6 September 2014 5

M. Reck-Kortmann et al. / Molecular Phylogenetics and Evolution xxx (2014) xxx–xxx

Fig. 1. Bayesian inference of Petunia species tree based on plastid and nuclear sequences. Thick black and gray branches correspond to nodes with posterior probabilities equal to 1 or between 0.7 and 0.9, respectively. The vertical bars to the right of the tree indicate the principal clades identified in the analysis. The pie charts on the nodes show the most likely ancestral areas as reconstructed by statistical dispersal-vicariance analysis (S-DIVA) with frequencies >1; the other reconstructions are collectively indicated in black (⁄). Current distributions are indicated before the species names. The map shows the geographical extents of the four areas considered in the analysis.

309 310 311 312 313 314 315 316 317 318 319 320 321

were parsimoniously informative. The nuclear regions were more parsimoniously informative (from 1.0% in G3PDH to 9.3% in WUS intron), whereas the plastid sequences ranged from 0.8% (trnLintron) to 2.9% (trnH-psbA). See Table 3 for more information about the individual sequences. The final alignment consisted of only 10% empty cells. All sequences generated for this study have been deposited in GenBank; Table 1 presents the accession numbers. The species P. axillaris, P. exserta, P. secreta, and P. occidentalis were characterized by sharing seven insertion/deletions (indels) in nuclear markers: six indels (no more than 20 bp) in the PolA1 and Hf1 genes and a larger one in the G3PDH sequence, with 259 bp. These species also shared 23 exclusive point mutations in the nuclear markers.

322

3.2. Petunia phylogeny

323

Phylogenetic reconstruction using Bayesian inference and maximum likelihood resulted in similar topologies. Fig. 1 shows the BI tree, and the ML tree is presented in Fig. S1 (Supplementary Material). Petunia formed a monophyletic group in both analyses. Petunia split into two major groups with full support, here termed clades I and II and described below (see Supplementary Figs. S2 and S3 for species flower morphology). Clade I was represented exclusively by purple-flowered and bee-pollinated species with a short corolla tube and comprised three subclades: subclade IA, formed by P. bajeensis, P. bonjardinensis, P. reitzii, P. saxicola, P. scheideana, P. mantiqueirensis, and P. altiplana; subclade IB, composed of P. integrifolia ssp. depauperata, P. littoralis, P. integrifolia, and P. riograndensis; and subclade IC, formed by P. inflata, P. inte-

324 325 326 327 328 329 330 331 332 333 334 335

Table 3 Genetic variability of each sampled marker used in this study, including: alignment length (number of base pairs); variable and parsimony-informative (PI) sites for each sampled locus; and percentage of missing data. Locus

Aligned length

Variable sites (%)

PI sites (%)

% Missing data

Plastidial trnH-psbA trnS-trnG trnL-trnF trnL intron matK gene

449 756 355 471 866

23 (5.1) 25 (3.3) 9 (2.5) 10 (2.1) 32 (3.7)

13 (2.9) 12 (1.6) 4 (1.1) 4 (0.8) 19 (2.2)

Zero Zero Zero Zero 4.34

cpDNA Total

2897

99 (3.4)

52 (1.8)

1.42

Nuclear ITS Hf1 gene PolA1gene G3pdh PID1D6 PID3C4 Intron of WOX4 Intron of WUS Intron of WOX1

532 1430 1002 572 239 178 355 205 223

66 (12.4) 134 (9.4) 80 (8.0) 39 (6.8) 8 (3.3) 9 (5.1) 69 (19.4) 40 (19.5) 33 (14.8)

34 (6.4) 63 (4.4) 13 (1.3) 6 (1.0) 4 (1.7) 8 (4.5) 20 (5.6) 19 (9.3) 11 (4.9)

Zero 10.11 12.76 28.24 13.04 13.04 13.04 13.04 27.04

Nuclear total

4736

478 (10.1)

178 (3.8)

13.50

Total

7633

577 (7.6)

230 (3.0)

9.68

rior, and P. guarapuavensis. The species in subclade IA are from the highland open fields of southern Brazil at altitudes of more than 900 m, except P. bajeensis, which is restricted to the Pampas region. Subclade IB encompasses the P. integrifolia group, whose

Please cite this article in press as: Reck-Kortmann, M., et al. Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. (2014), http://dx.doi.org/10.1016/j.ympev.2014.08.022

336 337 338 339

YMPEV 5006

No. of Pages 10, Model 5G

6 September 2014 6

M. Reck-Kortmann et al. / Molecular Phylogenetics and Evolution xxx (2014) xxx–xxx

353

species occur in the Pampas region and in the southern coastal region of Brazil. Within subclade IC, P. inflata and P. interior are preferentially found at elevations above 500 m, although several P. interior populations occur at elevations between 500 and 700 m in Santa Catarina state, whereas P. guarapuavensis is distributed between 800 and 1200 m. Clade II is represented by the three P. axillaris’ subspecies, P. exserta, P. occidentalis, and P. secreta. These taxa exhibit all three pollination syndromes found in Petunia (sphingophily, ornithophily, and melittophily, respectively). In this group, only P. occidentalis presents a short corolla tube; it occurs on eastern Andean slopes higher than 700 m. P. axillaris ssp. subandina occurs adjacent to the P. occidentalis range but at elevations lower than 700 m, and the other species of clade II occur in the Pampas region.

354

3.3. Ancestral area reconstruction

355

Ancestral area reconstructions for key nodes based on S-DIVA are presented in Fig. 1. Those for BBM and MESQUITE are presented in Supporting Information (Figs. S4 and S5, respectively). All analyses revealed similar ancestral reconstructions for the evaluated nodes. S-DIVA identified area A as the ancestral range for the basal node of Petunia (frequency 64.2%, with the rest divided between areas AC and CD with frequencies 22% and 14%, respectively; Fig. 1). For BBM analyses, the frequency of area A as the ancestral range for Petunia ranged from 99.7% to 80.7% (Fig. S4). For the MRCA of clade I, S-DIVA reconstructed three possible ancestral areas: A, AB, or AC, with similar frequencies (36%, 32%, and 32%, respectively). In regard to the BBM analyses, the most likely ancestral area inferred for the MRCA of clade I was A, with frequencies between 88% and 98% (Fig. S4). The S-DIVA analysis suggested that the divergence of subclade IA was preceded by a dispersal process from the Pampas grasslands (area A) to the highland grasslands (area C), followed by a vicariance process (Fig. 1). Another independent colonization of the highland grasslands is found in subclade IC. The ancestral area of this node was reconstructed as AC (50%) or BC (49%) in S-DIVA (Fig. 1) and as A (63–75%) in the BBM analyses (Fig. S4).

340 341 342 343 344 345 346 347 348 349 350 351 352

356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375

Q6

For clade II, the S-DIVA analysis reconstructed A (66%) or AD (34%) as the most likely ancestral area for this group (Fig. 1). The BBM analyses showed that the Pampas region (A) was the most likely ancestral area for clade II, with frequencies between 83% and 94% (Fig. S4).

376

3.4. Character evolution of Petunia tube morphology and pollination syndromes

381

The character state reconstructions indicate that the ancestor of Petunia might have had a short corolla tube and a bee pollination floral syndrome (Fig. 2). A short corolla tube and bee pollination persisted in clade I, whereas the species of clade II evolved a long corolla tube in most species, followed by a reversion to a short tube in P. occidentalis, and the pollinator syndrome evolved in some species to hawkmoth (P. axillaris complex) and hummingbird (P. exserta) pollination, followed by a reversion to bee pollination in P. secreta and P. occidentalis.

383

4. Discussion

392

4.1. Multilocus approaches

393

This is by far the study with the largest number of markers (9 nuclear and 5 plastid) and sites and the first to include all 20 taxa within Petunia (Ando et al., 2005; Kulcheski et al., 2006; Chen et al., 2007; Lorenz-Lemke et al., 2010). Although, as expected in groups that have undergone diversification recently (e.g. Richardson et al., 2001; Carstens and Knowles, 2007; Alarcón et al., 2012), sequence divergence between species was rather limited. Moreover, all previous phylogenetic analyses within Petunia have adopted the strategy of inferring species relationships using a single gene or multiple concatenated genes to form a single supergene. However, although this method may results in a wellsupported phylogeny (Rokas et al., 2003), sometimes it can increase the support for an incorrect species tree topology, especially when markers from different genomes are combined (Degnan and Rosenberg, 2006). Here we adopt the species-tree

394

Fig. 2. Evolution of Petunia corolla tube length and pollinator syndromes inferred from a parsimony model based on the Bayesian species tree topology. Color codes are shown in the legend.

Please cite this article in press as: Reck-Kortmann, M., et al. Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. (2014), http://dx.doi.org/10.1016/j.ympev.2014.08.022

377 378 379 380

382

384 385 386 387 388 389 390 391

395 396 397 398 399 400 401 402 403 404 405 406 407 408

YMPEV 5006

No. of Pages 10, Model 5G

6 September 2014 M. Reck-Kortmann et al. / Molecular Phylogenetics and Evolution xxx (2014) xxx–xxx

417

approach [see Liu et al. (2009) and Edwards (2009) for review], which simultaneously estimates each gene tree and the underlying history of species divergence, providing direct estimates of species trees. The Bayesian reconstruction of species tree using multiple independent loci is rapidly gaining support as the best approach, especially in recently radiated taxa (Cutter, 2013). Therefore, considering the above arguments, we consider the tree presented here as the best supported phylogenetic hypotheses within Petunia to date.

418

4.2. Phylogenetic relationships of Petunia

419

Our results based on an expanded sampling scheme reinforced the monophyly of the genus Petunia proposed in previous studies (Ando et al., 2005; Kulcheski et al., 2006; Chen et al., 2007; Lorenz-Lemke et al., 2010). Comparing Petunia species tree found here (Fig. 1) to the phylogenies published previously that exclusively or mostly included cpDNA markers (Ando et al., 2005; Kulcheski et al., 2006; LorenzLemke et al., 2010), we find a notable difference in relation to the composition of major clades. Where cpDNA reveals clades associated with the elevation of geographic species distributions, our phylogenetic reconstruction indicates that the basal divergence is more related to the differentiation of corolla tube length and that the species geographic distribution is related to divergences within these main clades. The first main clade (clade I) consists of species that share an overall morphological pattern of a short tube, purple flowers, and most likely exclusive bee pollination syndromes (Fig. 1; Supplementary Fig. S2). In addition, these species are self-incompatible and have allopatric distributions (Stehmann et al., 2009; LorenzLemke et al., 2010). Clade I was subdivided into three groups described previously as the highland clade (Lorenz-Lemke et al., 2010) except for P. bajeensis, the Petunia integrifolia group (Longo et al., 2014), and one new group composed of P. inflata, P. interior, and P. guarapuavensis. The second main clade (clade II) comprises species with long corolla tube flowers but greater diversity in relation to corolla shape and color (Supplementary Fig. 3). The plants of this clade are self-compatible (except for some lineages of P. axillaris), and moths, birds and bees pollinate their flowers (Ando and Hashimoto, 1995; Ando et al., 2001; Stehmann et al., 2009; Venail et al., 2010; Klahre et al., 2011). Although belonging to the same species complex, P. axillaris subspecies do not constitute a clade. Interestingly, our findings suggest a strong relationship between P. axillaris ssp. subandina and P. occidentalis. The close relationship between P. axillaris ssp. axillaris and P. secreta might not be surprising considering the similarities in the floral morphology of these taxa. Additionally, previous genetic and morphological analyses have shown that P. axillaris ssp. subandina is clearly distinct from the other two, and despite many individuals of P. axillaris ssp. subandina overlapping with the P. axillaris ssp. axillaris geographic distribution, the ecologic niche separation is evident in these subspecies (Turchetto et al., 2014a,b). Despite being the only member of clade II with a short corolla tube, P. occidentalis has been often associated with groups of all long-tubed species (Ando et al., 2005; Chen et al., 2007; Kriedt et al., 2014). Our analyses suggest that P. occidentalis could have arisen after the colonization of sub-Andean slopes by the common ancestor to this species and P. axillaris ssp. subandina. Within subclade IA, we recovered most of the highland Petunia species. Interestingly, P. bajeensis (a typical species from lowlands, distributed in the middle of the Pampas) and P. altiplana (from Planalto) were recovered as closely related species. However, the branch supports within this subclade do not allow us to resolve the relationships between these two species or with the other spe-

409 410 411 412 413 414 415 416

420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472

7

cies in the highland group. The better support within this subclade is among P. reitzii, P. saxicola, and P. scheideana. The close relationship recovered between P. saxicola and P. reitzii has already been suggested in previous studies (Kulcheski et al., 2006; Chen et al., 2007; Lorenz-Lemke et al., 2010). These species are restricted to the higher area of the plateau in the Brazilian state of Santa Catarina (Stehmann et al., 2009). Within subclade IB, P. integrifolia and P. riograndensis as well as P. littoralis and P. integrifolia ssp. depauperata are very close taxa, confirming the findings of Longo et al. (2014). Subclade IC, defined by P. inflata, P. interior and P. guarapuavensis, suggests several interesting features in Petunia’s phylogenetic history. P. inflata and P. interior have been considered to be members of the P. integrifolia complex (Segatto et al., 2014b); however, in our analysis, they appear in a different fully supported subclade. These species occur in sympatry in open fields in southern Brazil and are differentiated only by the inflexed pedicel of P. inflata (Stehmann et al., 2009). Petunia inflata and P. interior are considered distinct taxonomic units (Ando et al., 2005; Chen et al., 2007). However, individuals of these species share a great number of polymorphisms. This could be consistent with recent hybridization events (Segatto et al., 2014b); however, interspecific hybrids have not been found. The genetic similarity among these species and other geographically distant Petunia species suggest ancestral polymorphism sharing. In addition, the position of P. guarapuavensis in this subclade (from highland open fields and adjacent regions in Brazil), outside of the main highland clade, suggests an independent colonization of highland grasslands by Petunia.

473

4.3. Biogeographic insights into Petunia origin and diversification

502

In this study, we inferred the ancestral geographical distributions for certain key and well-supported nodes in the obtained Petunia phylogeny. Although the analyses are limited by poor support for some of the divergent nodes, we can provide important biogeographic insights into the origin and basal diversification of the genus. Previous molecular (point) estimates suggested that the divergence processes in Petunia started between approximately 1.3 (Lorenz-Lemke et al., 2010) and 2.8 million years ago (Särkinen et al., 2013). In this way, we can infer that Quaternary climate dynamics have had an important influence on the ancestral distribution patterns. During this period, there were strong temperature decreases that characterize Pliocene-Quaternary transition climate conditions, processes that caused the proliferation of grasslands in the current geographical range of Petunia. This scenario allows us to assume that the current Pampas region and possibly neighboring regions to the north provided suitable environments for Petunia species in their early stages of diversification. For that period in the highlands of the Brazilian Plateau, there is evidence that cool and mesic climatic conditions were replaced with slightly cooler Pliocene conditions, with a tendency toward Pleistocene-like wet/dry climatic cycles (Safford, 1999). Paleo-palynological evidence supports the existence of extensive areas of Campos vegetation on the highlands through the Glacial, Early and Mid-Holocene times (Behling and Pillar, 2007). The implemented analyses suggest that Petunia diversification occurred first in lowland areas, followed by independent colonization processes to higher areas. A provable alternate hypothesis of a widely distributed antecessor that later became extinct in the highlands remains unevaluated because in S-DIVA, extinctions and dispersals ‘‘cost’’ more than vicariance. However, the BBM analyses, with the widely distributed hypothetical antecessor option enforced, support the lowland areas as the ancestral distribution for Petunia (Fig. S4).

503

Please cite this article in press as: Reck-Kortmann, M., et al. Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. (2014), http://dx.doi.org/10.1016/j.ympev.2014.08.022

474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501

504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536

YMPEV 5006

No. of Pages 10, Model 5G

6 September 2014 8

M. Reck-Kortmann et al. / Molecular Phylogenetics and Evolution xxx (2014) xxx–xxx

549

Phylogenetic reconstruction supports at least two independent processes of colonization of the highlands. Thus, possible upward and downward movements in the altitudinal gradient in the distribution of Petunia species facilitated by the Quaternary glacialinterglacial cycles (Behling, 2002; Ponce et al., 2011; OliveiraFilho et al., 2013) might explain these two colonization events and even the most geographically divergent colonization of the disjunct P. mantiqueirensis at the northeast limit of the genus. Within clade II, two taxa occur on sub-Andean slopes outside of the core distribution range of Petunia. Our analyses suggest a dispersal process from the Pampas to the eastern sub-Andean grasslands (Figs. 1 and S4), which appears to be a recent and unique process within Petunia.

550

4.4. Evolution of morphological characters

551

It is known that adaptation to different environmental conditions and pollinator-mediated selection can drive the diversification of a genus (Fregonezi et al., 2013); therefore, it is paramount to understand how these traits evolved. The ancestor of Petunia might have had a short corolla tube and a bee pollination floral syndrome. Short corolla tube and melittophilous pollination syndrome persist in most Petunia species, but with a long tube in clade II species (P. axillaris, P. exserta, and P. secreta) with the exception of the short tube in P. occidentalis. Our phylogenetic tree support two equally parsimoniously hypotheses for the evolution of corolla tube length in the latter clade, a reversal to the short tube in P. occidentalis or two independent gains of the long corolla tube. We cannot rule out any of these hypotheses at the moment, but note that ‘‘rapid’’ shifts in tube length, in the context of shifts in pollination biology as a whole, may not be as unlikely as previously thought (see below). It is not possible to define the common ancestor of pollination syndrome in clade II, as this clade has all three syndromes found in Petunia. Shifts in pollination syndromes have occurred frequently in the Solanaceae; for example, bird-type pollination syndromes have evolved at least ten times (Knapp, 2010). Pollination syndromes may differ in some or many traits, and the difference in each of these traits is likely to be caused by polymorphisms in multiple genes (Venail et al., 2010). However, previous studies in the genus Petunia suggested that linkage between traits can be broken in a few generations and that strong selection is required to maintain specific pollination syndromes (Venail et al., 2010). According to Hoballah et al. (2007), in Petunia, changes in a single gene cause a major shift in pollination biology and support the notion that the adaptation of a flowering plant to a new pollinator type may involve a limited number of genes of large effect. The findings with the AN2 gene (MYB-type-type transcription factor, which is a major determinant of flower color variation), indicated that hawkmoth pollination is a derivative of bee pollination due to the presence of mutated AN2 alleles in the P. axillaris complex, indicating that the common ancestor of P. integrifolia and P. axillaris had colorful flower and that the white P. axillaris flowers arose by subsequent loss of AN2 function (Quattrocchio et al., 1999). A study with P. exserta indicated that the divergence time between P. exserta and P. axillaris ssp. axillaris is shorter than among the subspecies of the P. axillaris complex (A.L.A. Segatto, unpublished data). Taking this into account together with our character reconstruction, we suggest that the ornithophily syndrome in P. exserta could be a derivate of the hawkmoth state. The transition from hawkmoth to hummingbird pollination has also been found in Brunfelsia, another genus of Solanaceae (Filipowicz and Renner, 2012). The character state reconstruction suggests that the melittophilous state of P. secreta is a kind of reversion to the ancestral char-

537 538 539 540 541 542 543 544 545 546 547 548

552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600

acter, while in P. occidentalis this scenario is ambiguous. This hypothesis is supported by the close relationship of these species with the P. axillaris subspecies found here. Although P. secreta and P. occidentalis presented bee-pollinate syndromes, these species showed a morphology that is somewhat different from the ancestral bee-pollinated floral morphology. P. secreta has a long corolla tube, and this morphology is shared only with P. exserta (hummingbirds pollinated) and P. axillaris (hawkmoths pollinated) (Stehmann et al., 2009). P. occidentalis presents a short corolla tube like other Petunia bee-pollinated species, though with smaller flowers. According to the model of pollination syndromes proposed by Dollo (1893), once lost, a complex trait cannot revert to exactly the same form as before the change. If the evolution of floral morphology underlying a bird-pollination syndrome involves changes in multiple pathways, one could expect that changing back to a bee-pollination syndrome might be difficult or, if it does occur, would result in morphology somewhat different compared with the corresponding ancestral morphology. Using cpDNA data in pollinator reconstruction for the legume Gastrolobium pyramidale, Toon et al. (2014) found a reversal from bird- to bee-pollination syndromes although it was not supported by morphological changes. Here, we have molecular and morphological evidence of reversion in Petunia. The process of speciation usually involves the establishment of multiple isolation barriers. In addition to biological barriers, spatial isolation is an important factor in speciation. Species pollinated by bees were distributed in all Petunia regions cited in our biogeographical reconstruction, whereas species with other pollination syndromes are restricted to the Pampas and sub-Andean regions. In the middle of the Pampas, in a region known as Serra do Sudeste, Brazil, the two sizes of corolla tube and all three pollinator syndromes occur in sympatry. One possible explanation for the high morphological diversity in this region could lie in the range of soil diversity within a small geographical area (Turchetto et al., 2014b) because the shape of the corolla in Petunia species is significantly associated not only with the growing temperature but also with soil type (Aoki and Hattori, 1991).

601

5. Conclusion

639

To date, this is the most extensive phylogenetic reconstruction in Petunia. Our study does not thoroughly resolve the terminal positions in the Petunia phylogeny; however, the multilocus approach was efficient at resolving the internal clades. The long corolla tube species (+ P. occidentalis) were always in the same group, and the species mostly formed subgroups according to the elevation of their geographic ranges. Our area and state ancestral reconstructions suggest that Petunia originated in the Pampas region and might have had a short corolla tube and a bee pollination floral syndrome. Our data support the hypothesis that the Pleistocene influenced the rapid divergence in Petunia. To resolve the terminal positions, future studies are needed, using the species delimitation approach with a greater number of individuals for each species.

640

Acknowledgments

654

We thank J.R. Stehmann for his help in taxonomic determination. We also thank two anonymous reviewers for suggestions and comments that improved this manuscript. This project was supported by the Conselho Nacional de Desenvolvimento Científico Q3 e Tecnológico (CNPq), the Coordenação de Aperfeiçoamento de Pes- Q4 soal de Nível Superior (CAPES), and the Programa de Pós-Graduação

655

Please cite this article in press as: Reck-Kortmann, M., et al. Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. (2014), http://dx.doi.org/10.1016/j.ympev.2014.08.022

602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638

641 642 643 644 645 646 647 648 649 650 651 652 653

656 657 658 659 660

YMPEV 5006

No. of Pages 10, Model 5G

6 September 2014 M. Reck-Kortmann et al. / Molecular Phylogenetics and Evolution xxx (2014) xxx–xxx

662

em Genética e Biologia Molecular da Universidade Federal do Rio Grande do Sul (PPGBM-UFRGS).

663

Appendix A. Supplementary material

664 666

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ympev.2014.08. 022.

667

References

668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736

Alarcón, M., Vargas, P., Sáez, L., Molero, J., Aldasoro, J.J., 2012. Genetic diversity of mountain plants: Two migration episodes of Mediterranean Erodium (Geraniaceae). Mol. Phylogenet. Evol. 63, 866–876. Ando, T., Hashimoto, G., 1995. Petunia guarapuavensis (Solanaceae): a new species from planalto of Parana and Santa Catarina, Brazil. Brittonia 47, 328–334. Ando, T., Kokubun, H., Watanabe, H., Tanaka, N., Yukawa, T., Hashimoto, G., Marchesi, E., Suaréz, E., Basualdo, I.L., 2005. Phylogenetic analysis of Petunia sensu Jussieu (Solanaceae) using chloroplast DNA RFLP. Ann. Bot. 96, 289–297. Ando, T., Nomura, M., Tsukahara, J., Watanabe, H., Kokubun, H., Tsukamoto, T., Hashimoto, G., Marchesi, E., Kitching, I.J., 2001. Reproductive isolation in a native population of Petunia sensu Jussieu (Solanaceae). Ann. Bot. 88, 403–413. Aoki, C., Hattori, K., 1991. Attempt to classify Petunia species on the basis of corolla shape. Jpn. J. Breed. 41, 433–442. Avise, J.C., Wollenberg, K., 1997. Phylogenetics and the origin of species. Proc. Natl. Acad. Sci. USA 94, 7748–7755. Behling, H., 2002. South and southeast Brazilian grasslands during late quaternary times: a synthesis. Palaeogeogr. Palaeoclimatol. Palaeoecol. 177, 19–27. Behling, H., Pillar, V.D.P., 2007. Late quaternary vegetation, biodiversity and fire dynamics on the southern Brazilian highland and their implication for conservation and management of modern Araucaria forest and grassland ecosystems. Philos. Trans. R. Soc. B Biol. Sci. 362, 243–251. Bickford, D., Lohman, D.J., Sodhi, N.S., Ng, P.K.L., Meier, R., Winker, K., Ingram, K.K., Das, I., 2006. Cryptic species as a window on diversity and conservation. Trends Ecol. Evol. 22, 148–155. Carstens, B.C., Knowles, L.L., 2007. Shifting distributions and speciation: species divergence during rapid climate change. Mol. Ecol. 16, 619–627. Chen, F.C., Li, W.H., 2001. Genomic divergences between humans and other hominoids and the effective population size of the common ancestor of humans and chimpanzees. Am. J. Hum. Genet. 68, 444–456. Chen, S., Matsubara, K., Omori, T., Kokubun, H., Kodama, H., Watanabe, H., Hashimoto, G., Marchesi, E., Bullrich, L., Ando, T., 2007. Phylogenetic analysis of the genus Petunia (Solanaceae) based on the sequence of the HF1 gene. J. Plant. Res. 120, 385–397. Cutter, A.D., 2013. Integrating phylogenetics, Phylogeography and population genetics through genomes and evolutionary theory. Mol. Phylogen. Evol. 69, 1172–1185. Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. JModelTest 2: more models, new heuristics and parallel computing. Nat. Methods 9, 772. Dasmahapatra, K.K., Elias, M., Hill, R.I., Hoffman, J.I., Mallet, J., 2010. Mitochondrial DNA barcoding detects some species that are real, and some that are not. Mol. Ecol. 10, 264–273. Degnan, J.H., Rosenberg, N.A., 2006. Discordance of species trees with their most likely gene trees. PLoS Genet. 2, e68. Dollo, L., 1893. Les lois de l ’ évolution. Bull. Bel. Ver. Geol. Paleontol. Hydrol. 7, 164– 166. Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 29, 1969–1973. Dunn, I.S., Blattner, F.R., 1987. Charons 36–40: multi-enzyme, high capacity, recombination deficient replacement vectors with polylinkers and polystuffers. Nucleic Acids Res. 15, 2677–2698. Edwards, S.V., 2009. Is a new and general theory of molecular systematics emerging? Evolution 63, 1–19. Filipowicz, N., Renner, S.S., 2012. Brunfelsia (Solanaceae): a genus evenly divided between South America and radiations on Cuba and other Antillean islands. Mol. Phylog. Evol. 64, 1–11. Fregonezi, J.N., Freitas, L.B., Bonatto, S.L., Semir, J., Stehmann, J.R., 2012. Infrageneric classification of Calibrachoa (Solanaceae) based on morphological and molecular evidence. Taxon 61, 120–130. Fregonezi, J.N., Turchetto, C., Bonatto, S.L., Freitas, L.B., 2013. Biogeographical history and diversification of Petunia and Calibrachoa (Solanaceae) in the Neotropical Pampas grassland. Bot. J. Linn. Soc. 171, 140–153. Funk, D.J., Omland, K.E., 2003. Species-level paraphyly and polyphyly: frequency, causes, and consequences, with insights from animal mitochondrial DNA. Annu. Rev. Ecol. Syst. 34, 397–423. Gadagkar, S.R., Rosenberg, M.S., Kumar, S., 2005. Inferring species phylogenies from multiple genes: concatenated sequence tree versus consensus gene tree. J. Exp. Zool. 304B, 64–74. Galetto, L., Bernardello, L., 1993. Nectar secretion pattern and removal effects in three species of Solanaceae. Can. J. Bot. 71, 1394–1398.

661

665

9

Gascuel, O., 1997. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Mol. Biol. Evol. 14, 685–695. Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321. Heled, J., Drummond, A.J., 2010. Bayesian inference of species trees from multilocus data. Mol. Biol. Evol. 27, 570–580. Hey, J., 2010. The divergence of Chimpanzee species and subspecies as revealed in multipopulation isolation-with migration analyses. Mol. Biol. Evol. 27, 921– 933. Hey, J., Nielsen, R., 2007. Integration within the Felsenstein equation for improved Markov chain Monte Carlo methods in population genetics. Proc. Natl. Acad. Sci. USA 104, 2785–2790. Hilton, H., Hey, J., 1997. A multilocus view of speciation in the Drosophila virilis species group reveals complex histories and taxonomic conflicts. Genet. Res. 70, 185–194. Hoballah, M.E., Gübitz, T., Stuurman, J., Broger, L., Barone, M., Mandel, T., Dell’Olivo, A., Arnold, M., Kuhlemeier, C., 2007. Single gene-mediated shift in pollinator attraction in Petunia. Plant Cell 19, 779–790. Hou, Z., Sket, B., Fišer, C., Li, S., 2011. Eocene habitat shift from saline to freshwater promoted Tethyan amphipod diversification. Proc. Natl. Acad. Sci. 108, 14533– 14538. Hughes, C., Eastwood, R., 2006. Island radiation on a continental scale: exceptional rates of plant diversification after uplift of the Andes. Proc. Natl. Acad. Sci. USA 103, 10334–10339. Klahre, U., Gurba, A., Hermann, K., Saxenhofer, M., Bossolini, E., Guerin, P.M., Kuhlemeier, C., 2011. Pollinator choice in Petunia depends on two major genetic loci for floral scent production. Curr. Biol. 21, 730–739. Knapp, S., 2010. On ‘various contrivances’: pollination, phylogeny and flower form in the Solanaceae. Philos. Trans. R. Soc. B 365, 449–460. Knowles, L.L., Carstens, B.C., 2007. Delimiting species without monophyletic gene trees. Syst. Biol. 56, 887–895. Kokubun, H., Ando, T., Kohyama, S., Watanabe, H., Tsukamoto, T., Marchesi, E., 1997. Distribution of intermediate forms of Petunia axillaris subsp. axillaris and subsp. parodii (Solanaceae) in Uruguay revealed by discriminate analysis. Acta Phytotax. Geobot. 48, 173–185. Kriedt, R.A., Cruz, G.M.Q., Bonatto, S.L., Freitas, L.B., 2014. Novel transposable elements in Solanaceae: evolutionary relationships among Tnt1-related sequences in wild Petunia species. Plant Mol. Biol. Rep. 32, 142–152. Kulcheski, F.R., Muschner, V.C., Lorenz-Lemke, A.P., Stehmann, J.R., Bonatto, S.L., Salzano, F.M., Freitas, L.B., 2006. Molecular phylogenetic analysis of Petunia Juss. (Solanaceae). Genetica 126, 3–14. Liu, L.L., Yu, L., Kubatko, L., Pearl, D.K., Edwards, S.V., 2009. Coalescent methods for estimating phylogenetic trees. Mol. Phylogenet. Evol. 53, 320–328. Longo, D., Lorenz-Lemke, A.P., Mäder, G., Bonatto, S.L., Freitas, L.B., 2014. Phylogeography of the Petunia integrifolia complex in southern Brazil. Bot. J. Linn. Soc. 174, 199–213. López-Fernández, H., Winemiller, K.O., Honeycutt, R.L., 2010. Multilocus phylogeny and rapid radiations in Neotropical cichlid fishes (Perciformes: Cichlidae: Cichlinae). Mol. Phylogenet. Evol. 55, 1070–1086. Lorenz-Lemke, A.P., Mäder, G., Muschner, V.C., Stehmann, J.R., Bonatto, S.L., Salzano, F.M., Freitas, L.B., 2006. Diversity and natural hybridization in a highly endemic species of Petunia (Solanaceae): a molecular and ecological analysis. Mol. Ecol. 15, 4487–4497. Lorenz-Lemke, A.P., Togni, P.D., Mäder, G., Kriedt, R.A., Stehmann, J.R., Salzano, F.M., Bonatto, S.L., Freitas, L.B., 2010. Diversification of plant species in a subtropical region of eastern South American highlands: a phylogeographic perspective on native Petunia (Solanaceae). Mol. Ecol. 19, 5240–5251. Maddison, W.P., 1997. Gene trees in species trees. Syst. Biol. 46, 523–536. Maddison, W.P., Maddison, D.R., 2010. Mesquite: A Modular System for Evolutionary Analysis Version 2.73. . Mäder, G., Zamberlan, P.M., Fagundes, N.J., Magnus, T., Salzano, F.M., Bonatto, S.L., Freitas, L.B., 2010. The use and limits of ITS data in the analysis of intraspecific variation in Passiflora L. (Passifloraceae). Genet. Mol. Biol. 33, 99–108. Moritz, C.M., 1994. Defining ‘‘evolutionarily significant units’’ for conservation. Trends Ecol. Evol. 9, 373–375. Nielsen, R., Wakeley, J., 2001. Distinguishing migration from isolation: a Markov chain Monte Carlo approach. Genetics 158, 885–896. Oliveira-Filho, A.T., Budke, J.C., Jarenkow, J.A., Eisenlohr, P.V., Neves, D.R.M., 2013. Delving into the variations in tree species composition and richness across South American subtropical and Pampean forests. J. Plant Ecol.. http:// dx.doi.org/10.1093/jpe/rtt058. Ponce, J.F., Rabassa, J., Coronato, A., Borromei, A.M., 2011. Paleogeographical evolution of the Atlantic coast of Pampa and Patagonia from the last glacial maximum to the Middle Holocene. Biol. J. Linn. Soc. 103, 363–379. Quattrocchio, F., Wing, J., van der Woude, K., Souer, E., de Vetten, N., Mol, J., Koes, R., 1999. Molecular analysis of the anthocyanin2 gene of Petunia and its role in the evolution of flower color. Plant Cell 11, 1433–1444. Rambaut, A., 2008. FigTree v1.4: Tree Figure Drawing Tool. . Rambaut, A., Suchard, M.A., Xie, D., Drummond, A.J., 2013. Tracer v1.5 . Rannala, B., Yang, Z.H., 1996. Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference. J. Mol. Evol. 43, 304–311.

Please cite this article in press as: Reck-Kortmann, M., et al. Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. (2014), http://dx.doi.org/10.1016/j.ympev.2014.08.022

737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820

YMPEV 5006

No. of Pages 10, Model 5G

6 September 2014 10 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856

M. Reck-Kortmann et al. / Molecular Phylogenetics and Evolution xxx (2014) xxx–xxx

Richardson, J.E., Pennington, R.T., Pennington, T.D., Hollingsworth, P.M., 2001. Rapid diversification of a species-rich genus of Neotropical rain forest trees. Science 293, 2242–2245. Robertson, K., Goldberg, E.E., Igic´, B., 2011. Comparative evidence for the correlated evolution of polyploidy and self-compatibility in Solanaceae. Evolution 65, 139– 155. Rokas, A., Carroll, S.B., 2005. More genes or more taxa? The relative contribution of gene number and taxon number to phylogenetic accuracy. Mol. Biol. Evol. 22, 1337–1344. Rokas, A., Williams, B.L., King, N., Carroll, S.B., 2003. Genome-scale approaches to resolving incongruence in molecular phylogenies. Nature 425, 798–804. Rowe, K.C., Aplin, K.P., Baverstock, P.R., Moritz, C., 2011. Recent and rapid speciation with limited morphological disparity in the genus Rattus. Syst. Biol. 60, 188– 203. Roy, A., Frascaria, N., MacKay, J., Bousquet, J., 1992. Segregating random amplified polymorphic DNAs (RAPDs) in Betula alleghaniensis. Theor. Appl. Genet. 85, 173– 180. Särkinen, T., Bohs, L., Olmstead, R.G., Knapp, S., 2013. A phylogenetic framework for evolutionary study of the nightshades (Solanaceae): a dated 1000-tip tree. BMC Evol. Biol. 13, 214. Safford, H.D., 1999. Brazilian Páramos I. An introduction to the physical environment and vegetation of the campos de altitude. J. Biogeogr. 26, 693–712. Segatto, A.L.A., Cazé, A.L.R., Turchetto, C., Klahre, U., Kuhlemeier, C., Bonatto, S.L., Freitas, L.B., 2014a. Nuclear and plastid markers reveal the persistence of genetic identity: a new perspective on the evolutionary history of Petunia exserta. Mol. Phylogenet. Evol. 70, 504–512. Segatto, A.L.A., Ramos-Fregonezi, A.M.C., Bonatto, S.L., Freitas, L.B., 2014b. Molecular insights into the purple-flowered ancestor of garden petunias. Am. J. Bot. 10, 119–127. Simmons, M.P., Ochoterena, H., 2000. Gaps as characters in sequence-based phylogenetic analyses. Syst. Biol. 49, 369–381. Sink, K.C., 1975. Inheritance of three genes for morphological characters in Petunia hybrida in crosses with four Petunia species. Can. J. Genet. Cytol. 17, 67–74. Smith, S.A., Beaulieu, J.M., Donoghue, M.J., 2009. Mega-phylogeny approach for comparative biology: an alternative to supertree and supermatrix approaches. BMC Evol. Biol. 9, 37–49.

Stehmann, J.R., 1987. Petunia exserta (Solanaceae): Uma nova espécie do Rio Grande do Sul, Brasil. Napaea 2, 19–21. Stehmann, J.R., Lorenz-Lemke, A.P., Freitas, L.B., Semir, J., 2009. The genus Petunia. In: Gerats, T., Strommer, J. (Eds.), Petunia Evolutionary, Developmental and Physiological Genetics. Springer, New York, pp. 1–28. Stehmann, J.R., Semir, J., 2005. New species of Calibrachoa and Petunia (Solanaceae) from subtropical South America. In: Keating, R.C., Hollowell, V.C., Croat, T.B. (Eds.), Festschrift for William G. Darcy: The Legacy of a Taxonomist. Missouri Bot. Garden Press, Missouri, pp. 341–348. Stout, A.B., 1952. Reproduction on Petunia. Mem. Torrey. Bot. Club. 20, 1–202. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Thiers, B., 2010. Index Herbariorum: A Global Directory of Public Herbaria and Associated Staff. New York Botanical Garden’s Virtual Herbarium. . Toon, A., Cook, L.G., Crisp, M.D., 2014. Evolutionary consequences of shifts to birdpollination in the Australian pea-flowered legumes (Mirbelieae and Bossiaeeae). BMC Evol. Biol. 14, 43. Turchetto, C., Fagundes, N.J.R., Segatto, A.L.A., Kuhlemeier, C., Solís-Neffa, V.G., Speranza, P.R., Bonatto, S.L., Freitas, L.B., 2014a. Diversification in the South American Pampas: the genetic and morphological variation of the widespread Petunia axillaris complex (Solanaceae). Mol. Ecol. 23, 374–389. Turchetto, C., Segatto, A.L.A., Telles, M.P.C., Diniz-Filho, J.A.F., Freitas, L.B., 2014b. Infraspecific classification reflects genetic differentiation in the widespread Petunia axillaris complex: A comparison among morphological, ecological, and genetic patterns of geographic variation. Perspect. Plant. Ecol. Evol. Syst. 16, 75– 82. Venail, J., Dell’Olivo, A., Kuhlemeier, C., 2010. Speciation genes in the genus Petunia. Philos. Trans. R. Soc. B 365, 461–468. Yu, Y., Harris, A.J., He, X., 2010. S-DIVA (Statistical Dispersal-Vicariance Analysis): a tool for inferring biogeographic histories. Mol. Phylogenet. Evol. 56, 848–850. Yu, Y., Harris, A.J., He, X., 2013. RASP (Reconstruct Ancestral State in Phylogenies). . Zhang, X., Takahashi, H., Nakamura, I., Mii, M., 2008. Molecular discrimination among taxa of Petunia axillaris complex and P. integrifolia complex based on PolA1 sequence analysis. Breed. Sci. 58, 71–75.

857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893

Please cite this article in press as: Reck-Kortmann, M., et al. Multilocus phylogeny reconstruction: New insights into the evolutionary history of the genus Petunia. Mol. Phylogenet. Evol. (2014), http://dx.doi.org/10.1016/j.ympev.2014.08.022