CBI 7138

No. of Pages 9, Model 5G

29 September 2014 Chemico-Biological Interactions xxx (2014) xxx–xxx 1

Contents lists available at ScienceDirect

Chemico-Biological Interactions journal homepage: www.elsevier.com/locate/chembioint 6 7

Chelidonine, a natural benzophenathridine alkaloid, suppresses breast cancer cells by hTERT down regulation, senescence acceleration and induction of apoptosis and autophagy

3 4 5 8 9 10 11 1 2 3 6 14 15 16 17 18 19 20 21 22 23 24 25

Q1

Sakineh Kazemi Noureini ⇑, Hosein Esmaili Dept. Biology, Faculty of Basic Sciences, Hakim Sabzevari University, P.O. Box: 397, Sabzevar, Iran

a r t i c l e

i n f o

Article history: Received 28 April 2014 Received in revised form 9 September 2014 Accepted 12 September 2014 Available online xxxx Keywords: Chelidonine Apoptosis Autophagy Senescence Telomerase

a b s t r a c t In a preliminary study screening anti-proliferative natural alkaloids, a very potent benzophenanthridine, chelidonine showed strong cytotoxicity in cancer cells. While several modes of death have been identified, most of anti-cancer attempts have focused on stimulation of cells to undergo apoptosis. Chelidonine seems to trigger multiple mechanisms in MCF-7 breast cancer cells. It induces both apoptosis and autophagy modes of cell death in a dose dependent manner. Alteration of expression levels of bax/ bcl2, and dapk1a by increasing concentration of chelidonine approves switching the death mode from apoptosis induced by very low to autophagy by high concentrations of this compound. On the other hand, submicromolar concentrations of chelidonine strongly suppressed telomerase at both enzyme activity and hTERT transcriptional level. Long exposure of the cells to 50 nanomolar concentration of chelidonine considerably accelerated senescence. Altogether, chelidonine may provide a promising chemistry from nature to treat cancer. Ó 2014 Published by Elsevier Ireland Ltd.

27 28 29 30 31 32 33 34 35 36 37 38 39 40

42 41

1. Introduction

43

Chelidonium majus L., belonging to Papaveraceae family is one of the most important medicinal plants with known anticancer properties. Soon after 1896 when Botkin reported two cases of carcinoma, which responded to treatment with C. majus extracts, clinical uses of its derivatives started by treatment of several malignancies including gastric and breast cancer [1,2]. This plant contains several chemically and pharmacologically interesting alkaloids, that the most biologically active components are essentially isoquinolines [3]. Among them benzophenanthridines have been shown to block proliferation in several transformed and malignant cell types with different cytotoxic mechanisms [4–7], also in malignant melanoma cell regardless of their p53 status [8]. A number of these interesting compounds have shown a various strength of apoptogenic without DNA damage such as

44 45 46 47 48 49 50 51 52 53 54 55 56

chelidonine [9], while some other including sanguinarine and chelerythrine stimulate a dose dependent DNA damage and cytotoxicity [10]. Chelidonine has no significant cytotoxicity or DNA damage in both normal mouse primary spleen cells types and mouse lymphocytic leukemic cells, L1210 cells, but completely arrested growth of the latter [11]. The plant has shown selectively growth inhibition in cancer cells while no significant toxicity in normal cells even at about 50–100 fold concentrations [12]. There are also reports on its synthetic derivative, Ukrain, showing radioprotective effects on normal but not cancer cells [13]. In spite of very similar structures, in cell culture models certain metabolites of this plant showed much stronger effects than other, and cellular and molecular mechanism(s) of each compound remained to elucidate. This study has focused on antiproliferative mechanisms of chelidonine, the major benzophenanthridine alkaloid of C. majus in cell culture model.

⇑ Corresponding author. Tel.: +98 571 400 3012; fax: +98 571 400 3365. E-mail address: [email protected] (S.K. Noureini). http://dx.doi.org/10.1016/j.cbi.2014.09.013 0009-2797/Ó 2014 Published by Elsevier Ireland Ltd.

Please cite this article in press as: S.K. Noureini, H. Esmaili, Chelidonine, a natural benzophenathridine alkaloid, suppresses breast cancer cells by hTERT down regulation, senescence acceleration and induction of apoptosis and autophagy, Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/ j.cbi.2014.09.013

57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72

CBI 7138

No. of Pages 9, Model 5G

29 September 2014 2 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103

S.K. Noureini, H. Esmaili / Chemico-Biological Interactions xxx (2014) xxx–xxx

The uncontrolled growth of most of cancer cells is mainly because of the activity and expression of telomerase, the basically reverse transcriptase key enzyme in cell immortality, which compensates telomere attrition of an average of 100 ± 50 base-pairs that occurs in proliferating normal cells [14] as a result of end replication problem. This enzyme is diminished and hardly detectable in many adult somatic cells. However it is drastically over expressed in 85–90% of different kind of human cancer cells by up to a hundred-fold over the normal counterpart cells [15], and therefore confers a strong selective advantage for continued growth of malignant cells, in spite of their extremely short telomere length [16,17]. Telomerase inhibition induces proliferative senescence, apoptosis and genomic instability [18]. This ribonucleoprotein has shown very complicated levels of gene/protein regulation [19], so various strategies can be employed to repress it at least as a part of anti-cancer therapeutic strategies [20–22]. This compound has shown interesting beneficial effects in anticancer drug design. However, some investigators have focused on reducing its side effects and enhancing effectiveness and bioavailability through nano-particles. In a recent report Paul et al. have introduced chelidonine-loaded PLGA nanoparticles that showed a reasonable bioavailability in mice model while cytotoxicity is comparable with free chelidonine in hepatocarcinoma HepG2 cells [23]. Our previous screening study has introduced chelidonine to suppress telomerase strongly in hepatocarcinoma cell line, HepG-2 [7]. Here we show an almost complete suppression of telomerase in MCF-7 that occurs even at very low concentrations of chelidonine. Moreover, it induced multiple modes of death; senescence, apoptosis and autophagy. This may infer a global alteration in cell control by chelidonine that make it more attractive to elucidate detailed mechanisms of action, which needs more attention.

104

2. Material and methods

105

2.1. Cytotoxicity

106

Human breast adenocarcinoma cell line MCF7 (ACC115 from DSMZ) were maintained in 75 cm2 culture flasks in DMEM, supplemented with 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin, and 100 lg/ml streptomycin (all the materials from PAA, Austria). Cells were grown in 5% CO2 and 95% air atmosphere at 37 °C. Media were changed every other day, and the cells were subcultured every 5 days using trypsin-EDTA. Cell viability was evaluated routinely by trypan blue exclusion method using hemocytometer. To estimate the cytotoxicity of chelidonine, MTT test was assessed [24]. Briefly exponentially growing cells were seeded in 96 well plates 10,000 cell per well and after 24 h incubated in medium containing various concentrations of chelidonine freshly prepared from a stock solution (50 mM in absolute ethanol), while the final concentration of ethanol was always less than 0.01%. After 48 h incubation MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma-Aldrich) was added to final concentration of 0.5 mg/ml to each well. Four hours further incubation was done for MTT reduction to formazan purple product through mitochondrial dehydrogenases of viable cells and after dissolving it in dimethylsulfoxide including 10% SDS and 1% acetic acid, the absorbance was measured at 570 nm using a plate reader (BioTek, USA). The tests were repeated four times each in triplicate and the 50% lethal dosage, LD50, values were calculated from dose– response curves using Gen5 version1.06 software. To study telomerase activity and gene expression levels in chelidonine treated cells, subconfluent cultures were treated at three different concentrations; a relatively low concentration correlated with low cytotoxicity of chelidonine in MTT test, a second

107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134

concentration was equal to IC50 to have the maximum possible treatment and still producing enough cells for analysis, and a third concentration represented around the midpoint of the cytotoxicity curve. Treatment duration time was set to 48 h to have adequate time for cycling cells, because telomerase is a very rare protein in cells and is active only in a short period during S phase.

135

2.2. Telomerase activity

141

Subconfluent MCF-7 cells were seeded in 6 well plates and after 48 h incubation with various concentrations of chelidonine, washed with PBS. Cells were lysed in a buffer containing 10 mM Tris–HCl pH = 7.5, 1 mM MgCl2, 1 mM EGTA, 0.1 mM Phenylmethylsulfonylfluoride (PMSF), 5 mM beta-mercaptoethanol, 0.5% CHAPS and 10% glycerol according to Kim et al. [25], and after 30 min incubation on ice the lysates were centrifuged at 16,000g at 4 °C for 30 min. The supernatants were collected and stored at 80 °C until use. Protein concentration of supernatant was measured based on Bradford method [26] using plate reader (BioTek, USA) and analyzed with Gene5 software version1.06. For each of control and/or treated cells 0.5 lg of extracted total protein was used for quantitative TRAP assay based on a real-time SYBR-Green method [27] with small modifications [28]. The reaction mixtures including 1X SYBR Green master mix (GenetBio, South Korea), 0.5 lg protein of cell extract, 10 pmol TS (50 -AATCCGTCGAGCAGATT-30 ) and 5 pmol ACX (50 -GC GCGGCTTACCCTTACCCTTACCCTAACC-30 ) primers were incubated 30 min at 25 °C to allow the telomerase in the protein extracts to elongate the TS primer by adding TTAGGG repeat sequences. Then the amplification of telomerase products was started at 94 °C for 10 min to activate the hot-start taq polymerase and the 40 cycles of 30 s at 94 °C, 30 s at 50 °C and 45 s at 72 °C with signal acquisition on a real-time thermal cycler Rotor Gene 3000 (QIAGEN). The threshold cycle values (Ct) were determined by using Rotor Gene 6.01 software, from amplification plots and compared with the standard curve generated from serially diluted cell lysate of untreated MCF-7 control. A negative control was included in each assay, which was a reaction mixture minus cell extract or a heat/ RNase-treated sample containing the same amount of extract of untreated cells. In each run of the experiments products of samples were compared with the standard curve made from the serially dilutions of extracts of untreated cells.

142

2.3. RNA isolation, reverse transcription and real-time PCR

175

MCF-7 cells were harvested after 48 h treatment with various concentrations of chelidonine and total RNA was isolated using RNX-Plus (SinaClon; Iran) according to the manufacturer’s instruction and stored at -80 °C. The extracted RNA samples were checked for purity and quality by gel electrophoresis, and the concentrations were measured using Nanodrop 1000. First strand cDNA synthesis was performed according to the protocol suggested for the Reverse Transcription System (AccuPower RT PreMix, Bioneer) using oligo(dT)16 primers (Bioneer, South Korea). Quantification of mRNA levels of the genes was achieved by quantitative real-time RT-PCR using b2-microglobulin as housekeeping gene. PCR amplification was carried out in 10 ll reaction volume containing 1 ll of cDNA, 1x Rotor Gene SYBR Green I Master Mix (QIAGEN; Germany), 0.5 lM of each primer set: hTERT and b2 mg as described earlier [28], bcl2, bax and dapk1a as listed in Table 1, using a calibrator and standard curves for each gene.

176

2.4. Thermal FRET analysis

192

The probable interaction of chelidonine with telomerase substrate and interfering with the enzyme activity was estimated

193

Please cite this article in press as: S.K. Noureini, H. Esmaili, Chelidonine, a natural benzophenathridine alkaloid, suppresses breast cancer cells by hTERT down regulation, senescence acceleration and induction of apoptosis and autophagy, Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/ j.cbi.2014.09.013

136 137 138 139 140

143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174

177 178 179 180 181 182 183 184 185 186 187 188 189 190 191

194

CBI 7138

No. of Pages 9, Model 5G

29 September 2014 S.K. Noureini, H. Esmaili / Chemico-Biological Interactions xxx (2014) xxx–xxx Table 1 Primer sequences used in real-time PCR.

3.2. Chelidonine induces apoptosis and autophagy dose dependently

246

dapk1a

Forward: 50 CAGTGTTGTTGCTCTAGGAAG 30 Reverse: 50 GGGACTGCCACAAATGATGAG 30

Apoptotic death in MCF-7 cells was stimulated by very low concentration (0.5 lM) much stronger than high concentrations (2.5 and 5 lM). DNA fragmentation in MCF-7 cells induced by chelidonine after 48 h treatment was clearly visible in agarose gel as presented in Fig. 1C. On the other hand, morphological investigation showed that apoptosis stimulated by low concentrations of chelidonine was much stronger than autophagy (Fig. 2B), a different mode of cell death in which a blister appears in cell membrane (black arrows). However, by increasing chelidonine concentration the main mode of cell death is autophagy as seen in Fig. 2C. Quantitative analysis of bax/bcl2 mRNA levels in MCF-7 cells treated with chelidonine showed a considerable increase at very low concentrations; while it diminishes to equal amount and even lower than untreated cells at high concentrations (Fig. 3A). This dose-dependent difference in the strength of chelidonine effects in stimulation of apoptosis cell death is compatible with the results that seen in DNA fragmentation by gel electrophoresis. Both methods show strong apoptogenic effect of chelidonine in MCF-7 cells in lower concentrations than higher. A quite clear feature of autophagy in MCF-7 treated by high concentrations of chelidonine was seen in morphological investigations, while apoptotic cells were still frequent. Fig. 2C shows more frequent autophagy than apoptosis after 48 h treatment of the cells with 5 lM chelidonine. It seems that the mode of cell death under treatment with chelidonine, which is generally through apoptosis at low concentrations, shifts towards autophagy at high concentrations. A special protein kinase, death-associated protein kinase 1a (dapk1a), is believed to be involved and play critical role in autophagy [32]. We evaluated its expression level by quantitative realtime PCR in cells treated by various concentrations of chelidonine. In our experiment condition mRNA level of dapk1a is dosedependently elevated by chelidonine to several fold in comparison with untreated control cells (Fig. 3B). DAPk, a Ca2+/calmodulinregulated Ser/Thr kinase, is one of the most outstanding among the commonly shared genes between apoptosis and autophagy, which associates with the cytoskeleton. That is a tumor suppressor, which is involved in an early p53- dependent transformation checkpoint and an inhibitor of metastasis [32]. DAPk phosphorylates Beclin 1 at T119 within Beclin 1’s BH3 domain, thereby prevents its binding to Bcl-XL, by which it may induce autophagy [33]. On the other hand, DAPk up-regulates p53 through a mechanism that requires p19ARF. As p53 activates either apoptosis or autophagy, DAPk potentially links both these death pathways [34]. On the other hand pro-survival signaling that counter apoptosis is also inhibited by this kinase [35]. Altogether, expression of dapk1a in our experiments was strongly induced up to 32 times by high concentrations of chelidonine, and therefore strongly stimulates autophagy.

247

3.3. Chelidonine induces cell senescence at very low concentrations

296

Another mode of cell death especially detectable in long exposure of MCF-7 cells to very low concentrations of chelidonine was senescence. In treated cells with 0.05 lM chelidonine 48 h per passage over a period of 33 days, the number of senescent cells darkly stained by beta-galactosidase method counted in five random fields under the microscope (Fig. 2D) was increased to about 27% in comparison with 2.5% in un-treated control cells. In parallel, the doubling time lengthened to 62.6 ± 2.8 h in treated cells, in

297

215

219

The MCF-7 cells were treated 48 h with chelidonine at the specified concentrations. Cellular DNA was isolated and subjected to agarose gel electrophoresis followed by visualization of bands using ethidium bromide [30]. The data shown here is from a representative experiment repeated three times with almost similar results.

220

2.6. Morphological studies

221

234

For b-galactosidase assay demonstrating senescence, cells after washing with PBS were fixed for 3–5 min at room temperature in 2% formaldehyde/0.2% glutaraldehyde, followed by washing and adding fresh senescence-associated b-gal (SA-b-gal) stain solution as described by Djmiri et al. [31]. Then samples were incubated 4 h at 37 °C and no CO2 to develop the dark blue pigment. For long-term growth, MCF-7 cells were seeded into 25 cm2 tissue culture flasks in two sets; control and treated, for 4–5 d until 70–80% confluence before detaching, trypan-blue method counting and re-plating 0.3  106 cells into new culture flasks up to 33 days. In each passage, the chelidonine-treated set was treated 48 h at the desired concentration and afterward cells were fed with fresh normal medium. All the treatments were done in duplicate, the mean values were presented in the growth, and doubling curves.

235

2.7. Statistical analysis

236 238

Statistical analysis was performed by using standard student (t) test and a p < 0.05 was considered as the cut off for significant difference.

239

3. Results

240

3.1. Chelidonine has a strong cytotoxicity in MCF-7 cells

241

MTT test estimates 8 lM as LD50 value of chelidonine in MCF7 cells. The cytotoxic effects of chelidonine is quite strong so that cell

199 200 201 202 203 204 205 206 207 208 209 210 211 212

216 217 218

222 223 224 225 226 227 228 229 230 231 232 233

237

242

245

Forward: 50 TGCTTCAGGGTTTCATCCAG 30 Reverse: 50 GGCGGCAATCATCCTCTG 30

2.5. DNA ladder formation

198

244

bax

214

197

243

Forward: 50 ATGTGTGTGGAGAGCGTCAA 30 Reverse: 50 CAGTTCCACAAAGGCATCCCAG 30

213

196

death provokes sharply by increasing concentration up to 1.5 lM, while it reaches to an almost more gradually rate at about 25 lM concentration and higher (Fig. 1A).

Bcl2

using a simple thermal melting experiment based on Guedin et al. [29] with small modifications. Based on the method we may demonstrate the structural stabilization effect of chelidonine on a double-labeled fluorescence synthetic oligonucleotide of human telomere sequence rich in guanine, F21T (FAM 30 -GGG (TTAGGG)3-50 TAMRA), which inherently folds to an intramolecular quadruplex structure. Briefly, F21T at final concentration of 0.25 lM was heated at 95 °C for 10 min, quickly chilled on ice, and incubated at 37 °C for 2 h in presence of sodium cacodylate (10 mM), LiCl (90 mM) and KCl (10 mM), and various concentration of chelidonine 0, 0.25, 1.25, 2.5 and 12.5 lM. Then fluorescence intensity of the oligonucleotide was measured while heating gradually (1 °C/min) using Rotor-Gene 3000 real-time thermal cycler (QIAGEN); an increase in melting temperature (Tm) indicates preferential ligand binding to the folded rather than the unfolded form. Differential fluorescence intensity over temperature was calculated as melting temperature (Tm) using the RotorGene software version 1.06. The melting temperature of each sample was compared to those devoiding chelidonine.

195

3

Please cite this article in press as: S.K. Noureini, H. Esmaili, Chelidonine, a natural benzophenathridine alkaloid, suppresses breast cancer cells by hTERT down regulation, senescence acceleration and induction of apoptosis and autophagy, Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/ j.cbi.2014.09.013

248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295

298 299 300 301 302 303 304

CBI 7138

No. of Pages 9, Model 5G

29 September 2014 4

S.K. Noureini, H. Esmaili / Chemico-Biological Interactions xxx (2014) xxx–xxx

A

100 90 80 70

% Viable cells

60 50 40 30 20 10 0

0 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 μM Chelidonine

B

100 90 80

% viable cells

70 60 50 40 30 20 10 0 0

100

200

300

400

500

600

700

800

900

1000

Berberine concentration (µM)

C

Fig. 1. (A) Cell viability after 48 h treatment of MCF7 cells with different concentrations of chelidonine as estimated by MTT. Mean values ± standard error of means are shown. (B) Gel electrophoresis results presenting apoptotic DNA fragmentation in MCF-7 cells induced by 0.5, 2.5 and 5 lM chelidonine from left to right respectively. Crtl 1 and Crtl 2 represent the untreated controls that yielded in different amount of DNA.

305 306 307

comparison with 42.43 ± 0.5 h in un-treated controls. This concentration of chelidonine was chosen as no sign of increase in cell death and apoptosis was detectable by trypan blue exclusion

method and morphologically inspection of the cells. Fig. 3C and D represent the population size and number of doublings respectively from the experiments that repeated two times.

Please cite this article in press as: S.K. Noureini, H. Esmaili, Chelidonine, a natural benzophenathridine alkaloid, suppresses breast cancer cells by hTERT down regulation, senescence acceleration and induction of apoptosis and autophagy, Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/ j.cbi.2014.09.013

308 309 310

CBI 7138

No. of Pages 9, Model 5G

29 September 2014 S.K. Noureini, H. Esmaili / Chemico-Biological Interactions xxx (2014) xxx–xxx

A

B

C

D

5

Fig. 2. Morphology of untreated MCF-7 cells (A) as viewed using inverted phase contrast microscope (magnification, 200). MCF-7 cells after 48 h treatment with 0.5 (B) and 5 (C) lM chelidonine towards apoptosis and autophagy respectively (magnification in both, 400). Black arrows point the autophagic cells. Senescence induced after longterm treatment with 0.05 lM chelidonine that was evaluated by b-galactosidase staining method (D), the positive dark-blue stained cells (magnification, 100). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340

3.4. Chelidonine suppresses telomerase through hTERT down regulation Quantitative real-time telomere repeat amplification protocol (qTRAP) measurements showed strong decrease in telomerase activity to around 50% of untreated MCF7 control cells after 48 h treatment with about 1 lM chelidonine. Furthermore, the telomerase activity depletion was in a dose-dependent manner with a sharp depletion in very low concentrations, while it is almost completely inhibited at 8 lM (Fig. 4D). The quantitative real-time RT-PCR technique estimates a strong decrease in mRNA copy numbers of hTERT in MCF7 cells treated with 8 lM chelidonine to 3.5% of un-treated controls after 48 h (Fig. 4). Similar to the decline pattern of telomerase activity, hTERT mRNA level reduces steeply to 60% and to lower than 40% expression level of un-treated cells after 48 h treatment of the cells with 0.1 lM and 1 lM chelidonine, respectively (Fig. 4D). Altogether, telomerase inhibition by chelidonine showed the same profile at both enzyme activity and gene expression level. Berberine also caused a dose dependent telomerase inhibition in both activity and mRNA levels in MCF-7, however mRNA level decreased much stronger than the enzyme activity. Telomerase inhibition to 50% of un-treated cells in MCF-7 by berberine Q2 occurred at 27 lM after 48 h treatment (Fig. 4E). Thermal FRET analysis indicates only a small increase in Tm of the double-labeled oligonucleotide F21T; the average DTm was measured to no more than 5 °C at 1:50 concentration ratio of F21T:chelidonine. Therefore, the interaction between chelidonine and telomere sequences is too weak. In other word, chelidonine may not inhibit telomerase through limitation of its access to the substrate.

4. Discussion

341

Cell death mechanisms have been long exploited in the treatment of cancer, mainly because malignancies result from an increase in cell number due to the disruption of the delicate balance between cell proliferation and death. It is believed that the elimination of a cell is a complex well-controlled process. In most cases, stimulation and/or restoration of apoptotic cell death leads to suppression of transformation and tumorigenesis. However, apoptosis does not function alone to regulate cell fate, but autophagy, a procedure in which de novo-formed membrane-enclosed vesicles engulf and consume cellular components, is engaged in a complex interplay with apoptosis. Although in some situations, autophagy is assumed to serve as a cell survival pathway by suppressing apoptosis, in others, it may lead to death itself, either in collaboration with apoptosis or as a back-up mechanism when the former is defective [36]. Natural alkaloids of C. majus have been so far frequently reported to induce cell death especially through apoptosis induction. The most important secondary metabolites of isoquinolines in this plant includes chelidonine, sanguinarine, chelerythrine, and berberine with different structures and anti-proliferative effects on cancer cell lines that the detailed mechanisms need more investigation [37]. Chelidonine, the major benzophenanthridine of C. majus that showed a strong antiproliferative effect in human breast adenocarcinoma MCF-7, has been under focus here. Clear morphological changes towards at least two different modes of cell death appeared after 48 h treatment of MCF-7 cells; the classical morphology of apoptosis resulted by 0.1 lM concentration of chelidonine while the morphology of single blister formation or blister cell death (BCD) which is also known as

342

Please cite this article in press as: S.K. Noureini, H. Esmaili, Chelidonine, a natural benzophenathridine alkaloid, suppresses breast cancer cells by hTERT down regulation, senescence acceleration and induction of apoptosis and autophagy, Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/ j.cbi.2014.09.013

343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370

CBI 7138

No. of Pages 9, Model 5G

29 September 2014 6

S.K. Noureini, H. Esmaili / Chemico-Biological Interactions xxx (2014) xxx–xxx

B 40

3.5

relative expression of dapk1a

bax/bcl2 expression ratio

A

3 2.5 2 1.5 1 0.5

35 *

30 25 20 15 10 5

0

0 0

0.1 2 8 µM chelidonine

C 160

0

0.1

1

5

8

μM chelidonine

D

140

18 16

120 population doublings

population size (x million)

*

100 80 60 40 20

14 12 10 8 6 4 2

0

0 0

5 10 15 20 25 30 35 Time (in days)

0

5 10 15 20 25 30 35 Time (in days)

Fig. 3. Dose-dependent alterations of bax/bcl2 (A) and dapk1a (B) mRNA levels in breast cancer cell lines MCF-7, 48 h treated with chelidonine, p 6 0.05; ⁄p 6 0.01. Population size (C) and doubling time (D) changes in MCF-7 cells treated with 0.05 lM chelidonine (triangle) in comparison with the untreated control (diamond) after a few passages.

371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398

autophagy or oncosis, occurred by 1 lM and higher concentrations. A similar bimodal cell death has been seen in drug-resistance k562 human leukemia cells when treated with sanguinarine [38,39]. In addition to morphological changes towards apoptosis, a sharp increase in bax/bcl2 expression ratio was seen at very low concentration of chelidonine, so that the highest ratio coincides with the same concentration at which DNA fragmentation was clearly visible in gel electrophoresis; about 0.1 lM in our experiments. More interestingly the detected changes towards apoptosis in all the three methods; morphological approach, DNA fragmentation and bax/bcl2 expression ratio, occurred at very low concentration (around 0.1 to 1 lM) of chelidonine, while it diminishes by increasing concentration. On the other hand, we identified a very strong dose-dependent induction in transcription of dapk1a gene, which product is a critical kinase that regulates becline 1 and promotes autophagy. This is along with the increase of bax/bcl2 level in treated cells with 0.1 and 1 lM chelidonine that also manifested apoptosis. While apoptotic cells are still frequently visible, autophagy is strongly increased by concentration of chelidonine. It seems that this compound stimulates both modes of cell death simultaneously at low concentration, so that both play important roles synergistically to reduce cell viability very sharply. However, autophagy fulfills the main death pathway at higher than 1 lM concentration, while apoptosis is observed significantly at less than 1 lM chelidonine. Expression levels of the anti-apoptotic bcl2 gene is increased by increasing concentration of chelidonine (as seen in Fig. 3A that after an initial increase, bax/bcl2 declines to even lower than

untreated cells) and this resistance to apoptosis may contribute to boost autophagy by induction of dapk1a. In MCF-7 cells that wild type p53 is expressed, dapk1a can stimulate this protein through inhibition of mdm2. This may suggest that p53 is also overexpressed by chelidonine. Activation of p53 protein leads to both apoptosis and autophagy [36]. Therefore, p53 may link between all the modes of cell death that boosted by various concentration of chelidonine in this cell line as cell senescence may also be stimulated by p53, which in turn results in p21 induction and cell arrest. There are some other compounds that stimulate both apoptosis and autophagy in cancer cells. Such a bimodal cell death induction in a dose dependent manner has been already reported in several cancer cells under treatment with sanguinarine [38–40], another natural benzophenanthridine alkaloids that is structurally homologous to chelidonine. Sanguinarine at a low concentration (1.5 lg/ ml equal to 0.5 lM) induces apoptosis, while at high concentration (12.5 lg/ml equal to 4.15 lM) induces oncosis-blister cell death in p53 null K562 human erythroleukemia cells that is rather resistant to the induction of apoptosis [41]. It is important to note that the compounds with such effects might be valuable chemotherapeutic agents for most cancers, especially those develop drug resistance [38,40]. However, our data suggest chelidonine as a more valuable anti-cancer natural biochemical than sanguinarine, because the latter alkaloid is a strong cytotoxic compound (IC50 value of sanguinarine is 3 ± 0.25 lM in MCF-7 cells after 48 h using MTT test [personal communication]). Sanguinarine shows a very high affinity to interact with DNA [42], which suggests the high probability

Please cite this article in press as: S.K. Noureini, H. Esmaili, Chelidonine, a natural benzophenathridine alkaloid, suppresses breast cancer cells by hTERT down regulation, senescence acceleration and induction of apoptosis and autophagy, Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/ j.cbi.2014.09.013

399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426

CBI 7138

No. of Pages 9, Model 5G

29 September 2014 7

S.K. Noureini, H. Esmaili / Chemico-Biological Interactions xxx (2014) xxx–xxx

D

E % hTERT/β2mg expression ratio

90 80

% hTERT/β2mg expression rao

90

+

80

*

70

% telomerase acvity

100

% telomerase activity

100

70

+

60

60 * 50

+

50

+

40

40

30

30

* *

20

20

10

10

+

*

* +

0

0 0

0.1 1 µM Chelidonine

8

0

3.6 27 µM Berberine

54

Fig. 4. Standard curve and amplification plot of a representative experiment of qTRAP analysis (A). Cell lysates of untreated MCF-7 was serially diluted 1–5 and the next steps were followed as mentioned in Section 2.2. A negative control was included which contained lysis buffer without cell extract (the black curve). The amplification plot of standards were shown in a (blue; cell extract without dilution, pink; 1/5, green; 1/25, orange; 1/125). The qTRAP standard curve with efficiency factors is seen in B. Amplification plot of TRAP reactions is seen in C: red; un-treated MCF-7 cells, blue, green and pink extracts of 48 h treated cells with 0.1, 1 and 8 lM chelidonine respectively. Telomerase activity as measured by q-TRAP assay and hTERT transcription levels using quantitative real-time RT-PCR technique in MCF-7 cells after 48 h treatment with different concentrations of chelidonine and berberine were presented in D and E respectively. The mean value ± SEM of four logical repeats each including at least three samples for different concentrations of was presented, ⁄p 6 0.05, +p 6 0.01. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

427 428 429 430 431 432 433 434 435 436 437

for the genotoxic and mutagenic side effects [43,44]. The structure of chelidonine differs from sanguinarine only by having a hydroxyl group, while it is also electrostatically neutral in contrast with positively charged sanguinarine. These may interfere with DNA intercalation and result in low cytotoxicity of chelidonine. BIX-01294 a selective inhibitor of euchromatic histone-lysine N-methyltransferase 2 has been identified as a cancer specific strong autophagy inducer in estrogen receptor (ESR)-negative SKBr3 and ESR-positive MCF-7 breast cancer cells, HCT116 colon cancer cells, and importantly, in primary human breast and colon cancer cells. Exposure to BIX reduces cell viability in MCF-7 cells

more efficiently than in mammary epithelial MCF10A cell line. However, BIX accumulates intracellular reactive oxygen species (ROS), augments mitochondrial superoxide, hydrogen peroxide and glutathione redox potential in both cytosol and mitochondria [45], an almost similar mechanism as sanguinarine but not chelidonine Salinomycin is an anti-cancer chemical with preferential cytotoxicity in several cancer stem cells including breast cancer by blocking Wnt/b-catenin pathway, which is critical for stem cell self-renewal. However, it is relatively non-toxic to primary cells [46]. In addition to induction of apoptosis through conventional caspase mediated apoptotic pathways, salinomycin triggers a

Please cite this article in press as: S.K. Noureini, H. Esmaili, Chelidonine, a natural benzophenathridine alkaloid, suppresses breast cancer cells by hTERT down regulation, senescence acceleration and induction of apoptosis and autophagy, Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/ j.cbi.2014.09.013

438 439 440 441 442 443 444 445 446 447 448

CBI 7138

No. of Pages 9, Model 5G

29 September 2014 8 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496

497 498

S.K. Noureini, H. Esmaili / Chemico-Biological Interactions xxx (2014) xxx–xxx

massive autophagic response substantially stronger than to commonly used autophagic inducer Rapamycin in breast cancer cells and to lesser degree in human normal dermal fibroblasts [47]. Although any dose-dependency for bimodal cell death has not been described for BIX and salinomycin, both chelidonine and sanguinarine promote both apoptotic and autophagic cell death dose dependently. Quantitative TRAP assay measured a very low level of telomerase activity in treated cells; therefore, most likely the inhibition mechanism is depletion of the relative amount of the functional ribonucleoprotein by chelidonine. Telomerase regulation albeit very complicated, is mainly through transcription regulation of the catalytic subunit of the enzyme [48]. Our data showed that in treated cells hTERT mRNA level followed the same diminution pattern as the telomerase activity. This suggests that telomerase inhibitory effect of chelidonine is most likely by decreasing the transcription of hTERT gene. However, a potential telomerase inhibitor compound may also interfere with the enzyme activity by some additional mechanisms, which the most remarkable one is limitation of enzyme accessibility to its substrate. As melting temperature of synthetic telomeric oligonucleotide, F21T, in presence of chelidonine did not considerably increased, the enzyme activity could not be inhibited through stabilization of the substrate into folded state; therefore the limitation of enzyme accessibility to its substrate is failed. This is compatible with other publications indicating only a slight DNA binding capacity of chelidonine [49]. In this reference, the authors have reported that cytotoxicity of sanguinarine and chelerythrine among alkaloids of C. majus is through a rapid intensive DNA damage, while chelidonine induces intensive DNA damage in 15–20% of treated cells only in 24 h. In comparison, chelidonine even at sub-micromolar concentrations is much more effective on telomerase inhibition than berberine, a known natural alkaloid that inhibits telomerase [50]. In our hand, qTRAP measurements in MCF-7 cells treated with berberine estimated a strong repression of telomerase to around 10% of untreated cells at its LD50 value (equal to 54 lM as evaluated by MTT method). Bearing in mind the cytotoxicity of chelidonine and berberine and the concentration of each compound at which telomerase is inhibited to 50%, 0.5 and 27 lM respectively, chelidonine showed a very stronger anti-telomerase efficiency than berberine. In conclusion, chelidonine is proposed as a very potent anticancer bio-organic compound as it strongly inhibits telomerase and stimulates multiple mechanisms of cell death including apoptosis, autophagy and senescence. This compound probably induces global changes in gene expression profile of treated MCF-7 cells Q3 and stimulates several pathways to suppress cancer cell growth. Conflicts of interest The authors declare that there are no conflicts of interest.

499

Acknowledgments

500 502

We would like to thank the anonymous reviewers for their helpful comments and suggestions. This work was supported by the Iran National Science Foundation (INSF).

503

References

501

504 505 506 507 508 509

[1] D.J. Kim, B. Ahn, B.S. Han, H. Tsuda, Potential preventive effects of Chelidonium majus L. (Papaveraceae) herb extract on glandular stomach tumor development in rats treated with N-methyl-N0 -nitro-N nitrosoguanidine (MNNG) and hypertonic sodium chloride, Cancer Lett. 112 (1997) 203–208. [2] A. Lohninger, F. Hamler, Chelidonium majus L. (Ukrain) in the treatment of cancer patients, Drugs Exp. Clin. Res. 18 (Suppl.) (1992) 73–77.

[3] M.L. Colombo, E. Bosisio, Pharmacological activities of Chelidonium majus L. (Papaveraceae), Pharmacol. Res. 33 (1996) 127–134. [4] D. Habermehl, B. Kammerer, R. Handrick, T. Eldh, C. Gruber, N. Cordes, Proapoptotic activity of Ukrain is based on Chelidonium majus L. alkaloids and mediated via a mitochondrial death pathway, BMC Cancer 6 (2006) 14. [5] J. Huh, A. Liepins, J. Zielonka, C. Andrekopoulos, B. Kalyanaraman, A. Sorokin, Cyclooxygenase 2 rescues LNCaP prostate cancer cells from sanguinarineinduced apoptosis by a mechanism involving inhibition of nitric oxide synthase activity, Cancer Res. 66 (2006) 3726–3736. [6] S. Jantova, L. Cipak, S. Letasiova, Berberine induces apoptosis through a mitochondrial/caspase pathway in human promonocytic U937 cells, Toxicol. In Vitro 21 (2007) 25–31. [7] S.K. Noureini, M. Wink, Transcriptional down regulation of hTERT and senescence induction in HepG2 cells by chelidonine, World J. Gastroenterol. 15 (2009) 3603–3610. [8] J. Hammerová, S. Uldrijan, E. Táborská, I. Slaninová, Benzo[c]phenanthridine alkaloids exhibit strong anti-proliferative activity in malignant melanoma cells regardless of their p53 status, J. Dermatol. Sci. 62 (2011) 22–35. [9] A. Philchenkov, V. Kaminskyy, M. Zavelevich, R. Stoika, Apoptogenic activity of two benzophenanthridine alkaloids form Chelidonium majus L. does not correlate with their DNA damaging effects, Toxicol. In Vitro 22 (2008) 287– 295. [10] N. Cordes, L. Plasswilm, M. Bamberg, H.P. Rodemann, Ukrain, an alkaloid thiophosphoric acid derivative of Chelidonium majus L. protects human fibroblasts but not human tumor cells in vitro against ionizing radiation, Int. J. Radiat. Biol. 78 (2002) 17–27. [11] V. Kaminskyy, K.-W. Lin, Y. Filyak, R. Stoika, Differential effect of sanguinarine, chelerythrine and chelidonine on DNA damage and cell viability in primary mouse spleen cells and mouse leukemic cells, Cell Biol. Int. 32 (2008) 271–277. [12] G. Mazzanti, A. Di Sotto, A. Franchitto, C.L. Mammola, P. Mariani, S. Mastrangelo, F. Menniti-Ippolito, A. Vitalone, Chelidonium majus is not hepatotoxic in Wistar rats, in a 4 weeks feeding experiment, J. Ethnopharmacol. 126 (3) (2009) 518–524. [13] O. Hohenwarter, K. Strutzenberger, H. Katinger, A. Liepins, J.W. Nowicky, Selective inhibition of in vitro cell growth by the antitumor drug Ukrain, Drugs Exp. Clin. Res. 18 (Suppl.) (1992) 1–4. [14] K.E. Huffman, S.D. Levene, V.M. Tesmer, J.W. Shay, W.E. Wright, Telomere shortening is proportional to the size of the G-rich telomeric 30 -overhang, J. Biol. Chem. 275 (2000) 19719–19722. [15] M. Meyerson, C.M. Counter, E.N. Eaton, L.W. Ellisen, P. Steiner, S.D. Caddle, HEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization, Cell 90 (1997) 785–795. [16] E. Hiyama, T. Yokoyama, N. Tatsumoto, K. Hiyama, Y. Imamura, Y. Murakami, Telomerase activity in gastric cancer, Cancer Res. 55 (1995) 3258–3262. [17] L.L. Smith, H.A. Coller, J.M. Roberts, Telomerase modulates expression of growth-controlling genes and enhances cell proliferation, Nat. Cell Biol. 5 (2003) 474–479. [18] S.A. Stewart, R.A. Weinberg, Telomeres: cancer to human aging, Annu. Rev. Cell Dev. Biol. 22 (2006) 531–557. [19] D.L. Gómez, H.G. Farina, D.E. Gómez, Telomerase regulation: a key to inhibition?, Int J. Oncol. 43 (2013) 1351–1356. [20] B. Maji, S. Bhattacharya, Advances in the molecular design of potential anticancer agents via targeting of human telomeric DNA, Chem. Commun. (Camb) (2014). PMID:24695755. [21] I. Joseph, R. Tressler, E. Bassett, C. Harley, C.M. Buseman, P. Pattamatta, W.E. Wright, J.W. Shay, N.F. Go, The telomerase inhibitor imetelstat depletes cancer stem cells in breast and pancreatic cancer cell lines, Cancer Res. 70 (2010) 9494–9504. [22] M. Ruden, N. Puri, Novel anticancer therapeutics targeting telomerase, Cancer Treat. Rev. 39 (2013) 444–456. [23] A. Paul, S. Das, J. Das, A. Samadder, A.R. Khuda-Bukhsh, Cytotoxicity and apoptotic signalling cascade induced by chelidonine-loaded PLGA nanoparticles in HepG2 cells in vitro and bioavailability of nano-chelidonine in mice in vivo, Toxicol. Lett. 222 (2013) 10–22. [24] T. Mosmann, Rapid colorimetric assay for cellular growth and survival; application to proliferation and cytotoxicity assays, J. Immunol. Methods 65 (1983) 55–63. [25] N.W. Kim, M.A. Piatyszek, K.R. Prowse, C.B. Harley, M.D. West, P.L. Ho, Specific association of human telomerase activity with immortal cells and cancer, Science 266 (1994) 2011–2050. [26] M.M. Bradford, A rapid and sensitive method for quantitation. For each of control and/in utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [27] M. Hou, X. Dawei, M. Byorkltolm, A. Gruber, Real-Time quantitative telomeric repeat amplification protocol Assay for the detection of telomerase activity, Clin. Chem. 47 (2001) 519–524. [28] S.K. Noureini, M. Wink, Antiproliferative effects of crocin in HepG2 cells by telomerase inhibition and hTERT down-regulation, Asian Pac. J. Cancer Prev. 13 (2012) 2305–2309. [29] A. Guédin, L. Lacroix, J.L. Mergny, Thermal melting studies of ligand DNA interactions drug–DNA interaction protocols, Methods Mol. Biol. 613 (2010) 25–35. [30] Y.F. Shi, M.G. Szalay, L. Paskar, B.M. Sahai, M. Boyer, B. Singh, D.R. Green, Activation-induced cell death in T cell hybridomas is due to apoptosis. Morphologic aspects and DNA fragmentation, J. Immunol. 144 (1990) 3326– 3333.

Please cite this article in press as: S.K. Noureini, H. Esmaili, Chelidonine, a natural benzophenathridine alkaloid, suppresses breast cancer cells by hTERT down regulation, senescence acceleration and induction of apoptosis and autophagy, Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/ j.cbi.2014.09.013

510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595

CBI 7138

No. of Pages 9, Model 5G

29 September 2014 S.K. Noureini, H. Esmaili / Chemico-Biological Interactions xxx (2014) xxx–xxx 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629

[31] G.P. Dimri, X. Lee, G. Basile, M. Acosta, G. Scott, C. Roskelley, A biomarker that identifies senescent human cells in culture and in aging skin in vivo, Proc. Natl. Acad. Sci. U.S.A. 92 (1995) 9363–9367. [32] S. Bialik, A. Kimchi, The death-associated protein kinases: structure, function and beyond, Annu. Rev. Biochem. 75 (2006) 189–210. [33] E. Zalckvar, H. Berissi, L. Mizrachy, Y. Idelchuk, I. Koren, M. Eisenstein, DAPkmediated phosphorylation on the BH3 domain of Beclin-1 promotes dissociation of Beclin-1 from Bcl- XL to induce autophagy, EMBO Rep. 10 (2009) 285–292. [34] B. Inbal, S. Bialik, I. Sabanay, G. Shani, A. Kimchi, DAP kinase and DRP-1 mediate membrane blebbing and the formation of autophagic vesicles during programmed cell death, J. Cell Biol. 157 (2002) 455–468. [35] C.H. Chen, W.J. Wang, J.C. Kuo, H.C. Tsai, J.R. Lin, Z.F. Chang, R.H. Chen, Bidirectional signals transduced by DAPK–ERK interaction promote the apoptotic effect of DAPK, EMBO J. 24 (2005) 294–304. [36] A. Eisenberg-Lerner, S. Bialik, H.U. Simon, A. Kimchi, Life and death partners: apoptosis, autophagy and the cross-talk between them, Cell Death Differ. 16 (2009) 966–975. [37] J.J. Lu, J.L. Bao, X.P. Chen, M. Huang, Y.T. Wang, Alkaloids isolated from natural herbs as the anticancer agents, Evid. Based Complement. Alternat. Med. (2012) 485042, http://dx.doi.org/10.1155/2012/485042. [38] P. Weerasinghe, S. Hallock, S.C. Tang, B. Trump, A. Liepins, Sanguinarine overcomes P-glycoprotein-mediated multidrug-resistance via induction of apoptosis and oncosis in CEM-VLB 1000 cells, Exp. Toxicol. Pathol. 58 (1) (2006) 21–30. [39] P. Weerasinghe, S. Hallock, S.C. Tang, A. Liepins, Role of Bcl-2 family proteins and caspase-3 in sanguinarine-induced bimodal cell death, Cell Biol. Toxicol. 17 (2001) 371–381. [40] Z. Ding, S.C. Tang, P. Weerasinghe, X. Yang, A. Pater, A. Liepins, The alkaloid sanguinarine is effective against multidrug resistance in human cervical cells via bimodal cell death, Biochem. Pharmacol. 63 (8) (2002) 1415– 1421. [41] T. Kobayashi, S. Ruan, K. Clodi, K.O. Kliche, H. Shiku, M. Andreeff, W. Zhang, Overexpression of Bax gene sensitizes K562 erythroleukemia cells to apoptosis

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

9

induced by selective chemotherapeutic agents, Oncogene 16 (12) (1998) 1587–1591. A. Saran, S. Srivastava, E. Coutinho, M. Maiti, 1H NMR investigation of the interaction of berberine and sanguinarine with DNA, Indian J. Biochem. Biophys. 32 (2) (1995) 74–77. K.M. Ansari, M. Das, Potentiation of tumour promotion by topical application of argemone oil/isolated sanguinarine alkaloid in a model of mouse skin carcinogenesis, Chem. Biol. Interact. 188 (3) (2010) 591–597. M. Das, K.M. Ansari, A. Dhawan, Y. Shukla, S.K. Khanna, Correlation of DNA damage in epidemic dropsy patients to carcinogenic potential of argemone oil and isolated sanguinarine alkaloid in mice, Int. J. Cancer 117 (5) (2005) 709– 717. Y. Kim, Y.S. Kim, D.E. Kim, J.S. Lee, J.H. Song, H.G. Kim, D.H. Cho, S.Y. Jeong, D.H. Jin, S.J. Jang, H.S. Seol, Y.A. Suh, S.J. Lee, C.S. Kim, J.Y. Koh, J.J. Hwang, BIX-01294 induces autophagy-associated cell death via EHMT2/G9a dysfunction and intracellular reactive oxygen species production, Autophagy 9 (12) (2013) 2126–2139. D. Lu, M.Y. Choi, J. Yu, J.E. Castro, T.J. Kipps, D.A. Carson, Salinomycin inhibits Wnt signaling and selectively induces apoptosis in chronic lymphocytic leukemia cells, Proc. Natl. Acad. Sci. U.S.A. 108 (2011) 13253–13257. J.R. Jangamreddy, S. Ghavami, J. Grabarek, G. Kratz, E. Wiechec, B.A. Fredriksson, R.K. Rao Pariti, A. Cies´lar-Pobuda, S. Panigrahi, M.J. Łos, Salinomycin induces activation of autophagy, mitophagy and affects mitochondrial polarity: differences between primary and cancer cells, Biochim. Biophys. Acta 1833 (9) (2013) 2057–2069. C.M. Counter, M. Meyerson, E.N. Eaton, L.W. Ellisen, S.D. Caddle, D.A. Haber, Telomerase activity is restored in human cells by ectopic expression of hTERT (hEST2), the catalytic subunit of telomerase, Oncogene 16 (1998) 1217–1222. V. Kaminskyy, O. Kulachkovskyy, R. Stoika, A decisive role of mitochondria in defining rate and intensity of apoptosis induction by different alkaloids, Toxicol. Lett. 177 (2008) 168–181. N. Sriwilaijareon, S. Petmitr, A. Mutirangura, M. Ponglikitmongkol, P. Wilairat, Stage specificity of Plasmodium falciparum telomerase and its inhibition by berberine, Parasitol. Int. 51 (1) (2002) 99–103.

630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664

Please cite this article in press as: S.K. Noureini, H. Esmaili, Chelidonine, a natural benzophenathridine alkaloid, suppresses breast cancer cells by hTERT down regulation, senescence acceleration and induction of apoptosis and autophagy, Chemico-Biological Interactions (2014), http://dx.doi.org/10.1016/ j.cbi.2014.09.013