Parasitol Res (2014) 113:527–531 DOI 10.1007/s00436-013-3684-9
ORIGINAL PAPER
Multiplex PCR for diagnosis of Theileria uilenbergi , Theileria luwenshuni , and Theileria ovis in small ruminants Xiao Zhang & Zhijie Liu & Jifei Yang & Ze Chen & Guiquan Guan & Qiaoyun Ren & Aihong Liu & Jianxun Luo & Hong Yin & Youquan Li
Received: 15 August 2013 / Accepted: 4 November 2013 / Published online: 17 November 2013 # Springer-Verlag Berlin Heidelberg 2013
Abstract Infections with Theileria sp. may cause significant economic losses to the sheep industry. Species identification based on microscopic examination is difficult, and more suitable methods are required for the rapid detection and identification of Theileria sp, in clinical specimens. In this study, a multiplex polymerase chain reaction (mPCR) assay was developed to simultaneously identify three individual Theileria species in small ruminants. Three pairs of specific, sensitive primers were designed on the basis of the 5.8S ribosomal RNA gene (Theileria luwenshuni and Theileria ovis) and the 18S ribosomal RNA gene (Theileria uilenbergi) to generate target products of 303, 884, and 530 bp, respectively. Standard DNA for each of the three species was extracted from blood recovered from infected sheep, and a preliminary study was conducted on 56 sheep to verify the reliability of the system. Optimal PCR conditions, including primer concentration, annealing time, and the number of amplification cycles, were established. The assay sensitivity under these conditions was 10−3 % parasitemia, and its specificity was 100 %. The X. Zhang : Z. Liu : J. Yang : Z. Chen : G. Guan : Q. Ren : A. Liu : J. Luo : H. Yin : Y. Li (*) State Key Laboratory of Veterinary Etiological Biology, Xujiaping 1, Lanzhou, Gansu 730046, People’s Republic of China e-mail: [email protected] Y. Li e-mail: [email protected] X. Zhang : Z. Liu : J. Yang : Z. Chen : G. Guan : Q. Ren : A. Liu : J. Luo : H. Yin : Y. Li Key Laboratory of Veterinary Parasitology of Gansu Province, Xujiaping 1, Lanzhou, Gansu 730046, People’s Republic of China X. Zhang : Z. Liu : J. Yang : Z. Chen : G. Guan : Q. Ren : A. Liu : J. Luo : H. Yin : Y. Li Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Science, Xujiaping 1, Lanzhou, Gansu 730046, People’s Republic of China
results of the study suggest that mPCR represents a simple, efficient test method as a practical alternative for the rapid detection and identification of Theileria species in small ruminants.
Introduction Theileria parasites are tick-borne pathogens, responsible for diseases which impair the development and productivity of the livestock industry, and result in severe economic losses. Theileria was first discovered in Egypt in 1914 (Littlewood 1915). In China, theileriosis was first reported in sheep and goats by Yang et al. (1958) in Sichuan Province. Since then, there have been reports from several Chinese provinces, including Qinghai, Gansu, Liaoning, Inner Mongolia, Shanxi, and Ningxia (Yang et al. 1958; Wang et al. 1980; Luo and Yin 1997). More recently, Theileria spp. were reported in Xinjiang (Li et al. 2009) and Hubei provinces (Ge et al. 2011; Li et al. 2012). To date, six Theileria spp. have been recognized; Theileria lestoquardi , Theileria luwenshuni , Theileria uilenbergi , Theileria ovis , Theileria recomdita , and Theileria separata (Ahmed et al. 2006; Schnittger et al. 2003; Yin et al. 2007), of which only T. uilenbergi , T. luwenshuni, and T. ovis have been reported in China (Yin et al. 2007; Li et al. 2009, 2010) Smears of these three parasite species are presented in Fig. 1. Each Theileria sp. has its own biological characteristics, pathogenicity, and ecological and regional distribution. Generally, the diagnosis of theileriosis is based on the detection of merozoites in blood smears and from observations of clinical symptoms (Ahmed et al. 2002). Unfortunately, this method requires highly trained clinicians and cannot be used for species identification. Currently, Theileria species identification relies mainly on single polymerase chain reaction (PCR) and reverse line blot
528
Parasitol Res (2014) 113:527–531
Fig. 1 Microscopic observation of three Theileria sp. a T. luwenshuni, b T. uilenbergi, and c T. ovis
(RLB) hybridization assays based on the 18S ribosomal RNA gene (Yin et al. 2008). Unfortunately, these methods are time consuming and costly for the analysis of large numbers of samples. Multiplex PCR (mPCR) assay is a variant of single PCR and overcomes these hurdles using a mixture of specific primers in a single step (Edwards and Gibbs 1994). The objective of this study was to establish an mPCR assay for the simultaneous and accurate identification of three Theileria species in small ruminants.
were as follows: T. luwenshuni , AY262117, AY262118, AY262119, JF719831, JF719832, and JF719833; T. uilenbergi , AY262116, AY262120, AY262121, and JF719835; and T. ovis, AY672756 and FJ603460. Specific primer sets with similar annealing temperatures were designed with Primer 5.0 on the basis of the 5.8S and 18S rRNA gene sequences of the three Theileria species. The specific primers were synthesized by GenScript and verified bioinformatically by an Oligo 6.0 programmer. The sizes of the expected products and corresponding target genes are provided in Table 1.
Materials and methods PCR amplification and detection Positive control samples Theileria-negative sheep from Jingtai County were infected with either T. luwenshuni (Weiyuan), T. uilenbergi (Longde), or T. ovis (Kashi), and the blood samples recovered from these sheep were used as positive controls. Control species were typed with the primer sets Tluw 310/Tluw 680, specific to T. luwenshuni, and Tuil 310/Tuil 680, specific to T. uilenbergi (Yin et al. 2008). DNA was extracted from control samples using a blood core kit (QIAGEN, Germany) following the manufacturer's protocol, and the DNA yield was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).
Amplification can be influenced by many factors, including annealing temperature, primer concentration, and the number of amplification cycles. Gradient PCR was used to establish the optimum reaction conditions for each of the parameters as listed: temperature, 50, 52, 56, 58, 59, and 60 °C; primer concentration, 1, 5, 10, 15, and 20 pM; and number of amplification cycles, 30, 35, and 40. mPCR specificity and sensitivity
Several Theileria spp. genes were retrieved from GenBank and aligned by MEGA 5.1. The GenBank accession numbers
BLAST analysis was conducted by NCBI to assess mPCR specificity. mPCR was performed using three primer mixtures against DNA from the positive controls (T. luwenshuni, T. uilenbergi , and T. ovis), three other Theileria species (Theileria sergenti , Theileria annulata , and Theileria sinensis), and the related species Babesia bovis, Babesia sp. (Xinjiang), and Babesia motasi.
Table 1 Theileria spp. primer sets
Primer design
Parasite
Target ribosomal RNA gene
Primer sequence (5′–3′)
Expected product size (bp)
T. luwenshuni
5.8S
303
T. uilenbergi
18S
T. ovis
5.8S
GATGTGTTGGTTGAGGGTGCTATG CGTCAATCACAACCCGATACTTTAC TCTCGCATTAAGGCCTCCGGCT TCCAACGGATGGTAGCCTCGCA ACGATTCTATTTAGCAGGTT TCCATCACCCAATGTTTC
530 884
Parasitol Res (2014) 113:527–531
529
The mPCR assay was standardized using DNA extracted from the blood of the positive controls. Four sheep were used to generate three separate dilution series of infected blood and one uninfected blood. When the piroplasm parasite reached 1 %, the infected blood was collected using an EDTA-K2 vacuette tube (Greiner Bio-one GmbH). Infected blood was mixed and diluted with negative blood to give a tenfold dilution series of 10−1 to 10−3 % parasitemia (D’Oliveira et al. 1995). The mPCR assay was used for analysis.
Results
Fig. 2 mPCR specificity. Lanes M , DL2000 DNA marker; 1 , T. sergenti; 2, T. annulata; 3, T. sinensis; 4, B. bovine; 5, Babesia sp. (Xinjiang); 6, B. motasi; 7, T. luwenshuni; 8, T. uilenbergi; 9, T. ovis; and 10, combined T. luwenshuni, T. ovis, and T. uilenbergi
mPCR optimization An annealing temperature of 59 °C, primer concentrations of 10, 10, and 15 pM for T. luwenshuni, T. uilenbergi, and T. ovis, respectively, and 35 amplification cycles were selected as optimal for mPCR. The optimized PCR analyses were carried out in a final volume of 25 μl, including 3 μl 10× PCR buffer (Takara, Japan), 2 μl dNTPs (Takara), 1.2 μl ternary primer mixtures (Table 1), 0.3 μl rTaq DNA polymerase (Takara), and 18.5 μl distilled water. Amplification was carried out in a Mastercycler® (Eppendorf, Germany) with denaturation at 94 °C for 3 min followed by 35 cycles of 94 °C for 40 s, 59 °C for 1 min and 10 s, and 72 °C for 1 min, with a final extension step at 72 °C for 10 min, and held at 4 °C. The PCR products were electrophoresed on 1 % (w /v) agarose gel and visualized in a gel imaging system (Peiqing Scientific, Shanghai, China).
mPCR application to samples collected in the field To confirm the reliability of mPCR, 56 sheep samples collected from Zhouqu and Kashi were tested for the presence of Theileria spp., and the results were confirmed by DNA sequencing. The prevalence of T. luwenshuni, T. uilenbergi, and T. ovis was 67, 24, and 0 % in Zhouqu, respectively, and coinfection with T. luwenshuni and T. uilenbergi was 24 %. In
mPCR specificity Using piroplasm DNA to confirm cross reactivity among the mPCR primer sets, the specific products obtained were 884 bp for T. ovis , 530 bp for T. uilenbergi , and 303 bp for T. luwenshuni (Fig. 2). Nontarget species DNA displayed no evidence of fragment amplification or competition, indicating that the primer pairs used in this study were species specific and that the reaction products were distinguishable by gel electrophoresis.
mPCR sensitivity The results for mPCR sensitivity are shown in Fig. 3. Blood dilutions of 1 to 10−2 % parasitemia are clearly positive, and 10−3 % parasitemia is the lower limit of detection for all three species. These results demonstrate that the assay is sensitive to the three Theileria species tested.
Fig. 3 mPCR sensitivity. Lanes M, DL2000 DNA marker. Lanes 1–4, co-infection with T. luwenshuni, T. uilenbergi, and T. ovis, and at 1, 0.1, 0.01, and 10−3 % parasitemia, respectively
530
Kashi, the prevalence of T. luwenshuni, T. uilenbergi, and T. ovis was 0, 0, and 83 %, respectively. The amplified sequences were identical with published entries in GenBank.
Discussion Microscopic examination is traditionally used in cases of theileriosis, but it does not allow for the identification of individual Theileria species or the reliable detection of low levels of parasitemia. Single PCR can overcome these limitations, but most of the available diagnostic methods solely target a single pathogen. Real-time PCR has gained considerable popularity, but it still remains expensive for routine diagnosis in some developing countries. In this study, a specific, sensitive, inexpensive, single-step mPCR assay using three primer sets specific for the detection and identification of T. luwenshuni (303 bp), T. uilenbergi (530 bp), and T. ovis (884 bp ) was developed and tested. When using methods based on genomic amplification, the design of highly specific primers is essential. Previous studies indicate that the 18S rRNA gene and 5.8S rRNA gene are conserved amongst protozoans and therefore a specific target for the detection of Theileria spp. (Yin et al. 2008). In the present study, the mPCR uses three sets of primers, which are based on the 18S rRNA and 5.8S rRNA genes, have successfully amplified all target genes, and are absent from other related species. In addition, all combinations of primer pairs should be checked to avoid potential primer cross dimers, and the distance between amplicons must be large (i.e., >30 bp for fragments,
ORIGINAL PAPER
Multiplex PCR for diagnosis of Theileria uilenbergi , Theileria luwenshuni , and Theileria ovis in small ruminants Xiao Zhang & Zhijie Liu & Jifei Yang & Ze Chen & Guiquan Guan & Qiaoyun Ren & Aihong Liu & Jianxun Luo & Hong Yin & Youquan Li
Received: 15 August 2013 / Accepted: 4 November 2013 / Published online: 17 November 2013 # Springer-Verlag Berlin Heidelberg 2013
Abstract Infections with Theileria sp. may cause significant economic losses to the sheep industry. Species identification based on microscopic examination is difficult, and more suitable methods are required for the rapid detection and identification of Theileria sp, in clinical specimens. In this study, a multiplex polymerase chain reaction (mPCR) assay was developed to simultaneously identify three individual Theileria species in small ruminants. Three pairs of specific, sensitive primers were designed on the basis of the 5.8S ribosomal RNA gene (Theileria luwenshuni and Theileria ovis) and the 18S ribosomal RNA gene (Theileria uilenbergi) to generate target products of 303, 884, and 530 bp, respectively. Standard DNA for each of the three species was extracted from blood recovered from infected sheep, and a preliminary study was conducted on 56 sheep to verify the reliability of the system. Optimal PCR conditions, including primer concentration, annealing time, and the number of amplification cycles, were established. The assay sensitivity under these conditions was 10−3 % parasitemia, and its specificity was 100 %. The X. Zhang : Z. Liu : J. Yang : Z. Chen : G. Guan : Q. Ren : A. Liu : J. Luo : H. Yin : Y. Li (*) State Key Laboratory of Veterinary Etiological Biology, Xujiaping 1, Lanzhou, Gansu 730046, People’s Republic of China e-mail: [email protected] Y. Li e-mail: [email protected] X. Zhang : Z. Liu : J. Yang : Z. Chen : G. Guan : Q. Ren : A. Liu : J. Luo : H. Yin : Y. Li Key Laboratory of Veterinary Parasitology of Gansu Province, Xujiaping 1, Lanzhou, Gansu 730046, People’s Republic of China X. Zhang : Z. Liu : J. Yang : Z. Chen : G. Guan : Q. Ren : A. Liu : J. Luo : H. Yin : Y. Li Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Science, Xujiaping 1, Lanzhou, Gansu 730046, People’s Republic of China
results of the study suggest that mPCR represents a simple, efficient test method as a practical alternative for the rapid detection and identification of Theileria species in small ruminants.
Introduction Theileria parasites are tick-borne pathogens, responsible for diseases which impair the development and productivity of the livestock industry, and result in severe economic losses. Theileria was first discovered in Egypt in 1914 (Littlewood 1915). In China, theileriosis was first reported in sheep and goats by Yang et al. (1958) in Sichuan Province. Since then, there have been reports from several Chinese provinces, including Qinghai, Gansu, Liaoning, Inner Mongolia, Shanxi, and Ningxia (Yang et al. 1958; Wang et al. 1980; Luo and Yin 1997). More recently, Theileria spp. were reported in Xinjiang (Li et al. 2009) and Hubei provinces (Ge et al. 2011; Li et al. 2012). To date, six Theileria spp. have been recognized; Theileria lestoquardi , Theileria luwenshuni , Theileria uilenbergi , Theileria ovis , Theileria recomdita , and Theileria separata (Ahmed et al. 2006; Schnittger et al. 2003; Yin et al. 2007), of which only T. uilenbergi , T. luwenshuni, and T. ovis have been reported in China (Yin et al. 2007; Li et al. 2009, 2010) Smears of these three parasite species are presented in Fig. 1. Each Theileria sp. has its own biological characteristics, pathogenicity, and ecological and regional distribution. Generally, the diagnosis of theileriosis is based on the detection of merozoites in blood smears and from observations of clinical symptoms (Ahmed et al. 2002). Unfortunately, this method requires highly trained clinicians and cannot be used for species identification. Currently, Theileria species identification relies mainly on single polymerase chain reaction (PCR) and reverse line blot
528
Parasitol Res (2014) 113:527–531
Fig. 1 Microscopic observation of three Theileria sp. a T. luwenshuni, b T. uilenbergi, and c T. ovis
(RLB) hybridization assays based on the 18S ribosomal RNA gene (Yin et al. 2008). Unfortunately, these methods are time consuming and costly for the analysis of large numbers of samples. Multiplex PCR (mPCR) assay is a variant of single PCR and overcomes these hurdles using a mixture of specific primers in a single step (Edwards and Gibbs 1994). The objective of this study was to establish an mPCR assay for the simultaneous and accurate identification of three Theileria species in small ruminants.
were as follows: T. luwenshuni , AY262117, AY262118, AY262119, JF719831, JF719832, and JF719833; T. uilenbergi , AY262116, AY262120, AY262121, and JF719835; and T. ovis, AY672756 and FJ603460. Specific primer sets with similar annealing temperatures were designed with Primer 5.0 on the basis of the 5.8S and 18S rRNA gene sequences of the three Theileria species. The specific primers were synthesized by GenScript and verified bioinformatically by an Oligo 6.0 programmer. The sizes of the expected products and corresponding target genes are provided in Table 1.
Materials and methods PCR amplification and detection Positive control samples Theileria-negative sheep from Jingtai County were infected with either T. luwenshuni (Weiyuan), T. uilenbergi (Longde), or T. ovis (Kashi), and the blood samples recovered from these sheep were used as positive controls. Control species were typed with the primer sets Tluw 310/Tluw 680, specific to T. luwenshuni, and Tuil 310/Tuil 680, specific to T. uilenbergi (Yin et al. 2008). DNA was extracted from control samples using a blood core kit (QIAGEN, Germany) following the manufacturer's protocol, and the DNA yield was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).
Amplification can be influenced by many factors, including annealing temperature, primer concentration, and the number of amplification cycles. Gradient PCR was used to establish the optimum reaction conditions for each of the parameters as listed: temperature, 50, 52, 56, 58, 59, and 60 °C; primer concentration, 1, 5, 10, 15, and 20 pM; and number of amplification cycles, 30, 35, and 40. mPCR specificity and sensitivity
Several Theileria spp. genes were retrieved from GenBank and aligned by MEGA 5.1. The GenBank accession numbers
BLAST analysis was conducted by NCBI to assess mPCR specificity. mPCR was performed using three primer mixtures against DNA from the positive controls (T. luwenshuni, T. uilenbergi , and T. ovis), three other Theileria species (Theileria sergenti , Theileria annulata , and Theileria sinensis), and the related species Babesia bovis, Babesia sp. (Xinjiang), and Babesia motasi.
Table 1 Theileria spp. primer sets
Primer design
Parasite
Target ribosomal RNA gene
Primer sequence (5′–3′)
Expected product size (bp)
T. luwenshuni
5.8S
303
T. uilenbergi
18S
T. ovis
5.8S
GATGTGTTGGTTGAGGGTGCTATG CGTCAATCACAACCCGATACTTTAC TCTCGCATTAAGGCCTCCGGCT TCCAACGGATGGTAGCCTCGCA ACGATTCTATTTAGCAGGTT TCCATCACCCAATGTTTC
530 884
Parasitol Res (2014) 113:527–531
529
The mPCR assay was standardized using DNA extracted from the blood of the positive controls. Four sheep were used to generate three separate dilution series of infected blood and one uninfected blood. When the piroplasm parasite reached 1 %, the infected blood was collected using an EDTA-K2 vacuette tube (Greiner Bio-one GmbH). Infected blood was mixed and diluted with negative blood to give a tenfold dilution series of 10−1 to 10−3 % parasitemia (D’Oliveira et al. 1995). The mPCR assay was used for analysis.
Results
Fig. 2 mPCR specificity. Lanes M , DL2000 DNA marker; 1 , T. sergenti; 2, T. annulata; 3, T. sinensis; 4, B. bovine; 5, Babesia sp. (Xinjiang); 6, B. motasi; 7, T. luwenshuni; 8, T. uilenbergi; 9, T. ovis; and 10, combined T. luwenshuni, T. ovis, and T. uilenbergi
mPCR optimization An annealing temperature of 59 °C, primer concentrations of 10, 10, and 15 pM for T. luwenshuni, T. uilenbergi, and T. ovis, respectively, and 35 amplification cycles were selected as optimal for mPCR. The optimized PCR analyses were carried out in a final volume of 25 μl, including 3 μl 10× PCR buffer (Takara, Japan), 2 μl dNTPs (Takara), 1.2 μl ternary primer mixtures (Table 1), 0.3 μl rTaq DNA polymerase (Takara), and 18.5 μl distilled water. Amplification was carried out in a Mastercycler® (Eppendorf, Germany) with denaturation at 94 °C for 3 min followed by 35 cycles of 94 °C for 40 s, 59 °C for 1 min and 10 s, and 72 °C for 1 min, with a final extension step at 72 °C for 10 min, and held at 4 °C. The PCR products were electrophoresed on 1 % (w /v) agarose gel and visualized in a gel imaging system (Peiqing Scientific, Shanghai, China).
mPCR application to samples collected in the field To confirm the reliability of mPCR, 56 sheep samples collected from Zhouqu and Kashi were tested for the presence of Theileria spp., and the results were confirmed by DNA sequencing. The prevalence of T. luwenshuni, T. uilenbergi, and T. ovis was 67, 24, and 0 % in Zhouqu, respectively, and coinfection with T. luwenshuni and T. uilenbergi was 24 %. In
mPCR specificity Using piroplasm DNA to confirm cross reactivity among the mPCR primer sets, the specific products obtained were 884 bp for T. ovis , 530 bp for T. uilenbergi , and 303 bp for T. luwenshuni (Fig. 2). Nontarget species DNA displayed no evidence of fragment amplification or competition, indicating that the primer pairs used in this study were species specific and that the reaction products were distinguishable by gel electrophoresis.
mPCR sensitivity The results for mPCR sensitivity are shown in Fig. 3. Blood dilutions of 1 to 10−2 % parasitemia are clearly positive, and 10−3 % parasitemia is the lower limit of detection for all three species. These results demonstrate that the assay is sensitive to the three Theileria species tested.
Fig. 3 mPCR sensitivity. Lanes M, DL2000 DNA marker. Lanes 1–4, co-infection with T. luwenshuni, T. uilenbergi, and T. ovis, and at 1, 0.1, 0.01, and 10−3 % parasitemia, respectively
530
Kashi, the prevalence of T. luwenshuni, T. uilenbergi, and T. ovis was 0, 0, and 83 %, respectively. The amplified sequences were identical with published entries in GenBank.
Discussion Microscopic examination is traditionally used in cases of theileriosis, but it does not allow for the identification of individual Theileria species or the reliable detection of low levels of parasitemia. Single PCR can overcome these limitations, but most of the available diagnostic methods solely target a single pathogen. Real-time PCR has gained considerable popularity, but it still remains expensive for routine diagnosis in some developing countries. In this study, a specific, sensitive, inexpensive, single-step mPCR assay using three primer sets specific for the detection and identification of T. luwenshuni (303 bp), T. uilenbergi (530 bp), and T. ovis (884 bp ) was developed and tested. When using methods based on genomic amplification, the design of highly specific primers is essential. Previous studies indicate that the 18S rRNA gene and 5.8S rRNA gene are conserved amongst protozoans and therefore a specific target for the detection of Theileria spp. (Yin et al. 2008). In the present study, the mPCR uses three sets of primers, which are based on the 18S rRNA and 5.8S rRNA genes, have successfully amplified all target genes, and are absent from other related species. In addition, all combinations of primer pairs should be checked to avoid potential primer cross dimers, and the distance between amplicons must be large (i.e., >30 bp for fragments,
