RESEARCH PAPER RNA Biology 12:12, 1338--1354; December 2015; © 2015 Taylor and Francis Group, LLC

Mutational robustness and resilience of a replicative cis-element of RNA virus: Promiscuity, limitations, relevance Maria A Prostova1, Anatoly P Gmyl1,2, Denis V Bakhmutov1,y, Anna A Shishova1, Elena V Khitrina1, Marina S Kolesnikova1, Marina V Serebryakova2, Olga V Isaeva1, and Vadim I Agol1,2,* 1

M P Chumakov Institute of Poliomyelitis and Viral Encephalitides; Moscow Russia; 2M V Lomonosov Moscow State University; Moscow Russia y

Deceased

Keywords: genome stability, mutational tolerance, poliovirus, RNA folding, RNA/protein interaction, RNA viruses, RNA replication, viral evolvability

Since replication of RNA-viruses is generally a low-fidelity process, it would be advantageous, if specific interactions of their genomic cis-elements with dedicated ligands are relatively tolerant to mutations. The specificity/promiscuity trade-off of such interactions was addressed here by investigating structural requirements of the oriL (also known as the clover leaf-like element), of poliovirus RNA, a replicative cis-element containing a conserved essential tetraloop functionally interacting with the viral protein 3CD. The sequence of this tetraloop and 2 adjacent base-pairs was randomized in the viral genome, and viable viruses were selected in susceptible cells. Strikingly, each position of this octanucleotide in 62 investigated viable viruses could be occupied by any nucleotide (with the exception of one position, which lacked U), though with certain sequence preferences, confirmed by engineering mutant viral genomes whose phenotypic properties were found to correlate with the strength of the cis-element/ligand interaction. The results were compatible with a hypothesis that functional recognition by 3CD requires that this tetraloop should stably or temporarily adopt a YNMG-like (YDU/C, NDany nucleotide, MDA/C) fold. The fitness of “weak” viruses could be increased by compensatory mutations “improving” the tetraloops. Otherwise, the recognition of “bad” tetraloops might be facilitated by alterations in the 3CD protein. The virus appeared to tolerate mutations in its cis-element relaying on either robustness (spatial structure degeneracy) or resilience (a combination of dynamic RNA folding, low-fidelity replication modifying the cis-element or its ligand, and negative selection). These mechanisms (especially resilience involving metastable low-fit intermediates) can also contribute to the viral evolvability.

Introduction Replication of RNA viruses is accomplished by RNA-dependent RNA polymerases, which generally exhibit a relatively low fidelity. Thus, each newly generated genome of some viruses, for example, poliovirus, may differ from its template molecule by a mutation.1,2 This circumstance means that these viruses should cope with several serious evolutionary problems,3 one of which may be formulated as follows: how can the specificity of interaction between viral RNA cis-elements and their ligands be retained in spite of the likelihood of their mutational alterations? The problem of trade-off between specificity and promiscuity of this interaction is addressed in this study by using as a model a cis-element of poliovirus RNA. Poliovirus is a member of Picornaviridae, a well populated family of relatively small nonenveloped animal viruses, which includes also such pathogens as rhinoviruses (etiological agents of the common cold), hepatitis A virus, foot-and-mouth disease

virus and many others. The genome of these viruses is represented by a 7.5-8 kb polyadenylated single-stranded RNA of positive polarity containing an extended open reading frame (ORF) encoding a polyprotein, which is eventually processed into a dozen “mature” proteins. This ORF is flanked by 5’- and 3’untranslated regions (5UTR and 3UTR) harboring translational (IRES) and replicative (oriL and oriR) cis-elements (Fig. 1A)4,5. The replication of picornavirus genome occurs in several steps: initiation of the complementary (-) strand at the oriR-adjacent poly(A)-sequence; elongation of this strand and formation of the double-stranded replicative form RNA; initiation of the genomic (+) strand at the oriL (also known as clover leaf-like element); synthesis and polyadenylation of multiple progeny (+) strands.6,7 The structures of the replicative cis-elements markedly vary among representatives of different picornavirus genera.8 The 5’ end-adjacent element, oriL, of the genome of poliovirus (as well as of other enteroviruses, including rhinoviruses) is ~90 nt-long and folds into a clover leaf-like secondary structure (Fig. 1A)9,10. This

*Correspondence to: Vadim I Agol; Email: [email protected] Submitted: 05/18/2015; Revised: 09/22/2015; Accepted: 09/23/2015 http://dx.doi.org/10.1080/15476286.2015.1100794

1338

RNA Biology

Volume 12 Issue 12

and poly(A)-binding protein (PABP) bound to oriL and poly (A)-tail of the viral genome, respectively.16,18 To initiate the synthesis of RNA, 3Dpol should be proteolyticaly separated from the 3Cpro moiety and this process may possibly be also facilitated by the 3CD interaction with oriL. The oriL-bound RNP complex interacts also with viral protein 3AB.19,20 containing the moiety of protein VPg (3B) serving, in its uridylylated form, as primer for the initiation of positive and negative viral RNA strands. The uridylylation appears to be accomplished by 3Dpol associated with the oriL/ RNP complex using as a template still another viral replicative cis-element cre (also known as oriI) located in the central part of the viral genome (Fig. 1A).17,21 Another domain of oriL, its hairpin b, binds the PCBP (in its 2 isomeric forms, PCPB1 and PCBP2),22-25 and this interaction is important also for the stabilization of uncapped viral RNA by impeding its exonucleolytic degraFigure 1. The structure of poliovirus genome and design of the SELEX in vivo experiments. (A) A schematic dation.16,26 The affinity of PCBP representation of the genome of the Mahoney strain of type 1 poliovirus and of the oriL/3CD interaction. to the b domain of oriL is The protein-coding region is framed. The cis-replicative elements oriL, cre (oriI), and oriR are represented by markedly stimulated by binding thin lines and the translational element IRES is marked by a thick line. An stands for poly (A). The detailed structures of domains a-d of oriL are illustrated and the nucleotides subjected to randomization are 3CD to the d domain.27 and this highlighted in bold. (B) Consecutive steps of the SELEX experiments. PCR-generated cDNA of the synthetic effect is believed to play an impororiL-containing segment of poliovirus RNA harboring the randomized octanucleotide, ApaI and SplI sites, tant role in the switch from transand 5’-terminal ribozyme sequence was inserted into pT7PV1RibMS. The resulting plasmid was used to lation to replication of the viral transform E. coli. DNA from pools containing different numbers of plasmid clones was purified and trangenome because PCBP is known scribed with the T7 RNA polymerase. The transcripts were used to transfect Vero cells. RNA was isolated either from the primary plaques or plaques generated after one or more passages, and its oriL-containing to be also a positive regulator of fragment was sequenced. the translation of the poliovirus RNA.23,28,29 A hairpin at the 30 -terminus of element is believed to play amazingly multiple roles in viral repro- the negative viral RNA, which harbors complement of oriL, was duction, primarily through promoting formation of a complex also reported to functionally interact with viral proteins involved ribonucleoprotein (RNP) structure involving several viral and host in the genome replication.30 proteins.10-12 An essential component of this complex is the viral Such poly-functionality of oriL appears to require numerRNA-dependent RNA polymerase, 3Dpol, which is recruited there ous specific RNA/protein (as well as protein/protein) interin the form of its precursor 3CD, i.e., covalently linked to the viral actions. In view of their importance for the viral survival protease 3Cpro.13 This interaction appears to involve the hairpin and fitness, these interactions should be enough robust and domain d of oriL and the 3C moiety of 3CD.12,14 and is important are expected to sustain relative infidelity of the viral RNAfor the initiation of the synthesis of the both viral (positive).10,15 dependent RNA polymerase 3Dpol. On the other hand, the and complementary (negative) RNA strand.16,17 The requirement cis-element should retain its specificity with regard to highly of oriL for the latter process, which occurs at the opposite 3’-termi- distinctive recognition by its dedicated ligands. The nature nus of the template molecule, appears to be due to pseudo-circular- of the trade-off between specificity and sequence promiscuization of the viral RNA caused by interaction of its 5’- and 3’-ends ity of this element is not only important for the understandowing to the affinity between the poly(C)-binding protein (PCBP) ing functions and evolution of the poliovirus/enterovirus

www.tandfonline.com

RNA Biology

1339

genomes but is also an intriguing general evolutionary problem. As an approach to these issues, we sought to determine the space of permitted (i.e., compatible with the viral viability) sequences of the RNA and some of protein components of this complex RNP. An aspect of this study has been published previously.31 Here, we present a detailed investigation of the permitted structural variability of the apical part of hairpin d of the poliovirus oriL. To this end, the approach of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) in vivo was used. The nucleotides of the tetraloop and 2 adjacent base pairs of the hairpin d were randomized in the context of the full-length viral RNA, the modified genomes were transfected into susceptible cells, and the oriL region of the viable variant viruses was sequenced. Unexpectedly, it was found that each position of this octanucleotide in the investigated set of viable viruses could be occupied by any nucleotide (with the exception of one position, which lacked U), albeit with certain sequence preferences. The tentative conclusions derived from the SELEX experiments were verified by engineering viral genomes of interest, testing phenotypic properties and genetic stability of the relevant viruses, and assaying interaction between the mutated hairpin d and recombinant 3CD protein. The results demonstrated that the majority of tetraloops well-recognized by 3CD belonged to the YNMG (YDU/C, NDany nucleotide, MDA/C) sequence consensus, representatives of which are known to acquire a specific stable fold.32-36 Certain tetraloops with non-YNMG sequences but possessing the same spatial structure were also shown to be good partners of 3CD. We hypothesize that numerous tetraloops that were found in viable viruses and did not belong to this sequence consensus may also adopt, stably or temporarily, a YNMG-like folding necessary for their recognition by 3CD. We also propose that the variable fitness of these viruses positively correlates with the stability of the above conformation of the relevant tetraloop and could be enhanced by their appropriate alterations. There were also 2 sets of tetraloops, either possessing definitely different stable spatial structure, i.e., GNRA (RDG/A) and gCUUGc, or unable to fold into a YNMG-like manner for other reasons, endowing the relevant viruses with marginal viability, which, however, could be markedly enhanced by the acquisition of mutations in the oriL-recognizing motif of 3CD. Implications of these findings for understanding conservation and evolvability of viral RNA genomes will be discussed.

Table 1 Occurrence of nucleotides at each position of the randomized region of the plasmids and viruses. Flanking nt Nucleotide

N1

Tetraloop

N2

N3

N4

Flanking nt

N5

N6

N7

N8

24 34 12 29

29 22 24 24

15 15 32 39

24 39 20 17

Viral genomesb 3 25 11 56 19 31 28 33 50 14 22 8

17 0 3 81

17 17 6 61

17 42 14 28

a

Plasmids A T C G

A U C G

39 22 24 15

44 19 17 19

20 22 41 17

14 39 42 6

20 24 34 22

24 32 20 24

a

Averaged occupancy (in %) of each position of the randomized region of 41 individual plasmid clones. b Averaged occupancy of each position of the randomized region of 39 distinct individual viable viruses.

used to replace the relevant segment in the plasmid T7PV1RibMS encoding, under the T7 RNA polymerase promoter, the full-length poliovirus RNA fused to the hammerhead ribozyme at the 50 -end (Fig. 1B). The ribozyme served to generate the accurate monophosphorylated 5’-terminus needed for an earlier and more efficient generation of viruses upon transfection.37 The stock of randomized plasmids was obtained by transformation of E. coli TOP10. The extent of randomization was checked by sequencing the relevant fragment (corresponding to positions 1-111 of the viral RNA) of 41 randomly selected plasmid clones and found to be satisfactory (Table 1). It was also found that viral sequences of only 10 (24.4%) of these plasmids contained no additional mutations outside the randomized octanucleotide. Other clones harbored inadvertently introduced changes (or combinations thereof): single point mutations were detected in 9 clones, 2 point mutations in 1 clone, one-nt insertions in 13 clones, 2-nt insertions in 5 clones, whereas 6 clones contained deletions of 1 to 41 nt. Preparations of plasmid DNA isolated from 18 individual randomly selected clones as well as from 34 pools of 5 plasmids, from pools of 20, 100, 300, 900 plasmids and from 3 pools of Table 2 Specific infectivity of RNA obtained upon transcription of pooled plasmids with the randomized octanucleotide. Number of variants in the pool

Results

Relative specific infectivitya (by day 4 p.t.)

SELEX in vivo of viable viruses and primary structures of the apex of their domain d To define the set of sequences of the apex of the hairpin d that are compatible with the poliovirus viability, plasmids encoding the full viral genome with randomized 8 nt encompassing the tetraloop and 2 flanking base pairs of this hairpin were engineered (Fig. 1). The randomized octanucleotide was first introduced into a 130 nt-long DNA synthetic fragment corresponding to the 50 -terminal sequence of the viral genome, which then was

1340

20 100 300 900 2500

1£10¡5 1£10¡4 1£10¡2 1£10¡2 7£10¡3 1£10¡3 2£10¡3

a

The ratio to the specific infectivity of transcripts of the wild-type virusencoding plasmid, ~7£104 pfu/mg RNA.

RNA Biology

Volume 12 Issue 12

2500 plasmids were transcribed in vitro and serial dilutions of the transcripts were used to transfect Vero cells (Fig. 1B). Infectious plaque-forming viruses were generated by transcripts of 2 individual plasmids, by transcripts of 3 pools of 5 clones, and by each of the larger pools, with varying specific infectivity (Table 2). It should be admitted that the values of specific infectivities in this Table represent merely rough estimates due do approximate character of RNA concentrations in pools of 20-900 variants and appearance of many pinpoint-sized plaques in the transcripts of largest pools.

Attempts to sequence viral genomes from the primary plaques (especially from the small ones and appearing late after transfections) were not always successful, and in such cases the material from plaques was subjected to one or more bulk blind passages (Fig. 1B). The 50 -terminal region encompassing at least positions 15-111 of the genomes of 62 isolated viruses was sequenced. They possessed 39 unique octanucleotides corresponding to the randomized region (Fig. 2). Although this set hardly represented the entire space of permitted sequences, it demonstrated several important features. Any position of the octanucleotide could be occupied by any of the 4 nucleotides, the only exception being N6, which in our set of variants was not represented by U (Fig. 2, Table 1). However, the occupancy of specific positions in the tetraloop (with the exception of N4) was obviously nonrandom. N3 was preferably (in 56% cases) occupied by U, and the relevant viruses invariably possessed G6. Remarkably, this latter position was occupied by the same nucleotide, G, in 81% of the recovered viruses but 4 of 5 isolates with G3 had A6. N5 was represented by C in a half of the cases. These and some other preferences/biases allowed us to classify the majority of the observed tetraloops into 3 sequence consensuses (Fig. 2). Nearly a half of the isolates fitted the YNMG consensus. Nine tetranucleotides could be described by a related YNUG consensus, and 4 sequences belonged to the GSYA class (SDG/C). Other observed tetranucleotides either could not be assigned to a known consensus or exhibited some sequence heterogeneity. The sequences flanking the central tetranucleotide could form 2 base pairs in the overwhelming majority of the isolates, although either the adjacent or penultimate pairing was absent in some RNAs with the YNMG consensus. Of note, a wobble u2g7 pair was observed in a sizeable Figure 2. The results of analysis of randomized region in the RNA of the selected viable polioviruses. The proportion of the viruses. occupancy of nucleotides at different positions and the sequences of the randomized region are shown. The occupancy at each position is reflected by the size of the nucleotide symbol (for the quantitative data, see Some preliminary conclusions Table 1). Additional mutations were found in the sequenced region (positions 15-111) of the genomes with about the possible spatial structures 1 2 3 4 superscripts: ( ) G insertion into G14-G17; ( ) C insertion into C23-C25; ( ) A26!G; ( ) G insertion at position 40. of the apex of domain d in viable

www.tandfonline.com

RNA Biology

1341

viruses could be derived from the above sequence peculiarities. The YNMG tetranucleotides flanked with the c-g or u-g base pairs are known to belong to a common structural class of stable tetraloops.32-35,38,39 However, it should be noted that some of our isolates had a YNMG sequence flanked by other nucleotides, which in certain cases could not be paired. Certain YNUG tetranucleotides, e.g. UUUG flanked by ac-gu pairs (represented in our collection), were reported to belong to the same structural class.40 though another YNUG member, gCUUGc (not selected), exhibited a different folding.41 Furthermore, we have previously shown that a tetraloop with a GSYA sequence, namely auGCUAgu, is also a member of the YNMG structural class.31 Thus, the tetraloop of domain d in the majority of the isolates appeared to possess a folding of the YNMG class. Remarkably, no viruses with other known structural classes of stable tetraloops, GNRA and gCUUGc, have been isolated. These tetraloops are known to adopt conformations different from that of the YNMG fold.41,42 Non-GNRA tetraloops with GNRA-like conformations, such as UNAC.43 were also absent from the set of selected viruses. Unviable, quasi-infectious and/or low-fit genomes A very low specific infectivity of some preparations suggested, as could be expected, that many genomes with the randomized octanucleotide were unviable. Furthermore, the plaques formed upon transfection with some preparations became visible only after a prolonged incubation (e.g., by 7th day) and/or exhibited small/minute plaque phenotypes, the properties that could be due to a low fitness of the relevant genomes. Some of the

genomes could be quasi-infectious, i.e., requiring obligatory additional mutation after transfection to generate a plaque.44 Obviously, any information about the unviable, low-fit or quasi-infectious genomes would contribute to our understanding of the structural requirements for the functional oriL. To get some relevant knowledge, the region corresponding to the viral genome positions 1-111 was sequenced in 12 individual plasmids encoding apparently nonviable viruses, and the Minimum Free Energy (MEF) secondary structures of the respective oriLs were modeled using University of Vienna RNAFold Program (http:// rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi) (Table 3). Noteworthy, none of them had YNMG, YNUG, or GSYA tetraloops in the relevant place. In certain plasmids devoid of non-intended mutations, this tetraloop could be transformed into an octaloop (plasmids ##1-4), and this change was the only detectable alteration of the secondary structure. In this regard, it should be noted that unpairing of the tetranucleotide-adjacent or penultimate pairs was not lethal in the case of YNMG-containing plasmids (Fig. 2; see also below), suggesting that it was the non-YNMG tetranucleotide that was responsible for the non-infectivity of these plasmids. Octaloops as well as hexalopps could also be predicted in some other RNAs but in combinations with additional structural changes of unknown biological relevance. The oriL of the remaining non-infectious RNAs could be predicted to undergo more or less drastic alterations of their secondary structure (Table 3). Pertinent information was also obtained with the transcripts that generated plaques (usually late and/or small) containing viruses with post-transfectionally acquired mutations (but no

Table 3 OriL tetraloops apparently failing to ensure viability of the poliovirus genomea.a

No

Sequence of the octanucleotide in the plasmidb

1 2 3 4 5

aaCTGCta taCTTTgt aaCGCAgg tcGTAAat aaTAGCga

6

tgCGAAcc

7

ctTACAcg

8 9

ccGCGTga taGGATgc

Substitution E40T Substitution T11C; insertion of G21

10 11

acGGTCca ctGTACga

12

ccACTAct

None Substitution A4T; deletions of A90 and E100 Insertion of G32

Non-intended mutationsc

Changes in the oriL secondary structured

None None None None Insertion of A into A3-A6; deletion of A88 Insertions of G21, A26, E69, A70; deletion of G17 Insertion of G21

Transformation of the tetraloop of domain d into an octaloop Transformation of the tetraloop of domain d into an octaloop Transformation of the tetraloop of domain d into an octaloop Transformation of the tetraloop of domain d into an octaloop Transformation of the tetraloop of domain d into an octaloop; extension of the stem of domain a Transformation of the tetraloops of domain d into a hexaloop and that of domain b into a triloop; extension of the stem of domain b Transformation of the tetraloop of domain d into a hexaloop and that of domain b into a triloop; extension of the stem of domain b Transformation of domain d into 2 stem-loops Transformation of the tetraloop of domain d into an octaloop and that of domain b into a triloop; shortening of the stem of domain c; extension of the stem of domain b Shortening of the stem of domain d through generation of a bulge Transformation of domain d into 2 stem-loops Transformation of the tetraloop of domain d and the pentaloop of domain c into octaloops; shortening of the stem of domain d; extension of the stem of domain c

The sequence of individual plasmids whose transcripts (0.3 mg) failed to generate plaques by day 7 after transfection into Vero cells. Unpaired flanking nucleotides are underlined. c Non-intended mutations in the plasmids within the 5’-terminal 111 nt region of the viral genome. d As revealed by the calculation of the Minimum Free Energy structures. a

b

1342

RNA Biology

Volume 12 Issue 12

unintended changes in the relevant plasmid’s 50 -terminal 111 nucleotides). Taking into account that some alterations in the oriL structure could be suppressed by mutations in the 3CD protein,14 a segment encompassing positions 5800–6000 of the RNA (encoding amino acid residues 121-187 of 3CD) of some of these viruses was also sequenced. Substitutions auUUACgu!auUUAGgu and acCCUUgu!acCCUGgu (the changed nucleotides are underlined) were detected after passaging of viruses produced by transcripts of an individual plasmid and a pool of 5 variants, respectively, demonstrating the acquisition of YNMG or YNUG sequences. A more complex situation was observed with the transcript of another pool of 5 variants. Three viruses recovered from primary plaques were identified as descendants of the atAGCAat-harboring plasmid present in the pool. After a single passage, 2 of these viruses retained the above octanucleotide (obviously with the t!u replacement) but acquired the T!I mutation in the TGK motif of 3CD, whereas the third virus retained the 3CD unchanged but obtained the auGGCAau (i.e., a GSYA) sequence. After the 3rd passage, all the 3 genomes harbored the latter tetraloop and IGK, suggesting that both these changes had adaptive character but their combination endowed the virus with a greater fitness gain. The latter notion was supported by the fate of the virus generated by the same plasmid when it was transcribed individually: after 5 passages, the virus possessed auGGCAau and IGK. Thus, the results of this section supported our tentative conclusion about the viability of viruses able to form domain d with the YNMG as well as certain YNUG and GSYA tetraloops. They also suggested that fitness of some not-strong-enough viruses could be improved by acquisition of an optimal tetraloop and/or by changes in the tetraloop’s ligand, protein 3CD. Engineered mutants with altered tetraloops and flanking base pairs To define more exactly the validity of the above preliminary conclusions and to get some information on phenotypic properties of viruses differing in oriL sequences, we engineered a number of mutant genomes. This was important also because some of the in vivo selected viruses possessed mutations outside the randomized sequence. To detect possible compensatory mutations in 3CD, the relevant segment of the gene encoding this protein of certain relatively low-fit (and of some well-fit) engineered genomes was sequenced, in addition to the 50 -terminal region. First, genomes with the YNMG sequences having complete or incomplete pairing of flanking bases were engineered (Table 4). The RNA with the wt (wild-type) auUGCGgu exhibited a high specific infectivity and generated large-plaque progeny early (e.g., by 3rd day) post-transfection (Fig. 3). Similar properties were shared also by other YNMG-harboring genomes with 2 flanking base pairs, Watson-Crick or wobble. They produced early large plaques (Fig. 3A, #5) and, when their specific infectivity was assayed, it proved to be equal or comparable to that of the wt counterpart (by “comparable” we mean that they were within an order of magnitude). Non-complementarity of the tetraloopadjacent or penultimate bases might result in some fitness decrease, as evidenced by a more or less marked reduction in

www.tandfonline.com

plaque sizes (Fig. 3B, ##6-8;) as well as in genetic instability of the viruses. Mutations resulting in restoration of the 2 base pairs were detected after 5 passages (Table 4). Further, 2 groups of genomes with the YNUG tetraloops were constructed. One included variants with known40 (acUUUGgu) or tentatively proposed above YNMG-like spatial structure. These transcripts exhibited reasonably high specific infectivity (Table 4, ##9-11), produced early large plaques (Fig. 3A, #9, Fig. 3C, #10) and proved to be genetically stable upon passages. The second group contained 2 genomes with the same CUUG tetraloop but flanked with different base pairs. The first was agCUUGcu (Table 4, #13) known, as already noted, to fold into a structure other than YNMG,41 and the second was auCUUGgu (#12), i.e., flanked as in the wt poliovirus. Both these RNAs were infectious, but while the latter generated early large plaques containing genetically stable viruses, the former produced early heterogeneously-sized, mostly minute plaques (Fig. 3C). This virus acquired mutations changing the tetraloop either into that identical to a member of the “YNMG-like” group (agUUUGcu) or to a true YNMG representative (agCUCGcu) (Table 4). As mentioned above, 4 viruses with the GSYA consensus sequences were selected from the randomized plasmids, and one of such tetraloops, auGCUAgu, was previously shown to exhibit a YNMG-like folding.31 To better understand the properties of the viruses with such sequence consensus, we engineered 7 genomes differing in N4 and N5 as well as in flanking bases; some of these genomes contained tetraloops present in our collection of the SELEX-derived viral RNAs. All of the transcripts of this set generated early plaques of varying sizes and retained after 5 passages the engineered tetraloops (Table 4). The genome harboring the tetraloop with known YNMG-like folding generated large/medium-sized plaques (Table 4, Fig. 3A, #18), similarly with some other representatives of this group (##17, 20). However, other GSYA-possessing viruses appeared to be less fit (##14– 16, 19) and, in contrast to the large-plaque former, were genetically unstable: either T154I or K156R substitutions were detected in 3CD after several passages (Table 4). Thus, the tetraloop of the GSYA sequence with the known YNMG-like conformation appeared to be functional. However, some variants of this sequence consensus required specific alterations in the domain d–binding motif of its ligand. Next, we constructed a genome with the GNRA tetraloop, since no such viruses have been selected from the randomized RNAs. The transcript with the auGAGAgu exhibited a very low specific infectivity (3 orders of magnitude lower than that of the wild-type virus RNA) and generated small plaques relatively late after transfection (Table 4, Fig. 3D, #21), the properties compatible with its quasi-infectious nature. Indeed, the recovered virus possessed a changed tetraloop, auGAUAgu. When a virus with the latter structure was reconstructed, it showed a significantly improved fitness (Table 4, #22). Viral genomes with tetraloops not belonging to any of the above consensuses were also constructed. The underlying idea was not only to investigate functionality of the respective tetraloops but also to look at possible directions to the fitness increase. The engineered genomes proved to be infectious and generated early

RNA Biology

1343

Table 4 Plaque phenotype, specific infectivity and genetic stability of the engineered viral genomes. Detected alterations

##

Tetraloop and flanking bp

Plaque size at 3 day p.t., if not stated otherwise

Relative specific infectivitya

Known (or assumed) foldingb

in the octanucleotidec

in 3Cd

YNMG sequences, paired flanking bases 1 2 3 4 5

auUGCGgu (w.t.) agUGCGcu uuUACGaa auUCAGgu auUGAGgu

Large Large Large Large Large

6 7 8

auUGCGuu acCCCGgg gcCCAGac

Medium Small Heterogeneous, mostly medium

9 10 11 12 13

auUGUGgu acUUUGgu agUUUGcu auCUUGgu agCUUGcu

Large/medium Large Large Large Heterogeneous, mostly minute

14 15 16 17 18 19 20

auGGCAau aaGGCAuu auGGCAgu auGGUAgu auGCUAgu uuGCUAaa auGCUAau

Minute Small Small Large/medium Large/medium Minute Medium

21 22

auGAGAgu auGAUAgu

Minute at day 4 Medium

23 24 25

gcUUGGgc auGCACau agCUGAcu

Small Small Heterogeneous, mostly minute at day 5

26

auUCAGUgu

Minute at a day 4

1 YNMG n. d. (YNMG) n. d. (YNMG) 0.2 (YNMG) 1 (YNMG) YNMG sequences, unpaired flanking bases n. d. Unknown n. d. Unknown n. d. Unknown YNUG sequences 1 (YNMG) 0.3 YNMG 0.3 (YNMG) 0.8 (YNMG) 0.2 gCUUGc GSYA sequences 0.3 Unknown n. d. Unknown 0.5 Unknown 0.7 (YNMG) 0.2 YNMG 1.1 Unknown 0.1 (YNMG) GNRA sequence and a pseudorevertant 0.005 GNRA 0.7 Unknown Other tetraloops, paired flanking bases 0.4 Unknown n. d. Unknown n. d. Unknown Pentaloop 0.04

YNMG-like with N5 flipped out into major groove

n. d. n. d. n. d. n. d. n. d.

n. d. n. d. n. d. n. d. n.d.

aaUGCGuu acCCCGgu gcCCAGgc

None None None

n. d. None None None agUUUGcu or agCUCGcu

n. d. n. d. n. d. None None

None None None None None None None

T154I T154I n. d. n. d. None T154I or K156R n. d.

auGAUAgu None

None None

gcUUUGgc None either agCUCGcu

n.d. T154I or T154I

None

T154I, P89S +T154I, P2S, N34H, P89T

The values in this column correspond to the ratios of this parameter for the engineered and wild-type genome assayed in the same experiment. n.d. – not done. b The relevant references reporting the known folding are given in the main text. Assumptions regarding the likely folding are based on the specific infectivity and plaque phenotype as discussed in the main text. c The changed nucleotides are underlined. d The region of the genome encoding amino acid residues 1 -185 of 3C were sequenced. a

small or heterogeneous primary plaques. The viruses were genetically unstable. Upon passages, some of them acquired mutations leading to the YNMG consensus (agCUGAcu!agCUCGcu and gcUUGGgc! gcUUCGgc). Interestingly, the fitness gain of the “weak” agCUGAcu-harboring virus could be achieved in 2 different ways: instead of the acquisition of a YNMG tetraloop, a mutation in 3CD was observed in one case (Table 4). This observation suggested that although the combination of the tetraloop and 3CD mutations appeared to be optimal for the “strengthening” of the relevant virus, the only alteration of 3CD appeared to be

1344

accompanied with an acceptable fitness gain. The efficiency of this alteration was also demonstrated by its acquisition upon passages of the engineered auGCACau-harboring virus, which retained its non-consensus tetraloop (Table 4, #24). To understand whether the differences in phenotypic properties of the engineered viruses could be ascribed primarily to peculiarities of their domain d tetraloop structures, the Minimum Free Energy modeling of oriL of a number of them (Table 4, ##1 2, 4, 6-8, 13-16, 19, 21-26) was performed. A detectable change in the domain d was revealed in only a single case: the

RNA Biology

Volume 12 Issue 12

Figure 3. Plaque phenotypes of the engineered mutant viruses with the indicated octanucleotides. The plaques were photographed on days 3 (A-C) or 7 (D) after transfection. Each panel presents the results of separate experiments. The flasks are numbered to correspond to the genomes described in Table 4.

tetraloop of the acCCCGgg-containing mutant with the unpaired penultimate base pair (#7) appeared to be re-located from the positions 63-66 to positions 60-63 (UACC), and a 6-nt

bulge was formed at positions 69–74. Thus, this construct may be grouped together with the set of “heterogeneous and others” ones of Figure 2, the nature of infectivity of which will be discussed below. Remarkably, the relocated tetraloop returned back to its place after passages and retained its original YNMG structure. Finally, assuming that a YNMG folding of the apex of domain d is a key determinant of the viral viability, we investigated whether this is the sufficient feature to form a wellfit virus. To this end, a genome was engineered with a pentaloop auUCAGUgu replacing the tetraloop. The first 4 nt of this pentaloop were reported to form a YNMGlike structure, whereas the fifth one protrudes into the major groove45 (Fig. 4). The relevant transcript exhibited a very low specific activity Figure 4. Schematic representation of spatial structures of cUACGg (PDB ID: 1TXS) and cUCAGUg (PDB ID: (Table 4) and generated small 1Q75). The first (U, green) and the fourth (G, yellow) nucleotides of the both loops form non-canonical antiplaques at late times post-transfecsyn pairs. The fifth nucleotide (U, red) of cUCAGUg is protruded into the major groove. tion (Fig. 3D, #26). The viruses

www.tandfonline.com

RNA Biology

1345

recovered after a series of plaque, bulk, and low-multiplicity passages retained the engineered pentaloop but acquired various mutations in the sequenced region of the protein 3CD, including the T154I substitution (Table 4). Thus, a pentaloop with the YNMG-like folding appeared to be an acceptable structure but only if certain adaptive changes in its ligand protein were available (see also Discussion). Efficiency of RNA replication of oriL mutants To ascertain whether alterations of viral fitness/viability resulting from modifications of the tetraloop structure were due to changed efficiency of the genome replication, the time-course of accumulation of viral RNA in Vero cells transfected with some engineered RNAs was assayed by the quantitative PCR. First, efficiency of RNA replication of large-plaque formers with tetraloops representing sequence consensuses auUGAGgu (YNMG) and auUGUGgu (YNUG) was investigated and found to be essentially indistinguishable from that of the wild-type virus (Fig. 5A). Then, effects of 2 highly debilitating mutations were studied. As indicated above, the fitness of viruses with CUUG tetraloops markedly depended on the nature of the flanking bases, in a good correlation with the different folding of this element. As shown in Figure 5B, efficiency of genome replication of the auCUUGgu-containing virus was very similar to that of its wild counterpart, whereas the replacement of the flanking bases by g2-c7 resulted in a significant delay in the onset of RNA replication and >100-fold decrease in the amounts of RNA molecules synthesized by 15-24 h post-transfection. It may be reminded that the former tetraloop was proposed to fold into a YNMG structure, while the latter was demonstrated to acquire a distinctly different folding. In another experiment, replication of a genome with the auGAGAgu tetraloop (the GNRA fold) was

compared with that of its fitter pseudorevertant, auGAUAgu (Fig. 5C). The fitness gain correlated with a marked increase in the efficiency of RNA replication. Also, genome replication of a virus with auGCUAgu (a GSYA representative proposed to exhibit a YNMG-like folding) was assayed in this experiment. Its efficiency approached that of the wt RNA. Thus, the above experiments demonstrated a good correlation between genome replication and plaque phenotype of engineered viruses, strongly suggesting that alterations of the structure of the apex of the domain d affected primarily efficiency of the viral RNA synthesis. Interaction of mutated oriL with the viral protein 3CD To ascertain whether deficient replication of the viruses with certain oriL mutations was primarily due to impaired recognition of this cis-element by its protein ligand, 3CD, the electrophoretic mobility shift assays (EMSA) were performed. As interacting partners, we used 50 -terminal 115 nt-long fragments of mutant viral RNAs and recombinant His-tag-purified poliovirus 3CD protein harboring a mutation preventing its auto-proteolysis (see Materials and Methods). The results were visualized by RNA staining with ethidium bromide (EtBr) and 3CD detection by Western blotting. Two independent experiments with different preparations of oriL and 3CD and similar results were carried out, and the results of one of them are presented in Figure 6. EMSA with wt oriL (lane 1) demonstrated formation of 2 complexes visualized with EtBr and anti-3CD antibodies but only the slower-migrating upper one contained both oriL (as evidenced by its absence in the oriL-lacking sample) and 3CD (judging by its re-isolation from the complex followed by identification by SDS-PAGE or MALDI-MS). The faster-migrating complex represented an artifact, perhaps caused by incomplete specificity of our preparation of the anti-3CD antibodies and

Figure 5. Time course of replication of the engineered mutant viral genomes. Vero cell monolayers were transfected with transcripts (200 ng/well) of the relevant plasmids encoding full-length engineered viral genomes, and efficiency of their replication was assayed by real-time PCR. (A) Genomes of viruses with tetraloops belonging to the YNMG and YNUG sequence consensuses. (B) Genomes with the CUUG tetraloop flanked by different base pairs. (C) Genomes with the GAGA tetraloop, its GAUA pseudorevertant (a representative of the GSYA sequence consensus) and the auGCUAgu (also GSYA) tetraloop. All panels include also the wild-type viral RNA. Standard deviations are presented.

1346

RNA Biology

Volume 12 Issue 12

efficiency of genome replication of the relevant viruses as well as with the known and proposed structural features of the domain d of poliovirus oriL.

Discussion In view of relative infidelity of their replication machinery, it is highly advantageous for RNA viruses to be relatively tolerant to mutational alterations. This is particularly important because the natural viral transmission often involves bottleneck situations, when the establishment of a new viral population depends on the fitness/viability of a few viral particles, or even a single one. The present work was aimed at elucidating the extent and the nature of the mutational tolerance of an exemplary RNA/protein interaction, that between the cis-element oriL of poliovirus RNA and the viral protein 3CD. Figure 6. Efficiency of interaction of mutant oriLs with the recombinant 3CD. The 5’-terminal 115 nt-long fragments of mutant viral RNAs were incubated with the recombinant 3CD and electrophoresed as described in Materials and Methods. The results were visualized by EtBr staining (A) and western blotting with anti-3CD antibodies (B). Values below the gels represent optical density of the upper complex of panel B relative to that formed by the wild-type virus calculated using OneDScan program (Scanalytics Inc., Fairfax, USA). The upper bands at the lanes starts in the panel B correspond to unspecific RNA/3CD aggregates as they are present in samples containing tRNA (from calf liver, Boehringer Manheim GmbH, Germany) instead of oriL.

seemingly resulting from interaction of oriL with a bacterial protein(s) (perhaps SlyD, as suggested by preliminary results of MALDI-MS). Thus, the specificity and efficiency of the oriL/ 3CD interaction could be judged by the formation of the upper complex and its optical density in the Western blot gels. The following main conclusion emerged from the experiment shown in Figure 6. The tetraloops with known non-YNMG folding from low-fitness, genetically unstable and/or quasi-infectious genomes exhibited no or negligible affinity to 3CD, whereas tetraloops endowing viruses with a good fitness (and shown or proposed to have a YNMG-like spatial structure) exhibited good/ acceptable affinities to this protein ligand. This regularity is clearly evident upon comparison of the EMSA results obtained with the contrasting pairs of oriL: auGAGAgu (a “bad” GNRAfold) and its more fit pseudorevertant auGAUAgu (lanes 2 and 3); auGCUAgu (a GSYA sequence with YNMG-like fold from an efficient virus) and uuGCUAaa (another GSYA representative from a genetically unstable virus with unknown, likely nonYNMG, folding) (lanes 4 and 7); agCUUGcu (definitely nonYNMG folding from a poor genome) and auCUUGgu (with changed flanking pairs and distinct, possibly YNMG-like structure from a large plaque-former) (lanes 5 and 6). Also, the pentaloop-containing RNA (with a YNMG-like structural motif, which proved insufficient by itself to ensure viability of the virus) did not appreciably interact with 3CD. Thus, the strengths of interactions of differently modified oriL with 3CD correlated well with the phenotypic properties and

www.tandfonline.com

Promiscuity, though selective For proper functioning, interaction between essential genomic cis-elements and their dedicated ligands should be highly specific in order to avoid interference from unauthorized intruders. Generally, the need for specificity imposes significant restrictions on the structure of the interacting partners. However, our SELEX in vivo approach revealed, quite unexpectedly, that any position in the octanucleotide comprising the tetraloop of domain d and 2 adjacent base pairs in a non-exhaustive set of viable polioviruses can be occupied by any nucleotide (with only a single exception, absence of U at N6) (Fig. 2). At the same time, the occupancy of these positions was obviously nonrandom (Table 1). Half or more of N3, N5, and N6 positions were occupied by U, C, and G, respectively. The occupancy of flanking positions (N1, N2, N7, N8) was not haphazard either. A closer look at individual sequences revealed a further level of selectivity. Tetraloops with a YNMG sequence consensus constituted approximately a half of structures in the selected viruses, the majority of them being flanked with 2 Watson-Crick or wobble base pairs (Fig. 2). Such tetraloops are known to possess a characteristic stable fold.32-35 Remarkably, several detected nonYNMG tetraloops, especially of YNUG and GSYA consensus sequences, can also adopt a YNMG-like conformation as was demonstrated earlier for acUUUGgu.40 and auGCUAgu.31 These observations strongly argued that the YNMG-like conformation of this tetraloop was a key determinant of its functionality. On the other hand, the selected set of tetraloops was obviously biased against certain structures with stable nonYNMG conformations, such as GNRA and gCUUGc. Both these notions, the functionality of YNMG-like tetraloops and inadequacy of tetraloops with different stable folding were confirmed by the engineered viral genomes. A unifying hypothesis Besides tetraloops with the known YNMG-like structures, the SELEX approach generated a set of tetraloops with distinctly different or unknown folding. Nevertheless, we would like to consider a hypothesis according to which the domain d tetraloop, to

RNA Biology

1347

interact functionally with 3CD, should acquire stably or temporarily a YNMG-like conformation. Accordingly, we assume that those oriLs which endow the poliovirus genome with adequate fitness (judging by a high specific infectivity and capacity to form early large plaques) harbor a tetraloop of a YNMG-like folding (Table 4). We also propose that any other tetraloops that may adopt such conformation even only temporarily are potentially compatible with viral viability, the fitness of relevant viruses depending on the proportion of time during which this tetraloop may exhibit a YNMG-like folding and hence the likelihood of being captured by the ligand. This hypothesis is based on 2 general principles, the dependence of the specificity of RNA/protein interactions on their distinctive/unique structural features and on the dynamic nature of RNA folding. By using different approaches, it is definitely shown that RNA molecules, and their tetraloops in particular, may undergo conformational changes in a wide range of timescales.46,47 Due to this dynamic nature, even rather stable tetraloops (for example, of the GNRA class) may temporarily be folded in a great variety of ways.48 Thus, tetraloops are presenting to their potential ligands a choice of conformations, and the ligand may capture the relevant one, even if this conformation is not the predominant form.49 Adopting a “good” conformation by RNA cis-elements may be facilitated by their interaction with the ligand not only as a result of capture/fixation but also through an “induced fit” mechanism.50,51 The stability of tetraloops vary significantly not only among those with distinctly different primary structures but also between representatives of the same sequence consensus, e.g., YNMG.35 This may be a key factor controlling the affinity of a given tetraloop for a given ligand. On the one hand, a certain level of stability may be advantageous because the better (longer) is the relevant folding represented in the space of possible conformations of this tetraloop, the more recognizable it will be for its dedicated ligand. On the other hand, the instability of certain “bad” conformations may increase the chances of temporarily adopting a “good” one. Such a mechanism was likely responsible for the viability of the low-fit non-YNMG-possessing genomes, for example, the engineered acCCCGgg-containing RNA (Table 4, #7) apparently maintaining, as suggested above, predominantly a “bad” conformation. Thus, we propose that the YNMG-like fold is the foremost, if not the sole, factor required for the recognition of domain d tetraloop by 3CD protein. The validity of this proposal should be checked by further studies.

Possible structural elements involved in the oriL/3CD recognition What peculiarities of the YNMG-like conformations of the tetraloop might be relevant for its specific recognition by 3CD? The distinctive features of such conformations are as follows. The first (N3) and the last (N6) nucleotides of the tetraloop are forming a non-canonical anti-syn pair (Fig. 4), which stacks onto the flanking N2-N7 pair. The base of N4 swings into the minor grove, whereas the base of N5 stacks onto the N3-N6 pair.

1348

As noted above, the “YNMG-like” does not necessarily means “identical," and some subtle differences may exist between different representatives of the group, as for example, is the case with the UUCG and GCUA tetraloops.31 In both cases, the base of N5 is in the minor grove but it is either protruded into solvent (in UUCG) or descends into the grove, rendering it less accessible to solvent (in GCUA). The fact that both these tetraloops exhibited comparable efficiencies suggests, in accord with an earlier proposal,52 that the minor grove hardly plays a significant role in the interaction with 3CD. Likewise, the relevance of the major grove in this respect was indirectly supported by the results obtained with the pentaloop auUCAGUgu. Its first 4 nucleotides are supposed to form an YNMG-like structure and the base of the fifth nucleotide protrudes into the major groove45 (Fig. 4), creating steric hindrance at the 30 -side of the tetraloop between its first base pair and the flanking base pair. Such structure proved to be recognized by 3CD very poorly. Although the participation of the major grove in the oriL/3CD interaction seems quite plausible, the nature of specific chemical groups involved is more problematic. Further studies are needed to elucidate this issue in more detail. The role of flanking pairs seems to depend on the sequence of the relevant tetraloop. Thus, the functionality of bona fide YNMG appeared to be largely independent on the nature of the flanking pairing, provided it exists. In this case, the conformation is stabilized not only by stacking of N5 onto the N3-N6 pair but also by the formation of an H-bond between N5 and the sugarphosphate backbone. The lack of this additional stabilization might be the reason for a greater dependence of some YNMGlike tetraloops on the structure of the adjacent base pairs, exhibiting different strengths of pairing and/or stacking. In confirmation of earlier studies,14 we also observed that the functionality of some “bad” tetraloops could be markedly improved by alterations in the oriL-binding moiety of protein 3CD, typically by replacing TGK by TGR or IGK, suggesting that this motif is directly involved in the oriL recognition. However, the nature of chemical interacting groups of these partners is yet to be determined. It should also be noted that our analysis was markedly simplified by focusing only on certain short stretches of nucleotides and amino acids involved in the oriL/3CD recognition. Other structural elements of these ligands may affect their mutual affinity and/or functional outcome of their interaction. An important role of the structural motifs of hairpin d outside the tetraloop was reported.53 Moreover, it was proposed that in some rhinoviruses the stem of this domain rather than the tetraloop plays a major role in the oriL/3CD recognition.54 Also, it is known that 3CD mutations outside the TGK motif, e.g., in the KFRDI sequence (another RNA-binding motif) can profoundly affect the affinity of this protein to oriL.12,54 Thus, to gain a deeper insight into mechanistic aspects of oriL/3CD interaction in different enteroviruses further studies are needed. Viral phenotypes and the oriL/3CD affinity This study was initiated on the premise that the primary function of the apex of domain d consists in the recruitment of viral

RNA Biology

Volume 12 Issue 12

protein 3CD to the RNP complex to initiate synthesis of viral RNA strands. However, in view of the multi-functionality of the oriL (see Introduction), it could not be ruled out that this element might play also some other important roles. Although such a possibility cannot be rigorously excluded, our results demonstrated that the affinity between the domain d tetraloop and 3CD correlated well with both the viral fitness and efficiency of the replication of viral genomes. This correlation, however, may not necessarily be strictly linear because the occurrence of the tetraloop in a non-YNMG state may affect viral fitness also indirectly, for example, by increasing its affinity to non-specific competitor ligands. This reservation made, we may conclude that it is the specific oriL/3CD interaction that is remarkably tolerant to alterations of the primary structure of its RNA component. Robustness and resilience The structure of the tetraloop of domain d in natural polioviruses is remarkably conserved and is represented in the GenBank only by sequences of the YRCG (a subset of YNMG) consensus. The contrast between the potential promiscuity and such natural conservatism illustrates the existence of mechanisms allowing the virus to retain the structure of its essential cis-element in the most efficient conformation despite infidelity of the replicative machinery. But first, this element should be relatively tolerant to various alterations and our study demonstrates that this tolerance is based on 2 distinct mechanisms. The first is robustness, defined as “the invariance of phenotypes in the face of perturbation,"55 which is largely due in our case to the degeneracy of the RNA spatial structure: a significant number of diverse sequences are able to relatively stably maintain similar mutual orientation of atomic groups needed for specific interaction with 3CD. The second mechanism involves the following events. Even if mutations disturb the specific spatial structure and, as a consequence, its recognizability by the dedicated ligand, they may not necessarily kill the virus. We propose that this is due to the dynamic nature of RNA folding that may allow the cis-element to temporarily acquire a structure resembling the functional conformation. As a result, the specific interaction with the dedicated ligand could occur, and such genomes would encode a low-fit but viable virus exhibiting a minimal level of RNA replication. Then, due to the infidelity of the viral RNAsynthesising machinery, reverse or compensatory mutations in the cis-element may be acquired and selected for. This three-step recovery of wild-type phenotype after its impairment – temporary acquisition of functional conformation, procurement of correcting mutations and negative selection – may be called resilience, in distinction with the robustness. Our results demonstrated that in the studied setting resilience might involve 2 pathways: the problem caused by mutational inactivation/debilitation of the tetraloop can be solved by either restoration/acquisition of the YNMG-like folding or, as was also demonstrated previously,14 by changing the recognizing specificity of its ligand. How is the optimal solution chosen? It may be hypothesized that alterations in the TGK-containing structure of 3CD are associated with some fitness loss and therefore compensatory mutations in the tetraloop are preferable. If, however, the

www.tandfonline.com

tetraloop defect is very severe and its improvement could not be achieved in one (or perhaps 2) mutational step(s), then a changed 3CD is selected. Of note, the conversion of TGK into IGK or TGR may require only a single transition in both cases (codon changes from ACU to AUU and from AAA to AGA respectively). Obviously, either solution (alterations of the domain d or protein 3CD) is only possible, if the invalidated oriL retains some minimal functionality, permitting a certain level of genome replication needed for the appearance of compensating mutations. If this is impossible, the relevant genome will be dead, as illustrated in Table 3. Thus, these 2 mechanisms, robustness and resilience, are major factors endowing viral RNA genomes with their remarkable tolerance to mutational alterations. It would be interesting to estimate, admittedly roughly, relative contributions of these 2 mechanisms to the mutational tolerance of the wt poliovirus oriL. To what extent would each of them operate in the case of a single mutation caused by the replication infidelity? The tetraloop of this virus, auUGCGgu, belongs to the YNMG class of sequences, and according to our results, all mutations not changing this consensus, as well as one that leads to the UGUG sequence, should not markedly affect the viral phenotype. Thus, out of 12 possible substitutions at least 6 (one, 3 and 2 mutations at N3, N4 and N5, respectively) are not expected to appreciably affect viral fitness due to the robustness of the cis-element. Although the remaining 6 mutations in the tetraloop may be fitness-decreasing, all or nearly all of them would unlikely kill the virus, as suggested by the demonstrated above possibility of occupancy of each position of the tetraloop by any nucleotide, with a single possible exception. The invalidated mutants might subsequently regain full efficiency due to the resilience mechanism. If a mutation targets a position in the octanucleotide (the tetraloop and 2 flanking pairs), a similar line of reasoning will result, under the assumption that unpairing of one of the flanking pair would not change the phenotype, in the estimate that at least 18 out of 24 possible mutations would be fully tolerated (robustness), whereas the remaining 6 would generate viable, though possible debilitated, viruses able to regain their full fitness (resilience). Evolutionary implications This study demonstrated that numerous different sequences of poliovirus oriL are compatible with the viral viability, and that a significant number of them could be found in apparently well-fit laboratory-selected or engineered viruses. Nevertheless, as mentioned above, the variability of this structure in natural polioviruses appears to be restricted to the tetraloops with a YRCG sequence. Such tetraloops appear to endow the genome with an optimal fitness. Also, in spite of the fact that certain mutations of the TGK motif of 3CD may be beneficial under certain conditions, naturally circulating polioviruses invariably (judging by the GenBank) retain just this tripeptide. This conservatism may hint that just these structures of the interacting ligands are preferable over many others and therefore retained by selection. They may participate in some reactions other than oriL/3CD interactions or depend on some structural features of these partners, which were not taken into account here. Such strong conservatism

RNA Biology

1349

appears to be due to the combined effects of the genome robustness and resilience. On the other hand, both these mechanism, and especially resilience, may be important factors of the genome evolvability. Indeed, strongly debilitating but not deadly mutations may convert the genome into a metastable state, when a wide spectrum of fitness-increasing mutations can be explored. Indeed, as demonstrated above, the acquisition of the optimal fitness by weak genomes could be accomplished by following different trajectories (the actual number of which was likely much higher than observed here). This situation may allow the genome to cross deep depressions in the fitness landscape. In this regard, it should be noted that the relevant structures of oriL and 3CD in other enteroviruses might noticeably differ from those of poliovirus. Just to give some examples, oriL of some rhinoviruses is represented by a triloop of U(U/A)Y sequence and 3CD of rhinoviruses may have instead of the TGK motif various tripeptides (e.g., IGQ, IGS, IGL VGS, VGN, VGK, and VGQ). The hairpins d of different enteroviruses may or may not be functionally interchangeable.56,57 It is quite plausible that all these variations have evolved from the unknown founder enterovirus and that the resilience played a decisive role in this evolution. In more general terms, our study describes important additions to the list of various natural tools ensuring maintenance/ correction of the fitness of RNA viruses.3,58,59 and which may markedly affect their evolvability.60-64 Concluding remarks The present study provides an insight into how an essential replicative cis-element of poliovirus RNA is recognized by its protein ligand and how its structure is maintained during viral evolution. More generally, it helps solve the contradiction between the infidelity of replication of RNA viruses and the need to retain strict specificity of their genetic cis-elements. A crucial issue is that it is the spatial structure rather than nucleotide sequence that is a key feature recognized by its dedicated protein ligand. This fact itself permits a significant level of promiscuity because a specific structure may be generated by a variety of sequences. In addition, it was demonstrated that numerous conformationchanging, clearly adverse mutations of this essential, highly specific and evolutionary conserved RNA structure may not be lethal, conceivably because of its ability to temporarily adopt a variety of spatial structures, including a functional one, due to the dynamic nature of RNA folding. Even if the functional capacity of this element is profoundly jeopardized but is not lost completely, there is a marked potential for the full recovery as a result of the infidelity of genome replication ensuring easy acquisition of compensatory mutations followed by selection, which eventually restores the optimal spatial structure. There is an emergency route as well. If a mutation(s) alters the structure of an RNA cis-element so gravely that it cannot readily be repaired but still retains a minimal level of functionality, the fitness of the genome can be reestablished by mutational adjustment of its ligand. Such regularities may have general relevance also for the evolvability of RNA viruses, especially taking into account that natural

1350

transmission of them often includes bottlenecking events, involving a few or even single infectious particle. An important feature of the evolutionary scenario discussed here is the occurrence of strongly invalidating events resulting in the metastable state of the viral genome, which permits overcoming gorges in the fitness landscape through a repertoire of fitness-increasing intermediates.

Materials and Methods Generation of the basal plasmid A unique SplI restriction site was introduced at positions 111/ 112 of the poliovirus RNA in the fragment of the viral genome (positions 66-1129) in the phage M13-based plasmid pBM1.65 This was done by using the antisense mutagenic primer SPLI complementary to positions 105-124 (Table 5) and the protocol described previously.66 A fragment between KpnI and ScaI sites (coordinates 71-988) was excised from this intermediate. The plasmid pT7PV1SplI containing the full-length viral genome was assembled by the 3-fragment ligation using the above fragment as well as the 4888 nt-long KpnI-BglII and 4616 nt-long ScaI-BglII fragments from the pBR322-based plasmid pT7PV1.65 To introduce the sequence of a hammerhead ribozyme between the T7 promoter and viral genome, 2 PCR reactions with pT7PV1SplI as template and the antisense primer SPL1 and sense primers Rib2 and BHT7Rib1 (Table 5), containing partial ribozyme sequence, were performed to generate a fragment spanning between BamHI (in the pBR322 sequence) and SplI (in the viral sequence) containing the T7 promoter, ribozyme, and 111 5’-terminal poliovirus nt. This fragment was used in the 3-fragment ligation together with the BamHI-EcoRI and EcoRI-SplI fragments of pT7PV1Spl1 to produce the plasmid pT7PV1Rib. Unique restriction sites, MluI and SacI within a region encoding the viral protein 3C at positions 5861/5862 and 5952/5953 of the viral genome, respectively, were introduced in this plasmid by fusion PCR reactions (details of this procedure are available upon request) to generate the basal plasmid pT7PV1RibMS. These restriction sites were used in parallel experiments to be reported elsewhere. Generation of the plasmid with a randomized octanucleotide A 130 base pair-long synthetic DNA fragment SolD (Table 5) corresponding to a portion of the plasmid pT7PV1RibMS but with the randomized octanucleotide at the apex of domain d of oriL (positions 61-68 of poliovirus RNA) was purchased from Isogen Bioscience BV (The Netherlands). This fragment [containing the ApaI (fused to a portion of the ribozyme sequence) and SplI sites] was used as template in the PCR reaction with the primers Rib2 and SPL1 (Fig. 1B). The reaction mixture containing 10 pmoles SolD and 60 pmoles of Rib2 and SPLI primers was subjected to 10 cycles of heating/ cooling (20 sec at 55 C, 20 sec at 72 C, 15 sec at 95 C). The product was treated with ApaI and SplI endonucleases (Fermentas, Vilnius, Lithuania), purified by electrophoresis in 2.5% agarose, and ligated to a large fragment obtained upon digestion of pT7PV1RibMS with ApaI and SplI (Fig. 1B).

RNA Biology

Volume 12 Issue 12

Table 5 Oligonucleotides used. ##

Oligonucleotide

1 2 3 4

SPLI Rib2 BHT7Rib1 SolD

5 6 7 8 9 10 11 12 13 14 15 16 17

mut-s mut-a 3EP4 DEN3 H40As H40Aa 3CD3’ 3CD5’ B5594 DP7 PVL1 PVR1 PVP1

Sequencea CTTGGTTTcGTaCGTCTAAG gaggccgaaaggccgaaaagggcctatgggcccttcTTAAAACAGCTCTGG ctggatcctaatacgactcactatagggtgttttaactgatgaggccgaaaggccg gacgggcccttcTTAAAACAGCTCTGGGGTTGTACCCACCCCAG AGGCCCACGTGGCGGCTAGTACTCCGGT(N8)ACCCTTGTAC GCCTGTTTTATACTCCCTTCCCGTAACTTAGACGTACGAA CTCCGGT(mut-s)ACCCTTGc GT(mut-a)ACCGGAGTACc TTTTTTTTTTTTTTCTCCG GAAACAGAAGTGCTTGTTCG ACCAACCgcCGCTTCACCTG GAAGCGgcGGTTGGTAAAATAG gcgcgcggccgcAAATGAGTCAAGCCAACG gccatgGGACCAGGGTTCGATTAC GAAGTGGAGATCTTGGATGCC TTCCTTCGAAGGTCTCATCC GGCAGACGAGAAATACCCAT CGAACGTGATCCTGAGTGT FAM-GTTGATTCATGAATTTCCTTCATTGGCA-BHQ1d

Position in the genome 105–124, complement 1–15 NAb 1–118

54–75 51–70, complement 7438–polyA 158–177, complement 5548–5567 5541–5562, complement 7352–7369, complement 5438–5458 5594–5614 5987–6019, complement 7122–7141 7210–7229, complement 7160–7186

a

The mutation-generating and nonviral nucleotides are in small case letters. Non-applicable. c The mut-s and mut-a stand for various distinct mutagenic octaucleotides of sense and anti-sense polarity, respectively. d FAM - 6-carboxyfluorescein; BHQ1 - black hole quencher 1. b

Construction of viruses with the desired mutations Since the viruses generated by the SELEX procedure (see below) not infrequently contained mutations outside the apex of domain d, certain analogous genomes lacking these undesired mutations were constructed. To this end, RNA were isolated from preparations of the relevant viruses and a segment encompassing the 50 -end of the genome up to position 124 was generated by PCR using the Rib2 and SPLI primers. The product was digested with ApaI and SplI and used to generate constructs encoding the full-length viral genome, as described in the preceding paragraph. To generate plasmids encoding viral genomes with novel mutations, pairs of oligonucleotide primers containing a specific mutagenic sequence (mut-s) or its complement (mut-a) (Table 5) at one end and either SPLI or Rib2, at the other, were used in 2 separate PCRs with pT7PV1RibMS as template. The products obtained in each pair of these reactions were fused together in an additional PCR with Rib2 and SPL1 primers, digested with ApaI and SplI, and used to generated plasmids encoding the full-length viral genome as above. E. coli transformation and preparation of DNA E. coli TOP10 cells (Invitrogen, Carlsbad, California) were transformed by the plasmids, and the plasmid DNA was isolated from individual or pooled clones as described.67 Transcription and transfection Purified plasmid DNA was linearized by digestion with EcoRI and transcribed as described.65 The DEAE-dextran-mediated transfection of Vero cells was carried as described.65 For pools of

www.tandfonline.com

20, 100, 300 and 900 plasmid variants, the transcription reaction mixtures were used directly for transfection, and the content of viral RNA in them was estimated by EtBr staining in 1% agarose gel. For pools of 2500 variants, the genome RNA was purified by centrifugation in 5–20% sucrose gradients,65 and the concentration of RNA was determined spectrophotometrically. Sequencing viral genomes The material from a plaque was suspended in 0.3 ml of the nutrient medium. RNA was isolated by either phenol-chloroform extraction, or with the Trizol reagent (Invitrogen) or with the Qiagen RNAeasy kit (Qiagen, Hilden, Germany) and reverse transcribed by using random or 3EP4 (Table 5) primers. For generation of oriL-containing PCR products, primers Rib2 and DEN3 (Table 5) were used. The PCR products were gel-purified and sequenced either manually using afmolÒ DNA Cycle Sequencing System (Promega, Fitchburg, Wisconsin) or by automatic sequencers Beckman Coulter Seq 8000 or ABI 3130 Genetic Analyzer. Time-course of viral RNA replication Vero cells monolayers grown in 6-well panels (Corning Inc., Corning, NY; »2.4 105 cells/well) were transfected with 200 ng RNA transcripts/well, and the total RNA was extracted with the Trizol reagent 0, 10, 12,16, 20 and 24 h post-transfection (p.t.). Three wells were used as parallels for each time point. One mg of the purified RNA was used for reverse transcription with primer 3EP4 and the SuperScriptII Reverse Transcriptase (Invitrogen). The standard curve was generated by serial dilutions of the wild-type transcript supplemented with 1 mg RNA from mock-transfected Vero cells.

RNA Biology

1351

Real-time PCR was carried out by using ABI 7500 Real Time PCR System analyzer with primers PVL1 and PVR1 and FAM-tagged oligonucleotide PVP1 (Table 5) as the probe. 3ED expression and purification The fusion PCR product encoding the 55 N-terminal amino acid residues of the 3C protein with the introduced mutation H40A (to inactivate its proteolytic activity) was generated with primers 3ED50 , H40Aa, H40As, and DP7 (Table 5) with pT7PV1RibMS as template. The NcoI –BgllI fragment (positions 5432-5606) was cloned into the pQE60 expression vector (Qiagen). The rest of the 3CD coding sequence (positions 56077369) was cloned using the BgllI sites. PCR fragment for restriction and cloning was performed by using primers B5594 and 3D3’ (Table 5) and pT7PV1RibMS as template. The sequence of the resulting plasmid pQE60-3CD was verified by sequencing. The plasmid was used for the transformation of E. coli JM109 cells. The transformed cells in 200 ml of SOB medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 20 mM glucose) containing 100 mg/ml ampicillin were grown in a rotary shaker for 4-5 h at 37 C. The medium was changed to the one lacking glucose and containing 2 mM IPTG, and incubated overnight at room temperature. The suspension was centrifuged and the pellet was suspended in a solution containing 50 mM Tris-HCl, pH 7.5, 1 M NaCl, 100 mM MgCl2, 4 mM 2-mercaptoethanol, 2 mM PMSF and 7 mg/ml lysozyme. The suspension was incubated for 40 min at 4 C and sonicated thrice for 15 sec. After centrifugation, the supernatant was loaded onto the His-select 1 ml column (Sigma Aldrich, St. Louis, Missouri). The column was washed with 10 ml of 50 mM Tris¡HCl, pH7.5, 500 mM NaCl, 5% glycerol, 4 mM 2-mercaptoethanol and with 10 ml of the same buffer with 15 mM imidazole. The protein was eluted with the same buffer containing 300 mM imidazole. Generation of anti-3CD antibodies Mice were immunized with 25 mg of recombinant 3CD in PBS mixed with the Freund adjuvant (Calbiochem, Los Angeles, California) (1:1 by volume) by subcutaneous injection. The 2nd injection was made after 10 days followed by 4 injections with weekly intervals. After 5 additional days, the last injection of 3CD without adjuvant was made intraperitonealy together with 0.5 ml of Ehrlich ascites carcinoma cells. The ascites fluid and serum were collected after 10 days, centrifuged, and the supernatant was mixed with equal volume of glycerol and stored at -20 C.

fragment was ground, suspended in 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 2 mM EDTA, 0.1% SDS and the suspension was filtered through 0.45 mm Millipore filter. The resulting material was loaded onto a DEAE-Sepharose (Pharmacia, Uppsala, Sweden) column and washed with the same buffer without SDS. RNA was eluted with the latter buffer containing 1 M NaCl. The RNA-containing fractions were concentrated with butanol, extracted with one volume of chlorophorm and precipitated with isopropanol and NH4 acetate. For the EMSA, 3CD was transferred into a buffer containing 20 mM Tris-HCl, pH 8.0, 250 mM NaCl, 5% glycerol, 2 mM DTT by Sephadex G-75 gel-filtration. Fifteen ml of this solution (150 ng/ml) were mixed with 1 ml RNA (100 ng in water) and 1.6 ml 25 mM MgCl2 and incubated at 32 C for 15 min. The mixture was supplemented with 1.7 ml of 0.1% bromophenol blue in 50% glycerol and electrophoresed in the prerun native polyacrylamide gel in 2£TB buffer (17.8 mM Tris, 17.8 mM boric acid, pH 8) and 5% glycerol. After electrophoresis, the gel was stained with EtBr or transferred onto a nitrocellulose filter for Western-blotting with anti-3CD antibodies as described.69 MALDI mass spectrometry The protein bands were excised from the EMSA gel stained with Coomassie brilliant blue R-250. The samples for mass spectrometry were prepared as described.70 The mass spectra of trypsin-digested proteins were obtained using a MALDI-TOF/TOF mass-spectrometer (UltrafleXtreme, Bruker Daltonics, Germany) equipped with Nd laser in reflecto-mode. Monoisotopic [MH+] ions were measured in the 700-4500 m/z range with a tolerance of 50 ppm. To analyze mass spectra, FlexAnalysis 3.3 software (Bruker Daltonics) was used. The proteins were identified using the MASCOT search software (“peptide fingerprint” option; www.matrixscience.com). The search was carried out in databases NCBI. Candidate proteins were considered as reliably identified when score > 83.(p < 0.05) OriL conformation modeling The Minimum Free Energy (MFE) structures were calculated for the 50 -terminal 120 nt-long segments of viral RNA, using the Vienna RNA Web Services (http://rna.tbi.univie.ac.at/cgi-bin/ RNAfold.cgi).71

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed. Electrophoretic mobility shift assay (EMSA) and western-blotting RNA fragments corresponding to the 50 -terminal 115 nt of PV1 RNA were generated by transcription of SplI-linearized plasmids containing different variants of domain d sequence. The transcripts were gel-purified as described,68 with minor modifications. The samples were loaded onto the gel containing 2.5£TAE buffer (100 mM Tris, 50 mM acetic acid, pH 8.0, 2.5 mM EDTA) and 6 M urea; the band containing the desired

1352

Acknowledgments

This study has been supported by grants from the Russian Scientific Foundation (15-15-00147), Russian Foundation for Basic Research (02-04-48483, 05-04-48540, 08-04-00494 and 11-0400226-2), NWO-RFBR (047.017.023) and INTAS (01-2012). We are grateful to Maria Garber and Svetlana Tishchenko for sharing their experience in the RNA and protein purification.

RNA Biology

Volume 12 Issue 12

References 1. Drake JW, Holland JJ. Mutation rates among RNA viruses. Proc Natl Acad Sci U S A 1999; 96:13910-3; PMID:10570172; http://dx.doi.org/10.1073/pnas. 96.24.13910 2. Sanju
an R, Nebot MR, Chirico N, Mansky LM, Belshaw R. Viral mutation rates. J Virol 2010; 84:973348; http://dx.doi.org/10.1128/JVI.00694-10 3. Lauring AS, Frydman J, Andino R. The role of mutational robustness in RNA virus evolution. Nat Rev Microbiol 2013; 11:327-36; PMID:23524517; http:// dx.doi.org/10.1038/nrmicro3003 4. Agol VI. Picornavirus genome: An overview. In: Semler BL, Wimmer E, editors. Molecular Biology of Picoirnaviruses. Washington DC: ASM Press; 2002. page 127-48 5. Palmenberg A, Neubauer D, Skern T. Genome organization and encoded proteins. In: Ehrenfeld E, Domingo E, Roos RP, editors. The Picornaviruses. ASM Press; 2010. page 3-17 6. Rosovics MJ, Semler BL. Genome replication I: the players. In: Ehrenfeld E, Domingo E, Roos RP, editors. The Picornaviruses. ASM Press; 2010. page 107-25 7. Kirkegaard K, Semler BL. Genome replication II: the process. In: Ehrenfeld E, Domingo E, Roos RP, editors. The Picornaviruses. ASM Press; 2010. page 127-40 8. Liu Y, Wimmer E, Paul AV. Cis-acting RNA elements in human and animal plus-strand RNA viruses. Biochim Biophys Acta 2009; 1789:495-517; PMID:19781674; http://dx.doi.org/10.1016/j.bbagrm.2009.09.007 9. Rivera VM, Welsh JD, Maizel JV. Comparative sequence analysis of the 5’ noncoding region of the enteroviruses and rhinoviruses. Virology 1988; 165:4250; PMID:2838971; http://dx.doi.org/10.1016/00426822(88)90656-3 10. Andino R, Rieckhof GE, Baltimore D. A functional ribonucleoprotein around the 50 end of poliovirus RNA. Cell 1990; 63:369-80; PMID:2170027; http:// dx.doi.org/10.1016/0092-8674(90)90170-J 11. Ogram SA, Flanegan JB. Non-template functions of viral RNA in picornavirus replication. Curr Opin Virol 2011; 1:339-46; PMID:22140418; http://dx.doi.org/ 10.1016/j.coviro.2011.09.005 12. Andino R, Rieckhof GE, Achacoso PL, Baltimore D. Poliovirus RNA synthesis utilizes an RNP complex formed around the 50 -end of viral RNA. EMBO J 1993; 12:3587-98; PMID:8253083 13. Harris KS, Xiang W, Alexanders L, Lane WS, Paul AV, Wimmer E. Interaction of poliovirus polypeptide 3CDPro with the 50 and 3’ termini of the poliovirus genome. Identification of viral and celllular cofactors needed for efficient binding. J Biol Chem 1994; 269:27004-14; PMID:7929441 14. Andino R, Rieckhof GE, Trono D, Baltimore D. Substitutions in the protease (3Cpro) gene of poliovirus can suppress a mutation in the 50 noncoding region. J Virol 1990; 64:607-12; PMID:2153227 15. Vogt DA, Andino R. An RNA Element at the 50 -end of the poliovirus genome functions as a general promoter for RNA synthesis. PLoS Pathog 2010; 6:e1000936; PMID:20532207; http://dx.doi.org/10.1371/journal. ppat.1000936 16. Barton DJ, O’Donnell BJ, Flanegan JB. 5’ cloverleaf in poliovirus RNA is a cis-acting replication element required for negative-strand synthesis. EMBO J 2001; 20:1439-48; PMID:11250909; http://dx.doi.org/ 10.1093/emboj/20.6.1439 17. Lyons T, Murray KE, Roberts AW, Barton DJ. Poliovirus 50 -terminal cloverleaf RNA Is required in cis for VPg uridylylation and the Initiation of negative-strand RNA synthesis. J Virol 2001; 75:10696-708; PMID:11602711; http://dx.doi.org/10.1128/ JVI.75.22.10696-10708.2001 18. Herold J, Andino R. Poliovirus RNA replication requires genome circularization through a protein-protein bridge. Mol Cell 2001; 7:581-91; PMID:11463383; http://dx.doi.org/10.1016/S10972765(01)00205-2 19. Xiang W, Harris KS, Alexander L, Wimmer E. Interaction between the 50 -terminal cloverleaf and 3AB/

www.tandfonline.com

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

3CDpro of poliovirus is essential for RNA replication. J Virol 1995; 69:3658-67; PMID:7745714 Xiang W, Cuconati A, Paul AV., Cao X, Wimmer E. Molecular dissection of the multifunctional poliovirus RNA-binding protein 3AB. RNA 1995; 1:892-904; PMID:8548654 Sharma N, O’Donnell BJ, Flanegan JB. 3’-Terminal sequence in poliovirus negative-strand templates is the primary cis-acting element required for VPgpUpUprimed positive-strand initiation. J Virol 2005; 79:3565-77; PMID:15731251; http://dx.doi.org/ 10.1128/JVI.79.6.3565-3577.2005 Parsley TB, Towner JS, Blyn LB, Ehrenfeld E, Semler BL. Poly (rC) binding protein 2 forms a ternary complex with the 5’-terminal sequences of poliovirus RNA and the viral 3CD proteinase. RNA 1997; 3:1124-34; PMID:9326487 Gamarnik AV, Andino R. Switch from translation to RNA replication in a positive-stranded RNA virus. Genes Dev 1998; 12:2293-304; PMID:9694795; http://dx.doi.org/10.1101/gad.12.15.2293 Silvera D, Gamarnik AV, Andino R. The N-terminal K homology domain of the poly(rC)-binding protein is a major determinant for binding to the poliovirus 5’untranslated region and acts as an inhibitor of viral translation. J Biol Chem 1999; 274:38163-70; PMID:10608888; http://dx.doi.org/10.1074/ jbc.274.53.38163 Walter BL, Parsley TB, Ehrenfeld E, Semler BL. Distinct poly(rC) binding protein KH domain determinants for poliovirus translation initiation and viral RNA replication. J Virol 2002; 76:12008-22; PMID:12414943; http://dx.doi.org/10.1128/ JVI.76.23.12008-12022.2002 Murray KE, Roberts AW, Barton DJ. Poly(rC) binding proteins mediate poliovirus mRNA stability. RNA 2001; 7:1126-41; PMID:11497431; http://dx.doi.org/ 10.1017/S1355838201010044 Gamarnik AV, Andino R. Interactions of viral protein 3CD and poly(rC) binding protein with the 5’ untranslated region of the poliovirus genome. J Virol 2000; 74:2219-26; PMID:10666252; http://dx.doi.org/ 10.1128/JVI.74.5.2219-2226.2000 Blyn LB, Swiderek KM, Richards O, Stahl DC, Semler BL, Ehrenfeld E. Poly( rC ) binding protein 2 binds to stem-loop IV of the poliovirus RNA 5 ’ noncoding region: Identification by automated liquid chromatography-tandem mass spectrometry. Proc Natl Acad Sci U S A 1996; 93:11115-20; PMID:8855318; http://dx. doi.org/10.1073/pnas.93.20.11115 Perera R, Daijogo S, Walter BL, Nguyen JHC, Semler BL. Cellular protein modification by poliovirus: the two faces of poly(rC)-binding protein. J Virol 2007; 81:8919-32; PMID:17581994; http://dx.doi.org/ 10.1128/JVI.01013-07 Banerjee R, Tsai W, Kim W, Dasgupta A. Interaction of poliovirus-encoded 2C/2BC polypeptides with the 3’ terminus negative-strand cloverleaf requires an intact stem-loop b. Virology 2001; 280:41-51; PMID:11162817; http://dx.doi.org/10.1006/ viro.2000.0770 Melchers WJG, Zoll J, Tessari M, Bakhmutov DV, Gmyl AP, Agol VI, Heus HA. A GCUA tetranucleotide loop found in the poliovirus oriL by in vivo SELEX (un)expectedly forms a YNMG-like structure: Extending the YNMG family with GYYA. RNA 2006; 12:1671-82; PMID:16894217; http://dx.doi.org/ 10.1261/rna.113106 Cheong C, Varani G, Tinoco IJ. Solution structure of an unusually stable RNA hairpin, 5’GGAC(UUCG) GUCC. Nature 1990; 346:680-2; PMID:1696688; http://dx.doi.org/10.1038/346680a0 Ennifar E, Nikulin A, Tishchenko S, Serganov A, Nevskaya N, Garber M, Ehresmann B, Ehresmann C, Nikonov S, Dumas P. The crystal structure of UUCG tetraloop. J Mol Biol 2000; 304:35-42; PMID:11071808; http://dx.doi. org/10.1006/jmbi.2000.4204 Proctor DJ, Schaak JE, Bevilacqua JM, Falzone CJ, Bevilacqua PC. Isolation and characterization of a

RNA Biology

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

family of stable RNA tetraloops with the motif YNMG that participate in tertiary interactions. Biochemistry 2002; 41:12062-75; PMID:12356306; http://dx.doi. org/10.1021/bi026201s Villa A, Widjajakusuma E, Stock G. Molecular dynamics simulation of the structure, dynamics, and thermostability of the RNA hairpins uCACGg and cUUCGg. J Phys Chem B 2008; 112:134-42; PMID:18069816; http://dx.doi.org/10.1021/jp0764337 Ferner J, Villa A, Duchardt E, Widjajakusuma E, W€ohnert J, Stock G, Schwalbe H. NMR and MD studies of the temperature-dependent dynamics of RNA YNMG-tetraloops. Nucleic Acids Res 2008; 36:192840; PMID:18272534; http://dx.doi.org/10.1093/nar/ gkm1183 Herold J, Andino R. Poliovirus requires a precise 5’ end for efficient positive-strand RNA synthesis. J Virol 2000; 74:6394-400; PMID:10864650; http://dx.doi. org/10.1128/JVI.74.14.6394-6400.2000 Du Z, Yu J, Andino R, James TL. Extending the family of UNCG-like tetraloop motifs: NMR structure of a CACG tetraloop from coxsackievirus B3. Biochemistry 2003; 42:4373-83; PMID:12693932; http://dx.doi. org/10.1021/bi027314e Du Z, Yu J, Ulyanov NB, Andino R, James TL. Solution structure of a consensus stem-loop D RNA domain that plays important roles in regulating translation and replication in enteroviruses and rhinoviruses. Biochemistry 2004; 43:11959-72; PMID:15379536; http://dx.doi.org/10.1021/bi048973p Varani G, Cheong C, Tinoco I. Structure of an unusually stable RNA hairpin. Biochemistry 1991; 30:32809; PMID:1706937; http://dx.doi.org/10.1021/ bi00227a016 Jucker FM, Pardi A. Solution structure of the CUUG hairpin loop: a novel RNA tetraloop motif. Biochemistry 1995; 34:14416-27; PMID:7578046; http://dx.doi. org/10.1021/bi00044a019 Heus HA, Pardi A. Structural features that give rise to the unusual stability of RNA hairpins containing GNRA loops. Science 1991; 253:191-4; PMID:1712983; http:// dx.doi.org/10.1126/science.1712983 Zhao Q, Huang HC, Nagaswamy U, Xia Y, Gao X, Fox GE. UNAC tetraloops: to what extent do they mimic GNRA tetraloops? Biopolymers 2012; 97:61728; PMID:22605553; http://dx.doi.org/10.1002/ bip.22049 Gmyl AP, Pilipenko EV, Maslova SV, Belov GA, Agol VI. Functional and genetic plasticities of the poliovirus genome: quasi-infectious RNAs modified in the 5’untranslated region yield a variety of pseudorevertants. J Virol 1993; 67:6309-16; PMID:8396686 Theimer CA, Finger LD, Feigon J. YNMG tetraloop formation by a dyskeratosis congenita mutation in human telomerase RNA. RNA 2003; 9:1446-55; PMID:14624001; http://dx.doi.org/10.1261/ rna.5152303 Bothe JR, Nikolova EN, Eichhorn CD, Chugh J, Hansen AL, Al-Hashimi HM. Characterizing RNA dynamics at atomic resolution using solution-state NMR spectroscopy. Nat Methods 2011; 8:919-31; PMID:22036746; http://dx.doi.org/10.1038/nmeth. 1735 Chen AA, Garc
ıa AE. High-resolution reversible folding of hyperstable RNA tetraloops using molecular dynamics simulations. Proc Natl Acad Sci U S A 2013; 110:16820-5; PMID:24043821; http://dx.doi.org/ 10.1073/pnas.1309392110 DePaul AJ, Thompson EJ, Patel SS, Haldeman K, Sorin EJ. Equilibrium conformational dynamics in an RNA tetraloop from massively parallel molecular dynamics. Nucleic Acids Res 2010; 38:4856-67; PMID:20223768; http://dx.doi.org/10.1093/nar/ gkq134 Finger LD, Trantirek L, Johansson C, Feigon J. Solution structures of stem-loop RNAs that bind to the two Nterminal RNA-binding domains of nucleolin. Nucleic Acids Res 2003; 31:6461-72; PMID:14602904; http:// dx.doi.org/10.1093/nar/gkg866

1353

50. Williamson JR. Induced fit in RNA-protein recognition. Nat Struct Biol 2000; 7:834-7; PMID:11017187; http://dx.doi.org/10.1038/79575 51. Leulliot N, Varani G. Current topics in RNA-protein recognition: control of specificity and biological function through induced fit and conformational capture. Biochemistry 2001; 40:7947-56; PMID:11434763; http://dx.doi.org/10.1021/bi010680y 52. Ohlenschl€ager O, W€ohnert J, Bucci E, Seitz S, H€afner S, Ramachandran R, Zell R, G€orlach M. The structure of the stemloop D subdomain of coxsackievirus B3 cloverleaf RNA and its interaction with the proteinase 3C. Structure 2004; 12:237-48; http://dx.doi.org/10.1016/ j.str.2004.01.014 53. Sharma N, Ogram SA, Morasco BJ, Spear A, Chapman NM, Flanegan JB. Functional role of the 5’ terminal cloverleaf in coxsackievirus RNA replication. Virology 2009; 393:238-49; PMID:19732932; http://dx.doi. org/10.1016/j.virol.2009.07.039 54. Walker PA, Leong LE, Porter AG. Sequence and structural determinants of the interaction between the 5’noncoding region of picornavirus RNA and rhinovirus protease 3C. J Biol Chem 1995; 270:14510-6; PMID:7782313; http://dx.doi.org/10.1074/ jbc.270.24.14510 55. De Visser JAGM, Hermisson J, Wagner GP, Ancel Meyers L, Bagheri-Chaichian H, Blanchard JL, Chao L, Cheverud JM, Elena SF, Fontana W, et al. Perspective: Evolution and detection of genetic robustness. Evolution 2003; 57:1959-72; PMID:14575319 56. Zell R, Sidigi K, Bucci E, Stelzner A, G€orlach M. Determinants of the recognition of enteroviral cloverleaf RNA by coxsackievirus B3 proteinase 3C. RNA 2002; 8:188-201; PMID:11911365; http://dx.doi.org/ 10.1017/S1355838202012785

1354

57. Rieder E, Xiang W, Paul A, Wimmer E. Analysis of the cloverleaf element in a human rhinovirus type 14/poliovirus chimera: correlation of subdomain D structure, ternary protein complex formation and virus replication. J Gen Virol 2003; 84:2203-16; PMID:12867653; http:// dx.doi.org/10.1099/vir.0.19013-0 58. Barr JN, Fearns R. How RNA viruses maintain their genome integrity. J Gen Virol 2010; 91:1373-87; PMID:20335491; http://dx.doi.org/10.1099/ vir.0.020818-0 59. Elena SF. RNA virus genetic robustness: possible causes and some consequences. Curr Opin Virol 2012; 2:52530.; PMID:22818515; http://dx.doi.org/10.1016/j. coviro.2012.06.008 60. Wagner A, Stadler PF. Viral RNA and evolved mutational robustness. J Exp Zool 1999; 285:119-27; PMID:10440723; http://dx.doi.org/10.1002/(SICI) 1097-010X(19990815)285:2%3c119::AID-JEZ4% 3e3.0.CO;2-D 61. Wagner A. Robustness and evolvability: a paradox resolved. Proc Biol Sci 2008; 275:91-100; PMID:17971325; http:// dx.doi.org/10.1098/rspb.2007.1137 62. Cuevas JM, Moya A, Sanju
an R. A genetic background with low mutational robustness is associated with increased adaptability to a novel host in an RNA virus. J Evol Biol 2009; 22:2041-8; PMID:19702844; http://dx.doi.org/10.1111/j.14209101.2009.01817.x 63. Draghi JA, Parsons TL, Wagner GP, Plotkin JB. Mutational robustness can facilitate adaptation. Nature 2010; 463:353-5; PMID:20090752; http://dx.doi.org/ 10.1038/nature08694 64. Masel J, Trotter MV. Robustness and evolvability. Trends Genet 2010; 26:406-14; PMID:20598394; http://dx.doi.org/10.1016/j.tig.2010.06.002

RNA Biology

65. Pilipenko EV, Gmyl AP, Maslova SV, Svitkin YV, Sinyakov AN, Agol VI. Prokaryotic-like cis elements in the cap-independent internal initiation of translation on picornavirus RNA. Cell 1992; 68:119-31; PMID:1310072; http://dx. doi.org/10.1016/0092-8674(92)90211-T 66. Kunkel TA. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc Natl Acad Sci U S A 1985; 82:488-92; PMID:3881765; http://dx.doi. org/10.1073/pnas.82.2.488 67. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor laboratory Press; 1989 68. Tishchenko SV, Vassilieva JM, Platonova OB, Serganov AA, Fomenkova NP, Mudrik ES, Piendl W, Ehresmann C, Ehresmann B, Garber MB. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin. Biochem 2001; 66:948-53 69. Bardina MV, Lidsky PV, Sheval EV, Fominykh KV, van Kuppeveld FJM, Polyakov VY, Agol VI. Mengovirus-induced rearrangement of the nuclear pore complex: hijacking cellular phosphorylation machinery. J Virol 2009; 83:3150-61; PMID:19144712; http://dx. doi.org/10.1128/JVI.01456-08 70. Zernii EY, Nazipova AA, Gancharova OS, Kazakov AS, Serebryakova MV, Zinchenko DV, Tikhomirova NK, Senin II, Philippov PP, Permyakov EA, et al. Lightinduced disulfide dimerization of recoverin under ex vivo and in vivo conditions. Free Radic Biol Med 2015; 83:283-95; PMID:25772009; http://dx.doi.org/ 10.1016/j.freeradbiomed.2015.03.001 71. Gruber AR, Lorenz R, Bernhart SH, Neub€ock R, Hofacker IL. The Vienna RNA websuite. Nucleic Acids Res 2008; 36 (Web Server issue):W70-W74; PMID:18424795; http://dx.doi.org/10.1093/nar/gkn188

Volume 12 Issue 12