Cardnogenesis vol.13 no.ll pp.2O53-2O57, 1992
Mutational specificity of chromium(VI) compounds in the hprt locus of Chinese hamster ovary-Kl cells
Jia-Ling Yang1, Yi-Chi Hsieh, Cheng-Wen Wu and Te-Chang Lee Molecular and Genetic Toxicology Group, Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan, Republic of China 'Present address: Institute of Biomedical Sciences, National Tsing Hua University, Hsinchu 300, Taiwan, Republic of China
Introduction While chromium is a trace element required for glucose metabolism (1), epidemiological evidence has clearly demonstrated an increased incidence of respiratory cancers in workers exposed to chromium(VI) compounds (2 —4). Chromium compounds are known to cause chromosome aberrations (5), sister chromatid exchanges (6,7), cell transformation and gene mutations in cultured mammalian cells (8-10), and to induce tumors in experimental animals (11 -13). They also decrease the fidelity of polymerases during DNA replication and enhance the transcription activities of certain genes (14-16). The most toxic form of chromium is the hexavalent oxidative state, which is actively transported into cells by the sulfate transport system, and is reduced intracellularly via reactive chromium(V) and chromium(VI) intermediates to the ultimate trivalent form (17,18). However, the hexavalent form of chromium does not interact with macromolecules in vitro (19). © Oxford University Press
Materials and methods Cell culture CHO-K1 cells were grown in McCoy's 5A medium supplemented with fetal calf serum (10%), sodium bicarbonate (0.22% w/v), penicillin (100 U/ml), streptomycin (100 /ig/ml) and L-glutamine (0.33% w/v) (complete medium). The cells were incubated at 37°C in a humidified incubator containing 5% CO2 in air. Chromiwn compounds ChromiumCVI) oxide (CrO3; Merck 227) and potassium dichromate (K2Cr2O7; Merck 4862) were dissolved in water (MilliQ purified) to give 10 mM solutions. Lead(II) chromate (PbCrO4; Merck 7513) was dissolved in 1 N NaOH to give a 10 mM solution and then diluted with medium. All chromium compounds were dissolved immediately before treatment of cells. Cytotoxicity and mutagenicity The survival of CHO-K1 cells was determined by colony-forming ability. Briefly, I X 105 cells were grown in complete medium containing hypoxanthine (100 jiM), aminopterin (2 j»M) and thymine (30 jiM) (HAT medium) for 3 days to reduce the number of pre-existing HPRT-deficient cells. A million cells per 100 mm Petri dish were plated and incubated for 18 h. The cells were then exposed to various concentrations of chromium compounds in complete media for 24 h. At the end of the treatment, the cells were washed twice with PBS before trypsinizatkm. A portion of cells were diluted and plated at 200-1000 cells per 60 mm Petri dish in triplicate, and incubated for 7 days. The dishes were stained and the colony numbers were counted for determination of cytotoxicity. The remaining cells were maintained in their proliferative growing state for an 8 day expression period before mutant selection. Afterward, one million cells were split into 10 100 mm Petri dishes, fed with complete medium containing I1 jig/ml 6-thioguanine (6-TG), and incubated for 7 days. Plating efficiency was
2053
Downloaded from http://carcin.oxfordjournals.org/ at OCLC on March 18, 2015
Chromium(VI) compounds exert their genotoxicity and mutagenicity by complex metabolic reducing pathways that generate a variety of reactive forms of chromium and free radicals. To investigate the molecular nature of chromiuminduced mutations, we characterized the entire coding region of the hypoxanthine (guanine) phosphoribosyltransferase (hprt) gene of 27 independent mutants derived from chromhim(VI) oxide (CrO^-treated Chinese hamster ovaryKl cells, by direct sequencing of PCR-amplified cDNA. Among these mutants, 10 consisted of single base substitutions, five contained two base substitutions, one had four base substitutions, six were splicing mutations, and five exhibited single base pair insertions or deletions. All of the base substitutions and most of the frameshift mutations observed were located at A/T-rich sequences. More than 90% of the base substitutions (22/24) occurred in A-T base pairs. Among them, T - A and T — G transversions (18/22) predominated. The mutational hotspots for single and double base substitutions were the 3' thymidine of 5'PuT and thymidines of 5'ATTT sequences respectively. This mutational specificity was also observed in CHO-K1 cells treated with two other chromium(VI) compounds, namely K2Cr207 and PbCrO4. Strand bias was noticed in chromium mutagenicity, since 77% of T base substitutions occurred on the non-transcribed strand. This highly sequence-specific mutation spectrum suggests that a particular form of chromium may directly interact with DNA at these hotspot sequences.
The cellular components involved in the reduction of chromium(VI) include ascorbate (20,21), glutathione (22,23), cysteine (23), hydrogen peroxide (24), DT-diaphorase (25), cytochrome P450 reductases (26) and the mitochrondrial electron transport chain (27). Upon metabolic reduction, oxidative DNA damage such as single-strand breaks, radical —DNA adducts, chromium—DNA adducts, and chromium-mediated DNA—DNA or DNA-protein crosslinks are produced (28—32). Numerous studies have attempted to determine which intracellular state of chromium or which by-product generated during chromium reduction is the ultimate carcinogenic and mutagenic form. Interaction of metabolic intermediates with DNA and/or proteins, binding of stable chromiumQII) to DNA and DNA injury by free radicals generated during reduction of chromium are generally considered to be associated with chromium genotoxicity and carcinogenicity (33). Chromium has been shown to induce A T base pair substitution in histidine revertants of Salmonella typhimurium strains (34). However, little is known about the molecular mechanism of chromium-induced mutagenesis in mammalian cells. Because of the complex reactive species of chromium compounds, it is interesting and important to investigate the specific mutational spectra induced by chromium(VT) in mammalian cells. We have adopted a recent mRNA PCR method of amplifying the hprt coding region to analyze the altered nucleotide sequences of this target gene in chromium(VT)-induced CHO mutants (35). The results showed that all of the base changes were located at A/T-rich sequences and mat the most frequent mutations were T — A and T — G transversions.
J.-L.Yang et at. also determined at the same time by plating 200 cells in 60 mm Petri dishes with complete medium as described previously (36). Five individual 6-TGr colonies derived from each population were picked and transferred to 35 mm Petri dishes for further molecular analysis. mRNA PCR amplification About 250 cells in PBS were transferred into a 0.5 ml Eppendorf tube and cenlrifuged for 10 min at 4°C. The cell pellet was resuspended in 5 ml of cDNA cocktail as described (35). The reaction mixture was incubated at 37"C for 1 h to allow the lysis of cell membranes and the synthesis of first-strand cDNA using cytoplasmic mRNA as template. Primers were designed according to Konecki et al. (37) and were synthesized and purified as previously described (38). Primers PI: .jgCTCGGCGCCTCCTCTGCGGG.^, P2: ^ I C X J T A A T T T T A C T G G G A A C A T T O , P3: _4ACTCCTCACACCGCTCTTCGC-y and P4: 6S?CTCCTCGTGTTTGCAGATTC674 were used as two nested pairs for PCR amplification. The synthesized first-strand cDNA was used as template for two 30 cycle PCR amplifications and the amplified cDNA was analyzed as previously described (35).
100C i i-i
*
> >
10
c o o
1
A
cf^r~i(t'
2054
1
'
'
1
' :
A
;
~v^
^
-
m
w
k_
Mutational specificity of chromium(VI) compounds in the hprt locus of Chinese hamster ovary-Kl cells
Jia-Ling Yang1, Yi-Chi Hsieh, Cheng-Wen Wu and Te-Chang Lee Molecular and Genetic Toxicology Group, Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan, Republic of China 'Present address: Institute of Biomedical Sciences, National Tsing Hua University, Hsinchu 300, Taiwan, Republic of China
Introduction While chromium is a trace element required for glucose metabolism (1), epidemiological evidence has clearly demonstrated an increased incidence of respiratory cancers in workers exposed to chromium(VI) compounds (2 —4). Chromium compounds are known to cause chromosome aberrations (5), sister chromatid exchanges (6,7), cell transformation and gene mutations in cultured mammalian cells (8-10), and to induce tumors in experimental animals (11 -13). They also decrease the fidelity of polymerases during DNA replication and enhance the transcription activities of certain genes (14-16). The most toxic form of chromium is the hexavalent oxidative state, which is actively transported into cells by the sulfate transport system, and is reduced intracellularly via reactive chromium(V) and chromium(VI) intermediates to the ultimate trivalent form (17,18). However, the hexavalent form of chromium does not interact with macromolecules in vitro (19). © Oxford University Press
Materials and methods Cell culture CHO-K1 cells were grown in McCoy's 5A medium supplemented with fetal calf serum (10%), sodium bicarbonate (0.22% w/v), penicillin (100 U/ml), streptomycin (100 /ig/ml) and L-glutamine (0.33% w/v) (complete medium). The cells were incubated at 37°C in a humidified incubator containing 5% CO2 in air. Chromiwn compounds ChromiumCVI) oxide (CrO3; Merck 227) and potassium dichromate (K2Cr2O7; Merck 4862) were dissolved in water (MilliQ purified) to give 10 mM solutions. Lead(II) chromate (PbCrO4; Merck 7513) was dissolved in 1 N NaOH to give a 10 mM solution and then diluted with medium. All chromium compounds were dissolved immediately before treatment of cells. Cytotoxicity and mutagenicity The survival of CHO-K1 cells was determined by colony-forming ability. Briefly, I X 105 cells were grown in complete medium containing hypoxanthine (100 jiM), aminopterin (2 j»M) and thymine (30 jiM) (HAT medium) for 3 days to reduce the number of pre-existing HPRT-deficient cells. A million cells per 100 mm Petri dish were plated and incubated for 18 h. The cells were then exposed to various concentrations of chromium compounds in complete media for 24 h. At the end of the treatment, the cells were washed twice with PBS before trypsinizatkm. A portion of cells were diluted and plated at 200-1000 cells per 60 mm Petri dish in triplicate, and incubated for 7 days. The dishes were stained and the colony numbers were counted for determination of cytotoxicity. The remaining cells were maintained in their proliferative growing state for an 8 day expression period before mutant selection. Afterward, one million cells were split into 10 100 mm Petri dishes, fed with complete medium containing I1 jig/ml 6-thioguanine (6-TG), and incubated for 7 days. Plating efficiency was
2053
Downloaded from http://carcin.oxfordjournals.org/ at OCLC on March 18, 2015
Chromium(VI) compounds exert their genotoxicity and mutagenicity by complex metabolic reducing pathways that generate a variety of reactive forms of chromium and free radicals. To investigate the molecular nature of chromiuminduced mutations, we characterized the entire coding region of the hypoxanthine (guanine) phosphoribosyltransferase (hprt) gene of 27 independent mutants derived from chromhim(VI) oxide (CrO^-treated Chinese hamster ovaryKl cells, by direct sequencing of PCR-amplified cDNA. Among these mutants, 10 consisted of single base substitutions, five contained two base substitutions, one had four base substitutions, six were splicing mutations, and five exhibited single base pair insertions or deletions. All of the base substitutions and most of the frameshift mutations observed were located at A/T-rich sequences. More than 90% of the base substitutions (22/24) occurred in A-T base pairs. Among them, T - A and T — G transversions (18/22) predominated. The mutational hotspots for single and double base substitutions were the 3' thymidine of 5'PuT and thymidines of 5'ATTT sequences respectively. This mutational specificity was also observed in CHO-K1 cells treated with two other chromium(VI) compounds, namely K2Cr207 and PbCrO4. Strand bias was noticed in chromium mutagenicity, since 77% of T base substitutions occurred on the non-transcribed strand. This highly sequence-specific mutation spectrum suggests that a particular form of chromium may directly interact with DNA at these hotspot sequences.
The cellular components involved in the reduction of chromium(VI) include ascorbate (20,21), glutathione (22,23), cysteine (23), hydrogen peroxide (24), DT-diaphorase (25), cytochrome P450 reductases (26) and the mitochrondrial electron transport chain (27). Upon metabolic reduction, oxidative DNA damage such as single-strand breaks, radical —DNA adducts, chromium—DNA adducts, and chromium-mediated DNA—DNA or DNA-protein crosslinks are produced (28—32). Numerous studies have attempted to determine which intracellular state of chromium or which by-product generated during chromium reduction is the ultimate carcinogenic and mutagenic form. Interaction of metabolic intermediates with DNA and/or proteins, binding of stable chromiumQII) to DNA and DNA injury by free radicals generated during reduction of chromium are generally considered to be associated with chromium genotoxicity and carcinogenicity (33). Chromium has been shown to induce A T base pair substitution in histidine revertants of Salmonella typhimurium strains (34). However, little is known about the molecular mechanism of chromium-induced mutagenesis in mammalian cells. Because of the complex reactive species of chromium compounds, it is interesting and important to investigate the specific mutational spectra induced by chromium(VT) in mammalian cells. We have adopted a recent mRNA PCR method of amplifying the hprt coding region to analyze the altered nucleotide sequences of this target gene in chromium(VT)-induced CHO mutants (35). The results showed that all of the base changes were located at A/T-rich sequences and mat the most frequent mutations were T — A and T — G transversions.
J.-L.Yang et at. also determined at the same time by plating 200 cells in 60 mm Petri dishes with complete medium as described previously (36). Five individual 6-TGr colonies derived from each population were picked and transferred to 35 mm Petri dishes for further molecular analysis. mRNA PCR amplification About 250 cells in PBS were transferred into a 0.5 ml Eppendorf tube and cenlrifuged for 10 min at 4°C. The cell pellet was resuspended in 5 ml of cDNA cocktail as described (35). The reaction mixture was incubated at 37"C for 1 h to allow the lysis of cell membranes and the synthesis of first-strand cDNA using cytoplasmic mRNA as template. Primers were designed according to Konecki et al. (37) and were synthesized and purified as previously described (38). Primers PI: .jgCTCGGCGCCTCCTCTGCGGG.^, P2: ^ I C X J T A A T T T T A C T G G G A A C A T T O , P3: _4ACTCCTCACACCGCTCTTCGC-y and P4: 6S?CTCCTCGTGTTTGCAGATTC674 were used as two nested pairs for PCR amplification. The synthesized first-strand cDNA was used as template for two 30 cycle PCR amplifications and the amplified cDNA was analyzed as previously described (35).
100C i i-i
*
> >
10
c o o
1
A
cf^r~i(t'
2054
1
'
'
1
' :
A
;
~v^
^
-
m
w
k_
