Letters in Applied Microbiology ISSN 0266-8254
ORIGINAL ARTICLE
Multiplex PCR for detection of virulence markers of Vibrio vulnificus N. Bier, S. Diescher and E. Strauch Federal Institute for Risk Assessment, National Reference Laboratory for Monitoring Bacteriological Contamination of Bivalve Molluscs, Berlin, Germany
Significance and Impact of the Study: A multiplex PCR for simultaneous detection and characterization of potentially virulent strains of Vibrio vulnificus was developed and validated. Monitoring programs will benefit from this cost and time effective method when screening large strain collections. Application of the multiplex PCR simplifies determination of risks emanating from V. vulnificus in recreational waters or mussel primary production.
Keywords genotyping, markers, methods, polymerase chain reaction, rapid, virulence. Correspondence Eckhard Strauch, Federal Institute for Risk Assessment, Department of Biological Safety, National Reference Laboratory for Monitoring Bacteriological Contamination of Bivalve Molluscs, Max-Dohrn-Str. 8-10, D - 10589 Berlin, Germany. E-mail: [email protected] 2014/2441: received 27 November 2014, revised 12 January 2015 and accepted 13 January 2015 doi:10.1111/lam.12394
Abstract Vibrio vulnificus is a Gram-negative pathogen found in coastal and estuarine waters worldwide that can cause life threatening diseases. Characterization of the vcg (virulence correlated gene) or 16S rRNA alleles is used to distinguish virulent (clinical (C)-type) from presumably avirulent (environmental (E)type) strains. However, some studies reported a significant number of clinical strains belonging to the E-type. In recent years more potential virulence markers have been identified, that are useful for the identification of potentially pathogenic isolates of the E-type. In this study, we successfully combined detection of pathogenicity region XII, nanA and a mannitol fermentation operon with the virulence associated alleles of the 16S rRNA and vcg genes in one multiplex PCR. Additionally, toxR primers for species confirmation and internal amplification control were included. Validation of multiplex amplification was performed with a total of 132 bacterial strains, including V. vulnificus (n = 71), other Vibrionaceae (n = 50) and non-Vibrio isolates (n = 11). Multiplex PCR showed reliable amplification of four of the five virulence markers with a high sensitivity and specificity. Amplification of the 16S rRNA type B allele was not completely reliable with conventional PCR assays, however, the positive predictive value of this marker was 100 %.
Introduction Vibrio vulnificus is a pathogenic bacterium naturally occurring in coastal and estuarine waters worldwide that can cause life-threatening diseases by wound infection or food poisoning (Oliver 2006). High incidences of infection correlate with increased abundances of V. vulnificus in the summer months. But despite the frequent occurrence of this pathogen in seawater and seafood as well as a high number of persons being at risk, the number of reported cases is relatively low (Oliver 2006). This indicates that other factors may exist which either make only few persons vulnerable for infection or enable only few strains to cause infection. Many studies concentrated on 414
finding molecular markers that might help identifying V. vulnificus isolates with a high virulence potential. By multilocus sequence typing (MLST) V. vulnificus isolates can be grouped into two clusters with most of the environmental isolates belonging to cluster I and a higher proportion of clinical isolates in cluster II, indicating a higher virulence potential among strains of the latter cluster (Bisharat et al. 2007; Cohen et al. 2007; Bier et al. 2013; Reynaud et al. 2013). However, several clinical strains were also found in cluster I, indicating that cluster I strains can also cause severe infections. Characterization of V. vulnificus isolates revealed sequence polymorphisms in the virulence correlated gene (vcg type E and C) as well as in the 16S rRNA gene (16S rRNA type A and B) and
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
N. Bier et al.
categorization of V. vulnificus isolates to one of these types is commonly used to discriminate between virulent (clinical (C)-type) and presumably avirulent (environmental (E)-type) strains (Nilsson et al. 2003; Rosche et al. 2005; Vickery et al. 2007). The vcg type C and 16S rRNA type B alleles are described to correlate with the clinical origin of V. vulnificus isolates and with virulence in iron dextran-treated mice, although highly virulent strains belonging to the E-genotype were also reported (Thiaville et al. 2011). In a recent study we found that the majority of clinical isolates of wound infections from the Baltic were of the E-genotype (Bier et al. 2013). But despite the low prevalence of the C-genotype among these clinical strains, the vcgC and 16S rRNA type B alleles were highly predictive for MLST cluster II, which was also reported in other studies (Cohen et al. 2007; Thiaville et al. 2011). We found significant correlations between the clinical origin and some recently discovered potential virulence markers, such as the ability to ferment mannitol (Drake et al. 2010), the presence of pathogenicity region XII (PRXII) (Cohen et al. 2007) and the gene nanA of the sialic acid catabolism region (Jeong et al. 2009; Lubin et al. 2012). Moreover, these markers were present in clinical E-type strains, whose virulence potential would remain undetected by the vcg and 16S rRNA typing scheme (Bier et al. 2013). Similar results were reported shortly afterwards by Reynaud et al. (2013) for clinical strains from the northeastern USA mainly isolated from blood, indicating that the observed correlations are neither geographically restricted to the Baltic Sea region nor occur only in isolates from wound infections. These findings strongly suggest that the presence of the pathogenicity region XII, the nanA gene and genes of the mannitol fermentation operon should additionally be addressed when estimating the pathogenic potential of V. vulnificus isolates found in nonclinical settings such as the environment, retail or mussel primary production. Instead of five individual PCR analyses it would be valuable to perform a combined PCR assay. Therefore the objective of this study was to develop and validate a multiplex PCR for simultaneous detection of five virulence associated genes: 16S rRNA type B allele, vcg type C allele, the nanA gene, pathogenicity region XII and the mannitol fermentation operon. The PCR contained also primers for the V. vulnificus specific toxR gene as species marker and amplification control. Results and discussion Selection of target genes Primers were chosen from the literature to generate PCR products with size differences of approximately 100 bp
Multiplex PCR for V. vulnificus
and higher (Fig. 1). The ability to ferment mannitol can be tested by a PCR targeting a gene within the mannitol fermentation operon, encoding the IIA domain of the mannitol specific phosphotransferase system (manIIA – amplicon size: 243 bp). The amplification of this gene in PCR assays is in complete accordance with biochemical testing for mannitol fermentation (Froelich and Oliver 2011; Bier et al. 2013). For detection of the nanA gene of the sialic acid catabolism cluster different primers were described in the literature (Lubin et al. 2012). The initially chosen primer pair nanA–F/nanA–R, which had been used in singleplex PCRs (amplicon size: 745 bp) (Bier et al. 2013), failed in some strains under multiplex conditions and had to be replaced. The new primer pair rpiR-F/nanA-2R yielded specific products (amplicon size: 1299 bp) giving the same results as obtained in singleplex PCRs with former primers. For detection of PRXII in the multiplex PCR we decided to target VVA1613 encoding a putative chondroitinase AC lyase located on PRXII (amplicon size: 2257 bp) (Cohen et al. 2007). Detection of VVA1613 was in complete accordance with the presence of PRXII in Bier et al. (2013), which was confirmed by several additional PCRs. The species-specific PCR targeting toxR described by Bauer and Rørvik is frequently used for identification of different Vibrio spp. and showed 100% sensitivity and specificity (Bauer and Roervik 2007). The addition of the Vibrio vulnificus-specific primer pair targeting toxR enables specific detection of V. vulnificus and serves simultaneously as internal amplification control. For amplification of the vcg type C allele (amplicon size: 99 bp) and the 16S rRNA type B allele (amplicon size: 839 bp) we added primers described by Warner and Oliver (2008a,b), and successfully used in Han and Ge (2010). Parameter optimization for multiplex PCR Optimization of multiplex PCR was performed using 11 V. vulnificus strains with different virulence characteristics (see Table 1). An optimal annealing temperature of 63°C was determined by performing a gradient PCR with ranging annealing temperatures (54, 57, 60, 62, 63, and 65°C). Performance of multiplex PCR was best with a concentration of MgCl2 of 2 mmol l1, 15 U of Taq polymerase and 30 amplification cycles. Increased concentrations of MgCl2 (3 mmol l1) and Taq polymerase (25 U per reaction) as well as higher cycle numbers (35 cycles) resulted in formation of unspecific products in some strains rather than higher product yields. To improve amplification of vcgC and PRXII the concentration of dNTPs was increased up to 3 mmol l1. Satisfying results were achieved after further increasing the concentrations of primer pairs vcgC-F/vcgC-R and
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
415
Multiplex PCR for V. vulnificus
N. Bier et al.
M
1
2
3
4
5
6
7
8
9
10 PRXII
2 kb
nanA
1·2 kb 1 kb
16S rRNA-type B allele 500 bp
toxR manIIA
100 bp
vcg-type C allele
Figure 1 Electrophoretic separation of multiplex PCR products obtained from different Vibrio vulnificus isolates in 18 % agarose: M: GeneRuler 100 bp Plus DNA Ladder (Fermentas, St. Leon-Rot, Germany); lane 1 to 10: V. vulnificus isolates VN-0094, CMCP6, VN-3110, VN-3910, VN-3369, VN-3478, VN-2813, VN-3378, VN-3461 and VN-3927 (strains are marked with ¶ in Table 1.). Amplicon sizes are: PRXII (2257 bp), nanA (1299 bp), 16S rRNA type B allele (839 bp), toxR (435 bp), ManIIA (243 bp) and vcg type C allele (99 bp). Table 1 Seventy one Vibrio vulnificus strains used in this study and their virulence characteristics Virulence characteristics
Multiplex PCR results
V. vulnificus strain ID
No.
PRXII
nanA
16S rRNA type
manIIA
vcg type
PRXII
nanA
16S-B§
toxR
manIIA
vcgC
VN-0010, VN-0016, VN-0126, VN-0130, VN-0132, VN-0133, VN-0206, VN-3972* VN-0119, VN-2961 VN-0227, VN-0288 VN-0207 VN-0105, VN-3110¶, VN-3135* VN-0100, VN-0104 VN-3910¶, VN-3922, VN-3925 VN-3538 VN-0092, VN-0112 VN-0094*¶, VN-0095, VN-0120, VN-0128, VN-0129, MO6-24, CMCP6*¶, VN-3379 VN-0096*, VN-0131* VN-0067 VN-3978* VN-0102 VN-0108, VN-3378¶ VN-2813¶ VN-3368*, VN-3369¶, VN-3478¶ VN-0127* VN-0097, VN-0098, ATCC33149, VN-0101*, VN-0103, VN-0125, VN-0143, VN-0204, VN-0205, VN-0208, VN-0209, VN-0235, VN-0239, VN-0243, VN-0251, VN-0260, VN-0264, VN-0266, VN-0270, VN-0274, VN-0275, VN-0276, VN-0277, VN-0280, VN-3461¶, VN-3909*, VN-3927¶
8
+
A
+
E
+
+
+
2 2 1 3 2 3 1 2 8
+ + + + + + + + +
+ + + + + + +
B B AB A B AB B B B
+ + + + +
E E E E E E E E C
+ + + + + + + + +
+ + + + + + +
† + † + + + † +
+ + + + + + + + +
+ + + + +
+
2 1 1 1 2 1 3 1 27
+
+ + + + +
A AB A AB A A B A A
+ + + +
E E E E E E C E E
+
+ + + + +
† † +
+ + + + + + + + +
+ + (+)‡ + +
+
*Strains used for optimization of multiplex PCR. †Falsely negative. ‡Falsely positive. §16S-B is a short form for 16S rRNA type B. ¶Strains shown in Figure 1.
416
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
N. Bier et al.
Multiplex PCR for V. vulnificus
VVA1612F/VVA1613R up to 06 and 08 lmol l1, respectively. To prevent nonspecific primer annealing we performed a Hot Start amplification which resulted in higher band intensities of specific products. Moreover Hot Start amplification, as well as the use of freshly prepared genomic DNA, proved necessary for reliable amplification of all target genes in each of the 11 V. vulnificus strains used for optimization. Optimized protocol for multiplex PCR Optimized cycling conditions were 30 cycles of the standard cycling steps in a Hot Start approach: 94°C for 4 min, 30 cycles with denaturation at 94°C for 30 s, primer annealing at 63°C for 30 s and extension at 72°C for 25 min, followed by a final extension step at 72°C for 10 min. Multiplex PCR reactions were performed in a volume of 25 ll with 19 PCR buffer (2 mmol l1 MgCl2), 03 mmol l1 of each dNTP, and 15 U DreamTaq DNA polymerase with 1 ll of genomic DNA. The primer concentrations were as follows: 08 lmol l1 of PRXII primers (VVA1612F/VVA1613R), 06 lmol l1 of vcgC primers (vcgC-F/vcgC-R) and 02 lmol l1 of all other primers (rpiR-F/nanA-2R, 16S B-F1/16S B-R1, UtoxF/VvtoxR, Man IIA F/Man IIA R). Specificity of multiplex PCR For validation of multiplex PCR additional 60 V. vulnificus isolates, together with 50 other Vibrionaceae and 11 non-Vibrio isolates were tested using the optimized multiplex PCR protocol. Sensitivity (%), specificity (%), negative (NPV) and positive predictive value (PPV) were calculated for each target gene individually from the multiplex PCR results of the V. vulnificus strains (Table 2). PRXII, nanA, vcgC, manIIA: PRXII, the gene nanA and the vcgC-allele could be detected with a sensitivity and specificity of 100%. One strain (VN–0102) showed a weak unspecific band with the size of the manIIA product
resulting in a specificity of 975% and a positive predictive value of 969% for detection of manIIA. 16S rRNA type B: Amplification of the 16S rRNA type B allele with primer pair 16S B-F1/16S B-R1 was possible in most strains, but failed in seven strains (VN-0067, VN0092, VN-0102, VN-0112, VN-0119, VN-0207 and VN2961). These strains remained falsely negative, even when tested in singleplex PCR. This leads to a decreased sensitivity of 731 % and a negative predictive value of 865 % for detection of the 16S rRNA type B allele. Because of the decreased binding efficiency of this primer pair, we designed new primers for amplification of 16S rRNA type B allele (amplicon size: 317 bp). The use of the new primer pair Vv-16SB-F1/Vv-16SB-R2 enabled amplification in six of the seven falsely negative tested strains, increasing the sensitivity to 962%. However, we decided to exclude these primers from the multiplex PCR since they also led to amplification of the 16S rRNA type A allele in four strains, resulting in a decreased specificity of 911% and a positive predictive value of 862%. These results imply that the sequence polymorphisms in the 16S RNA type A and type B alleles are not sufficient for reliable discrimination by traditional PCR compared to 16S rRNA typing by the real-time PCR assay described by Vickery et al. (2007). We therefore suggest to perform the multiplex PCR with primer pair 16S B-F1/ 16S B-R1 (Warner and Oliver 2008b) for screening of large strain collections since in this case a positive predictive value of 100 % was achieved. Strains that had been tested negative for 16S rRNA type B allele in the multiplex PCR could additionally be tested in a second step with real-time PCR for 16S rRNA typing. toxR: In the multiplex PCR a reliable amplification of the V. vulnifiucs specific toxR gene was achieved. In all tested V. vulnificus strains the specific product was generated (100% sensitivity), while this was not the case in nontarget Vibrionaceae and non-Vibrio strains (100% specificity). In few cases the multiplex PCR generated weak diverse patterns of unspecific products with other Vibrionaceae or non-Vibrio strains (data not shown), which seems
Table 2 Validation of the performance of the multiplex PCR for individual target genes
Target gene
No. of truly positive strains (n)
No. of truly negative strains (n)
Sensitivity (%)
Specificity (%)
Positive predictive value (PPV) (%)
Negative predictive value (NPV) (%)
PRXII nanA 16S rRNA type B manIIA vcgC toxR
34 29 26 31 11 71
37 42 45 40 60 61*
34/34 29/29 19/26 31/31 11/11 71/71
37/37 42/42 45/45 39/40 60/60 61/61
34/34 29/29 19/19 31/32 11/11 71/71
37/37 42/42 45/52 39/39 60/60 61/61
(100) (100) (731) (100) (100) (100)
(100) (100) (100) (975) (100) (100)
(100) (100) (100) (969) (100) (100)
(100) (100) (865) (100) (100) (100)
*For the species specific toxR PCR 61 other Vibrionaceae and non-Vibrio isolates were included for the calculation.
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
417
Multiplex PCR for V. vulnificus
N. Bier et al.
inevitable given the number of different primer pairs in one PCR reaction. Therefore, band patterns should only be interpreted when the specific toxR product and discrete bands characteristic for V. vulnificus isolates are observed. Application of multiplex PCR So far two multiplex PCR assays have been described for detection of V. vulnificus isolates and simultaneous determination of the 16S rRNA, vcg or CPS types (Warner and Oliver 2008b; Han and Ge 2010). In a recent study (Bier et al. 2013) each clinical V. vulnificus strain was characterized by possessing at least one of five virulence markers: vcg type C allele, 16SrRNA type B allele, PRXII, nanA, or the ability to ferment mannitol, which motivated us to develop a PCR assay for simultaneous detection of these markers. We successfully achieved amplification of these five potential virulence markers in one multiplex PCR, which substantially simplifies characterization of potential pathogenic V. vulnificus isolates. The addition of species-specific primers allows confirmation of the identity of V. vulnificus and serves simultaneously as an amplification control. The multiplex PCR assay validated in this study is the first one to detect additional virulence-associated markers (Bier et al. 2013; Reynaud et al. 2013) besides the determination of vcg and 16S rRNA types. In the United States V. vulnificus is the leading cause of seafood related death cases (Oliver 2006) while in the Baltic all known cases occurred after contact with seawater
(Bier et al. 2013). In recent years, concerns aroused that infections caused by this pathogen will rise in the future due to global warming and the demographic change of the human population (Baker-Austin et al. 2010, 2012). For these reasons monitoring programs for V. vulnificus at bathing locations or in the production of bivalve molluscs could be demanded by public health authorities. The multiplex PCR described in this study offers a valuable tool to efficiently cope with large numbers of sampled strains that will inevitably be generated during monitoring programs. Materials and methods Bacterial strains Bacterial strains used in this study are listed in Table 1 and Table S1. A total of 132 bacterial strains, including V. vulnificus (n = 71), other Vibrionaceae (n = 50) and non-Vibrio isolates (n = 11) were used to assess the specificity of the multiplex PCR. Vibrio vulnificus isolates comprised of 53 isolates of different origin, already characterized and published by Bier et al. (2013) and 18 additional environmental biotype 1 isolates from our strain collection. The identities of all V. vulnificus isolates had been confirmed by a species-specific toxR PCR (Bauer and Roervik 2007) and MLST according to Bisharat et al. (2007). All V. vulnificus isolates were characterized by single PCR or real-time PCR for the five different virulence markers as described (Rosche et al. 2005; Cohen et al.
Table 3 Primers used in this study Primer
Gene target/designation
Sequence (50 to 30 )
Amplicon (bp)
Reference
VVA1612F* VVA1613R*
PRXII, 5‘flanking region PRXII, putative chondroitinase AC lyase Sialic acid catabolism cluster Sialic acid catabolism cluster 16S rRNA type B allele 16S rRNA type B allele Sialic acid catabolism cluster Sialic acid catabolism cluster toxR of V. vulnificus toxR of V. vulnificus 16S rRNA type B allele 16S rRNA type B allele Enzyme IIA of mannitol fermentation operon Enzyme IIA of mannitol fermentation operon vcg type C allele vcg type C allele
ACCCTGATCGTTGGCTACTC GGAGCGGTGTGATGGTGTTG
2257
Cohen et al. (2007) Cohen et al. (2007)
TACGCAAGCCCAGCGGCATG TTGCCACTTCCGCGATCGGG GCCTACGGGCCAAAGAGG CCTGCGTCTCCGCTGGCT TKATCGCCGCTCCYCATACA GCAACGCCACCGTATTCAAC GASTTTGTTTGGCGYGARCAAGGTT AACGGAACTTAGACTCCGAC TAATACCGCATGATGCCTACGGGC AACGTCAAATGATGCCGCTATTAACGAC GATGTTGGTGAACAACTTCTCTGC
1299
Lubin et al. (2012) Lubin et al. (2012) Warner and Oliver (2008a) Warner and Oliver (2008a) Bier et al. (2013) Lubin et al. (2012) Bauer and Roervik (2007) Bauer and Roervik (2007) This study This study Froelich and Oliver (2011)
rpiR-F* nanA-2R* 16S B-F1* 16S B-R1* nanA-F nanA-R UtoxF* VvtoxR* Vv-16SB-F1 Vv-16SB-R2 Man IIA F* Man IIA R* vcgC-F* vcgC-R*
839 745 435 317 243
TCTGAAGCCTGTTGGATGCC AGCTGCCGATAGCGATCT TGAGCTAACGCGAGTAGTGAG
Froelich and Oliver (2011) 99
Warner and Oliver (2008b) Warner and Oliver (2008b)
*Primers used in multiplex PCR.
418
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
N. Bier et al.
2007; Vickery et al. 2007; Froelich and Oliver 2011; Lubin et al. 2012; Bier et al. 2013): vcg, 16S rDNA, nanA, pathogenicity region XII and manIIA, of the mannitol fermentation operon. Biochemical testing of mannitol fermentation was carried out according to Bier et al. (2013). Primers and standard PCR conditions The PCR primers, target genes and amplicon sizes used are shown in Table 3. Primers were synthesized by Metabion International AG (Martinsried, Germany). Standard PCR reactions were performed using a Mastercycler EP gradient (Eppendorf, Hamburg, Germany) in a volume of 25 ll with 19 PCR buffer (2 mmol l1 MgCl2), 02 mmol l1 of each deoxynucleoside triphosphate (dNTP), 02 lmol l1 of each primer and 15 U DreamTaq DNA polymerase (Fermentas, St. Leon-Rot, Germany). 1 ll of genomic DNA, extracted from 1 ml of an overnight culture using the RTP bacterial DNA kit (Stratec Molecular, Berlin, Germany), was routinely used as template in one PCR reaction. After an initial denaturation step at 94°C for 4 min, the cycling conditions were the following: 30 cycles of denaturation at 94°C for 30 s, primer annealing for 30 s and extension at 72°C for 25 min, followed by a final extension step at 72°C for 10 min. For Hot Start amplification Taq polymerase was added separately after the initial denaturation step at 94°C for 4 min. PCR products were separated by electrophoresis on 18% agarose.
Multiplex PCR for V. vulnificus
Sensitivity (%), specificity (%), negative (NPV) and positive predictive value (PPV) were calculated for each target gene with the following equations: Sensitivityð%Þ ¼100 ðno. of truly positive tested strains= ðno. of truly positive tested strains þ no. of falsely negative tested strainsÞÞ Specificityð%Þ ¼100 ðno. of truly negative tested strains= ðno. of truly negative tested strains þ no. of falsely positive tested strainsÞÞ Positive predictive value (PPV)ð%Þ ¼ 100 ðno. of truly positive tested strains= ðno. of truly positive tested strains þ no. of falsely positive tested strainsÞÞ Negative predictive value (NPV)ð%Þ ¼ 100 ðno. of truly negative tested strains= ðno. of truly negative tested strains þ no. of falsely negative tested strainsÞÞ Acknowledgements This work was supported by the Federal Ministry of Education and Research (VibrioNet, BMBF grant 01KI1015A). Conflict of Interest The authors declare no conflict of interest.
Optimization of multiplex PCR
References
Optimization experiments were conducted with five nanogramm of genomic DNA of 11 V. vulnificus isolates. A gradient PCR was performed to find the optimal annealing temperature allowing simultaneous and specific amplification of six different products. To increase the product yield higher concentrations of MgCl2, dNTPs and Taq polymerase as well as different numbers of PCR cycles were tested. Primer concentrations were increased individually (02–08 lmol l1), when higher band intensities were needed. To decrease the number of unspecific by-products and to increase the yield of specific PCR products at the same time traditional PCR was compared to a Hot Start amplification approach.
Baker-Austin, C., Stockley, L., Rangdale, R. and MartinezUrtaza, J. (2010) Environmental occurrence and clinical impact of Vibrio vulnificus and Vibrio parahaemolyticus: a European perspective. Environ Microbiol Rep 2, 7–18. Baker-Austin, C., Trinanes, J.A., Taylor, N.G.H., Hartnell, R., Siitonen, A. and Martinez-Urtaza, J. (2012) Emerging Vibrio risk at high latitudes in response to ocean warming. Nat Clim Chang 3, 73–77. Bauer, A. and Roervik, L.M. (2007) A novel multiplex PCR for the identification of Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. Lett Appl Microbiol 45, 371–375. Bier, N., Bechlars, S., Diescher, S., Klein, F., Hauk, G., Duty, O., Strauch, E. and Dieckmann, R. (2013) Genotypic diversity and virulence characteristics of clinical and environmental Vibrio vulnificus isolates from the baltic sea region. Appl Environ Microbiol 79, 3570–3581. Bisharat, N., Cohen, D.I., Maiden, M.C., Crook, D.W., Peto, T. and Harding, R.M. (2007) The evolution of genetic structure in the marine pathogen, Vibrio vulnificus. Infect Genet Evol 7, 685–693.
Validation of multiplex PCR and statistical measures Validation of multiplex amplification was performed with a total of 132 bacterial strains, including V. vulnificus (n = 71), other Vibrionaceae (n = 50) and non-Vibrio isolates (n = 11).
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
419
Multiplex PCR for V. vulnificus
N. Bier et al.
Cohen, A.L.V., Oliver, J.D., DePaola, A., Feil, E.J. and Boyd, E.F. (2007) Emergence of a virulent clade of Vibrio vulnificus and correlation with the presence of a 33kilobase genomic island. Appl Environ Microbiol 73, 5553– 5565. Drake, S.L., Whitney, B., Levine, J.F., DePaola, A. and Jaykus, L.A. (2010) Correlation of mannitol fermentation with virulence-associated genotypic characteristics in Vibrio vulnificus isolates from oysters and water samples in the Gulf of Mexico. Foodborne Pathog Dis 7, 97–101. Froelich, B. and Oliver, J. (2011) Orientation of mannitol related genes can further differentiate strains of Vibrio vulnificus possessing the vcgC allele. Adv Stud Biol 3, 151–160. Han, F. and Ge, B. (2010) Multiplex PCR assays for simultaneous detection and characterization of Vibrio vulnificus strains. Lett Appl Microbiol 51, 234–240. Jeong, H.G., Man, H.O., Byoung, S.K., Min, Y.L., Ho, J.H. and Sang, H.C. (2009) The capability of catabolic utilization of N-acetylneuraminic acid, a sialic acid, is essential for Vibrio vulnificus pathogenesis. Infect Immun 77, 3209–3217. Lubin, J.B., Kingston, J.J., Chowdhury, N. and Boyd, E.F. (2012) Sialic acid catabolism and transport gene clusters are lineage specific in Vibrio vulnificus. Appl Environ Microbiol 78, 3407–3415. Nilsson, W.B., Paranjype, R.N., DePaola, A. and Strom, M.S. (2003) Sequence polymorphism of the 16S rRNA gene of Vibrio vulnificus is a possible indicator of strain virulence. J Clin Microbiol 41, 442–446. Oliver, J.D. (2006) Vibrio vulnificus. In The Biology of Vibrios, ed. Thompson, F.L., Austin, B. and Swings, J. pp. 349–366. Washington, DC: ASM Press.
420
Reynaud, Y., Pitchford, S., De Decker, S., Wikfors, G.H. and Brown, C.L. (2013) Molecular typing of environmental and clinical strains of Vibrio vulnificus isolated in the northeastern USA. PLoS ONE 8, e83357. Rosche, T.M., Yano, Y. and Oliver, J.D. (2005) A rapid and simple PCR analysis indicates there are two subgroups of Vibrio vulnificus which correlate with clinical or environmental isolation. Microbiol Immunol 49, 381–389. Thiaville, P.C., Bourdage, K.L., Wright, A.C., Farrell-Evans, M., Garvan, C.W. and Gulig, P.A. (2011) Genotype is correlated with but does not predict virulence of Vibrio vulnificus biotype 1 in subcutaneously inoculated, iron dextran-treated mice. Infect Immun 79, 1194–1207. Vickery, M.C.L., Nilsson, W.B., Strom, M.S., Nordstrom, J.L. and DePaola, A. (2007) A real-time PCR assay for the rapid determination of 16S rRNA genotype in Vibrio vulnificus. J Microbiol Methods 68, 376–384. Warner, E. and Oliver, J.D. (2008a) Population structures of two genotypes of Vibrio vulnificus in oysters (Crassostrea virginica) and seawater. Appl Environ Microbiol 74, 80–85. Warner, E.B. and Oliver, J.D. (2008b) Multiplex PCR assay for detection and simultaneous differentiation of genotypes of Vibrio vulnificus biotype 1. Foodborne Pathog Dis 5, 691–693.
Supporting Information Additional Supporting Information may be found in the online version of this article: Table S1 Other Vibrionaceae and non-Vibrio isolates used for exclusivity tests.
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
Copyright of Letters in Applied Microbiology is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
ORIGINAL ARTICLE
Multiplex PCR for detection of virulence markers of Vibrio vulnificus N. Bier, S. Diescher and E. Strauch Federal Institute for Risk Assessment, National Reference Laboratory for Monitoring Bacteriological Contamination of Bivalve Molluscs, Berlin, Germany
Significance and Impact of the Study: A multiplex PCR for simultaneous detection and characterization of potentially virulent strains of Vibrio vulnificus was developed and validated. Monitoring programs will benefit from this cost and time effective method when screening large strain collections. Application of the multiplex PCR simplifies determination of risks emanating from V. vulnificus in recreational waters or mussel primary production.
Keywords genotyping, markers, methods, polymerase chain reaction, rapid, virulence. Correspondence Eckhard Strauch, Federal Institute for Risk Assessment, Department of Biological Safety, National Reference Laboratory for Monitoring Bacteriological Contamination of Bivalve Molluscs, Max-Dohrn-Str. 8-10, D - 10589 Berlin, Germany. E-mail: [email protected] 2014/2441: received 27 November 2014, revised 12 January 2015 and accepted 13 January 2015 doi:10.1111/lam.12394
Abstract Vibrio vulnificus is a Gram-negative pathogen found in coastal and estuarine waters worldwide that can cause life threatening diseases. Characterization of the vcg (virulence correlated gene) or 16S rRNA alleles is used to distinguish virulent (clinical (C)-type) from presumably avirulent (environmental (E)type) strains. However, some studies reported a significant number of clinical strains belonging to the E-type. In recent years more potential virulence markers have been identified, that are useful for the identification of potentially pathogenic isolates of the E-type. In this study, we successfully combined detection of pathogenicity region XII, nanA and a mannitol fermentation operon with the virulence associated alleles of the 16S rRNA and vcg genes in one multiplex PCR. Additionally, toxR primers for species confirmation and internal amplification control were included. Validation of multiplex amplification was performed with a total of 132 bacterial strains, including V. vulnificus (n = 71), other Vibrionaceae (n = 50) and non-Vibrio isolates (n = 11). Multiplex PCR showed reliable amplification of four of the five virulence markers with a high sensitivity and specificity. Amplification of the 16S rRNA type B allele was not completely reliable with conventional PCR assays, however, the positive predictive value of this marker was 100 %.
Introduction Vibrio vulnificus is a pathogenic bacterium naturally occurring in coastal and estuarine waters worldwide that can cause life-threatening diseases by wound infection or food poisoning (Oliver 2006). High incidences of infection correlate with increased abundances of V. vulnificus in the summer months. But despite the frequent occurrence of this pathogen in seawater and seafood as well as a high number of persons being at risk, the number of reported cases is relatively low (Oliver 2006). This indicates that other factors may exist which either make only few persons vulnerable for infection or enable only few strains to cause infection. Many studies concentrated on 414
finding molecular markers that might help identifying V. vulnificus isolates with a high virulence potential. By multilocus sequence typing (MLST) V. vulnificus isolates can be grouped into two clusters with most of the environmental isolates belonging to cluster I and a higher proportion of clinical isolates in cluster II, indicating a higher virulence potential among strains of the latter cluster (Bisharat et al. 2007; Cohen et al. 2007; Bier et al. 2013; Reynaud et al. 2013). However, several clinical strains were also found in cluster I, indicating that cluster I strains can also cause severe infections. Characterization of V. vulnificus isolates revealed sequence polymorphisms in the virulence correlated gene (vcg type E and C) as well as in the 16S rRNA gene (16S rRNA type A and B) and
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
N. Bier et al.
categorization of V. vulnificus isolates to one of these types is commonly used to discriminate between virulent (clinical (C)-type) and presumably avirulent (environmental (E)-type) strains (Nilsson et al. 2003; Rosche et al. 2005; Vickery et al. 2007). The vcg type C and 16S rRNA type B alleles are described to correlate with the clinical origin of V. vulnificus isolates and with virulence in iron dextran-treated mice, although highly virulent strains belonging to the E-genotype were also reported (Thiaville et al. 2011). In a recent study we found that the majority of clinical isolates of wound infections from the Baltic were of the E-genotype (Bier et al. 2013). But despite the low prevalence of the C-genotype among these clinical strains, the vcgC and 16S rRNA type B alleles were highly predictive for MLST cluster II, which was also reported in other studies (Cohen et al. 2007; Thiaville et al. 2011). We found significant correlations between the clinical origin and some recently discovered potential virulence markers, such as the ability to ferment mannitol (Drake et al. 2010), the presence of pathogenicity region XII (PRXII) (Cohen et al. 2007) and the gene nanA of the sialic acid catabolism region (Jeong et al. 2009; Lubin et al. 2012). Moreover, these markers were present in clinical E-type strains, whose virulence potential would remain undetected by the vcg and 16S rRNA typing scheme (Bier et al. 2013). Similar results were reported shortly afterwards by Reynaud et al. (2013) for clinical strains from the northeastern USA mainly isolated from blood, indicating that the observed correlations are neither geographically restricted to the Baltic Sea region nor occur only in isolates from wound infections. These findings strongly suggest that the presence of the pathogenicity region XII, the nanA gene and genes of the mannitol fermentation operon should additionally be addressed when estimating the pathogenic potential of V. vulnificus isolates found in nonclinical settings such as the environment, retail or mussel primary production. Instead of five individual PCR analyses it would be valuable to perform a combined PCR assay. Therefore the objective of this study was to develop and validate a multiplex PCR for simultaneous detection of five virulence associated genes: 16S rRNA type B allele, vcg type C allele, the nanA gene, pathogenicity region XII and the mannitol fermentation operon. The PCR contained also primers for the V. vulnificus specific toxR gene as species marker and amplification control. Results and discussion Selection of target genes Primers were chosen from the literature to generate PCR products with size differences of approximately 100 bp
Multiplex PCR for V. vulnificus
and higher (Fig. 1). The ability to ferment mannitol can be tested by a PCR targeting a gene within the mannitol fermentation operon, encoding the IIA domain of the mannitol specific phosphotransferase system (manIIA – amplicon size: 243 bp). The amplification of this gene in PCR assays is in complete accordance with biochemical testing for mannitol fermentation (Froelich and Oliver 2011; Bier et al. 2013). For detection of the nanA gene of the sialic acid catabolism cluster different primers were described in the literature (Lubin et al. 2012). The initially chosen primer pair nanA–F/nanA–R, which had been used in singleplex PCRs (amplicon size: 745 bp) (Bier et al. 2013), failed in some strains under multiplex conditions and had to be replaced. The new primer pair rpiR-F/nanA-2R yielded specific products (amplicon size: 1299 bp) giving the same results as obtained in singleplex PCRs with former primers. For detection of PRXII in the multiplex PCR we decided to target VVA1613 encoding a putative chondroitinase AC lyase located on PRXII (amplicon size: 2257 bp) (Cohen et al. 2007). Detection of VVA1613 was in complete accordance with the presence of PRXII in Bier et al. (2013), which was confirmed by several additional PCRs. The species-specific PCR targeting toxR described by Bauer and Rørvik is frequently used for identification of different Vibrio spp. and showed 100% sensitivity and specificity (Bauer and Roervik 2007). The addition of the Vibrio vulnificus-specific primer pair targeting toxR enables specific detection of V. vulnificus and serves simultaneously as internal amplification control. For amplification of the vcg type C allele (amplicon size: 99 bp) and the 16S rRNA type B allele (amplicon size: 839 bp) we added primers described by Warner and Oliver (2008a,b), and successfully used in Han and Ge (2010). Parameter optimization for multiplex PCR Optimization of multiplex PCR was performed using 11 V. vulnificus strains with different virulence characteristics (see Table 1). An optimal annealing temperature of 63°C was determined by performing a gradient PCR with ranging annealing temperatures (54, 57, 60, 62, 63, and 65°C). Performance of multiplex PCR was best with a concentration of MgCl2 of 2 mmol l1, 15 U of Taq polymerase and 30 amplification cycles. Increased concentrations of MgCl2 (3 mmol l1) and Taq polymerase (25 U per reaction) as well as higher cycle numbers (35 cycles) resulted in formation of unspecific products in some strains rather than higher product yields. To improve amplification of vcgC and PRXII the concentration of dNTPs was increased up to 3 mmol l1. Satisfying results were achieved after further increasing the concentrations of primer pairs vcgC-F/vcgC-R and
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
415
Multiplex PCR for V. vulnificus
N. Bier et al.
M
1
2
3
4
5
6
7
8
9
10 PRXII
2 kb
nanA
1·2 kb 1 kb
16S rRNA-type B allele 500 bp
toxR manIIA
100 bp
vcg-type C allele
Figure 1 Electrophoretic separation of multiplex PCR products obtained from different Vibrio vulnificus isolates in 18 % agarose: M: GeneRuler 100 bp Plus DNA Ladder (Fermentas, St. Leon-Rot, Germany); lane 1 to 10: V. vulnificus isolates VN-0094, CMCP6, VN-3110, VN-3910, VN-3369, VN-3478, VN-2813, VN-3378, VN-3461 and VN-3927 (strains are marked with ¶ in Table 1.). Amplicon sizes are: PRXII (2257 bp), nanA (1299 bp), 16S rRNA type B allele (839 bp), toxR (435 bp), ManIIA (243 bp) and vcg type C allele (99 bp). Table 1 Seventy one Vibrio vulnificus strains used in this study and their virulence characteristics Virulence characteristics
Multiplex PCR results
V. vulnificus strain ID
No.
PRXII
nanA
16S rRNA type
manIIA
vcg type
PRXII
nanA
16S-B§
toxR
manIIA
vcgC
VN-0010, VN-0016, VN-0126, VN-0130, VN-0132, VN-0133, VN-0206, VN-3972* VN-0119, VN-2961 VN-0227, VN-0288 VN-0207 VN-0105, VN-3110¶, VN-3135* VN-0100, VN-0104 VN-3910¶, VN-3922, VN-3925 VN-3538 VN-0092, VN-0112 VN-0094*¶, VN-0095, VN-0120, VN-0128, VN-0129, MO6-24, CMCP6*¶, VN-3379 VN-0096*, VN-0131* VN-0067 VN-3978* VN-0102 VN-0108, VN-3378¶ VN-2813¶ VN-3368*, VN-3369¶, VN-3478¶ VN-0127* VN-0097, VN-0098, ATCC33149, VN-0101*, VN-0103, VN-0125, VN-0143, VN-0204, VN-0205, VN-0208, VN-0209, VN-0235, VN-0239, VN-0243, VN-0251, VN-0260, VN-0264, VN-0266, VN-0270, VN-0274, VN-0275, VN-0276, VN-0277, VN-0280, VN-3461¶, VN-3909*, VN-3927¶
8
+
A
+
E
+
+
+
2 2 1 3 2 3 1 2 8
+ + + + + + + + +
+ + + + + + +
B B AB A B AB B B B
+ + + + +
E E E E E E E E C
+ + + + + + + + +
+ + + + + + +
† + † + + + † +
+ + + + + + + + +
+ + + + +
+
2 1 1 1 2 1 3 1 27
+
+ + + + +
A AB A AB A A B A A
+ + + +
E E E E E E C E E
+
+ + + + +
† † +
+ + + + + + + + +
+ + (+)‡ + +
+
*Strains used for optimization of multiplex PCR. †Falsely negative. ‡Falsely positive. §16S-B is a short form for 16S rRNA type B. ¶Strains shown in Figure 1.
416
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
N. Bier et al.
Multiplex PCR for V. vulnificus
VVA1612F/VVA1613R up to 06 and 08 lmol l1, respectively. To prevent nonspecific primer annealing we performed a Hot Start amplification which resulted in higher band intensities of specific products. Moreover Hot Start amplification, as well as the use of freshly prepared genomic DNA, proved necessary for reliable amplification of all target genes in each of the 11 V. vulnificus strains used for optimization. Optimized protocol for multiplex PCR Optimized cycling conditions were 30 cycles of the standard cycling steps in a Hot Start approach: 94°C for 4 min, 30 cycles with denaturation at 94°C for 30 s, primer annealing at 63°C for 30 s and extension at 72°C for 25 min, followed by a final extension step at 72°C for 10 min. Multiplex PCR reactions were performed in a volume of 25 ll with 19 PCR buffer (2 mmol l1 MgCl2), 03 mmol l1 of each dNTP, and 15 U DreamTaq DNA polymerase with 1 ll of genomic DNA. The primer concentrations were as follows: 08 lmol l1 of PRXII primers (VVA1612F/VVA1613R), 06 lmol l1 of vcgC primers (vcgC-F/vcgC-R) and 02 lmol l1 of all other primers (rpiR-F/nanA-2R, 16S B-F1/16S B-R1, UtoxF/VvtoxR, Man IIA F/Man IIA R). Specificity of multiplex PCR For validation of multiplex PCR additional 60 V. vulnificus isolates, together with 50 other Vibrionaceae and 11 non-Vibrio isolates were tested using the optimized multiplex PCR protocol. Sensitivity (%), specificity (%), negative (NPV) and positive predictive value (PPV) were calculated for each target gene individually from the multiplex PCR results of the V. vulnificus strains (Table 2). PRXII, nanA, vcgC, manIIA: PRXII, the gene nanA and the vcgC-allele could be detected with a sensitivity and specificity of 100%. One strain (VN–0102) showed a weak unspecific band with the size of the manIIA product
resulting in a specificity of 975% and a positive predictive value of 969% for detection of manIIA. 16S rRNA type B: Amplification of the 16S rRNA type B allele with primer pair 16S B-F1/16S B-R1 was possible in most strains, but failed in seven strains (VN-0067, VN0092, VN-0102, VN-0112, VN-0119, VN-0207 and VN2961). These strains remained falsely negative, even when tested in singleplex PCR. This leads to a decreased sensitivity of 731 % and a negative predictive value of 865 % for detection of the 16S rRNA type B allele. Because of the decreased binding efficiency of this primer pair, we designed new primers for amplification of 16S rRNA type B allele (amplicon size: 317 bp). The use of the new primer pair Vv-16SB-F1/Vv-16SB-R2 enabled amplification in six of the seven falsely negative tested strains, increasing the sensitivity to 962%. However, we decided to exclude these primers from the multiplex PCR since they also led to amplification of the 16S rRNA type A allele in four strains, resulting in a decreased specificity of 911% and a positive predictive value of 862%. These results imply that the sequence polymorphisms in the 16S RNA type A and type B alleles are not sufficient for reliable discrimination by traditional PCR compared to 16S rRNA typing by the real-time PCR assay described by Vickery et al. (2007). We therefore suggest to perform the multiplex PCR with primer pair 16S B-F1/ 16S B-R1 (Warner and Oliver 2008b) for screening of large strain collections since in this case a positive predictive value of 100 % was achieved. Strains that had been tested negative for 16S rRNA type B allele in the multiplex PCR could additionally be tested in a second step with real-time PCR for 16S rRNA typing. toxR: In the multiplex PCR a reliable amplification of the V. vulnifiucs specific toxR gene was achieved. In all tested V. vulnificus strains the specific product was generated (100% sensitivity), while this was not the case in nontarget Vibrionaceae and non-Vibrio strains (100% specificity). In few cases the multiplex PCR generated weak diverse patterns of unspecific products with other Vibrionaceae or non-Vibrio strains (data not shown), which seems
Table 2 Validation of the performance of the multiplex PCR for individual target genes
Target gene
No. of truly positive strains (n)
No. of truly negative strains (n)
Sensitivity (%)
Specificity (%)
Positive predictive value (PPV) (%)
Negative predictive value (NPV) (%)
PRXII nanA 16S rRNA type B manIIA vcgC toxR
34 29 26 31 11 71
37 42 45 40 60 61*
34/34 29/29 19/26 31/31 11/11 71/71
37/37 42/42 45/45 39/40 60/60 61/61
34/34 29/29 19/19 31/32 11/11 71/71
37/37 42/42 45/52 39/39 60/60 61/61
(100) (100) (731) (100) (100) (100)
(100) (100) (100) (975) (100) (100)
(100) (100) (100) (969) (100) (100)
(100) (100) (865) (100) (100) (100)
*For the species specific toxR PCR 61 other Vibrionaceae and non-Vibrio isolates were included for the calculation.
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
417
Multiplex PCR for V. vulnificus
N. Bier et al.
inevitable given the number of different primer pairs in one PCR reaction. Therefore, band patterns should only be interpreted when the specific toxR product and discrete bands characteristic for V. vulnificus isolates are observed. Application of multiplex PCR So far two multiplex PCR assays have been described for detection of V. vulnificus isolates and simultaneous determination of the 16S rRNA, vcg or CPS types (Warner and Oliver 2008b; Han and Ge 2010). In a recent study (Bier et al. 2013) each clinical V. vulnificus strain was characterized by possessing at least one of five virulence markers: vcg type C allele, 16SrRNA type B allele, PRXII, nanA, or the ability to ferment mannitol, which motivated us to develop a PCR assay for simultaneous detection of these markers. We successfully achieved amplification of these five potential virulence markers in one multiplex PCR, which substantially simplifies characterization of potential pathogenic V. vulnificus isolates. The addition of species-specific primers allows confirmation of the identity of V. vulnificus and serves simultaneously as an amplification control. The multiplex PCR assay validated in this study is the first one to detect additional virulence-associated markers (Bier et al. 2013; Reynaud et al. 2013) besides the determination of vcg and 16S rRNA types. In the United States V. vulnificus is the leading cause of seafood related death cases (Oliver 2006) while in the Baltic all known cases occurred after contact with seawater
(Bier et al. 2013). In recent years, concerns aroused that infections caused by this pathogen will rise in the future due to global warming and the demographic change of the human population (Baker-Austin et al. 2010, 2012). For these reasons monitoring programs for V. vulnificus at bathing locations or in the production of bivalve molluscs could be demanded by public health authorities. The multiplex PCR described in this study offers a valuable tool to efficiently cope with large numbers of sampled strains that will inevitably be generated during monitoring programs. Materials and methods Bacterial strains Bacterial strains used in this study are listed in Table 1 and Table S1. A total of 132 bacterial strains, including V. vulnificus (n = 71), other Vibrionaceae (n = 50) and non-Vibrio isolates (n = 11) were used to assess the specificity of the multiplex PCR. Vibrio vulnificus isolates comprised of 53 isolates of different origin, already characterized and published by Bier et al. (2013) and 18 additional environmental biotype 1 isolates from our strain collection. The identities of all V. vulnificus isolates had been confirmed by a species-specific toxR PCR (Bauer and Roervik 2007) and MLST according to Bisharat et al. (2007). All V. vulnificus isolates were characterized by single PCR or real-time PCR for the five different virulence markers as described (Rosche et al. 2005; Cohen et al.
Table 3 Primers used in this study Primer
Gene target/designation
Sequence (50 to 30 )
Amplicon (bp)
Reference
VVA1612F* VVA1613R*
PRXII, 5‘flanking region PRXII, putative chondroitinase AC lyase Sialic acid catabolism cluster Sialic acid catabolism cluster 16S rRNA type B allele 16S rRNA type B allele Sialic acid catabolism cluster Sialic acid catabolism cluster toxR of V. vulnificus toxR of V. vulnificus 16S rRNA type B allele 16S rRNA type B allele Enzyme IIA of mannitol fermentation operon Enzyme IIA of mannitol fermentation operon vcg type C allele vcg type C allele
ACCCTGATCGTTGGCTACTC GGAGCGGTGTGATGGTGTTG
2257
Cohen et al. (2007) Cohen et al. (2007)
TACGCAAGCCCAGCGGCATG TTGCCACTTCCGCGATCGGG GCCTACGGGCCAAAGAGG CCTGCGTCTCCGCTGGCT TKATCGCCGCTCCYCATACA GCAACGCCACCGTATTCAAC GASTTTGTTTGGCGYGARCAAGGTT AACGGAACTTAGACTCCGAC TAATACCGCATGATGCCTACGGGC AACGTCAAATGATGCCGCTATTAACGAC GATGTTGGTGAACAACTTCTCTGC
1299
Lubin et al. (2012) Lubin et al. (2012) Warner and Oliver (2008a) Warner and Oliver (2008a) Bier et al. (2013) Lubin et al. (2012) Bauer and Roervik (2007) Bauer and Roervik (2007) This study This study Froelich and Oliver (2011)
rpiR-F* nanA-2R* 16S B-F1* 16S B-R1* nanA-F nanA-R UtoxF* VvtoxR* Vv-16SB-F1 Vv-16SB-R2 Man IIA F* Man IIA R* vcgC-F* vcgC-R*
839 745 435 317 243
TCTGAAGCCTGTTGGATGCC AGCTGCCGATAGCGATCT TGAGCTAACGCGAGTAGTGAG
Froelich and Oliver (2011) 99
Warner and Oliver (2008b) Warner and Oliver (2008b)
*Primers used in multiplex PCR.
418
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
N. Bier et al.
2007; Vickery et al. 2007; Froelich and Oliver 2011; Lubin et al. 2012; Bier et al. 2013): vcg, 16S rDNA, nanA, pathogenicity region XII and manIIA, of the mannitol fermentation operon. Biochemical testing of mannitol fermentation was carried out according to Bier et al. (2013). Primers and standard PCR conditions The PCR primers, target genes and amplicon sizes used are shown in Table 3. Primers were synthesized by Metabion International AG (Martinsried, Germany). Standard PCR reactions were performed using a Mastercycler EP gradient (Eppendorf, Hamburg, Germany) in a volume of 25 ll with 19 PCR buffer (2 mmol l1 MgCl2), 02 mmol l1 of each deoxynucleoside triphosphate (dNTP), 02 lmol l1 of each primer and 15 U DreamTaq DNA polymerase (Fermentas, St. Leon-Rot, Germany). 1 ll of genomic DNA, extracted from 1 ml of an overnight culture using the RTP bacterial DNA kit (Stratec Molecular, Berlin, Germany), was routinely used as template in one PCR reaction. After an initial denaturation step at 94°C for 4 min, the cycling conditions were the following: 30 cycles of denaturation at 94°C for 30 s, primer annealing for 30 s and extension at 72°C for 25 min, followed by a final extension step at 72°C for 10 min. For Hot Start amplification Taq polymerase was added separately after the initial denaturation step at 94°C for 4 min. PCR products were separated by electrophoresis on 18% agarose.
Multiplex PCR for V. vulnificus
Sensitivity (%), specificity (%), negative (NPV) and positive predictive value (PPV) were calculated for each target gene with the following equations: Sensitivityð%Þ ¼100 ðno. of truly positive tested strains= ðno. of truly positive tested strains þ no. of falsely negative tested strainsÞÞ Specificityð%Þ ¼100 ðno. of truly negative tested strains= ðno. of truly negative tested strains þ no. of falsely positive tested strainsÞÞ Positive predictive value (PPV)ð%Þ ¼ 100 ðno. of truly positive tested strains= ðno. of truly positive tested strains þ no. of falsely positive tested strainsÞÞ Negative predictive value (NPV)ð%Þ ¼ 100 ðno. of truly negative tested strains= ðno. of truly negative tested strains þ no. of falsely negative tested strainsÞÞ Acknowledgements This work was supported by the Federal Ministry of Education and Research (VibrioNet, BMBF grant 01KI1015A). Conflict of Interest The authors declare no conflict of interest.
Optimization of multiplex PCR
References
Optimization experiments were conducted with five nanogramm of genomic DNA of 11 V. vulnificus isolates. A gradient PCR was performed to find the optimal annealing temperature allowing simultaneous and specific amplification of six different products. To increase the product yield higher concentrations of MgCl2, dNTPs and Taq polymerase as well as different numbers of PCR cycles were tested. Primer concentrations were increased individually (02–08 lmol l1), when higher band intensities were needed. To decrease the number of unspecific by-products and to increase the yield of specific PCR products at the same time traditional PCR was compared to a Hot Start amplification approach.
Baker-Austin, C., Stockley, L., Rangdale, R. and MartinezUrtaza, J. (2010) Environmental occurrence and clinical impact of Vibrio vulnificus and Vibrio parahaemolyticus: a European perspective. Environ Microbiol Rep 2, 7–18. Baker-Austin, C., Trinanes, J.A., Taylor, N.G.H., Hartnell, R., Siitonen, A. and Martinez-Urtaza, J. (2012) Emerging Vibrio risk at high latitudes in response to ocean warming. Nat Clim Chang 3, 73–77. Bauer, A. and Roervik, L.M. (2007) A novel multiplex PCR for the identification of Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. Lett Appl Microbiol 45, 371–375. Bier, N., Bechlars, S., Diescher, S., Klein, F., Hauk, G., Duty, O., Strauch, E. and Dieckmann, R. (2013) Genotypic diversity and virulence characteristics of clinical and environmental Vibrio vulnificus isolates from the baltic sea region. Appl Environ Microbiol 79, 3570–3581. Bisharat, N., Cohen, D.I., Maiden, M.C., Crook, D.W., Peto, T. and Harding, R.M. (2007) The evolution of genetic structure in the marine pathogen, Vibrio vulnificus. Infect Genet Evol 7, 685–693.
Validation of multiplex PCR and statistical measures Validation of multiplex amplification was performed with a total of 132 bacterial strains, including V. vulnificus (n = 71), other Vibrionaceae (n = 50) and non-Vibrio isolates (n = 11).
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
419
Multiplex PCR for V. vulnificus
N. Bier et al.
Cohen, A.L.V., Oliver, J.D., DePaola, A., Feil, E.J. and Boyd, E.F. (2007) Emergence of a virulent clade of Vibrio vulnificus and correlation with the presence of a 33kilobase genomic island. Appl Environ Microbiol 73, 5553– 5565. Drake, S.L., Whitney, B., Levine, J.F., DePaola, A. and Jaykus, L.A. (2010) Correlation of mannitol fermentation with virulence-associated genotypic characteristics in Vibrio vulnificus isolates from oysters and water samples in the Gulf of Mexico. Foodborne Pathog Dis 7, 97–101. Froelich, B. and Oliver, J. (2011) Orientation of mannitol related genes can further differentiate strains of Vibrio vulnificus possessing the vcgC allele. Adv Stud Biol 3, 151–160. Han, F. and Ge, B. (2010) Multiplex PCR assays for simultaneous detection and characterization of Vibrio vulnificus strains. Lett Appl Microbiol 51, 234–240. Jeong, H.G., Man, H.O., Byoung, S.K., Min, Y.L., Ho, J.H. and Sang, H.C. (2009) The capability of catabolic utilization of N-acetylneuraminic acid, a sialic acid, is essential for Vibrio vulnificus pathogenesis. Infect Immun 77, 3209–3217. Lubin, J.B., Kingston, J.J., Chowdhury, N. and Boyd, E.F. (2012) Sialic acid catabolism and transport gene clusters are lineage specific in Vibrio vulnificus. Appl Environ Microbiol 78, 3407–3415. Nilsson, W.B., Paranjype, R.N., DePaola, A. and Strom, M.S. (2003) Sequence polymorphism of the 16S rRNA gene of Vibrio vulnificus is a possible indicator of strain virulence. J Clin Microbiol 41, 442–446. Oliver, J.D. (2006) Vibrio vulnificus. In The Biology of Vibrios, ed. Thompson, F.L., Austin, B. and Swings, J. pp. 349–366. Washington, DC: ASM Press.
420
Reynaud, Y., Pitchford, S., De Decker, S., Wikfors, G.H. and Brown, C.L. (2013) Molecular typing of environmental and clinical strains of Vibrio vulnificus isolated in the northeastern USA. PLoS ONE 8, e83357. Rosche, T.M., Yano, Y. and Oliver, J.D. (2005) A rapid and simple PCR analysis indicates there are two subgroups of Vibrio vulnificus which correlate with clinical or environmental isolation. Microbiol Immunol 49, 381–389. Thiaville, P.C., Bourdage, K.L., Wright, A.C., Farrell-Evans, M., Garvan, C.W. and Gulig, P.A. (2011) Genotype is correlated with but does not predict virulence of Vibrio vulnificus biotype 1 in subcutaneously inoculated, iron dextran-treated mice. Infect Immun 79, 1194–1207. Vickery, M.C.L., Nilsson, W.B., Strom, M.S., Nordstrom, J.L. and DePaola, A. (2007) A real-time PCR assay for the rapid determination of 16S rRNA genotype in Vibrio vulnificus. J Microbiol Methods 68, 376–384. Warner, E. and Oliver, J.D. (2008a) Population structures of two genotypes of Vibrio vulnificus in oysters (Crassostrea virginica) and seawater. Appl Environ Microbiol 74, 80–85. Warner, E.B. and Oliver, J.D. (2008b) Multiplex PCR assay for detection and simultaneous differentiation of genotypes of Vibrio vulnificus biotype 1. Foodborne Pathog Dis 5, 691–693.
Supporting Information Additional Supporting Information may be found in the online version of this article: Table S1 Other Vibrionaceae and non-Vibrio isolates used for exclusivity tests.
Letters in Applied Microbiology 60, 414--420 © 2015 The Society for Applied Microbiology
Copyright of Letters in Applied Microbiology is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
