Article pubs.acs.org/JAFC
Mutations in Cyclodextrin Glycosyltransferase from Bacillus circulans Enhance β‑Cyclization Activity and β‑Cyclodextrin Production Min Huang,†,‡ Caiming Li,†,‡ Zhengbiao Gu,†,‡,§ Li Cheng,†,‡ Yan Hong,†,‡,§ and Zhaofeng Li*,†,‡,§ †
State Key Laboratory of Food Science and Technology, ‡School of Food Science and Technology, and §Synergetic Innovation Center of Food Safety and Nutrition, Jiangnan University, Wuxi, Jiangsu 214122, People’s Republic of China ABSTRACT: Cyclodextrin glycosyltransferase (EC 2.4.1.19, CGTase) is used to produce cyclodextrins, which are cyclic glucans with many industrial applications. In the present study, the effects of the amino acid residue at position 577, which is located in calcium-binding site III (CaIII), on cyclization activity and cyclodextrin production were investigated by replacing Asp577 in CGTase from Bacillus circulans STB01 with glutamate, arginine, lysine, and histidine. The results showed that mutations D577E and D577R significantly increased the β-cyclization activity. The D577R mutant, in particular, displayed a 30.7% increase in the β-cyclization activity when compared to the wild-type CGTase. Furthermore, under conditions resembling industrial production processes, the D577R and D577E mutants displayed 9.1 and 2.0% enhancement in β-cyclodextrin production, respectively. More importantly, the higher β-cyclization activities resulted in a significant reduction in the amount of mutant protein required during the process. Thus, the two mutants were much more suitable for the industrial production of β-cyclodextrin than the wild-type enzyme. KEYWORDS: cyclodextrin glycosyltransferase, cyclodextrin, cyclization activity, Asp577, mutation
■
increasing the number of electrostatic interactions.10 However, no data were provided concerning the effects of mutations at Asp577 on the cyclization activity of this enzyme. To test the hypothesis that the conformational stabilizing effect conferred by mutations of Asp577 may also enhance the cyclization activity of the enzyme, site-directed mutagenesis was used to convert Asp577 of CGTase from B. circulans STB01 to glutamate, arginine, lysine, and histidine. The effects of these mutations on the cyclization activity of CGTase and cyclodextrin production were determined. The relative mechanisms were also analyzed.
INTRODUCTION Cyclodextrins are cyclic α-1,4-glycosidic-linked oligomers of glucose. The most common types, which consist of six, seven, or eight glucose residues, are known as α-, β-, or γ-cyclodextrin, respectively. 1 These molecules find numerous potential applications in food, cosmetics, pharmaceuticals, agriculture, and chemical industries, because of their special ability to form inclusion complexes with small hydrophobic molecules.2−4 Cyclodextrins are commonly produced by the enzymatic conversion of starch through cyclization reactions catalyzed by cyclodextrin glycosyltransferase (EC 2.4.1.19, CGTase).5 CGTases can be classified as α-, β-, or γ-CGTases according to their main cyclodextrin product.6 Because of its relatively high yield and low price, β-cyclodextrin is the most widely marketed among the cyclodextrins.4 Nevertheless, even β-cyclodextrin is too costly for many applications.7 To develop more widespread industrial applications, there is a need to decrease the production cost of βcyclodextrin. An effective way to accomplish this goal is to reduce the amount of CGTase protein required during the process, because this enzyme is a significant cost factor in the production of β-cyclodextrin. Thus, mutants of CGTase with an increased activity for cyclization are of high industrial interest. CGTase is a member of the α-amylase family of glycosyl hydrolases (family 13),7,8 which commonly have two calciumbinding sites, called CaI and CaII. The enzyme used in our studies, β-CGTase from Bacillus circulans strain STB01, contains an additional calcium-binding site, CaIII.9 CaIII is located at the A/D domain interface and contains calcium-interacting residues Ala315 and Asp577. A previous study found that mutation of Asp577 to lysine improved the thermostability of this CGTase and suggested that the D577K mutation may enhance the conformational stability of the enzyme by the formation of additional hydrogen bonds and © 2014 American Chemical Society
■
MATERIALS AND METHODS
Bacterial Strains and Plasmids. Escherichia coli JM109 [F′ (traD36, proAB+ lacIq, Δ(lacZ)M15) endA1 recA1 hsdR17(rk−, mk+) mcrA supE44 λ− gyrA96 relA1 Δ(lac-proAB) thi-1]11 was used for recombinant DNA manipulations. Plasmid cgt/pST containing the βCGTase gene from B. circulans strain STB01 was used for site-directed mutagenesis, sequencing, and expression of the β-CGTase (mutant) proteins.10,12 The mutant β-CGTases were produced with Bacillus subtilis WB600 [trpC2 nprE aprE EPR bpr mpr nprB; Emr].13 DNA Manipulations and Sequencing. Restriction endonucleases, prime STAR HS DNA polymerase, and polymerase chain reaction (PCR) reagents were purchased from TaKaRa Shuzo (Otsu, Japan) and used in accordance with the instructions of the manufacturer. DNA manipulations and calcium chloride transformation of E. coli strains were performed as previously described.14 Transformation of B. subtilis was performed following the method by Spizizen.15 DNA sequences were determined by cycle sequencing with an ABI PRISM BigDye primer cycle sequencing kit with AmpliTaq DNA polymerase (PerkinElmer, Foster City, CA). Received: Revised: Accepted: Published: 11209
July 23, 2014 September 24, 2014 October 30, 2014 October 30, 2014 dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Journal of Agricultural and Food Chemistry
Article
Site-Directed Mutagenesis. Site-directed mutagenesis was performed using a one-step PCR method with plasmid cgt/pST as the template and a pair of complementary primers (Table 1). The PCR
protein-modeling server (http://www.expasy.ch/swissmod/SWISSMODEL.html).23 The PyMol molecular graphics system (http:// www.pymol.org) was used to visualize and analyze the model structure.
Table 1. Primers Used for Site-Directed Mutagenesis
RESULTS Expression and Purification of the Wild-Type and Mutant CGTases. B. circulans β-CGTase mutants D577E, D577R, D577K, and D577H were successfully constructed using site-directed mutagenesis. The wild-type and mutant CGTases were expressed in B. subtilis WB600, and the secreted proteins were isolated from the culture medium. There were no obvious differences in the levels of expression among the recombinant wild-type and mutant CGTases, with 20−25 mg of each of the CGTase proteins produced per liter in shake-flask cultures. The mutant CGTase proteins were purified to apparent homogeneity using a combination of anion-exchange and hydrophobic chromatographies. The purity and molecular weight of the wild-type and mutant CGTase proteins were verified using sodium dodecyl sulfate−polyacrylamide gel electrophoresis (SDS−PAGE) (data not shown). Cyclization Activities of Wild-Type and Mutant CGTases. The CGTase enzymes were assayed to determine α-, β- and γ-cyclization activities (Table 2). None of the mutations had a substantial effect upon the ratio of β-cyclization activity to total cyclization activity. These ratios varied from 74.6% (D577E) to 76.6% (D577K), with D577H, D577R, and the wild type having intermediate values, in that order. However, the D577E mutant displayed a 14.0% increase in total cyclization activity and an 11.2% overall increase in the β-cyclization activity when compared to the wild-type CGTase. More interesting, the D577R mutant displayed an even larger enhancement of total cyclization activity (32.5%), resulting in a 30.7% overall increase in β-cyclization activity, compared to that of the wild-type CGTase. In contrast, the D577K mutant showed only a 1.3% increase in the total cyclization activity and a 1.5% increase in βcyclization activity. Finally, the D577H mutant displayed slight decreases in the total cyclization activity and β-cyclization activity compared to wild-type CGTase. Starch Conversions of the Wild-Type and Mutant CGTases under Conditions Resembling Industrial Production Processes. To assess the performance of the mutant CGTases under conditions resembling those used in the industrial production of β-cyclodextrin, each enzyme was assayed in a reaction mixture containing CGTase protein (0.1 unit/mL βcyclization activity) and 5% (wet basis, w/v) soluble starch. The reaction mixtures were incubated at 45 °C and sampled over a 24 h time course. Although small amounts of α- and γ-cyclodextrin were produced, β-cyclodextrin was the main product for all CGTases (Figure 1). After 24 h of incubation, the wild-type enzyme converted 45.4% of the starch into cyclodextrins, of which the majority (69.2%) was β-cyclodextrin (Table 3).
a
desired mutation
primer sequence (5′−3′)
D577E
GCAATGTGTATGAAAACTTCGAG CTCGAAGTTTTCATACACATTGC GCAATGTGTATCGTAACTTCGAG CTCGAAGTTACGATACACATTGC GCAATGTGTATAAGAACTTCGAG CTCGAAGTTCTTATACACATTGC GCAATGTGTATCATAACTTCGAG CTCGAAGTTATGATACACATTGC
D577R D577K D577H
■
DNA template cgt/pST cgt/pST cgt/pST cgt/pST
a
Nucleotide sequences corresponding to the mutated amino acids are underlined.
products were treated with DpnI and then used to transform E. coli JM109 cells. The intended mutations were confirmed by DNA sequencing. To generate expression strains, the resulting (mutant) plasmids were used to transformed B. subtilis WB600 competent cells. Production and Purification of CGTase Proteins. A single colony of B. subtilis WB600 harboring cgt/pST (wild type or mutant) was inoculated into 50 mL of Luria−Bertani medium containing 5 μg/ mL kanamycin and grown at 37 °C overnight. A 2 mL portion of this overnight culture was then diluted into 50 mL of terrific broth containing 5 μg/mL kanamycin and incubated on a rotary shaker (200 rpm) at 37 °C for 48 h. The CGTase present in the supernatant was purified to homogeneity, as previously described.11 The purified enzymes were aliquoted and stored at −80 °C. The protein concentration was determined using the Bradford assay,16 with reagents obtained from the Bio-Rad protein assay reagent kit (Bio-Rad, Hercules, CA). Bovine serum albumin was used as the standard. Enzyme Assays. All assays were measured by incubating 0.1 mL of appropriately diluted purified CGTase with 0.9 mL of 1% (w/v) maltodextrin (DE = 3, Roquette Frères, Lestrem, France) in 10 mM phosphate buffer (pH 6.5) at 50 °C for 10 min. The concentrations of α-, β-, and γ-cyclodextrin formed were determined using the methyl orange,17 phenolphthalein,18 and bromocresol green19 methods, respectively. One unit of each activity was defined as the amount of enzyme that produced 1 μmol of the corresponding cyclodextrin per minute. High-Performance Liquid Chromatography (HPLC) Product Analysis. The formation of cyclodextrins under conditions resembling an industrial production process was performed by incubating 0.1 unit/ mL CGTase (β-cyclization activity) with 5% (wet basis, w/v) soluble starch solution in 10 mM phosphate buffer (pH 6.5) at 45 °C for 24 h. At regular time intervals, samples were taken and boiled for 20 min. The concentrations of α-, β-, and γ-cyclodextrin in the reaction mixture were determined by HPLC, as described in previous reports.12,20,21 Structure Modeling of the (Mutant) CGTase. The X-ray crystal structure of the wild-type CGTase from B. circulans was obtained from the Research Collaboratory for Structural Bioinformatics (RCSB) Protein Data Bank (PDB accession code 1CXI).22 Homology models of the mutant CGTases were constructed using the SWISS-MODEL
Table 2. Cyclization Activities of the Wild-Type and Mutant CGTases from B. circulans STB01a CGTase
α-cyclization activity (units/mg)
β-cyclization activity (units/mg)
γ-cyclization activity (units/mg)
total (units/mg)
wild type D577E D577R D577K D577H
31.6 ± 0.3 ab (10.4) 36.9 ± 0.5 d (10.7) 31.1 ± 0.3 a (7.7) 32.2 ± 0.4 b (10.5) 33.2 ± 0.4 c (11.2)
231.6 ± 1.9 b (76.5) 257.6 ± 2.6 c (74.6) 302.8 ± 2.3 d (75.5) 235.0 ± 2.2 b (76.6) 222.3 ± 1.8 a (75.0)
39.6 ± 0.8 a (13.1) 50.7 ± 0.7 b (14.7) 67.4 ± 0.9 c (16.8) 39.6 ± 0.4 a (12.9) 41.0 ± 0.3 a (13.8)
302.8 b 345.2 c 401.3 d 306.8 b 296.5 a
a
Numbers in parentheses indicate the ratio in specific activities for the formation of the different cyclodextrins. Each value represents the mean of three independent measurements, and means with different letters within the same column are significantly different (p < 0.05). 11210
dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Journal of Agricultural and Food Chemistry
Article
Figure 1. Cyclodextrins formed during incubation of the (mutant) CGTases from B. circulans STB01 (0.1 unit/mL β-cyclization activity) with 5% (wet basis, w/v) soluble starch solution in 10 mM phosphate buffer (pH 6.5) at 45 °C for 24 h: (black line) α-cyclodextrin, (red line) β-cyclodextrin, and (blue line) γ-cyclodextrin for (A) wild-type CGTase, (B) mutant D577E, (C) mutant D577R, (D) mutant D577K, and (E) mutant D577H.
Table 3. Starch Conversions of the Wild-Type and Mutant CGTases from B. circulans STB01a product (g/L) CGTase
conversion of starch into cyclodextrins (%)
α
β
γ
wild type D577E D577R D577K D577H
45.4 44.6 47.4 46.4 44.6
3.8 ± 0.1 ab (16.7) 3.5 ± 0.2 a (15.7) 3.5 ± 0.1 a (14.8) 4.1 ± 0.1 b (17.7) 3.8 ± 0.2 ab (17.0)
15.7 ± 0.2 a (69.2) 16.1 ± 0.1 b (72.2) 17.2 ± 0.1 c (72.6) 16.2 ± 0.2 b (69.8) 15.8 ± 0.1 a (70.9)
3.2 ± 0.1 b (14.1) 2.7 ± 0.1 a (12.1) 3.0 ± 0.2 ab (12.6) 2.9 ± 0.1 a (12.5) 2.7 ± 0.1 a (12.1)
CGTase proteins (0.1 unit/mL β-cyclization activity) were incubated with 5% (wet basis, w/v) soluble starch solution at pH 6.5 and 45 °C for 24 h. Numbers in parentheses indicate the percentage of each cyclodextrin present in the product mixture. Each value represents the mean of three independent measurements, and means with different letters within the same column are significantly different (p < 0.05).
a
The mutant CGTases produced somewhat more β-cyclodextrin under the same reaction conditions (Figure 1 and Table 3). The D577R mutant showed the greatest enhancement in β-
cyclodextrin production, converting 47.4% of the starch into cyclodextrins, of which 72.6% was β-cyclodextrin. This represents a 9.5% enhancement in β-cyclodextrin production. 11211
dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Journal of Agricultural and Food Chemistry
Article
Figure 2. Models of the (mutant) CGTases from B. circulans STB01: (yellow dashed line) hydrogen bond, (cyan ball) Ca2+ in site CaIII, (green) carbon, (red) oxygen, and (blue) nitrogen for (A) wild-type CGTases, (B) mutant D577E, (C) mutant D577R, (D) mutant D577K, and (E) mutant D577H.
stability of α-amylase.26−28 Although there are some differences between CGTase and α-amylase in these regions, it was also indicated that the mutation of the amino acid residues at calciumbinding sites could affect the CGTase activities.29,30 This suggested that the calcium-binding sites might have a critical function to CGTase. The results supported this hypothesis, demonstrating that mutations at the site CaIII of β-CGTase from B. circulans strain STB01, specifically replacement of Asp 577 with glutamate, arginine, or lysine, could have a beneficial effect on β-cyclization activity; the mutants enhanced the β-cyclization activity in the order D577R > D577E > D577K. The homology modeling results appeared to support the hypothesis that the enhancement in β-cyclization activity of βCGTase was related to a conformational stabilizing effect, because all of the mutants with a newly introduced hydrogen bond by mutations of Asp577 showed higher β-cyclization activities (Figure 2 and Table 2). A possible explanation was that the increase of enzyme stability was more conducive to the synthesis of the main product in the enzyme-catalyzed reaction. However, the enhancement in the β-cyclization activity might not completely depend upon the conformational stabilizing effect. The structural changes suggested that D577E gave the greatest increase in the number of interactions between the side chain at residue 577 and the other residues in domain D, followed by D577R and D577K. The order in which the substitutions enhanced the β-cyclization activity did not correlate with the changes in structure predicted by homology modeling. Previous studies have shown that domain D might be involved in positioning domain E in the correct orientation.31 Furthermore, domain E has an important role in adsorbing starch granules.32
The D577K mutant showed a 3.1% increase in β-cyclodextrin production, converting 46.4% of the starch to cyclodextrins, of which 69.8% was β-cyclodextrin. Although the D577E mutant showed a slight decline in starch conversion, the mutation resulted in a 2.5% increase in β-cyclodextrin production, which came at the expense of α-cyclodextrin and γ-cyclodextrin production. The D577H mutant had a slightly lower starch conversion and almost the same β-cyclodextrin production when compared to the wild-type CGTase. Homology Modeling of the Mutant β-CGTases. A structural model of each of the mutant CGTases was prepared using the SWISS-MODEL protein-modeling server (Figure 2).23 Substitution of aspartate for glutamate conserves the negative charge but adds an additional aliphatic carbon and increases the chain length. Comparing the homology model of D577E (Figure 2B) to the structure of the wild-type β-CGTase (Figure 2A) suggests that the glutamate residue forms additional hydrogen bonds with residues Asn560 and Asn578. Substitution of the negatively charged aspartate with a positively charged residue, such as arginine (Figure 2C) or lysine (Figure 2D), changes the ionic character of this residue and may also introduce a hydrogen bond with Asn562. Substitution of aspartate by histidine (Figure 2E) also changes the ionic character of the residue, but in this case, no additional hydrogen bonds are predicted.
■
DISCUSSION Biochemical studies have revealed calcium-binding sites in the protein molecules of this family.24,25 Previous reports about calcium-binding sites had showed that the amino acid residues within these regions related to the catalytic activity and thermal 11212
dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Journal of Agricultural and Food Chemistry
Article
(8) Leemhuis, H.; Kelly, R. M.; Dijkhuizen, L. Engineering of cyclodextrin glucanotransferases and the impact for biotechnological applications. Appl. Microbiol. Biotechnol. 2010, 85, 823−835. (9) Ban, X. F.; Li, C. M.; Bao, C. H.; Gu, Z. B.; Li, Z. F. Structure and function analysis of calcium binding sites in cyclodextrin glucanotransferase. Prog. Biochem. Biophys. 2013, 40, 1239−1246. (10) Li, C. M.; Ban, X. F.; Gu, Z. B.; Li, Z. F. Calcium ion contribution to thermostability of cyclodextrin glycosyltransferase is closely related to calcium-binding site CaIII. J. Agric. Food Chem. 2013, 61, 8836−8841. (11) Yanisch-Perron, C.; Vieira, J.; Messing, J. Improved M13 phage cloning vectors and host strains: Nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 1985, 33, 103−119. (12) Li, Z. F.; Ban, X. F.; Gu, Z. B.; Li, C. M.; Huang, M.; Hong, Y.; Cheng, L. Mutations enhance β-cyclodextrin specificity of cyclodextrin glycosyltransferase from Bacillus circulans. Carbohydr. Polym. 2014, 108, 112−117. (13) Wu, X. C.; Lee, W.; Tran, L.; Wong, S. L. Engineering a Bacillus subtilis expression−secretion system with a strain deficient in 6 extracellular proteases. J. Bacteriol. 1991, 173, 4952−4958. (14) Joseph, S.; David, W. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: New York, 2001; Vol. 2. (15) Spizizen, J. Transformation of biochemically deficient strains of Bacillus subtilis by deoxyribonucleate. Proc. Natl. Acad. Sci. U. S. A. 1958, 44, 1072−1078. (16) Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein−dye binding. Anal. Biochem. 1976, 72, 248−254. (17) Lejeune, A.; Sakaguchi, K.; Imanaka, T. A spectrophotometric assay for the cyclization activity of cyclomaltohexaose (α-cyclodextrin) glucanotransferase. Anal. Biochem. 1989, 181, 6−11. (18) Makela, M.; Korpela, T.; Laakso, S. Colorimetric determination of β-cyclodextrin: Two assay modifications based on molecular complexation of phenolphtalein. J. Biochem. Biophys. Methods 1987, 14, 85−92. (19) Kato, T.; Horikoshi, K. Colorimetric determination of γcyclodextrin. Anal. Chem. 1984, 56, 1738−1740. (20) Li, Z. F.; Zhang, J. Y.; Wang, M.; Gu, Z. B.; Du, G. C.; Li, J. K.; Wu, J.; Chen, J. Mutations at subsite-3 in cyclodextrin glycosyltransferase from Paenibacillus macerans enhancing α-cyclodextrin specificity. Appl. Microbiol. Biotechnol. 2009, 83, 483−490. (21) Li, Z. F.; Zhang, J. Y.; Sun, Q.; Wang, M.; Gu, Z. B.; Du, G. C.; Wu, J.; Chen, J. Mutations of lysine 47 in cyclodextrin glycosyltransferase from Paenibacillus macerans enhance β-cyclodextrin specificity. J. Agric. Food Chem. 2009, 57, 8386−8391. (22) Knegtel, R. M.; Strokopytov, B.; Penninga, D.; Faber, O. G.; Rozeboom, H. J.; Kalk, K. H.; Dijkhuizen, L.; Dijkstra, B. W. Crystallographic studies of the interaction of cyclodextrin glycosyltransferase from Bacillus circulans strain 251 with natural substrates and products. J. Biol. Chem. 1995, 270, 29256−29264. (23) Arnold, K.; Bordoli, L.; Kopp, J.; Schwede, T. The SWISSMODEL workspace: A web-based environment for protein structure homology modelling. Bioinformatics 2006, 22, 195−201. (24) Janecek, S. α-Amylase family: Molecular biology and evolution. Prog. Biophys. Mol. Biol. 1997, 67, 67−97. (25) Buisson, G.; Duee, E.; Haser, R.; Payan, F. Three dimensional structure of porcine pancreatic α-amylase at 2.9 Å resolution. Role of calcium in structure and activity. EMBO J. 1987, 6, 3909−3916. (26) Sajedi, R. H.; Taghdir, M.; Naderi-Manesh, H.; Khajeh, K.; Ranjbar, B. Nucleotide sequence, structural investigation and homology modeling studies of a Ca2+-independent α-amylase with acidic pHprofile. J. Biochem. Mol. Biol. 2007, 40, 315−324. (27) Yadav, J. K. A differential behavior of α-amylase, in terms of catalytic activity and thermal stability, in response to higher concentration CaCl2. Int. J. Biol. Macromol. 2012, 51, 146−152. (28) Igarashi, K.; Hatada, Y.; Ikawa, K.; Araki, H.; Ozawa, T.; Kobayashi, T.; Ozaki, K.; Ito, S. Improved thermostability of a Bacillus αamylase by deletion of an arginine-glycine residue is caused by enhanced calcium binding. Biochem. Biophys. Res. Commun. 1998, 248, 372−377.
Therefore, to identify the molecular bases for the effects seen here, future studies must resort to more sophisticated modeling approaches. In addition, under the same reaction conditions resembling industrial production processes, the mutants with enhanced βcyclization activities could produce more β-cyclodextrin in the order D577R > D577K > D577E. The D577R mutant demonstrated a substantial enhancement in β-cyclodextrin production. More importantly, because of a higher β-cyclization activity, the amount of D577R protein in the reaction mixture could be reduced by 30.7% when compared to the wild-type CGTase. Although the D577E mutant showed only a 2.5% increase in β-cyclodextrin production, the amount of mutant protein was also reduced by 11.2%. Thus, these mutations of Asp577 resulted in the increased β-cyclodextrin production and reduced amount of CGTase required during the reaction process. In conclusion, Asp577, which is located on the periphery of domain D and is a key residue within calcium-binding site CaIII, played an important role in cyclization activity. The mutations D577R and D577E could obviously enhance the total cyclization activity and β-cyclization activity. Furthermore, under conditions resembling industrial production processes, the D577R and D577E mutants displayed increased β-cyclodextrin production; the higher β-cyclization activities resulted in the significant reduction in the amount of mutant protein required during the process. Thus, the two mutants were much more suitable for the industrial production of β-cyclodextrin than the wild-type enzyme.
■
AUTHOR INFORMATION
Corresponding Author
*Telephone/Fax: 86-510-85329237. E-mail: zfl[email protected]. cn. Funding
Financial support for this work was obtained from the National Natural Science Foundation of China (31101228), the Natural Science Foundation of Jiangsu Province (BK2011152), and the Fok Ying-Tong Education Foundation, China (131069). Notes
The authors declare no competing financial interest.
■
REFERENCES
(1) Szejtli, J. Introduction and general overview of cyclodextrin chemistry. Chem. Rev. 1998, 98, 1743−1753. (2) Saenger, W. Cyclodextrin inclusion compounds in research and industry. Angew. Chem. 1980, 19, 344−362. (3) Del Valle, E. M. M. Cyclodextrins and their uses: A review. Process Biochem. 2004, 39, 1033−1046. (4) Li, Z.; Wang, M.; Wang, F.; Gu, Z.; Du, G.; Wu, J.; Chen, J. γCyclodextrin: A review on enzymatic production and applications. Appl. Microbiol. Biot. 2007, 77, 245−255. (5) Li, Z.; Chen, S.; Gu, Z.; Chen, J.; Wu, J. α-Cyclodextrin: Enzymatic production and food applications. Trends Food Sci. Technol. 2014, 35, 151−160. (6) Penninga, D.; Strokopytov, B.; Rozeboom, H. J.; Lawson, C. L.; Dijkstra, B. W.; Bergsma, J.; Dijkhuizen, L. Site-directed mutations in tyrosine 195 of cyclodextrin glycosyltransferase from Bacillus circulans strain 251 affect activity and product specificity. Biochemistry 1995, 34, 3368−3376. (7) van der Veen, B. A.; Uitdehaag, J. C.; Dijkstra, B. W.; Dijkhuizen, L. Engineering of cyclodextrin glycosyltransferase reaction and product specificity. Biochim. Biophys. Acta, Protein Struct. Mol. Enzymol. 2000, 1543, 336−360. 11213
dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Journal of Agricultural and Food Chemistry
Article
(29) Goh, P. H.; Illias, R. M.; Goh, K. M. Rational mutagenesis of cyclodextrin glucanotransferase at the calcium binding regions for enhancement of thermostability. Int. J. Mol. Sci. 2012, 13, 5307−5323. (30) Nakamura, A.; Haga, K.; Yamane, K. Three histidine residues in the active center of cyclodextrin glucanotransferase from alkalophilic Bacillus sp. 1011Effects of the replacement on pH dependence and transition-state stabilization. Biochemistry 1993, 32, 6624−6631. (31) Rimphanitchayakit, V.; Tonozuka, T.; Sakano, Y. Construction of chimeric cyclodextrin glucanotransferases from Bacillius circulans A11 and Paenibacillus macerans IAM1243 and analysis of their product specificity. Carbohydr. Res. 2005, 340, 2279−2289. (32) Penninga, D.; vanderVeen, B. A.; Knegtel, R. M. A.; vanHijum, S.; Rozeboom, H. J.; Kalk, K. H.; Dijkstra, B. W.; Dijkhuizen, L. The raw starch binding domain of cyclodextrin glycosyltransferase from Bacillus circulans strain 251. J. Biol. Chem. 1996, 271, 32777−32784.
11214
dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Mutations in Cyclodextrin Glycosyltransferase from Bacillus circulans Enhance β‑Cyclization Activity and β‑Cyclodextrin Production Min Huang,†,‡ Caiming Li,†,‡ Zhengbiao Gu,†,‡,§ Li Cheng,†,‡ Yan Hong,†,‡,§ and Zhaofeng Li*,†,‡,§ †
State Key Laboratory of Food Science and Technology, ‡School of Food Science and Technology, and §Synergetic Innovation Center of Food Safety and Nutrition, Jiangnan University, Wuxi, Jiangsu 214122, People’s Republic of China ABSTRACT: Cyclodextrin glycosyltransferase (EC 2.4.1.19, CGTase) is used to produce cyclodextrins, which are cyclic glucans with many industrial applications. In the present study, the effects of the amino acid residue at position 577, which is located in calcium-binding site III (CaIII), on cyclization activity and cyclodextrin production were investigated by replacing Asp577 in CGTase from Bacillus circulans STB01 with glutamate, arginine, lysine, and histidine. The results showed that mutations D577E and D577R significantly increased the β-cyclization activity. The D577R mutant, in particular, displayed a 30.7% increase in the β-cyclization activity when compared to the wild-type CGTase. Furthermore, under conditions resembling industrial production processes, the D577R and D577E mutants displayed 9.1 and 2.0% enhancement in β-cyclodextrin production, respectively. More importantly, the higher β-cyclization activities resulted in a significant reduction in the amount of mutant protein required during the process. Thus, the two mutants were much more suitable for the industrial production of β-cyclodextrin than the wild-type enzyme. KEYWORDS: cyclodextrin glycosyltransferase, cyclodextrin, cyclization activity, Asp577, mutation
■
increasing the number of electrostatic interactions.10 However, no data were provided concerning the effects of mutations at Asp577 on the cyclization activity of this enzyme. To test the hypothesis that the conformational stabilizing effect conferred by mutations of Asp577 may also enhance the cyclization activity of the enzyme, site-directed mutagenesis was used to convert Asp577 of CGTase from B. circulans STB01 to glutamate, arginine, lysine, and histidine. The effects of these mutations on the cyclization activity of CGTase and cyclodextrin production were determined. The relative mechanisms were also analyzed.
INTRODUCTION Cyclodextrins are cyclic α-1,4-glycosidic-linked oligomers of glucose. The most common types, which consist of six, seven, or eight glucose residues, are known as α-, β-, or γ-cyclodextrin, respectively. 1 These molecules find numerous potential applications in food, cosmetics, pharmaceuticals, agriculture, and chemical industries, because of their special ability to form inclusion complexes with small hydrophobic molecules.2−4 Cyclodextrins are commonly produced by the enzymatic conversion of starch through cyclization reactions catalyzed by cyclodextrin glycosyltransferase (EC 2.4.1.19, CGTase).5 CGTases can be classified as α-, β-, or γ-CGTases according to their main cyclodextrin product.6 Because of its relatively high yield and low price, β-cyclodextrin is the most widely marketed among the cyclodextrins.4 Nevertheless, even β-cyclodextrin is too costly for many applications.7 To develop more widespread industrial applications, there is a need to decrease the production cost of βcyclodextrin. An effective way to accomplish this goal is to reduce the amount of CGTase protein required during the process, because this enzyme is a significant cost factor in the production of β-cyclodextrin. Thus, mutants of CGTase with an increased activity for cyclization are of high industrial interest. CGTase is a member of the α-amylase family of glycosyl hydrolases (family 13),7,8 which commonly have two calciumbinding sites, called CaI and CaII. The enzyme used in our studies, β-CGTase from Bacillus circulans strain STB01, contains an additional calcium-binding site, CaIII.9 CaIII is located at the A/D domain interface and contains calcium-interacting residues Ala315 and Asp577. A previous study found that mutation of Asp577 to lysine improved the thermostability of this CGTase and suggested that the D577K mutation may enhance the conformational stability of the enzyme by the formation of additional hydrogen bonds and © 2014 American Chemical Society
■
MATERIALS AND METHODS
Bacterial Strains and Plasmids. Escherichia coli JM109 [F′ (traD36, proAB+ lacIq, Δ(lacZ)M15) endA1 recA1 hsdR17(rk−, mk+) mcrA supE44 λ− gyrA96 relA1 Δ(lac-proAB) thi-1]11 was used for recombinant DNA manipulations. Plasmid cgt/pST containing the βCGTase gene from B. circulans strain STB01 was used for site-directed mutagenesis, sequencing, and expression of the β-CGTase (mutant) proteins.10,12 The mutant β-CGTases were produced with Bacillus subtilis WB600 [trpC2 nprE aprE EPR bpr mpr nprB; Emr].13 DNA Manipulations and Sequencing. Restriction endonucleases, prime STAR HS DNA polymerase, and polymerase chain reaction (PCR) reagents were purchased from TaKaRa Shuzo (Otsu, Japan) and used in accordance with the instructions of the manufacturer. DNA manipulations and calcium chloride transformation of E. coli strains were performed as previously described.14 Transformation of B. subtilis was performed following the method by Spizizen.15 DNA sequences were determined by cycle sequencing with an ABI PRISM BigDye primer cycle sequencing kit with AmpliTaq DNA polymerase (PerkinElmer, Foster City, CA). Received: Revised: Accepted: Published: 11209
July 23, 2014 September 24, 2014 October 30, 2014 October 30, 2014 dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Journal of Agricultural and Food Chemistry
Article
Site-Directed Mutagenesis. Site-directed mutagenesis was performed using a one-step PCR method with plasmid cgt/pST as the template and a pair of complementary primers (Table 1). The PCR
protein-modeling server (http://www.expasy.ch/swissmod/SWISSMODEL.html).23 The PyMol molecular graphics system (http:// www.pymol.org) was used to visualize and analyze the model structure.
Table 1. Primers Used for Site-Directed Mutagenesis
RESULTS Expression and Purification of the Wild-Type and Mutant CGTases. B. circulans β-CGTase mutants D577E, D577R, D577K, and D577H were successfully constructed using site-directed mutagenesis. The wild-type and mutant CGTases were expressed in B. subtilis WB600, and the secreted proteins were isolated from the culture medium. There were no obvious differences in the levels of expression among the recombinant wild-type and mutant CGTases, with 20−25 mg of each of the CGTase proteins produced per liter in shake-flask cultures. The mutant CGTase proteins were purified to apparent homogeneity using a combination of anion-exchange and hydrophobic chromatographies. The purity and molecular weight of the wild-type and mutant CGTase proteins were verified using sodium dodecyl sulfate−polyacrylamide gel electrophoresis (SDS−PAGE) (data not shown). Cyclization Activities of Wild-Type and Mutant CGTases. The CGTase enzymes were assayed to determine α-, β- and γ-cyclization activities (Table 2). None of the mutations had a substantial effect upon the ratio of β-cyclization activity to total cyclization activity. These ratios varied from 74.6% (D577E) to 76.6% (D577K), with D577H, D577R, and the wild type having intermediate values, in that order. However, the D577E mutant displayed a 14.0% increase in total cyclization activity and an 11.2% overall increase in the β-cyclization activity when compared to the wild-type CGTase. More interesting, the D577R mutant displayed an even larger enhancement of total cyclization activity (32.5%), resulting in a 30.7% overall increase in β-cyclization activity, compared to that of the wild-type CGTase. In contrast, the D577K mutant showed only a 1.3% increase in the total cyclization activity and a 1.5% increase in βcyclization activity. Finally, the D577H mutant displayed slight decreases in the total cyclization activity and β-cyclization activity compared to wild-type CGTase. Starch Conversions of the Wild-Type and Mutant CGTases under Conditions Resembling Industrial Production Processes. To assess the performance of the mutant CGTases under conditions resembling those used in the industrial production of β-cyclodextrin, each enzyme was assayed in a reaction mixture containing CGTase protein (0.1 unit/mL βcyclization activity) and 5% (wet basis, w/v) soluble starch. The reaction mixtures were incubated at 45 °C and sampled over a 24 h time course. Although small amounts of α- and γ-cyclodextrin were produced, β-cyclodextrin was the main product for all CGTases (Figure 1). After 24 h of incubation, the wild-type enzyme converted 45.4% of the starch into cyclodextrins, of which the majority (69.2%) was β-cyclodextrin (Table 3).
a
desired mutation
primer sequence (5′−3′)
D577E
GCAATGTGTATGAAAACTTCGAG CTCGAAGTTTTCATACACATTGC GCAATGTGTATCGTAACTTCGAG CTCGAAGTTACGATACACATTGC GCAATGTGTATAAGAACTTCGAG CTCGAAGTTCTTATACACATTGC GCAATGTGTATCATAACTTCGAG CTCGAAGTTATGATACACATTGC
D577R D577K D577H
■
DNA template cgt/pST cgt/pST cgt/pST cgt/pST
a
Nucleotide sequences corresponding to the mutated amino acids are underlined.
products were treated with DpnI and then used to transform E. coli JM109 cells. The intended mutations were confirmed by DNA sequencing. To generate expression strains, the resulting (mutant) plasmids were used to transformed B. subtilis WB600 competent cells. Production and Purification of CGTase Proteins. A single colony of B. subtilis WB600 harboring cgt/pST (wild type or mutant) was inoculated into 50 mL of Luria−Bertani medium containing 5 μg/ mL kanamycin and grown at 37 °C overnight. A 2 mL portion of this overnight culture was then diluted into 50 mL of terrific broth containing 5 μg/mL kanamycin and incubated on a rotary shaker (200 rpm) at 37 °C for 48 h. The CGTase present in the supernatant was purified to homogeneity, as previously described.11 The purified enzymes were aliquoted and stored at −80 °C. The protein concentration was determined using the Bradford assay,16 with reagents obtained from the Bio-Rad protein assay reagent kit (Bio-Rad, Hercules, CA). Bovine serum albumin was used as the standard. Enzyme Assays. All assays were measured by incubating 0.1 mL of appropriately diluted purified CGTase with 0.9 mL of 1% (w/v) maltodextrin (DE = 3, Roquette Frères, Lestrem, France) in 10 mM phosphate buffer (pH 6.5) at 50 °C for 10 min. The concentrations of α-, β-, and γ-cyclodextrin formed were determined using the methyl orange,17 phenolphthalein,18 and bromocresol green19 methods, respectively. One unit of each activity was defined as the amount of enzyme that produced 1 μmol of the corresponding cyclodextrin per minute. High-Performance Liquid Chromatography (HPLC) Product Analysis. The formation of cyclodextrins under conditions resembling an industrial production process was performed by incubating 0.1 unit/ mL CGTase (β-cyclization activity) with 5% (wet basis, w/v) soluble starch solution in 10 mM phosphate buffer (pH 6.5) at 45 °C for 24 h. At regular time intervals, samples were taken and boiled for 20 min. The concentrations of α-, β-, and γ-cyclodextrin in the reaction mixture were determined by HPLC, as described in previous reports.12,20,21 Structure Modeling of the (Mutant) CGTase. The X-ray crystal structure of the wild-type CGTase from B. circulans was obtained from the Research Collaboratory for Structural Bioinformatics (RCSB) Protein Data Bank (PDB accession code 1CXI).22 Homology models of the mutant CGTases were constructed using the SWISS-MODEL
Table 2. Cyclization Activities of the Wild-Type and Mutant CGTases from B. circulans STB01a CGTase
α-cyclization activity (units/mg)
β-cyclization activity (units/mg)
γ-cyclization activity (units/mg)
total (units/mg)
wild type D577E D577R D577K D577H
31.6 ± 0.3 ab (10.4) 36.9 ± 0.5 d (10.7) 31.1 ± 0.3 a (7.7) 32.2 ± 0.4 b (10.5) 33.2 ± 0.4 c (11.2)
231.6 ± 1.9 b (76.5) 257.6 ± 2.6 c (74.6) 302.8 ± 2.3 d (75.5) 235.0 ± 2.2 b (76.6) 222.3 ± 1.8 a (75.0)
39.6 ± 0.8 a (13.1) 50.7 ± 0.7 b (14.7) 67.4 ± 0.9 c (16.8) 39.6 ± 0.4 a (12.9) 41.0 ± 0.3 a (13.8)
302.8 b 345.2 c 401.3 d 306.8 b 296.5 a
a
Numbers in parentheses indicate the ratio in specific activities for the formation of the different cyclodextrins. Each value represents the mean of three independent measurements, and means with different letters within the same column are significantly different (p < 0.05). 11210
dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Journal of Agricultural and Food Chemistry
Article
Figure 1. Cyclodextrins formed during incubation of the (mutant) CGTases from B. circulans STB01 (0.1 unit/mL β-cyclization activity) with 5% (wet basis, w/v) soluble starch solution in 10 mM phosphate buffer (pH 6.5) at 45 °C for 24 h: (black line) α-cyclodextrin, (red line) β-cyclodextrin, and (blue line) γ-cyclodextrin for (A) wild-type CGTase, (B) mutant D577E, (C) mutant D577R, (D) mutant D577K, and (E) mutant D577H.
Table 3. Starch Conversions of the Wild-Type and Mutant CGTases from B. circulans STB01a product (g/L) CGTase
conversion of starch into cyclodextrins (%)
α
β
γ
wild type D577E D577R D577K D577H
45.4 44.6 47.4 46.4 44.6
3.8 ± 0.1 ab (16.7) 3.5 ± 0.2 a (15.7) 3.5 ± 0.1 a (14.8) 4.1 ± 0.1 b (17.7) 3.8 ± 0.2 ab (17.0)
15.7 ± 0.2 a (69.2) 16.1 ± 0.1 b (72.2) 17.2 ± 0.1 c (72.6) 16.2 ± 0.2 b (69.8) 15.8 ± 0.1 a (70.9)
3.2 ± 0.1 b (14.1) 2.7 ± 0.1 a (12.1) 3.0 ± 0.2 ab (12.6) 2.9 ± 0.1 a (12.5) 2.7 ± 0.1 a (12.1)
CGTase proteins (0.1 unit/mL β-cyclization activity) were incubated with 5% (wet basis, w/v) soluble starch solution at pH 6.5 and 45 °C for 24 h. Numbers in parentheses indicate the percentage of each cyclodextrin present in the product mixture. Each value represents the mean of three independent measurements, and means with different letters within the same column are significantly different (p < 0.05).
a
The mutant CGTases produced somewhat more β-cyclodextrin under the same reaction conditions (Figure 1 and Table 3). The D577R mutant showed the greatest enhancement in β-
cyclodextrin production, converting 47.4% of the starch into cyclodextrins, of which 72.6% was β-cyclodextrin. This represents a 9.5% enhancement in β-cyclodextrin production. 11211
dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Journal of Agricultural and Food Chemistry
Article
Figure 2. Models of the (mutant) CGTases from B. circulans STB01: (yellow dashed line) hydrogen bond, (cyan ball) Ca2+ in site CaIII, (green) carbon, (red) oxygen, and (blue) nitrogen for (A) wild-type CGTases, (B) mutant D577E, (C) mutant D577R, (D) mutant D577K, and (E) mutant D577H.
stability of α-amylase.26−28 Although there are some differences between CGTase and α-amylase in these regions, it was also indicated that the mutation of the amino acid residues at calciumbinding sites could affect the CGTase activities.29,30 This suggested that the calcium-binding sites might have a critical function to CGTase. The results supported this hypothesis, demonstrating that mutations at the site CaIII of β-CGTase from B. circulans strain STB01, specifically replacement of Asp 577 with glutamate, arginine, or lysine, could have a beneficial effect on β-cyclization activity; the mutants enhanced the β-cyclization activity in the order D577R > D577E > D577K. The homology modeling results appeared to support the hypothesis that the enhancement in β-cyclization activity of βCGTase was related to a conformational stabilizing effect, because all of the mutants with a newly introduced hydrogen bond by mutations of Asp577 showed higher β-cyclization activities (Figure 2 and Table 2). A possible explanation was that the increase of enzyme stability was more conducive to the synthesis of the main product in the enzyme-catalyzed reaction. However, the enhancement in the β-cyclization activity might not completely depend upon the conformational stabilizing effect. The structural changes suggested that D577E gave the greatest increase in the number of interactions between the side chain at residue 577 and the other residues in domain D, followed by D577R and D577K. The order in which the substitutions enhanced the β-cyclization activity did not correlate with the changes in structure predicted by homology modeling. Previous studies have shown that domain D might be involved in positioning domain E in the correct orientation.31 Furthermore, domain E has an important role in adsorbing starch granules.32
The D577K mutant showed a 3.1% increase in β-cyclodextrin production, converting 46.4% of the starch to cyclodextrins, of which 69.8% was β-cyclodextrin. Although the D577E mutant showed a slight decline in starch conversion, the mutation resulted in a 2.5% increase in β-cyclodextrin production, which came at the expense of α-cyclodextrin and γ-cyclodextrin production. The D577H mutant had a slightly lower starch conversion and almost the same β-cyclodextrin production when compared to the wild-type CGTase. Homology Modeling of the Mutant β-CGTases. A structural model of each of the mutant CGTases was prepared using the SWISS-MODEL protein-modeling server (Figure 2).23 Substitution of aspartate for glutamate conserves the negative charge but adds an additional aliphatic carbon and increases the chain length. Comparing the homology model of D577E (Figure 2B) to the structure of the wild-type β-CGTase (Figure 2A) suggests that the glutamate residue forms additional hydrogen bonds with residues Asn560 and Asn578. Substitution of the negatively charged aspartate with a positively charged residue, such as arginine (Figure 2C) or lysine (Figure 2D), changes the ionic character of this residue and may also introduce a hydrogen bond with Asn562. Substitution of aspartate by histidine (Figure 2E) also changes the ionic character of the residue, but in this case, no additional hydrogen bonds are predicted.
■
DISCUSSION Biochemical studies have revealed calcium-binding sites in the protein molecules of this family.24,25 Previous reports about calcium-binding sites had showed that the amino acid residues within these regions related to the catalytic activity and thermal 11212
dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Journal of Agricultural and Food Chemistry
Article
(8) Leemhuis, H.; Kelly, R. M.; Dijkhuizen, L. Engineering of cyclodextrin glucanotransferases and the impact for biotechnological applications. Appl. Microbiol. Biotechnol. 2010, 85, 823−835. (9) Ban, X. F.; Li, C. M.; Bao, C. H.; Gu, Z. B.; Li, Z. F. Structure and function analysis of calcium binding sites in cyclodextrin glucanotransferase. Prog. Biochem. Biophys. 2013, 40, 1239−1246. (10) Li, C. M.; Ban, X. F.; Gu, Z. B.; Li, Z. F. Calcium ion contribution to thermostability of cyclodextrin glycosyltransferase is closely related to calcium-binding site CaIII. J. Agric. Food Chem. 2013, 61, 8836−8841. (11) Yanisch-Perron, C.; Vieira, J.; Messing, J. Improved M13 phage cloning vectors and host strains: Nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 1985, 33, 103−119. (12) Li, Z. F.; Ban, X. F.; Gu, Z. B.; Li, C. M.; Huang, M.; Hong, Y.; Cheng, L. Mutations enhance β-cyclodextrin specificity of cyclodextrin glycosyltransferase from Bacillus circulans. Carbohydr. Polym. 2014, 108, 112−117. (13) Wu, X. C.; Lee, W.; Tran, L.; Wong, S. L. Engineering a Bacillus subtilis expression−secretion system with a strain deficient in 6 extracellular proteases. J. Bacteriol. 1991, 173, 4952−4958. (14) Joseph, S.; David, W. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: New York, 2001; Vol. 2. (15) Spizizen, J. Transformation of biochemically deficient strains of Bacillus subtilis by deoxyribonucleate. Proc. Natl. Acad. Sci. U. S. A. 1958, 44, 1072−1078. (16) Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein−dye binding. Anal. Biochem. 1976, 72, 248−254. (17) Lejeune, A.; Sakaguchi, K.; Imanaka, T. A spectrophotometric assay for the cyclization activity of cyclomaltohexaose (α-cyclodextrin) glucanotransferase. Anal. Biochem. 1989, 181, 6−11. (18) Makela, M.; Korpela, T.; Laakso, S. Colorimetric determination of β-cyclodextrin: Two assay modifications based on molecular complexation of phenolphtalein. J. Biochem. Biophys. Methods 1987, 14, 85−92. (19) Kato, T.; Horikoshi, K. Colorimetric determination of γcyclodextrin. Anal. Chem. 1984, 56, 1738−1740. (20) Li, Z. F.; Zhang, J. Y.; Wang, M.; Gu, Z. B.; Du, G. C.; Li, J. K.; Wu, J.; Chen, J. Mutations at subsite-3 in cyclodextrin glycosyltransferase from Paenibacillus macerans enhancing α-cyclodextrin specificity. Appl. Microbiol. Biotechnol. 2009, 83, 483−490. (21) Li, Z. F.; Zhang, J. Y.; Sun, Q.; Wang, M.; Gu, Z. B.; Du, G. C.; Wu, J.; Chen, J. Mutations of lysine 47 in cyclodextrin glycosyltransferase from Paenibacillus macerans enhance β-cyclodextrin specificity. J. Agric. Food Chem. 2009, 57, 8386−8391. (22) Knegtel, R. M.; Strokopytov, B.; Penninga, D.; Faber, O. G.; Rozeboom, H. J.; Kalk, K. H.; Dijkhuizen, L.; Dijkstra, B. W. Crystallographic studies of the interaction of cyclodextrin glycosyltransferase from Bacillus circulans strain 251 with natural substrates and products. J. Biol. Chem. 1995, 270, 29256−29264. (23) Arnold, K.; Bordoli, L.; Kopp, J.; Schwede, T. The SWISSMODEL workspace: A web-based environment for protein structure homology modelling. Bioinformatics 2006, 22, 195−201. (24) Janecek, S. α-Amylase family: Molecular biology and evolution. Prog. Biophys. Mol. Biol. 1997, 67, 67−97. (25) Buisson, G.; Duee, E.; Haser, R.; Payan, F. Three dimensional structure of porcine pancreatic α-amylase at 2.9 Å resolution. Role of calcium in structure and activity. EMBO J. 1987, 6, 3909−3916. (26) Sajedi, R. H.; Taghdir, M.; Naderi-Manesh, H.; Khajeh, K.; Ranjbar, B. Nucleotide sequence, structural investigation and homology modeling studies of a Ca2+-independent α-amylase with acidic pHprofile. J. Biochem. Mol. Biol. 2007, 40, 315−324. (27) Yadav, J. K. A differential behavior of α-amylase, in terms of catalytic activity and thermal stability, in response to higher concentration CaCl2. Int. J. Biol. Macromol. 2012, 51, 146−152. (28) Igarashi, K.; Hatada, Y.; Ikawa, K.; Araki, H.; Ozawa, T.; Kobayashi, T.; Ozaki, K.; Ito, S. Improved thermostability of a Bacillus αamylase by deletion of an arginine-glycine residue is caused by enhanced calcium binding. Biochem. Biophys. Res. Commun. 1998, 248, 372−377.
Therefore, to identify the molecular bases for the effects seen here, future studies must resort to more sophisticated modeling approaches. In addition, under the same reaction conditions resembling industrial production processes, the mutants with enhanced βcyclization activities could produce more β-cyclodextrin in the order D577R > D577K > D577E. The D577R mutant demonstrated a substantial enhancement in β-cyclodextrin production. More importantly, because of a higher β-cyclization activity, the amount of D577R protein in the reaction mixture could be reduced by 30.7% when compared to the wild-type CGTase. Although the D577E mutant showed only a 2.5% increase in β-cyclodextrin production, the amount of mutant protein was also reduced by 11.2%. Thus, these mutations of Asp577 resulted in the increased β-cyclodextrin production and reduced amount of CGTase required during the reaction process. In conclusion, Asp577, which is located on the periphery of domain D and is a key residue within calcium-binding site CaIII, played an important role in cyclization activity. The mutations D577R and D577E could obviously enhance the total cyclization activity and β-cyclization activity. Furthermore, under conditions resembling industrial production processes, the D577R and D577E mutants displayed increased β-cyclodextrin production; the higher β-cyclization activities resulted in the significant reduction in the amount of mutant protein required during the process. Thus, the two mutants were much more suitable for the industrial production of β-cyclodextrin than the wild-type enzyme.
■
AUTHOR INFORMATION
Corresponding Author
*Telephone/Fax: 86-510-85329237. E-mail: zfl[email protected]. cn. Funding
Financial support for this work was obtained from the National Natural Science Foundation of China (31101228), the Natural Science Foundation of Jiangsu Province (BK2011152), and the Fok Ying-Tong Education Foundation, China (131069). Notes
The authors declare no competing financial interest.
■
REFERENCES
(1) Szejtli, J. Introduction and general overview of cyclodextrin chemistry. Chem. Rev. 1998, 98, 1743−1753. (2) Saenger, W. Cyclodextrin inclusion compounds in research and industry. Angew. Chem. 1980, 19, 344−362. (3) Del Valle, E. M. M. Cyclodextrins and their uses: A review. Process Biochem. 2004, 39, 1033−1046. (4) Li, Z.; Wang, M.; Wang, F.; Gu, Z.; Du, G.; Wu, J.; Chen, J. γCyclodextrin: A review on enzymatic production and applications. Appl. Microbiol. Biot. 2007, 77, 245−255. (5) Li, Z.; Chen, S.; Gu, Z.; Chen, J.; Wu, J. α-Cyclodextrin: Enzymatic production and food applications. Trends Food Sci. Technol. 2014, 35, 151−160. (6) Penninga, D.; Strokopytov, B.; Rozeboom, H. J.; Lawson, C. L.; Dijkstra, B. W.; Bergsma, J.; Dijkhuizen, L. Site-directed mutations in tyrosine 195 of cyclodextrin glycosyltransferase from Bacillus circulans strain 251 affect activity and product specificity. Biochemistry 1995, 34, 3368−3376. (7) van der Veen, B. A.; Uitdehaag, J. C.; Dijkstra, B. W.; Dijkhuizen, L. Engineering of cyclodextrin glycosyltransferase reaction and product specificity. Biochim. Biophys. Acta, Protein Struct. Mol. Enzymol. 2000, 1543, 336−360. 11213
dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
Journal of Agricultural and Food Chemistry
Article
(29) Goh, P. H.; Illias, R. M.; Goh, K. M. Rational mutagenesis of cyclodextrin glucanotransferase at the calcium binding regions for enhancement of thermostability. Int. J. Mol. Sci. 2012, 13, 5307−5323. (30) Nakamura, A.; Haga, K.; Yamane, K. Three histidine residues in the active center of cyclodextrin glucanotransferase from alkalophilic Bacillus sp. 1011Effects of the replacement on pH dependence and transition-state stabilization. Biochemistry 1993, 32, 6624−6631. (31) Rimphanitchayakit, V.; Tonozuka, T.; Sakano, Y. Construction of chimeric cyclodextrin glucanotransferases from Bacillius circulans A11 and Paenibacillus macerans IAM1243 and analysis of their product specificity. Carbohydr. Res. 2005, 340, 2279−2289. (32) Penninga, D.; vanderVeen, B. A.; Knegtel, R. M. A.; vanHijum, S.; Rozeboom, H. J.; Kalk, K. H.; Dijkstra, B. W.; Dijkhuizen, L. The raw starch binding domain of cyclodextrin glycosyltransferase from Bacillus circulans strain 251. J. Biol. Chem. 1996, 271, 32777−32784.
11214
dx.doi.org/10.1021/jf503523z | J. Agric. Food Chem. 2014, 62, 11209−11214
