Journal of Virological Methods 195 (2014) 1–8
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Multiplex PCR for simultaneous detection and differentiation of sheeppox, goatpox and orf viruses from clinical samples of sheep and goats G. Venkatesan a , V. Balamurugan a,b , V. Bhanuprakash a,c,∗ a
Division of Virology, Indian Veterinary Research Institute, Nainital District, Mukteswar 263 138, Uttarakhand, India Project Directorate on Animal Disease Monitoring and Surveillance (PD-ADMAS), Hebbal, Bangalore 560 024, Karnataka, India c Indian Veterinary Research Institute, Bangalore Campus, Hebbal, Bangalore 560 024, Karnataka, India b
a b s t r a c t Article history: Received 12 June 2013 Received in revised form 2 October 2013 Accepted 4 October 2013 Available online 14 October 2013 Keywords: Capripox Orf Multiplex PCR Mixed infections Differential diagnosis Clinical specimens
A multiplex polymerase chain reaction (mPCR) was developed and evaluated for detection of pox viral infections simultaneously using clinical samples from sheep and goats. Specific primers for three pox viruses of sheep and goats including sheeppox virus (SPPV), goatpox virus (GTPV) and orf virus (ORFV) were designed targeting conserved sequences of the DNA binding phosphoprotein (I3L) coding gene of Capripoxvirus (CaPV) and the DNA polymerase (E9L) gene of parapoxvirus for identification of these viruses. The mPCR assay was found to be sensitive for detecting as low as 350 pg of viral genomic DNA or 102 copies of standard plasmid of individual targets; and 103 copies of plasmid in a mixture of two or three viruses. The assay was specific for detecting one or more of the viruses in various combinations from clinical specimens. Two hundred and thirty five (n = 235) clinical samples from sheep and goats received from different geographical regions of the country for diagnosis of pox infection were evaluated by developed uniplex and mPCR assays. The assay had improved diagnostic sensitivity and specificity over to in-use laboratory diagnostic methods and can be useful for clinical differential diagnosis of these infections in sheep and goats. © 2013 Elsevier B.V. All rights reserved.
1. Introduction More than two viruses can infect sheep and goats simultaneously in a population when they are reared communally. This system is common in many parts of the world. Among the mixed infections of small ruminants in India, bluetongue and PPR are considered to be significant followed by sheeppox (SP), goatpox (GP) and orf (Bhanuprakash et al., 2011). Sheeppox virus (SPPV) and goatpox virus (GTPV), the members of the Capripoxvirus genus and the orf virus (ORFV), a member of the genus Parapoxvirus, are the causative agents of SP, GP and orf, respectively (OIE, 2012). These infections are endemic in central and northern Africa, the Middle and Far East, and the Indian sub-continent (Hosamani et al., 2009; Beard et al., 2010; Bhanuprakash et al., 2011). Capripox causes high mortality and morbidity, whereas, orf incurs high morbidity in adults and mortality even up to 90% in lambs and kids and they
∗ Corresponding author at: Indian Veterinary Research Institute, Bangalore Campus, Hebbal, Bangalore 560 024, Karnataka, India. Tel.: +91 080 23410908; fax: +91 080 23412509. E-mail address: [email protected] (V. Bhanuprakash). 0166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2013.10.009
incur severe economic threat to poor farmers (Bhanuprakash et al., 2011). In India, outbreaks of SP and GP has been reported regularly (Mondal et al., 2004; Bhanuprakash et al., 2006, 2010; Roy et al., 2008; Venkatesan et al., 2010; Verma et al., 2011) and also increasing number of reports of contagious ecthyma (orf infection) in sheep and goats has been described worldwide (Inoshima et al., 2002; Guo et al., 2004; Hosamani et al., 2006; Chan et al., 2007; Abrahao et al., 2009; Zhao et al., 2010; Venkatesan et al., 2011). Capripoxvirus (CaPV) can be of emerging disease threat (Babiuk et al., 2008) and exhibit change in host specificity and pathogenesis (Bhanuprakash et al., 2010; Yan et al., 2012). Similarly, increasing number of orf outbreaks due to virus persistency and host immune evasion strategy can be of severe threat to small ruminants (Hosamani et al., 2009). Strains of SPPV and GTPV, exhibit host preference rather than host specificity (Kitching and Taylor, 1985; Babiuk et al., 2008). Since CaPVs are serologically identical, their unequivocal identification depends exclusively on molecular techniques (Hosamani et al., 2004; Le Goff et al., 2009). In addition, capripox can occur in orf infected sheep and goats in a mixed fashion simultaneously. The mixed infections of CaPV with orf or other disease/s can increase the severity of either infection and is not uncommon (Hosamani et al., 2004), as reported recently from China
2
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
(Chu et al., 2011). Diagnosis of capripox and orf infection is usually based on clinical, serological (Bhanuprakash et al., 2006; Hosamani et al., 2009; Bhanuprakash et al., 2011), nucleic acid techniques like PCR (Ireland and Binepal, 1998; Heine et al., 1999; Inoshima et al., 2000; Inoshima et al., 2002; Bora et al., 2011) and real-time PCR methods (Gallina et al., 2006; Nitsche et al., 2006; Balinsky et al., 2008; Balamurugan et al., 2009; Cheng et al., 2009; Bora et al., 2011; Venkatesan et al., 2012). However, these molecular techniques are based on the detection of different pathogens using different PCR assays targeting species-specific genes but not simultaneously in a single tube. There are reports for the detection and differentiation of SPPV and GTPV strains by PCR-RFLP (Hosamani et al., 2004; Fulzele et al., 2006), PCR/real time PCRs (Orlova et al., 2006; Le Goff et al., 2009; Lamien et al., 2011a,b) and also for simultaneous detection of CaPV and ORFV by mPCR (Zheng et al., 2007). However, the information is scanty on the use of multiplex PCR (mPCR) for simultaneous detection and differentiation of SPPV, GTPV and ORFV in a single tube format. In the present study, the optimization of mPCR for detection and differentiation of SPPV, GTPV and ORFV and its evaluation using cell culture adapted virus isolates and suspected clinical specimens from sheep and goats has been carried out. The developed assay has been used regularly for identifying mixed infections of CaPV and ORFV, which are often not apparent in sheep and goats. 2. Materials and methods 2.1. Cells, viruses and clinical samples Vero cells (CCL-81) from ATCC were used for propagation of SPPV and GTPV isolates, whereas, the primary lamb testes (PLT) cells with bovine calf serum (BCS) were used for ORFV isolates infection and propagation. The vaccine viruses namely GTPVUttarkashi at passage level 60 (P60), SPPV-Srinagar at P40 and ORFV-Mukteswar at P50 were used for optimization of mPCR assay after purification using sucrose density gradient. Besides, cell culture adapted virus isolates of GTPV (n = 5), SPPV (n = 7) and ORFV (n = 11) were used for evaluation of the assay. The other pox viruses namely buffalopox virus (BPXV) and camelpox virus (CMLV) cell culture isolates and clinical samples were also included as known negative controls in determining the diagnostic specificity (DSp) of the assay. Mock infected Vero and PLT cells were used as negative controls. After optimizing the mPCR, the test was evaluated using two hundred and thirty five (n = 235) clinical specimens consisting of skin scabs, mouth lesions, blood, swabs, tissues, and organs collected from sheep and goats during capripox and orf outbreaks (2004–2012). These samples were either collected from field outbreaks by the disease investigating team or submitted to laboratory for clinical investigation from various regional disease diagnostic/investigation laboratories of state animal husbandry departments. 2.2. Genomic DNA extraction Total genomic DNA (gDNA) from the purified vaccine viruses, cell culture infected field isolates and clinical specimens was extracted using commercial gDNA extraction kit as per manufacturer’s protocol (AuPrep, Life technologies Pvt. Ltd., New Delhi, India). The purified GTPV, SPPV and ORFV were used directly for the extraction of gDNA. The infected Vero and PLT cells with field virus isolates were harvested at 80% CPE using 200 L of phosphate buffer saline (PBS) after decanting the medium. The clinical samples were homogenized using PBS, pH 7.4 and a 10% (w/v) suspension was made. The field isolates and processed samples were
freeze-thawed three times before subjecting for DNA extraction. The extracted gDNA was stored at −20 ◦ C until use. 2.3. Designing the mPCR primers The complete genome sequences of eight CaPV strains including SPPV (TU-V02127/AY077832, A/AY077833, and NISKHI/AY077834), GTPV (G20-LKV/AY077836 and Pellor/AY077835), and LSDV (NW-LW/AF409137, NI-2490/AF325528 and LW-1959/AF409138) were retrieved from the GenBank database and analyzed for distinct variation among these species in some gene coding sequences. Similarly, the complete genome sequences of six parapoxviruses [three ORFV strains namely (NZ2/U06671, IA82/AY386263 and SA00/AY386264), three BPSV isolates (RS/AY424973 and BV-AR2/AY386265) and one PCPV isolate (TQ/AY424972)] were also retrieved for designing ORFVspecific primers. Multiple sequence alignment revealed that the several genome regions with DNA sequences specific to CAPVs (Vaccinia virus analogous I3L gene, DNA binding phophoprotein) (Fig. 1) and parapoxvirus (DNA polymerase gene, ORF025). A pair of three primers was designed (two forward and one common reverse) for detection and differentiation of SPPV and GTPV, whereas, one pair of primers for parapoxvirus distinct from CaPV was also designed using Primer select program in DNASTAR package. These designed species-specific primers were shown with their position in genome and ORF of targeted gene in Table 1. Species-specific primers were designed so that the mPCR can amplify fragments differed in length namely 133 bp for GTPV, 296 and 133 bp for SPPV, and 214 bp for ORFV so as to differentiate products in agarose gel electrophoresis. 2.4. PCR optimization and construction of standard plasmids The reaction conditions for single PCR namely concentration of MgCl2 , dNTPs, primers, Taq DNA polymerase (Jump StartTM Taq DNA polymerase, Sigma, Foster City, CA, USA) and template DNA were optimized at different annealing temperatures (60–66 ◦ C) for 35 cycles of thermal profile. After optimizing the PCR for all the species individually, the reaction was performed in a Master cycler (Eppendorf, Hamburg, Germany) in 50 L volume containing 1 L of gDNA from purified virus (100 ng), 10 pmol of each primer (CP MLT 1 and 3 for SPPV, CP MLT 2 and 3 for GTPV and OV MLT 1 and 2 for ORFV), 5 L of the 10x buffer (100 mM Tris–HCl pH 8.8, 500 mM KCl, 0.8% NP-40), 2 mM MgCl2 , 200 M/L of each dNTPs, and 1 U of JumpStartTM Taq DNA polymerase (M/s Sigma, Foster City, CA, USA). Amplification was performed by initial denaturation at 95 ◦ C for 5 min followed by 35 cycles of denaturation at 94 ◦ C for 30 s, annealing at 63 ◦ C for 30 s and extension at 72 ◦ C for 30 s with a final extension at 72 ◦ C for 7 min. Amplicons were analyzed by electrophoresis through 2.5% agarose-TAE (40 mM Tris–acetate, pH 8.0, 1 mM EDTA) gel, stained with ethidium bromide. Three amplified fragments (293 bp and 133 bp for SPPV, 133 bp for GTPV and 214 bp for ORFV) from gradient purified DNA were gel purified and cloned into pGEM-T Easy vector (Promega, Madison, USA) as per manufacturer’s protocol and plasmid construct was generated by standard molecular cloning technique. The identity of the plasmid construct was confirmed by commercial sequencing and copy number of each insert was calculated. 2.5. Optimization of mPCR Similar to single PCR, the optimum conditions (concentration of different primers and MgCl2 ) for amplifying three viruses in a single tube reaction were standardized at different annealing temperatures (60, 61, 62, 63, 64, 65 and 66 ◦ C) with 106 copies/L of each of standard plasmid using Hot start Taq DNA polymerase
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
3
Fig. 1. Multiple sequence alignment of I3L gene of CaPV isolates showing strategy used in designing the primers for simultaneous differentiation of SPPV and GTPV isolates in multiplex PCR. The position of primers and variation at 3 end of forward primer (CPMLT 1) is highlighted.
(JumpStartTM Taq DNA polymerase, M/s Sigma, Foster City, CA, USA). The different concentrations of primers (combination of forward and reverse primers in varying concentrations) and MgCl2 were used to arrive at an optimum concentration to be used in mPCR to amplify specific products for differentiation of three viruses. After selecting an optimum annealing temperature in multiplex format for individual species-specific amplicons, the same was performed using mixture of all three DNAs to select a temperature where it amplify all the three fragments with an almost equal intensity and specificity. The optimized mPCR was also checked over gDNA extracted from purified viruses of SPPV, GTPV and ORFV. 2.6. Analytical specificity and sensitivity of mPCR The specificity of the mPCR was analyzed by using different cell culture adapted isolates of SPPV (n = 7), GTPV (n = 5) and ORFV (n = 13) using standard conditions. Further, the cross-reactivity of the designed primers were also checked with other related viruses
namely BPXV and CMLV, the orthopoxviruses (OPXV) of the family poxviridae and also with other related viruses of small ruminants such as peste des petits ruminants (PPRV) and bluetongue virus (BTV). The mock infected Vero and PLT cells in which the respective viruses propagated were also included to delineate the specificity of the assay. To verify the contamination of primers and other reagents, no template control (NTC) was included in each of the assays. The amplified size-specific fragments of all three species of vaccine viruses were sequenced to evaluate the specificity of the assay. The analytical sensitivity in order to determine the lower detection limit (LOD) of the mPCR was evaluated by using serial 10-fold dilutions of standard plasmid (ranged from 108 to 101 copies/L) and purified viral DNA (350 ng to 350 fg/L) of all three viruses in both uniplex and multiplex formats. Further, the limit of detection (LOD) of the assay was identified for all the three viruses by mixing equal ratios of plasmids and gDNA from purified viruses containing all the three fragments.
Table 1 Details of primers used in mPCR for detection and differentiation of SPPV, GTPV and ORFV strains. Sl. No.
Primer name
Primer sequence (5 –3 )
Genomic position
Position in ORF
Expected size
1 2 3 4 5
CP MLT 1 (Fwd) CP MLT 2 (Fwd) CP MLT 3 (Rev) PP MLT 1 (Fwd) PP MLT 2 (Rev)
GCCAGGAACTTTATATTCGATG GATATAGAATAGGGCTAGTTGCAG CATCAAAAATGACATCTACATATATAGC CTG CGG TAC CTG GAC TCG C TCT CGG TGC GCT GGA TGA A
39,196–39,217 39,357–39,380 39,461–39,488 26,077–26,095 25,882–25,900
322–343 483–506 587–614 820–838 1015–1033
293 bp only in SPPV and 133 bp in both SPPV and GTPV isolates 214 bp only in ORFV isolates
Note: Positions of CaPV and ORFV primers are according to SPPV TU (AY077832) and OV NZ2 strain (DQ184476) respectively. Position in ORF of designed primers indicates I3L gene (ORF 045) of CaPV and E9L gene (ORF 025) of ORFV isolates.
4
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
Table 2 List of known virus isolates of SPPV, GTPV and ORFV used in this study. Sl. No.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
Name of isolate/s and passage level
GTPV-Uttarkashi, P60 GTPV-Mukteswar, P8 GTPV-Akola/08, P4 GTPV-CIRG/16, P3 GTPV-CIRG/17, P3 SPPV-Srinagar, P40 SPPV-Srinagar, P7 SPPV-Ranipet SPPV-RF SPPV-Makhdoom, P5 SPPV-Pune/08, P3 SPPV-AMD, P2 ORFV-67/04 ORFV-Muk (59/05), P50 ORFV 79/04 ORFV 82/04 ORFV-Muk/09, P4 ORFV-Bhopal ORFV-Hyd ORFV-Bangalore ORFV-Assam ORFV-Meghalaya ORFV-TN/08 ORFV-Ludhiana ORFV-Orissa
Species identified by different techniques
DNA pol gene based PCR
Uniplex PCR
Multiplex PCR
CaPV
GTPV
GTPV
CaPV
GTPV
GTPV
CaPV CaPV CaPV CaPV CaPV CaPV CaPV CaPV
GTPV GTPV GTPV SPPV SPPV SPPV SPPV SPPV
GTPV GTPV GTPV SPPV SPPV SPPV SPPV SPPV
CaPV CaPV ORFV ORFV
SPPV SPPV ORFV ORFV
SPPV SPPV ORFV ORFV
ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV
ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV
ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV
2.7. Evaluation of mPCR The different cell culture adapted virus isolates of GTPV, SPPV and ORFV shown in Table 2 were evaluated by the optimized mPCR assay. In addition, the assay was also evaluated using a total of eighty two (n = 82), eighty eight (n = 88) and sixty five (n = 65) clinical specimens suspected respectively of GP, SP and orf infection from sheep and goats. All the field isolates and clinical samples were also evaluated by uniplex PCR format and were subjected to inuse laboratory techniques namely counterimmunoelectrophoresis (CIE) (Sharma et al., 1988) and DNA polymerase gene-based conventional PCR assays (Balamurugan et al., 2009; Bora et al., 2011) for comparative evaluation. The relative diagnostic specificity (DSp) and sensitivity (DSn) of mPCR was calculated by analyzing known negative (n = 50 and 35) and positive (n = 75 and 50) samples for CaPV and ORFV, respectively when compared to DNA polymerase gene-based PCR assays (Balamurugan et al., 2009; Bora et al., 2011). 3. Results 3.1. Optimization of mPCR The primers designed for these viruses produced the amplicons of 293 and 133 bp for SPPV, only 133 bp for GTPV and 214 bp for ORFV in mPCR assay. The optimum annealing temperature for mPCR in both the formats was 63.3 ◦ C (Fig. 2). The optimum concentration of primers specific to SPPV was 10 pmol of CP MLT 1 and 15 pmol of CP MLT 2 and 3 while primer concentration for GTPV (CP MLT 2 and 3) and ORFV (OV MLT 1 and 2) were found to be 15 pmol/L. The optimum concentration of MgCl2 , dNTPs, and Taq DNA polymerase was 3.5 mM, 250 M, and 1.0 IU, respectively for 35 cycles in mPCR reaction. The PCR products were analyzed by
Fig. 2. Agarose gel (2.5%) electrophoresis showing optimization of annealing temperature (Ta ) for clear identification of different targets of three viruses in mPCR assay. (A) Amplification of SPPV specific fragments (293 and 133 bp) at different temperatures (60–66 ◦ C), (B) GTPV specific amplification of 133 bp fragment at the same conditions and (C) ORFV specific amplicon (214 bp) and (D) amplification of multiple targets (all three fragments) at different temperatures (60–66 ◦ C) using mixed target DNA as template. Lane M: 100 bp DNA ladder (MBI Fermentas, USA).
electrophoresis through 2.5% agarose-TAE gel stained with ethidium bromide. 3.2. The analytical specificity The primers used in uniplex and mPCR have shown high specificity for the respective viruses (Fig. 3 A and B). No amplification was observed with PPRV, BTV, BPXV, and CMLV; mock infected Vero and PLT cells, or NTC or double distilled water (ddH2 O). 3.3. The analytical sensitivity The lower detection limit of mPCR was found to be 2.9 × 102 , 1.8 × 102 and 1.9 × 102 copies of standard plasmid for SPPV, GTPV and ORFV, respectively (Fig. 4) in both PCR formats, whereas, it was 350 pg of purified viral gDNA of all three species. When the mPCR was checked over mixed plasmid DNAs of GTPV with ORFV; and SPPV with ORFV in equal ratios, the sensitivity was 103 copies each of SPPV and GTPV, whereas, it was 102 copies for ORFV (Fig. 5). The detection limit of purified DNA of mixed viruses was found to be 350 pg for GTPV and SPPV; and 35 pg for ORFV genome in mPCR assay (figure not shown). 3.4. Evaluation of mPCR The optimized mPCR assay was able to detect and differentiate SPPV, GTPV and ORFV explicitly when it applied over known cell culture adapted virus isolates (Fig. 6). It produced two fragments (293 and 133 bp) for SPPV, only 133 bp for GTPV and 214 bp for
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
5
Fig. 5. Limit of detection of the developed mPCR employed over 10-fold serially diluted mixed plasmid DNA of these viruses. (A) Combined GTPV and ORFV plasmid DNA (109 –102 copies). (B) Combined SPPV and ORFV plasmid DNA (108 –103 copies).
Fig. 3. (A) Specificity of mPCR in the detection of individual targets of SPPV, GTPV and ORFV using respective purified vaccine viral DNA. Agarose gel (2.5%) electrophoresis showing specific amplification of SPPV with 293 and 133 bp amplicons (lane 1: Srinagar, P40; lane 2: Ranipet, P50), GTPV with 133 bp amplicon only (lane 3: Uttarkashi, P60) and ORFV with 214 bp amplicon only (lane 4: Mukteswar, P50) and no cross reactivity with orthopox viruses (lane 5: BPXV-Vij/96 and lane 6: CMLV-I); lane M: 100 bp DNA ladder (MBI Fermentas, Madison, USA). (B) Specificity of mPCR primers analyzed for multiple targets using mixed DNA of purified viruses (lanes 1–3: individual targets of SPPV, GTPV and ORFV DNA as positive control; lane 4: combined SPPV and ORFV; lane 5: GTPV and ORFV; lane 6: combined SPPV, GTPV and ORFV DNA; lane 7: negative control; lane M: 50 bp DNA ladder (MBI Fermentas, Madison, USA).
ORFV isolates. The details of positive isolates used in this study are shown in Table 2. The comparative detection rates of CIE, in-use PCR, uniplex and multiplex PCRs respectively were 30.5, 70.7, 80.5 and 80.5% for GTPV (n = 82), 23.9, 75, 81.8 and 84.1% for SPPV (n = 88) and 32.3, 64.6, 78.5 and 81.5% for ORFV (n = 65) on testing clinical samples (n = 235) (Table 3). The detection of some of the representative clinical samples of GTPV, SPPV and ORFV was shown in Fig. 7. The percentage of co-infection/mixed form of ORFV with GTPV and
SPPV in clinical samples was found to be 11.9 when tested a total of 235 samples suspected of these infections (Table 3). The relative DSp of the mPCR assay was 90 and 91.4%, whereas, the DSn of the assay shown to be of 97.3 and 98% for CaPV and ORFV, respectively.
4. Discussion In India, the occurrence of mixed infections of CaPV and ORFV in sheep/goats is usually go either un-diagnosed or diagnosed as SP or GP based on the host species involved or as orf based on lesions/clinical signs. It is therefore necessary to detect simultaneously and differentiate these viruses at an early stage in order to prevent the spread of the infections by timely vaccination. Therefore in this study, the mPCR targeting I3L gene of CaPV and DNA polymerase gene of ORFV genomes was optimized and evaluated for detection and differentiation of these infections, using known cell culture isolates and clinical samples suspected for SPPV, GTPV and ORFV. The mPCR described above could detect and differentiate these species and also useful in surveillance, molecular epidemiology and clinical diagnosis of these infections.
Fig. 4. Agarose gel (2.5%) electrophoresis showing limit of detection of the uniplex and multiplex PCRs for individual targets of SPPV, GTPV and ORFV using 10-fold serially diluted plasmid DNA (108 –101 copies). (A) Uniplex and multiplex formats for analyzing sensitivity of SPPV fragments (293 and 133 bp). (B) GTPV fragment (only 133 bp) and (C) ORFV fragment (214 bp). Lane M: 100 bp DNA ladder (MBI, Fermentas).
6
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
Table 3 Results of different clinical specimens tested by various diagnostic techniques. Type of suspected clinical sample(s)
Total number
Rate of detection by different diagnostics in percentage (number)
CIE
DNA pol PCR
Uniplex PCR
Multiplex PCR
Mixed infection of CaPV and ORFV identified by mPCR
Goatpox Sheeppox Orf
N = 82 N = 88 N = 65
30.5 (25) 23.9 (21) 32.3 (21)
70.7 (58) 75.0 (66) 64.6 (42)
80.5 (66) 81.8 (72) 78.5 (51)
80.5 (66) 84.1 (74) 81.5 (53)
7.3 (6) 9.1 (8) 21.5 (14)
Total
N = 235
28.5 (67)
70.6 (166)
80.4 (189)
82.1 (193)
11.9 (28)
Values in parentheses indicate the number.
Fig. 6. Agarose gel electrophoresis showing some of the positive cell culture isolates detected by multiplex PCR; lanes 1 and 2: SPPV-Pune/08 and SPPV-Makhdoom; lane 2: GTPV Akola/08; lanes 3–5: ORFV-67/04, ORFV-79/04 and ORFV-82/04; lane 6: negative control where no virus was detected; lane M: 50 bp DNA ladder (MBI, Fermentas).
In the present study, the viral genomic DNA extracted from known virus isolates and field clinical samples when subjected to optimized mPCR either in uniplex and multiplex formats (Tables 2 and 3), showed comparable results, entailing the specificity and efficiency of the primers. Therefore, the developed mPCR assay can be of economical and rapid. When the limit of detection for both uniplex and multiplex formats using individual targets of DNA was found to be the same, the sensitivity was found to be 10-times lower, when the mixed DNA of these viruses was subjected to mPCR assay. It may be attributed to the fact of competitive interference of primers for binding with their respective template DNAs. The detection rate of mixed population of virus genomic DNAs present in the samples by uniplex PCR is generally lower than mPCR format, may be due to the amount of the individual target DNA (varies from samples to samples) present in the samples. Even though the limit of detection for both uniplex and multiplex formats using individual targets of DNA was found to
be the same, the detection rate of mixed population of viral genomic DNAs present in the individual samples by uniplex PCR is generally lower than mPCR format. This was based on the comparison of the positive clinical samples suspected for any of these three infections. This may be due to the variation in the quantity of the individual target DNA for these three viruses present in the samples. For example, the samples containing low target either for GTPV or SPPV may be positive in the multiplex PCR for ORFV infection and negative in the uniplex capripox PCR assay. Similarly, the samples containing low target for the ORFV genome may be positive in the multiplex PCR for SPPV/GTPV infection and negative in the uniplex ORF PCR assay. Interestingly, the optimized assay was able to detect viral gDNA as low as 350 pg in the mixed population of these viruses. This implies the ability of the assay to detect and differentiate these infections clinically. When mPCR was employed on gDNA extracted from a total of 235 clinical samples, it could detect and differentiate SPPV, GTPV and ORFV simultaneously with high diagnostic efficacy as revealed by DSp and DSn. Using this assay, 11.9% of the samples were found to be co-infection either by GTPV with ORFV or SPPV with ORFV. The ability of the developed mPCR to identify mixed/co-infection, is not possible by conventional PCR targeting single virus as described elsewhere (Balamurugan et al., 2009; Bora et al., 2011). In the present investigation, a total of two samples suspected for GTPV and three samples suspected for ORFV from goats were identified as SPPV. The comparative detection rates of multiplex format is higher (Table 3) compared to in-use laboratory techniques namely CIE (Sharma et al., 1988) and conventional PCRs as described earlier (Balamurugan et al., 2009; Bora et al., 2011). The developed technique was applied directly over extracted gDNA from different specimens of both animal species and had shown to detect all virus species in single as well as mixed forms namely GTPV with ORFV in goats, SPPV with ORFV in sheep as well as goats and also SPPV from goat samples. However, the mixed infection caused by SPPV and GTPV in either sheep or goats was as evidenced by
Fig. 7. Evaluation of mPCR using suspected clinical specimens by agarose gel (2%) analysis. Lane 1: GTPV Uttarkashi; lane 2: SPPV Srinagar 38/00; lane 3: ORFV Mukteswar as positive controls (vaccine viruses); lane 4: 3080/scab/Pune/09 (GTPV + ORFV in goats); lane 5: 344/scab/VBRI/06 (SPPV + ORFV in sheep); lane 6: ORFV TS/Muk/09/83 (ORFV in sheep scab); lane 7: 51/06/Ludhiana/Punjab (ORFV + GTPV in goats); lane 8: 55/06/scab/Punjab/06 (SPPV + ORFV in goat); lane 9: 30/01/scab/AMD/08 (SPPV + ORFV in sheep); lane 10: 203/VBRI/06 (ORFV + SPPV in sheep); lane 11: ORFV Muk/59/05 (ORFV in goat); lane 12: SB-5/scab/Akola/08 (Negative sample); lane M: 100 bp ladder plus DNA marker.
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
amplification of two bands (293 and 133 bp) should further be confirmed for species identification by PCR-RFLP as described in earlier reports (Hosamani et al., 2004; Venkatesan et al., 2012). The mPCR assay could identity mixed infections in clinical samples from sheep/goats. Among these, co-infection of ORFV with GTPV (7.3%) was found to be more when compared to ORFV with SPPV co-infection (4.9%). A total of seven clinical samples of goat origin were identified as SPPV and out of which, three were found as co-infection with ORFV by mPCR assay. The present study describes mPCR assay, which is accurate and rapid for detection and differentiation of CaPV strains from ORFV and will be more useful in conjunction with currently available virus detection procedures. The results for both diseases could be reached to destination within 24 h by described format when compared to laborious virus isolation and neutralization assays. When fifteen biopsy samples from sheep/goats suspected for SP, GP and orf were analyzed by virus isolation and VNT, the mPCR shown comparable specificity and greater sensitivity over conventional cell culture methods and also to current in-use laboratory PCR techniques. In conclusion, the developed mPCR assay shows considerable diagnostic potential as economical and rapid approach for simultaneous detection and differentiation of SPPV, GTPV and ORFV either one or more viruses in single tube reaction. This assay can be used as an alternate tool over existing conventional single PCR for differentiatial diagnosis of pox viral diseases of sheep and goats within 24 h. Acknowledgements The authors thank the Director, Indian Veterinary Research Institute (IVRI), for providing all the facilities to carry out this research work (part of PhD thesis of first author) and to staff of pox virus laboratory, Division of Virology, IVRI, Mukteswar for their help and technical assistance. The authors also thank the Directors and staff of regional disease diagnostic laboratories of state animal husbandry departments for sending outbreaks clinical samples periodically to Pox laboratory, IVRI, Mukteswar for diagnostic investigation of animal viral diseases. References Abrahao, J.S., Campos, R.K., Trindade, G.S., Guedes, M.I., Lobato, Z.I., Mazur, C., Ferreira, P.C., Bonjardim, C.A., Kroon, E.G., 2009. Detection and phylogenetic analysis of Orf virus from sheep in Brazil: a case report. Virol. J. 6, 47. Babiuk, S., Bowden, T.R., Boyle, D.B., Wallace, D.B., Kitching, R.P., 2008. Capripox viruses: an emerging worldwide threat to sheep, goats and cattle. Transbound. Emerg. Dis. 55, 263–272. Balamurugan, V., Danappa Jayappa, K., Hosamani, M., Bhanuprakash, V., Venkatesan, G., Singh, R.K., 2009. Comparative efficacy of conventional and TaqMan polymerase chain reaction assays in the detection of capripoxviruses from clinical samples. J. Vet. Diagn. Invest. 21, 225–231. Balinsky, C.A., Delhon, G., Smoliga, G., Prarat, M., French, R.A., Geary, S.J., Rock, D.L., Rodriguez, L.L., 2008. Rapid preclinical detection of sheeppox virus by a real-time PCR assay. J. Clin. Microbiol. 46, 438–442. Beard, P.M., Sugar, S., Bazarragchaa, E., Gerelmaa, U., Tserendorj Sh Tuppurainen, E., Sodnomdarjaa, R., 2010. A description of two outbreaks of capripoxvirus disease in Mongolia. Vet. Microbiol. 142, 427–431. Bhanuprakash, V., Indrani, B.K., Hosamani, M., Singh, R.K., 2006. The current status of sheep pox disease. Comp. Immunol. Microbiol. Infect. Dis. 29, 27–60. Bhanuprakash, V., Venkatesan, G., Balamurugan, V., Hosamani, M., Yogisharadhya, R., Chauhan, R.S., Pande, A., Mondal, B., Singh, R.K., 2010. Pox outbreaks in sheep and goats at Makhdoom (Uttar Pradesh), India: evidence of sheeppox virus infection in goats. Transbound. Emerg. Dis. 57, 375–382. Bhanuprakash, V., Hosamani, M., Singh, R.K., 2011. Prospects of control and eradication of capripox from the Indian subcontinent: a perspective. Antiviral Res. 91, 225–232. Bora, D.P., Venkatesan, G., Bhanuprakash, V., Balamurugan, V., Prabhu, M., Sivasankar, M.S., Yogisharadhya, R., 2011. TaqMan real-time PCR assay based on DNA polymerase gene for rapid detection of Orf infection. J. Virol. Methods 178, 249–252.
7
Chan, K.W., Lin, J.W., Lee, S.H., Liao, C.J., Tsai, M.C., Hsu, W.L., Wong, M.L., Shih, H.C., 2007. Identification and phylogenetic analysis of orf virus from goats in Taiwan. Virus Genes 35, 705–712. Cheng, Z., Yue, J., Li, Y., Xu, L., Wang, K., Zhou, B., Chen, J., Li, J., Jiang, N., 2009. Development and application of TaqMan-MGB real-time quantitative PCR assay for detection of goat pox virus. Sheng Wu Gong Cheng Xue Bao 25, 464– 472. Chu, Y., Yan, X., Gao, P., Zhao, P., He, Y., Liu, J., Lu, Z., 2011. Molecular detection of a mixed infection of goatpox virus, orf virus, and Mycoplasma capricolum subsp. capripneumoniae in goats. J. Vet. Diagn. Invest. 23, 786–789. Fulzele, S., Singh, R.K., Hosamani, M., Mondal, B., Yadav, M.P., 2006. Evaluation of duplex PCR and PCR-RFLP for diagnosis of sheep pox and goat pox. Int. J. Trop. Med. 1, 66–70. Gallina, L., Dal Pozzo, F., McInnes, C.J., Cardeti, G., Guercio, A., Battilani, M., Ciulli, S., Scagliarini, A., 2006. A real time PCR assay for the detection and quantification of orf virus. J. Virol. Methods 134, 140–145. Guo, J., Rasmussen, J., Wünschmann, A., de La Concha-Bermejillo, A., 2004. Genetic characterization of orf viruses isolated from various ruminant species of a zoo. Vet. Microbiol. 99, 81–92. Heine, H.G., Stevens, M.P., Foord, A.J., Boyle, D.B., 1999. A capripoxvirus detection PCR and antibody ELISA based on the major antigen P32, the homolog of the vaccinia virus H3L gene. J. Immunol. Methods 227, 187–196. Hosamani, M., Bhanuprakash, V., Scagliarini, A., Singh, R.K., 2006. Comparative sequence analysis of major envelope protein gene (B2L) of Indian orf viruses isolated from sheep and goats. Vet. Microbiol. 116, 317–324. Hosamani, M., Mondal, B., Tembhurne, P.A., Bandyopadhyay, S.K., Singh, R.K., Rasool, T.J., 2004. Differentiation of sheep pox and goat poxviruses by sequence analysis and PCR-RFLP of P32 gene. Virus Genes 29, 73–80. Hosamani, M., Scagliarini, A., Bhanuprakash, V., McInnes, C.J., Singh, R.K., 2009. Orf: an update on current research and future perspectives. Expert Rev. Anti-Infect. Ther. 7, 879–893. Inoshima, Y., Morooka, A., Sentsui, H., 2000. Detection and diagnosis of Parapoxvirus by the polymerase chain reaction. J. Virol. Methods 84, 201–208. Inoshima, Y., Murakami, K., Wu, D., Sentsui, H., 2002. Characterization of parapoxviruses circulating among wild Japanese serows (Capricornis crispus). Microbiol. Immunol. 46, 583–587. Ireland, D.C., Binepal, Y.C., 1998. Improved detection of capripoxvirus in biopsy samples by PCR. J. Virol. Methods 74, 1–7. Kitching, R.P., Taylor, W.P., 1985. Transmission of capripoxvirus. Res. Vet. Sci. 39, 196–199. Lamien, C.E., Le Goff, C., Silber, R., Wallace, D.B., Gulyaz, V., Tuppurainen, E., Madani, H., Caufour, P., Adam, T., El Harrak, M., Luckins, A.G., Albina, E., Diallo, A., 2011a. Use of the Capripoxvirus homologue of vaccinia virus 30 kDa RNA polymerase subunit (RPO30) gene as a novel diagnostic and genotyping target: development of a classical PCR method to differentiate goat poxvirus from sheep poxvirus. Vet. Microbiol. 149, 30–39. Lamien, C.E., Lelenta, M., Goger, W., Silber, R., Tuppurainen, E., Matijevic, M., Luckins, A.G., Diallo, A., 2011b. Real time PCR method for simultaneous detection, quantitation and differentiation of capripoxviruses. J. Virol. Methods 171, 134– 140. Le Goff, C., Lamien, C.E., Fakhfakh, E., Chadeyras, A., Aba-Adulugba, E., Libeau, G., Tuppurainen, E., Wallace, D.B., Adam, T., Silber, R., Gulyaz, V., Madani, H., Caufour, P., Hammami, S., Diallo, A., Albina, E., 2009. Capripoxvirus G-protein-coupled chemokine receptor: a host-range gene suitable for virus animal origin discrimination. J. Gen. Virol. 90, 1967–1977. Mondal, B., Hosamani, M., Dutta, T.K., Senthilkumar, V.S., Rathore, R., Singh, R.K., 2004. An outbreak of sheep pox on a sheep breeding farm in Jammu, India. Rev. Sci. Tech. 23, 943–949. Nitsche, A., Büttner, M., Wilhelm, S., Pauli, G., Meyer, H., 2006. Real-time PCR detection of parapoxvirus DNA. Clin. Chem. 52, 316–319. OIE, 2012. Sheeppox and goat pox. In: Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (Mammals, Birds and Bees), 7th ed. Office International des Epizooties Manual, Paris, France (Chapter 2.7.14). Orlova, E.S., Shcherbakova, A.V., Diev, V.I., Zakharov, V.M., 2006. Differentiation of capripoxvirus species and strains by polymerase chain reaction. Mol. Biol. 40, 158–164. Roy, P., Purushothaman, V., Sreekumar, C., Tamizharasan, S., Chandramohan, A., 2008. Sheep pox disease outbreaks in Madras Red and Mechery breeds of indigenous sheep in Tamilnadu, India. Res. Vet. Sci. 85, 617–621. Sharma, B., Negi, B.S., Pandey, A.B., Bandyopadhyay, S.K., Shankar, H., Yadav, M.P., 1988. Detection of goat pox antigen and antibody by CIE test. Trop. Anim. Health Prod. 20, 109–113. Venkatesan, G., Balamurugan, V., Singh, R.K., 2010. Goat pox virus isolated from an outbreak at Akola, Maharashtra (India) phylogenetically related to Chinese strain. Trop. Anim. Health Prod. 42, 1053–1056. Venkatesan, G., Balamurugan, V., Bora, D.P., Yogisharadhya, R., Prabhu, M., Bhanuprakash, V., 2011. Sequence and phylogenetic analyses of an Indian isolate of orf virus from sheep. Vet. Ital. 47, 323–332. Venkatesan, G., Bhanuprakash, V., Balamurugan, V., Bora, D.P., Prabhu, M., Yogisharadhya, R., Pandey, A.B., 2012. Rapid detection and quantification of Orf virus from infected scab materials of sheep and goats. Acta Virol. 56, 81–83. Verma, S., Verma, L.K., Gupta, V.K., Katoch, V.C., Dogra, V., Pal, B., Sharma, M., 2011. Emerging Capripoxvirus disease outbreaks in Himachal Pradesh, a northern state of India. Transbound. Emerg. Dis. 58, 79–85.
8
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
Yan, X.M., Chu, Y.F., Wu, G.H., Zhao, Z.X., Li, J., Zhu, H.X., Zhang, Q., 2012. An outbreak of sheep pox associated with goat poxvirus in Gansu province of China. Vet. Microbiol. 156, 425–428. Zhao, K., Song, D., He, W., Lu, H., Zhang, B., Li, C., Chen, K., Gao, F., 2010. Identification and phylogenetic analysis of an Orf virus isolated from an
outbreak in sheep in the Jilin province of China. Vet. Microbiol. 142, 408–415. Zheng, M., Liu, Q., Jin, N., Guo, J., Huang, X., Li, H., Zhu, W., Xiong, Y., 2007. A duplex PCR assay for simultaneous detection and differentiation of Capripoxvirus and Orf virus. Mol. Cell. Probes 21, 276–281.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Multiplex PCR for simultaneous detection and differentiation of sheeppox, goatpox and orf viruses from clinical samples of sheep and goats G. Venkatesan a , V. Balamurugan a,b , V. Bhanuprakash a,c,∗ a
Division of Virology, Indian Veterinary Research Institute, Nainital District, Mukteswar 263 138, Uttarakhand, India Project Directorate on Animal Disease Monitoring and Surveillance (PD-ADMAS), Hebbal, Bangalore 560 024, Karnataka, India c Indian Veterinary Research Institute, Bangalore Campus, Hebbal, Bangalore 560 024, Karnataka, India b
a b s t r a c t Article history: Received 12 June 2013 Received in revised form 2 October 2013 Accepted 4 October 2013 Available online 14 October 2013 Keywords: Capripox Orf Multiplex PCR Mixed infections Differential diagnosis Clinical specimens
A multiplex polymerase chain reaction (mPCR) was developed and evaluated for detection of pox viral infections simultaneously using clinical samples from sheep and goats. Specific primers for three pox viruses of sheep and goats including sheeppox virus (SPPV), goatpox virus (GTPV) and orf virus (ORFV) were designed targeting conserved sequences of the DNA binding phosphoprotein (I3L) coding gene of Capripoxvirus (CaPV) and the DNA polymerase (E9L) gene of parapoxvirus for identification of these viruses. The mPCR assay was found to be sensitive for detecting as low as 350 pg of viral genomic DNA or 102 copies of standard plasmid of individual targets; and 103 copies of plasmid in a mixture of two or three viruses. The assay was specific for detecting one or more of the viruses in various combinations from clinical specimens. Two hundred and thirty five (n = 235) clinical samples from sheep and goats received from different geographical regions of the country for diagnosis of pox infection were evaluated by developed uniplex and mPCR assays. The assay had improved diagnostic sensitivity and specificity over to in-use laboratory diagnostic methods and can be useful for clinical differential diagnosis of these infections in sheep and goats. © 2013 Elsevier B.V. All rights reserved.
1. Introduction More than two viruses can infect sheep and goats simultaneously in a population when they are reared communally. This system is common in many parts of the world. Among the mixed infections of small ruminants in India, bluetongue and PPR are considered to be significant followed by sheeppox (SP), goatpox (GP) and orf (Bhanuprakash et al., 2011). Sheeppox virus (SPPV) and goatpox virus (GTPV), the members of the Capripoxvirus genus and the orf virus (ORFV), a member of the genus Parapoxvirus, are the causative agents of SP, GP and orf, respectively (OIE, 2012). These infections are endemic in central and northern Africa, the Middle and Far East, and the Indian sub-continent (Hosamani et al., 2009; Beard et al., 2010; Bhanuprakash et al., 2011). Capripox causes high mortality and morbidity, whereas, orf incurs high morbidity in adults and mortality even up to 90% in lambs and kids and they
∗ Corresponding author at: Indian Veterinary Research Institute, Bangalore Campus, Hebbal, Bangalore 560 024, Karnataka, India. Tel.: +91 080 23410908; fax: +91 080 23412509. E-mail address: [email protected] (V. Bhanuprakash). 0166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2013.10.009
incur severe economic threat to poor farmers (Bhanuprakash et al., 2011). In India, outbreaks of SP and GP has been reported regularly (Mondal et al., 2004; Bhanuprakash et al., 2006, 2010; Roy et al., 2008; Venkatesan et al., 2010; Verma et al., 2011) and also increasing number of reports of contagious ecthyma (orf infection) in sheep and goats has been described worldwide (Inoshima et al., 2002; Guo et al., 2004; Hosamani et al., 2006; Chan et al., 2007; Abrahao et al., 2009; Zhao et al., 2010; Venkatesan et al., 2011). Capripoxvirus (CaPV) can be of emerging disease threat (Babiuk et al., 2008) and exhibit change in host specificity and pathogenesis (Bhanuprakash et al., 2010; Yan et al., 2012). Similarly, increasing number of orf outbreaks due to virus persistency and host immune evasion strategy can be of severe threat to small ruminants (Hosamani et al., 2009). Strains of SPPV and GTPV, exhibit host preference rather than host specificity (Kitching and Taylor, 1985; Babiuk et al., 2008). Since CaPVs are serologically identical, their unequivocal identification depends exclusively on molecular techniques (Hosamani et al., 2004; Le Goff et al., 2009). In addition, capripox can occur in orf infected sheep and goats in a mixed fashion simultaneously. The mixed infections of CaPV with orf or other disease/s can increase the severity of either infection and is not uncommon (Hosamani et al., 2004), as reported recently from China
2
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
(Chu et al., 2011). Diagnosis of capripox and orf infection is usually based on clinical, serological (Bhanuprakash et al., 2006; Hosamani et al., 2009; Bhanuprakash et al., 2011), nucleic acid techniques like PCR (Ireland and Binepal, 1998; Heine et al., 1999; Inoshima et al., 2000; Inoshima et al., 2002; Bora et al., 2011) and real-time PCR methods (Gallina et al., 2006; Nitsche et al., 2006; Balinsky et al., 2008; Balamurugan et al., 2009; Cheng et al., 2009; Bora et al., 2011; Venkatesan et al., 2012). However, these molecular techniques are based on the detection of different pathogens using different PCR assays targeting species-specific genes but not simultaneously in a single tube. There are reports for the detection and differentiation of SPPV and GTPV strains by PCR-RFLP (Hosamani et al., 2004; Fulzele et al., 2006), PCR/real time PCRs (Orlova et al., 2006; Le Goff et al., 2009; Lamien et al., 2011a,b) and also for simultaneous detection of CaPV and ORFV by mPCR (Zheng et al., 2007). However, the information is scanty on the use of multiplex PCR (mPCR) for simultaneous detection and differentiation of SPPV, GTPV and ORFV in a single tube format. In the present study, the optimization of mPCR for detection and differentiation of SPPV, GTPV and ORFV and its evaluation using cell culture adapted virus isolates and suspected clinical specimens from sheep and goats has been carried out. The developed assay has been used regularly for identifying mixed infections of CaPV and ORFV, which are often not apparent in sheep and goats. 2. Materials and methods 2.1. Cells, viruses and clinical samples Vero cells (CCL-81) from ATCC were used for propagation of SPPV and GTPV isolates, whereas, the primary lamb testes (PLT) cells with bovine calf serum (BCS) were used for ORFV isolates infection and propagation. The vaccine viruses namely GTPVUttarkashi at passage level 60 (P60), SPPV-Srinagar at P40 and ORFV-Mukteswar at P50 were used for optimization of mPCR assay after purification using sucrose density gradient. Besides, cell culture adapted virus isolates of GTPV (n = 5), SPPV (n = 7) and ORFV (n = 11) were used for evaluation of the assay. The other pox viruses namely buffalopox virus (BPXV) and camelpox virus (CMLV) cell culture isolates and clinical samples were also included as known negative controls in determining the diagnostic specificity (DSp) of the assay. Mock infected Vero and PLT cells were used as negative controls. After optimizing the mPCR, the test was evaluated using two hundred and thirty five (n = 235) clinical specimens consisting of skin scabs, mouth lesions, blood, swabs, tissues, and organs collected from sheep and goats during capripox and orf outbreaks (2004–2012). These samples were either collected from field outbreaks by the disease investigating team or submitted to laboratory for clinical investigation from various regional disease diagnostic/investigation laboratories of state animal husbandry departments. 2.2. Genomic DNA extraction Total genomic DNA (gDNA) from the purified vaccine viruses, cell culture infected field isolates and clinical specimens was extracted using commercial gDNA extraction kit as per manufacturer’s protocol (AuPrep, Life technologies Pvt. Ltd., New Delhi, India). The purified GTPV, SPPV and ORFV were used directly for the extraction of gDNA. The infected Vero and PLT cells with field virus isolates were harvested at 80% CPE using 200 L of phosphate buffer saline (PBS) after decanting the medium. The clinical samples were homogenized using PBS, pH 7.4 and a 10% (w/v) suspension was made. The field isolates and processed samples were
freeze-thawed three times before subjecting for DNA extraction. The extracted gDNA was stored at −20 ◦ C until use. 2.3. Designing the mPCR primers The complete genome sequences of eight CaPV strains including SPPV (TU-V02127/AY077832, A/AY077833, and NISKHI/AY077834), GTPV (G20-LKV/AY077836 and Pellor/AY077835), and LSDV (NW-LW/AF409137, NI-2490/AF325528 and LW-1959/AF409138) were retrieved from the GenBank database and analyzed for distinct variation among these species in some gene coding sequences. Similarly, the complete genome sequences of six parapoxviruses [three ORFV strains namely (NZ2/U06671, IA82/AY386263 and SA00/AY386264), three BPSV isolates (RS/AY424973 and BV-AR2/AY386265) and one PCPV isolate (TQ/AY424972)] were also retrieved for designing ORFVspecific primers. Multiple sequence alignment revealed that the several genome regions with DNA sequences specific to CAPVs (Vaccinia virus analogous I3L gene, DNA binding phophoprotein) (Fig. 1) and parapoxvirus (DNA polymerase gene, ORF025). A pair of three primers was designed (two forward and one common reverse) for detection and differentiation of SPPV and GTPV, whereas, one pair of primers for parapoxvirus distinct from CaPV was also designed using Primer select program in DNASTAR package. These designed species-specific primers were shown with their position in genome and ORF of targeted gene in Table 1. Species-specific primers were designed so that the mPCR can amplify fragments differed in length namely 133 bp for GTPV, 296 and 133 bp for SPPV, and 214 bp for ORFV so as to differentiate products in agarose gel electrophoresis. 2.4. PCR optimization and construction of standard plasmids The reaction conditions for single PCR namely concentration of MgCl2 , dNTPs, primers, Taq DNA polymerase (Jump StartTM Taq DNA polymerase, Sigma, Foster City, CA, USA) and template DNA were optimized at different annealing temperatures (60–66 ◦ C) for 35 cycles of thermal profile. After optimizing the PCR for all the species individually, the reaction was performed in a Master cycler (Eppendorf, Hamburg, Germany) in 50 L volume containing 1 L of gDNA from purified virus (100 ng), 10 pmol of each primer (CP MLT 1 and 3 for SPPV, CP MLT 2 and 3 for GTPV and OV MLT 1 and 2 for ORFV), 5 L of the 10x buffer (100 mM Tris–HCl pH 8.8, 500 mM KCl, 0.8% NP-40), 2 mM MgCl2 , 200 M/L of each dNTPs, and 1 U of JumpStartTM Taq DNA polymerase (M/s Sigma, Foster City, CA, USA). Amplification was performed by initial denaturation at 95 ◦ C for 5 min followed by 35 cycles of denaturation at 94 ◦ C for 30 s, annealing at 63 ◦ C for 30 s and extension at 72 ◦ C for 30 s with a final extension at 72 ◦ C for 7 min. Amplicons were analyzed by electrophoresis through 2.5% agarose-TAE (40 mM Tris–acetate, pH 8.0, 1 mM EDTA) gel, stained with ethidium bromide. Three amplified fragments (293 bp and 133 bp for SPPV, 133 bp for GTPV and 214 bp for ORFV) from gradient purified DNA were gel purified and cloned into pGEM-T Easy vector (Promega, Madison, USA) as per manufacturer’s protocol and plasmid construct was generated by standard molecular cloning technique. The identity of the plasmid construct was confirmed by commercial sequencing and copy number of each insert was calculated. 2.5. Optimization of mPCR Similar to single PCR, the optimum conditions (concentration of different primers and MgCl2 ) for amplifying three viruses in a single tube reaction were standardized at different annealing temperatures (60, 61, 62, 63, 64, 65 and 66 ◦ C) with 106 copies/L of each of standard plasmid using Hot start Taq DNA polymerase
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
3
Fig. 1. Multiple sequence alignment of I3L gene of CaPV isolates showing strategy used in designing the primers for simultaneous differentiation of SPPV and GTPV isolates in multiplex PCR. The position of primers and variation at 3 end of forward primer (CPMLT 1) is highlighted.
(JumpStartTM Taq DNA polymerase, M/s Sigma, Foster City, CA, USA). The different concentrations of primers (combination of forward and reverse primers in varying concentrations) and MgCl2 were used to arrive at an optimum concentration to be used in mPCR to amplify specific products for differentiation of three viruses. After selecting an optimum annealing temperature in multiplex format for individual species-specific amplicons, the same was performed using mixture of all three DNAs to select a temperature where it amplify all the three fragments with an almost equal intensity and specificity. The optimized mPCR was also checked over gDNA extracted from purified viruses of SPPV, GTPV and ORFV. 2.6. Analytical specificity and sensitivity of mPCR The specificity of the mPCR was analyzed by using different cell culture adapted isolates of SPPV (n = 7), GTPV (n = 5) and ORFV (n = 13) using standard conditions. Further, the cross-reactivity of the designed primers were also checked with other related viruses
namely BPXV and CMLV, the orthopoxviruses (OPXV) of the family poxviridae and also with other related viruses of small ruminants such as peste des petits ruminants (PPRV) and bluetongue virus (BTV). The mock infected Vero and PLT cells in which the respective viruses propagated were also included to delineate the specificity of the assay. To verify the contamination of primers and other reagents, no template control (NTC) was included in each of the assays. The amplified size-specific fragments of all three species of vaccine viruses were sequenced to evaluate the specificity of the assay. The analytical sensitivity in order to determine the lower detection limit (LOD) of the mPCR was evaluated by using serial 10-fold dilutions of standard plasmid (ranged from 108 to 101 copies/L) and purified viral DNA (350 ng to 350 fg/L) of all three viruses in both uniplex and multiplex formats. Further, the limit of detection (LOD) of the assay was identified for all the three viruses by mixing equal ratios of plasmids and gDNA from purified viruses containing all the three fragments.
Table 1 Details of primers used in mPCR for detection and differentiation of SPPV, GTPV and ORFV strains. Sl. No.
Primer name
Primer sequence (5 –3 )
Genomic position
Position in ORF
Expected size
1 2 3 4 5
CP MLT 1 (Fwd) CP MLT 2 (Fwd) CP MLT 3 (Rev) PP MLT 1 (Fwd) PP MLT 2 (Rev)
GCCAGGAACTTTATATTCGATG GATATAGAATAGGGCTAGTTGCAG CATCAAAAATGACATCTACATATATAGC CTG CGG TAC CTG GAC TCG C TCT CGG TGC GCT GGA TGA A
39,196–39,217 39,357–39,380 39,461–39,488 26,077–26,095 25,882–25,900
322–343 483–506 587–614 820–838 1015–1033
293 bp only in SPPV and 133 bp in both SPPV and GTPV isolates 214 bp only in ORFV isolates
Note: Positions of CaPV and ORFV primers are according to SPPV TU (AY077832) and OV NZ2 strain (DQ184476) respectively. Position in ORF of designed primers indicates I3L gene (ORF 045) of CaPV and E9L gene (ORF 025) of ORFV isolates.
4
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
Table 2 List of known virus isolates of SPPV, GTPV and ORFV used in this study. Sl. No.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
Name of isolate/s and passage level
GTPV-Uttarkashi, P60 GTPV-Mukteswar, P8 GTPV-Akola/08, P4 GTPV-CIRG/16, P3 GTPV-CIRG/17, P3 SPPV-Srinagar, P40 SPPV-Srinagar, P7 SPPV-Ranipet SPPV-RF SPPV-Makhdoom, P5 SPPV-Pune/08, P3 SPPV-AMD, P2 ORFV-67/04 ORFV-Muk (59/05), P50 ORFV 79/04 ORFV 82/04 ORFV-Muk/09, P4 ORFV-Bhopal ORFV-Hyd ORFV-Bangalore ORFV-Assam ORFV-Meghalaya ORFV-TN/08 ORFV-Ludhiana ORFV-Orissa
Species identified by different techniques
DNA pol gene based PCR
Uniplex PCR
Multiplex PCR
CaPV
GTPV
GTPV
CaPV
GTPV
GTPV
CaPV CaPV CaPV CaPV CaPV CaPV CaPV CaPV
GTPV GTPV GTPV SPPV SPPV SPPV SPPV SPPV
GTPV GTPV GTPV SPPV SPPV SPPV SPPV SPPV
CaPV CaPV ORFV ORFV
SPPV SPPV ORFV ORFV
SPPV SPPV ORFV ORFV
ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV
ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV
ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV ORFV
2.7. Evaluation of mPCR The different cell culture adapted virus isolates of GTPV, SPPV and ORFV shown in Table 2 were evaluated by the optimized mPCR assay. In addition, the assay was also evaluated using a total of eighty two (n = 82), eighty eight (n = 88) and sixty five (n = 65) clinical specimens suspected respectively of GP, SP and orf infection from sheep and goats. All the field isolates and clinical samples were also evaluated by uniplex PCR format and were subjected to inuse laboratory techniques namely counterimmunoelectrophoresis (CIE) (Sharma et al., 1988) and DNA polymerase gene-based conventional PCR assays (Balamurugan et al., 2009; Bora et al., 2011) for comparative evaluation. The relative diagnostic specificity (DSp) and sensitivity (DSn) of mPCR was calculated by analyzing known negative (n = 50 and 35) and positive (n = 75 and 50) samples for CaPV and ORFV, respectively when compared to DNA polymerase gene-based PCR assays (Balamurugan et al., 2009; Bora et al., 2011). 3. Results 3.1. Optimization of mPCR The primers designed for these viruses produced the amplicons of 293 and 133 bp for SPPV, only 133 bp for GTPV and 214 bp for ORFV in mPCR assay. The optimum annealing temperature for mPCR in both the formats was 63.3 ◦ C (Fig. 2). The optimum concentration of primers specific to SPPV was 10 pmol of CP MLT 1 and 15 pmol of CP MLT 2 and 3 while primer concentration for GTPV (CP MLT 2 and 3) and ORFV (OV MLT 1 and 2) were found to be 15 pmol/L. The optimum concentration of MgCl2 , dNTPs, and Taq DNA polymerase was 3.5 mM, 250 M, and 1.0 IU, respectively for 35 cycles in mPCR reaction. The PCR products were analyzed by
Fig. 2. Agarose gel (2.5%) electrophoresis showing optimization of annealing temperature (Ta ) for clear identification of different targets of three viruses in mPCR assay. (A) Amplification of SPPV specific fragments (293 and 133 bp) at different temperatures (60–66 ◦ C), (B) GTPV specific amplification of 133 bp fragment at the same conditions and (C) ORFV specific amplicon (214 bp) and (D) amplification of multiple targets (all three fragments) at different temperatures (60–66 ◦ C) using mixed target DNA as template. Lane M: 100 bp DNA ladder (MBI Fermentas, USA).
electrophoresis through 2.5% agarose-TAE gel stained with ethidium bromide. 3.2. The analytical specificity The primers used in uniplex and mPCR have shown high specificity for the respective viruses (Fig. 3 A and B). No amplification was observed with PPRV, BTV, BPXV, and CMLV; mock infected Vero and PLT cells, or NTC or double distilled water (ddH2 O). 3.3. The analytical sensitivity The lower detection limit of mPCR was found to be 2.9 × 102 , 1.8 × 102 and 1.9 × 102 copies of standard plasmid for SPPV, GTPV and ORFV, respectively (Fig. 4) in both PCR formats, whereas, it was 350 pg of purified viral gDNA of all three species. When the mPCR was checked over mixed plasmid DNAs of GTPV with ORFV; and SPPV with ORFV in equal ratios, the sensitivity was 103 copies each of SPPV and GTPV, whereas, it was 102 copies for ORFV (Fig. 5). The detection limit of purified DNA of mixed viruses was found to be 350 pg for GTPV and SPPV; and 35 pg for ORFV genome in mPCR assay (figure not shown). 3.4. Evaluation of mPCR The optimized mPCR assay was able to detect and differentiate SPPV, GTPV and ORFV explicitly when it applied over known cell culture adapted virus isolates (Fig. 6). It produced two fragments (293 and 133 bp) for SPPV, only 133 bp for GTPV and 214 bp for
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
5
Fig. 5. Limit of detection of the developed mPCR employed over 10-fold serially diluted mixed plasmid DNA of these viruses. (A) Combined GTPV and ORFV plasmid DNA (109 –102 copies). (B) Combined SPPV and ORFV plasmid DNA (108 –103 copies).
Fig. 3. (A) Specificity of mPCR in the detection of individual targets of SPPV, GTPV and ORFV using respective purified vaccine viral DNA. Agarose gel (2.5%) electrophoresis showing specific amplification of SPPV with 293 and 133 bp amplicons (lane 1: Srinagar, P40; lane 2: Ranipet, P50), GTPV with 133 bp amplicon only (lane 3: Uttarkashi, P60) and ORFV with 214 bp amplicon only (lane 4: Mukteswar, P50) and no cross reactivity with orthopox viruses (lane 5: BPXV-Vij/96 and lane 6: CMLV-I); lane M: 100 bp DNA ladder (MBI Fermentas, Madison, USA). (B) Specificity of mPCR primers analyzed for multiple targets using mixed DNA of purified viruses (lanes 1–3: individual targets of SPPV, GTPV and ORFV DNA as positive control; lane 4: combined SPPV and ORFV; lane 5: GTPV and ORFV; lane 6: combined SPPV, GTPV and ORFV DNA; lane 7: negative control; lane M: 50 bp DNA ladder (MBI Fermentas, Madison, USA).
ORFV isolates. The details of positive isolates used in this study are shown in Table 2. The comparative detection rates of CIE, in-use PCR, uniplex and multiplex PCRs respectively were 30.5, 70.7, 80.5 and 80.5% for GTPV (n = 82), 23.9, 75, 81.8 and 84.1% for SPPV (n = 88) and 32.3, 64.6, 78.5 and 81.5% for ORFV (n = 65) on testing clinical samples (n = 235) (Table 3). The detection of some of the representative clinical samples of GTPV, SPPV and ORFV was shown in Fig. 7. The percentage of co-infection/mixed form of ORFV with GTPV and
SPPV in clinical samples was found to be 11.9 when tested a total of 235 samples suspected of these infections (Table 3). The relative DSp of the mPCR assay was 90 and 91.4%, whereas, the DSn of the assay shown to be of 97.3 and 98% for CaPV and ORFV, respectively.
4. Discussion In India, the occurrence of mixed infections of CaPV and ORFV in sheep/goats is usually go either un-diagnosed or diagnosed as SP or GP based on the host species involved or as orf based on lesions/clinical signs. It is therefore necessary to detect simultaneously and differentiate these viruses at an early stage in order to prevent the spread of the infections by timely vaccination. Therefore in this study, the mPCR targeting I3L gene of CaPV and DNA polymerase gene of ORFV genomes was optimized and evaluated for detection and differentiation of these infections, using known cell culture isolates and clinical samples suspected for SPPV, GTPV and ORFV. The mPCR described above could detect and differentiate these species and also useful in surveillance, molecular epidemiology and clinical diagnosis of these infections.
Fig. 4. Agarose gel (2.5%) electrophoresis showing limit of detection of the uniplex and multiplex PCRs for individual targets of SPPV, GTPV and ORFV using 10-fold serially diluted plasmid DNA (108 –101 copies). (A) Uniplex and multiplex formats for analyzing sensitivity of SPPV fragments (293 and 133 bp). (B) GTPV fragment (only 133 bp) and (C) ORFV fragment (214 bp). Lane M: 100 bp DNA ladder (MBI, Fermentas).
6
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
Table 3 Results of different clinical specimens tested by various diagnostic techniques. Type of suspected clinical sample(s)
Total number
Rate of detection by different diagnostics in percentage (number)
CIE
DNA pol PCR
Uniplex PCR
Multiplex PCR
Mixed infection of CaPV and ORFV identified by mPCR
Goatpox Sheeppox Orf
N = 82 N = 88 N = 65
30.5 (25) 23.9 (21) 32.3 (21)
70.7 (58) 75.0 (66) 64.6 (42)
80.5 (66) 81.8 (72) 78.5 (51)
80.5 (66) 84.1 (74) 81.5 (53)
7.3 (6) 9.1 (8) 21.5 (14)
Total
N = 235
28.5 (67)
70.6 (166)
80.4 (189)
82.1 (193)
11.9 (28)
Values in parentheses indicate the number.
Fig. 6. Agarose gel electrophoresis showing some of the positive cell culture isolates detected by multiplex PCR; lanes 1 and 2: SPPV-Pune/08 and SPPV-Makhdoom; lane 2: GTPV Akola/08; lanes 3–5: ORFV-67/04, ORFV-79/04 and ORFV-82/04; lane 6: negative control where no virus was detected; lane M: 50 bp DNA ladder (MBI, Fermentas).
In the present study, the viral genomic DNA extracted from known virus isolates and field clinical samples when subjected to optimized mPCR either in uniplex and multiplex formats (Tables 2 and 3), showed comparable results, entailing the specificity and efficiency of the primers. Therefore, the developed mPCR assay can be of economical and rapid. When the limit of detection for both uniplex and multiplex formats using individual targets of DNA was found to be the same, the sensitivity was found to be 10-times lower, when the mixed DNA of these viruses was subjected to mPCR assay. It may be attributed to the fact of competitive interference of primers for binding with their respective template DNAs. The detection rate of mixed population of virus genomic DNAs present in the samples by uniplex PCR is generally lower than mPCR format, may be due to the amount of the individual target DNA (varies from samples to samples) present in the samples. Even though the limit of detection for both uniplex and multiplex formats using individual targets of DNA was found to
be the same, the detection rate of mixed population of viral genomic DNAs present in the individual samples by uniplex PCR is generally lower than mPCR format. This was based on the comparison of the positive clinical samples suspected for any of these three infections. This may be due to the variation in the quantity of the individual target DNA for these three viruses present in the samples. For example, the samples containing low target either for GTPV or SPPV may be positive in the multiplex PCR for ORFV infection and negative in the uniplex capripox PCR assay. Similarly, the samples containing low target for the ORFV genome may be positive in the multiplex PCR for SPPV/GTPV infection and negative in the uniplex ORF PCR assay. Interestingly, the optimized assay was able to detect viral gDNA as low as 350 pg in the mixed population of these viruses. This implies the ability of the assay to detect and differentiate these infections clinically. When mPCR was employed on gDNA extracted from a total of 235 clinical samples, it could detect and differentiate SPPV, GTPV and ORFV simultaneously with high diagnostic efficacy as revealed by DSp and DSn. Using this assay, 11.9% of the samples were found to be co-infection either by GTPV with ORFV or SPPV with ORFV. The ability of the developed mPCR to identify mixed/co-infection, is not possible by conventional PCR targeting single virus as described elsewhere (Balamurugan et al., 2009; Bora et al., 2011). In the present investigation, a total of two samples suspected for GTPV and three samples suspected for ORFV from goats were identified as SPPV. The comparative detection rates of multiplex format is higher (Table 3) compared to in-use laboratory techniques namely CIE (Sharma et al., 1988) and conventional PCRs as described earlier (Balamurugan et al., 2009; Bora et al., 2011). The developed technique was applied directly over extracted gDNA from different specimens of both animal species and had shown to detect all virus species in single as well as mixed forms namely GTPV with ORFV in goats, SPPV with ORFV in sheep as well as goats and also SPPV from goat samples. However, the mixed infection caused by SPPV and GTPV in either sheep or goats was as evidenced by
Fig. 7. Evaluation of mPCR using suspected clinical specimens by agarose gel (2%) analysis. Lane 1: GTPV Uttarkashi; lane 2: SPPV Srinagar 38/00; lane 3: ORFV Mukteswar as positive controls (vaccine viruses); lane 4: 3080/scab/Pune/09 (GTPV + ORFV in goats); lane 5: 344/scab/VBRI/06 (SPPV + ORFV in sheep); lane 6: ORFV TS/Muk/09/83 (ORFV in sheep scab); lane 7: 51/06/Ludhiana/Punjab (ORFV + GTPV in goats); lane 8: 55/06/scab/Punjab/06 (SPPV + ORFV in goat); lane 9: 30/01/scab/AMD/08 (SPPV + ORFV in sheep); lane 10: 203/VBRI/06 (ORFV + SPPV in sheep); lane 11: ORFV Muk/59/05 (ORFV in goat); lane 12: SB-5/scab/Akola/08 (Negative sample); lane M: 100 bp ladder plus DNA marker.
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
amplification of two bands (293 and 133 bp) should further be confirmed for species identification by PCR-RFLP as described in earlier reports (Hosamani et al., 2004; Venkatesan et al., 2012). The mPCR assay could identity mixed infections in clinical samples from sheep/goats. Among these, co-infection of ORFV with GTPV (7.3%) was found to be more when compared to ORFV with SPPV co-infection (4.9%). A total of seven clinical samples of goat origin were identified as SPPV and out of which, three were found as co-infection with ORFV by mPCR assay. The present study describes mPCR assay, which is accurate and rapid for detection and differentiation of CaPV strains from ORFV and will be more useful in conjunction with currently available virus detection procedures. The results for both diseases could be reached to destination within 24 h by described format when compared to laborious virus isolation and neutralization assays. When fifteen biopsy samples from sheep/goats suspected for SP, GP and orf were analyzed by virus isolation and VNT, the mPCR shown comparable specificity and greater sensitivity over conventional cell culture methods and also to current in-use laboratory PCR techniques. In conclusion, the developed mPCR assay shows considerable diagnostic potential as economical and rapid approach for simultaneous detection and differentiation of SPPV, GTPV and ORFV either one or more viruses in single tube reaction. This assay can be used as an alternate tool over existing conventional single PCR for differentiatial diagnosis of pox viral diseases of sheep and goats within 24 h. Acknowledgements The authors thank the Director, Indian Veterinary Research Institute (IVRI), for providing all the facilities to carry out this research work (part of PhD thesis of first author) and to staff of pox virus laboratory, Division of Virology, IVRI, Mukteswar for their help and technical assistance. The authors also thank the Directors and staff of regional disease diagnostic laboratories of state animal husbandry departments for sending outbreaks clinical samples periodically to Pox laboratory, IVRI, Mukteswar for diagnostic investigation of animal viral diseases. References Abrahao, J.S., Campos, R.K., Trindade, G.S., Guedes, M.I., Lobato, Z.I., Mazur, C., Ferreira, P.C., Bonjardim, C.A., Kroon, E.G., 2009. Detection and phylogenetic analysis of Orf virus from sheep in Brazil: a case report. Virol. J. 6, 47. Babiuk, S., Bowden, T.R., Boyle, D.B., Wallace, D.B., Kitching, R.P., 2008. Capripox viruses: an emerging worldwide threat to sheep, goats and cattle. Transbound. Emerg. Dis. 55, 263–272. Balamurugan, V., Danappa Jayappa, K., Hosamani, M., Bhanuprakash, V., Venkatesan, G., Singh, R.K., 2009. Comparative efficacy of conventional and TaqMan polymerase chain reaction assays in the detection of capripoxviruses from clinical samples. J. Vet. Diagn. Invest. 21, 225–231. Balinsky, C.A., Delhon, G., Smoliga, G., Prarat, M., French, R.A., Geary, S.J., Rock, D.L., Rodriguez, L.L., 2008. Rapid preclinical detection of sheeppox virus by a real-time PCR assay. J. Clin. Microbiol. 46, 438–442. Beard, P.M., Sugar, S., Bazarragchaa, E., Gerelmaa, U., Tserendorj Sh Tuppurainen, E., Sodnomdarjaa, R., 2010. A description of two outbreaks of capripoxvirus disease in Mongolia. Vet. Microbiol. 142, 427–431. Bhanuprakash, V., Indrani, B.K., Hosamani, M., Singh, R.K., 2006. The current status of sheep pox disease. Comp. Immunol. Microbiol. Infect. Dis. 29, 27–60. Bhanuprakash, V., Venkatesan, G., Balamurugan, V., Hosamani, M., Yogisharadhya, R., Chauhan, R.S., Pande, A., Mondal, B., Singh, R.K., 2010. Pox outbreaks in sheep and goats at Makhdoom (Uttar Pradesh), India: evidence of sheeppox virus infection in goats. Transbound. Emerg. Dis. 57, 375–382. Bhanuprakash, V., Hosamani, M., Singh, R.K., 2011. Prospects of control and eradication of capripox from the Indian subcontinent: a perspective. Antiviral Res. 91, 225–232. Bora, D.P., Venkatesan, G., Bhanuprakash, V., Balamurugan, V., Prabhu, M., Sivasankar, M.S., Yogisharadhya, R., 2011. TaqMan real-time PCR assay based on DNA polymerase gene for rapid detection of Orf infection. J. Virol. Methods 178, 249–252.
7
Chan, K.W., Lin, J.W., Lee, S.H., Liao, C.J., Tsai, M.C., Hsu, W.L., Wong, M.L., Shih, H.C., 2007. Identification and phylogenetic analysis of orf virus from goats in Taiwan. Virus Genes 35, 705–712. Cheng, Z., Yue, J., Li, Y., Xu, L., Wang, K., Zhou, B., Chen, J., Li, J., Jiang, N., 2009. Development and application of TaqMan-MGB real-time quantitative PCR assay for detection of goat pox virus. Sheng Wu Gong Cheng Xue Bao 25, 464– 472. Chu, Y., Yan, X., Gao, P., Zhao, P., He, Y., Liu, J., Lu, Z., 2011. Molecular detection of a mixed infection of goatpox virus, orf virus, and Mycoplasma capricolum subsp. capripneumoniae in goats. J. Vet. Diagn. Invest. 23, 786–789. Fulzele, S., Singh, R.K., Hosamani, M., Mondal, B., Yadav, M.P., 2006. Evaluation of duplex PCR and PCR-RFLP for diagnosis of sheep pox and goat pox. Int. J. Trop. Med. 1, 66–70. Gallina, L., Dal Pozzo, F., McInnes, C.J., Cardeti, G., Guercio, A., Battilani, M., Ciulli, S., Scagliarini, A., 2006. A real time PCR assay for the detection and quantification of orf virus. J. Virol. Methods 134, 140–145. Guo, J., Rasmussen, J., Wünschmann, A., de La Concha-Bermejillo, A., 2004. Genetic characterization of orf viruses isolated from various ruminant species of a zoo. Vet. Microbiol. 99, 81–92. Heine, H.G., Stevens, M.P., Foord, A.J., Boyle, D.B., 1999. A capripoxvirus detection PCR and antibody ELISA based on the major antigen P32, the homolog of the vaccinia virus H3L gene. J. Immunol. Methods 227, 187–196. Hosamani, M., Bhanuprakash, V., Scagliarini, A., Singh, R.K., 2006. Comparative sequence analysis of major envelope protein gene (B2L) of Indian orf viruses isolated from sheep and goats. Vet. Microbiol. 116, 317–324. Hosamani, M., Mondal, B., Tembhurne, P.A., Bandyopadhyay, S.K., Singh, R.K., Rasool, T.J., 2004. Differentiation of sheep pox and goat poxviruses by sequence analysis and PCR-RFLP of P32 gene. Virus Genes 29, 73–80. Hosamani, M., Scagliarini, A., Bhanuprakash, V., McInnes, C.J., Singh, R.K., 2009. Orf: an update on current research and future perspectives. Expert Rev. Anti-Infect. Ther. 7, 879–893. Inoshima, Y., Morooka, A., Sentsui, H., 2000. Detection and diagnosis of Parapoxvirus by the polymerase chain reaction. J. Virol. Methods 84, 201–208. Inoshima, Y., Murakami, K., Wu, D., Sentsui, H., 2002. Characterization of parapoxviruses circulating among wild Japanese serows (Capricornis crispus). Microbiol. Immunol. 46, 583–587. Ireland, D.C., Binepal, Y.C., 1998. Improved detection of capripoxvirus in biopsy samples by PCR. J. Virol. Methods 74, 1–7. Kitching, R.P., Taylor, W.P., 1985. Transmission of capripoxvirus. Res. Vet. Sci. 39, 196–199. Lamien, C.E., Le Goff, C., Silber, R., Wallace, D.B., Gulyaz, V., Tuppurainen, E., Madani, H., Caufour, P., Adam, T., El Harrak, M., Luckins, A.G., Albina, E., Diallo, A., 2011a. Use of the Capripoxvirus homologue of vaccinia virus 30 kDa RNA polymerase subunit (RPO30) gene as a novel diagnostic and genotyping target: development of a classical PCR method to differentiate goat poxvirus from sheep poxvirus. Vet. Microbiol. 149, 30–39. Lamien, C.E., Lelenta, M., Goger, W., Silber, R., Tuppurainen, E., Matijevic, M., Luckins, A.G., Diallo, A., 2011b. Real time PCR method for simultaneous detection, quantitation and differentiation of capripoxviruses. J. Virol. Methods 171, 134– 140. Le Goff, C., Lamien, C.E., Fakhfakh, E., Chadeyras, A., Aba-Adulugba, E., Libeau, G., Tuppurainen, E., Wallace, D.B., Adam, T., Silber, R., Gulyaz, V., Madani, H., Caufour, P., Hammami, S., Diallo, A., Albina, E., 2009. Capripoxvirus G-protein-coupled chemokine receptor: a host-range gene suitable for virus animal origin discrimination. J. Gen. Virol. 90, 1967–1977. Mondal, B., Hosamani, M., Dutta, T.K., Senthilkumar, V.S., Rathore, R., Singh, R.K., 2004. An outbreak of sheep pox on a sheep breeding farm in Jammu, India. Rev. Sci. Tech. 23, 943–949. Nitsche, A., Büttner, M., Wilhelm, S., Pauli, G., Meyer, H., 2006. Real-time PCR detection of parapoxvirus DNA. Clin. Chem. 52, 316–319. OIE, 2012. Sheeppox and goat pox. In: Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (Mammals, Birds and Bees), 7th ed. Office International des Epizooties Manual, Paris, France (Chapter 2.7.14). Orlova, E.S., Shcherbakova, A.V., Diev, V.I., Zakharov, V.M., 2006. Differentiation of capripoxvirus species and strains by polymerase chain reaction. Mol. Biol. 40, 158–164. Roy, P., Purushothaman, V., Sreekumar, C., Tamizharasan, S., Chandramohan, A., 2008. Sheep pox disease outbreaks in Madras Red and Mechery breeds of indigenous sheep in Tamilnadu, India. Res. Vet. Sci. 85, 617–621. Sharma, B., Negi, B.S., Pandey, A.B., Bandyopadhyay, S.K., Shankar, H., Yadav, M.P., 1988. Detection of goat pox antigen and antibody by CIE test. Trop. Anim. Health Prod. 20, 109–113. Venkatesan, G., Balamurugan, V., Singh, R.K., 2010. Goat pox virus isolated from an outbreak at Akola, Maharashtra (India) phylogenetically related to Chinese strain. Trop. Anim. Health Prod. 42, 1053–1056. Venkatesan, G., Balamurugan, V., Bora, D.P., Yogisharadhya, R., Prabhu, M., Bhanuprakash, V., 2011. Sequence and phylogenetic analyses of an Indian isolate of orf virus from sheep. Vet. Ital. 47, 323–332. Venkatesan, G., Bhanuprakash, V., Balamurugan, V., Bora, D.P., Prabhu, M., Yogisharadhya, R., Pandey, A.B., 2012. Rapid detection and quantification of Orf virus from infected scab materials of sheep and goats. Acta Virol. 56, 81–83. Verma, S., Verma, L.K., Gupta, V.K., Katoch, V.C., Dogra, V., Pal, B., Sharma, M., 2011. Emerging Capripoxvirus disease outbreaks in Himachal Pradesh, a northern state of India. Transbound. Emerg. Dis. 58, 79–85.
8
G. Venkatesan et al. / Journal of Virological Methods 195 (2014) 1–8
Yan, X.M., Chu, Y.F., Wu, G.H., Zhao, Z.X., Li, J., Zhu, H.X., Zhang, Q., 2012. An outbreak of sheep pox associated with goat poxvirus in Gansu province of China. Vet. Microbiol. 156, 425–428. Zhao, K., Song, D., He, W., Lu, H., Zhang, B., Li, C., Chen, K., Gao, F., 2010. Identification and phylogenetic analysis of an Orf virus isolated from an
outbreak in sheep in the Jilin province of China. Vet. Microbiol. 142, 408–415. Zheng, M., Liu, Q., Jin, N., Guo, J., Huang, X., Li, H., Zhu, W., Xiong, Y., 2007. A duplex PCR assay for simultaneous detection and differentiation of Capripoxvirus and Orf virus. Mol. Cell. Probes 21, 276–281.
