REPORT Mutations in MECOM, Encoding Oncoprotein EVI1, Cause Radioulnar Synostosis with Amegakaryocytic Thrombocytopenia Tetsuya Niihori,1,* Meri Ouchi-Uchiyama,2,3 Yoji Sasahara,2 Takashi Kaneko,4 Yoshiko Hashii,5 Masahiro Irie,2,3 Atsushi Sato,3 Yuka Saito-Nanjo,2,3 Ryo Funayama,6 Takeshi Nagashima,6 Shin-ichi Inoue,1 Keiko Nakayama,6 Keiichi Ozono,5 Shigeo Kure,2 Yoichi Matsubara,1,7 Masue Imaizumi,3,8 and Yoko Aoki1,8 Radioulnar synostosis with amegakaryocytic thrombocytopenia (RUSAT) is an inherited bone marrow failure syndrome, characterized by thrombocytopenia and congenital fusion of the radius and ulna. A heterozygous HOXA11 mutation has been identified in two unrelated families as a cause of RUSAT. However, HOXA11 mutations are absent in a number of individuals with RUSAT, which suggests that other genetic loci contribute to RUSAT. In the current study, we performed whole exome sequencing in an individual with RUSAT and her healthy parents and identified a de novo missense mutation in MECOM, encoding EVI1, in the individual with RUSAT. Subsequent analysis of MECOM in two other individuals with RUSAT revealed two additional missense mutations. These three mutations were clustered within the 8th zinc finger motif of the C-terminal zinc finger domain of EVI1. Chromatin immunoprecipitation and qPCR assays of the regions harboring the ETS-like motif that is known as an EVI1 binding site showed a reduction in immunoprecipitated DNA for two EVI1 mutants compared with wild-type EVI1. Furthermore, reporter assays showed that MECOM mutations led to alterations in both AP-1- and TGF-b-mediated transcriptional responses. These functional assays suggest that transcriptional dysregulation by mutant EVI1 could be associated with the development of RUSAT. We report missense mutations in MECOM resulting in a Mendelian disorder that provide compelling evidence for the critical role of EVI1 in normal hematopoiesis and in the development of forelimbs and fingers in humans.
Radioulnar synostosis with amegakaryocytic thrombocytopenia (RUSAT [MIM: 605432]) is an inherited bone marrow failure syndrome with skeletal anomalies.1 RUSAT is characterized by thrombocytopenia that progresses to pancytopenia and congenital proximal fusion of the radius and ulna that results in extremely limited pronation and supination of the forearm. A heterozygous HOXA11 (MIM: 142958) mutation has been identified by candidate gene analysis in two unrelated families as a cause of RUSAT.2 However, a number of individuals with RUSAT lacking HOXA11 mutations have been reported,3 which suggests that additional genetic loci are responsible for RUSAT. To discover a causative mutation, we performed whole exome sequencing on a girl with RUSAT (TRS1) who lacked a HOXA11 mutation (Table 1, Figure 1A, Supplemental Note) and whose parents lacked clinical symptoms of RUSAT. TRS1 underwent cord blood transplantation (CBT) at 4 months of age and complete donor-typed chimerism was confirmed by analysis of her peripheral blood at day þ35. Donor-derived DNA was sometimes observed in recipient fingernails and saliva after hematopoietic stem cell transplantation.6,7 Therefore, DNA from peripheral blood of TRS1, which was collected before
CBT, was used for whole exome sequencing. This study was approved by the Ethics Committee of the Tohoku University School of Medicine. All samples analyzed in this study were collected after written informed consent was obtained. We searched for de novo variants as pathogenic candidates by the filtering steps detailed in Table S1 and identified one heterozygous alteration, c.2266A>G in MECOM (EVI1) (GenBank: NM_001105078, MIM: 165215), which resulted in the amino acid substitution p.Thr756Ala. To confirm that this alteration was a germline variant, Sanger sequencing was performed on DNA from other tissues via a previously described protocol.8 The c.2266A>G variant was present in a buccal swab, fingernails, and hairs of the girl collected after cord blood transplantation, but it was absent in blood samples of her parents and her healthy brother (Figure 1B). We confirmed high levels of donor chimerism in the nail of TRS1 (data not shown); therefore, the small mutant allele fractions from the nails, and possibly the buccal swab, would be mainly due to her chimerism, rather than somatic mosaicism. Mutation analysis of all coding exons and neighboring introns of MECOM in two additional individuals with simplex RUSAT lacking a HOXA11 mutation identified two variants: c.2252A>G (p.His751Arg)
1 Department of Medical Genetics, 2Department of Pediatrics, Tohoku University School of Medicine, Sendai 980-8574, Japan; 3Department of Hematology and Oncology, Miyagi Children’s Hospital, Sendai 989-3126, Japan; 4Department of Hematology-Oncology, Tokyo Metropolitan Children’s Medical Center, Fuchu 183-8561, Japan; 5Department of Pediatrics, Osaka University Graduate School of Medicine, Suita 565-0871, Japan; 6Division of Cell Proliferation, United Centers for Advanced Research and Translational Medicine, Tohoku University Graduate School of Medicine, Sendai 980-8575, Japan; 7 National Research Institute for Child Health and Development, Tokyo 157-8535, Japan 8 These authors contributed equally to this work *Correspondence: [email protected] http://dx.doi.org/10.1016/j.ajhg.2015.10.010. Ó2015 by The American Society of Human Genetics. All rights reserved.
848 The American Journal of Human Genetics 97, 848–854, December 3, 2015
Table 1.
Clinical Manifestations in Individuals with Mutations in MECOM
Individual
TRS24
TRS1
TRS35
Clinical Information Family history
simplex
simplex
simplex
Gender
female
female
male
Age at last clinical examination
3 years 2 months
8 years 9 months
8 years 0 months
Height (SD)
90.3 cm (0.95)
113.7 cm (2.5)
112 cm (2.42)
Weight (SD)
11.8 kg (1.07)
16.6 kg (2.1)
17.8 kg (1.63)
Gestational age
35 weeks
37 weeks
31 weeks
Birth weight
2,160 g
2,058 g
2,180 g
Leukocyte count at birth
6,780/ml
17,100/ml
3,220/ml
Hemoglobin count at birth
4.0 g/dl
12.9 g/dl
2.7 g/dl
Platelet count at birth
5,000/ml
8,000/ml
89,000/ml
Initial clinical presentation
neonatal asphyxia
systemic petechiae
fetal hydrops
HSC transplantation
CBT, 4 months
uBMT, 18 months
uBMT, 8 months
Radioulnar synostosis
blt
blt
blt
Finger abnormality
blt bony defect of the intermediate phalanges of the fifth digits, blt brachymesophalangia of the fourth digits
blt clinodactyly of the fifth digits
overlapping fingers without abnormalities of bone
Hearing
normal
sensorineural hearing impairment: Rt 55 dB, Lt 33.75 dB
prelingual sensorineural hearing impairment: Rt 60 dB, Lt 25 dB
Psychomotor development
normal
normal
mild intellectual disability (IQ 67)
Other
none
cleft palate, dysarthria
hydrocele testicle
cDNA (GenBank: NM_001105078)
c.2266A>G
c.2252A>G
c.2248C>T
Protein (GenBank: NP_001098548)
p.Thr756Ala
p.His751Arg
p.Arg750Trp
Mutations in MECOM
Abbreviations are as follows: HSC, hematopoietic stem cell; CBT, cord blood transplantation; blt, bilateral; uBMT, unrelated bone marrow transplantation; Rt, right; Lt, left; IQ, intelligence quotient.
in individual TRS24 and c.2248C>T (p.Arg750Trp) in TRS35 (Table 1, Figures 1C and 1D). The c.2252A>G (p.His751Arg) variant was present in the DNA collected from a buccal swab and hairs of TRS2 but was absent from her fingernails and peripheral blood, nor was it present in her healthy parents. TRS3 presented the c.2248C>T (p.Arg750Trp) variant in his buccal swab, nails, and hairs. This variant was not detected in the DNA of his healthy mother, and the samples of his father were not available. All of the samples fromTRS2 and TRS3 that we could analyze were collected after hematopoietic stem cell transplantation. Therefore, these sequencing results indicate that the germline mutant allele in the buccal swab and nails might be diluted by donor-derived DNA. Alternatively, we could not exclude the possibility for post-zygotic mutations.9 In total, two of these three variants were considered to be de novo. All three variants affect residues in a highly conserved region of EVI1 (Figure 2A)
and were predicted in silico to be damaging (Table S2). None of the three variants was observed in 382 ethnicitymatched healthy controls or in public variant databases, such as dbSNP, 1000 Genomes, the Human Genetic Variation Database, and ExAC (see Web Resources). These results strongly suggest that these variants are disease-causing mutations. The Evi1 locus was initially identified as a common target of the retroviral integration site in murine myeloid leukemia.10 In humans, MECOM represents a frequent site of insertional mutagenesis after gene therapy for X-linked chronic granulomatous disease.11 MECOM encodes the transcriptional regulator proteins EVI1 and MDS1-EVI1, which are transcribed from alternative transcriptional start sites.12 EVI1 has been reported to be able to recruit either coactivators or corepressors.13 High MECOM expression, which is observed in 5%–10% of all cases of acute myeloid leukemia, is predictive of a poor
The American Journal of Human Genetics 97, 848–854, December 3, 2015 849
AGAACCCACACAGGAGAGCAG
AGAACCCACACAGGAGAGCAG
B
A
WT
WT
TRS1
WT
AGAACCCACACAGGAGAGCAG
c.2266A>G p.Thr756Ala A AGAACCCAC CAGGAGAGCAG G
Peripheral blood (Pre-CBT) A AGAACCCACGCAGGAGAGCAG
Hair (Post-CBT)
Figure 1. Individuals with RUSAT Attributed to MECOM Mutations (A) Radiographs of the forearms of TRS1 show bilateral radioulnar synostosis (arrows). Open arrowheads indicate a bilateral bony defect of the intermediate phalanges of the fifth digits. (B–D) Mutation analysis of TRS1 (B), TRS2 (C), and TRS3 (D) and their families. DNA extraction was performed with a BuccalAmp DNA Extraction Kit (Epicenter) for buccal swab and ISOHAIR (Nippon Gene) for fingernails and hairs. PCR primers are listed in Table S3. Abbreviations are as follows: WT, wild-type; BMT, bone marrow transplantation; CBT, cord blood transplantation; NA, not available.
A AGAACCCACGCAGGAGAGCAG
Buccal swab (Post-CBT)
C and three such motifs in its C-terminal domain that recognize an ETSNail like motif19–21 (Figure 2A). In each (Post-CBT) TRS2 c.2252A>G zinc finger motif, a zinc ion is tetrap.His751Arg hedrally coordinated between two CTAACACGGCA GCTTGAGAACC D cysteines at one end of the b sheet NA WT AACCTAACACGGCACTTGAG and two histidines in the a helix, Hair which stabilizes protein folding22 (Post-BMT) TRS3 A (Figure 2B). All three mutations idenCTAACACGGCGCTTGAGAACC c.2248C>T p.Arg750Trp tified in individuals with RUSAT Buccal swab AACCTAACA C TGGCACTTGAG (Post-BMT) affected the histidine essential for Hair folding stability (Figures S1A and CTAACACGGC ACTTGAGAACC (Post-BMT) S1B) or the neighboring residues, Nail and p.Arg750Trp was located at the C (Post-BMT) AACCTAACATGGCACTTGAG position predicted to contact DNA CTAACACGGCACTTGAGAACC Buccal swab directly22 (Figure S1C). These find(Post-BMT) Peripheral blood ings suggest that the identified muta(Post-BMT) tions might alter the folding stability AACCTAACACGGCACTTGAG T of the 8th zinc finger motif and Nail (Post-BMT) the DNA-binding ability of the C-terminal zinc finger domain (ZFD) of EVI1. To test the DNA binding ability of mutant EVI1 in vivo, outcome.14 The aberrant expression of MECOM has also been found in solid tumors, such as ovarian and colon can- we performed chromatin immunoprecipitation (ChIP)cers.15,16 In inherited bone marrow failure syndromes, qPCR assays on regions known to be EVI1 binding EVI1 is thought to repress RBM8A gene expression by sites.19 Compared with wild-type EVI1, we observed binding to a site created by a pathogenic variant in the significantly reduced levels of RUNX1 exon 1 DNA precip50 untranslated region of RBM8A in individuals with itated with p.Arg750Trp and p.His751Arg mutants as well thrombocytopenia with absent radii syndrome.17 In as reduced levels of CD109 promoter DNA precipitated normal human cells, MECOM is expressed in hematopoiet- with p.Arg750Trp mutants, albeit with large error bars ic stem cells and plays an important function in hemato- (Figure S2). These two regions harbor ETS-like motifs poiesis and stem cell self-renewal.14 In mice, Mecom is and 12-O-Tetradecanoylphorbol-13-acetate (TPA)-responexpressed at high levels in the urinary system, the lung, sive element (TRE) motifs. The TRE motif is commonly the heart, and the limb bud in embryo,18 which suggests recognized by activator protein-1 (AP-1, formed by JUN that this gene plays an important role in limb develop- and FOS), and a physical association between EVI1 and ment. These observations support the evidence that FOS has been reported.19 Our results suggest that the direct and/or indirect DNA binding ability of two EVI1 MECOM mutations cause RUSAT. EVI1 contains seven Cys2His2 zinc finger motifs in its mutants to one or more genomic regions might be N-terminal domain that recognize a GATA-like motif decreased. WT
CTAACACGGCACTTGAGAACC
WT
A AGAACCCAC CAGGAGAGCAG G
CTAACACGGCACTTGAGAACC
850 The American Journal of Human Genetics 97, 848–854, December 3, 2015
A
B
Figure 2. Mutations in MECOM Identified in Individuals with RUSAT (A) MECOM mutations were clustered in the 8th zinc finger motif. All affected residues are completely conserved throughout evolution. Blue dots indicate the cysteines and histidines essential for the folding stability of the zinc finger domain. A cylinder and open arrows indicate a helix and b sheets, respectively. (B) Homology modeling of the 8th zinc finger motif. Homology models of the C-terminal ZFD of EVI1 were generated using SWISSMODEL (RRID: nif-0000-03522) on the crystal structure of a designed zinc finger protein bound to DNA (PDB: 1MEY). This protein and the C-terminal ZFD of the human EVI1 protein share 50% sequence identity.
To examine whether EVI1 variants alter transcriptional regulation, we performed luciferase assays using two reporter systems, focusing on activator protein-1 (AP-1) and transforming growth factor b (TGF-b) signaling. First, we measured luciferase activity upon binding of transcription factors to the AP-1 enhancer elements, which is one of the targets of regulation by EVI1 with dependence on the C-terminal ZFD.23 Renilla luciferase encoded by phRLnull-luc was used to normalize the transfection efficiency. We observed a suppression of relative luciferase activity (RLA) in cells transfected with wild-type EVI1 compared with cells transfected with empty vector after treatment with 10% serum, whereas EVI1 mutants displayed enhanced suppression—that is, a gain-of-function effect (Figure 3B). We obtained similar results with HEK293 cells (data not shown). These results showed that effects of wild-type EVI1 were different from those observed in NIH 3T3 cells using a luciferase reporter plasmid harboring three repeats of TRE followed by the herpes simplex virus thymidine kinase promoter23 but were similar to the observations made in an immortalized normal ovarian epithelial cell line transfected with the same luciferase reporter plasmid as that used in this study.25 This discordance might be explained by the difference of the backbone of each luciferase construct. Next, we used a p3TP-lux reporter vector, which also contains TRE and a portion of the plasminogen activator inhibitor (PAI)-1 promoter24 and has been used to demonstrate the suppression of TGF-b-mediated transcriptional responses by EVI1.26 RLA in cells transfected with wildtype EVI1 was suppressed, unlike cells transfected with empty vector after treatment with 1 ng/ml TGF-b1, whereas EVI1 mutants showed an attenuated suppression effect (Figure 3C). Kurokawa et al. showed that the
C-terminal ZFD deletion had a similar effect on TGFb-mediated transcriptional response to that of the wildtype construct.26 Our results raise the possibility that missense mutations affecting the C-terminal ZFD are also associated with aberrant TGF-b signaling. These results indicate that mutations might be gain of function for AP1 and partial loss of function for TGF-b signaling. Further studies are needed to elucidate transcriptional dysregulation in the mutant EVI1 background. All individuals with mutations in MECOM identified in this study were simplex cases and required hematopoietic stem cell transplantation to counter bone marrow failure (Table 1). By contrast, the individuals with a HOXA11 mutation reported by Thompson et al.1,2 were familial cases with a broad hematologic spectrum that ranged from early-onset bone marrow failure to a lack of clinical problems. Furthermore, TRS1 and TRS3 exhibited severe anemia at birth (hemoglobin 4.0 and 2.7 g/dl, respectively), whereas the individuals harboring a HOXA11 mutation did not experience this issue. Mutations in MECOM might therefore be associated with a severe hematologic phenotype among individuals with RUSAT. Thompson et al.1 reported an individual with a HOXA11 mutation who had sensorineural deafness. The two individuals with MECOM mutations, TRS2 and TRS3, also had sensorineural hearing impairments. A mouse model, called Junbo, expressing a mutation corresponding to human EVI1 p.Asn782Ile, had susceptibility to otitis media and hearing loss.27 As for our individuals with RUSAT, TRS3 did not have chronic otitis media, and a past history of chronic otitis media was uncertain in TRS2. These observations suggest that individuals with MECOM mutations would be associated with hearing impairment not due to chronic otitis media.
The American Journal of Human Genetics 97, 848–854, December 3, 2015 851
A
B
C
Figure 3. EVI1 Mutants Alter Transcriptional Regulation (A) Immunoblot of exogenous EVI1 in NIH 3T3 whole-cell lysates. The protein levels were comparable for FLAG-tagged wild-type and mutant EVI1. (B) Luciferase assay for AP-1 enhancer element. Empty or EVI1 expression constructs, pAP-1-luc (Agilent Technologies; contains seven tandem repeats of TRE-like TGACTAA motif, which is consensus AP-1 binding site), and phRL null luc (transfection control) were co-transfected into NIH 3T3 cells using lipofectamine 2000 (Life Technologies). At 18 hr after transfection, the cells were serum starved in DMEM for 24 hr and were either treated or untreated with 10% newborn calf serum (GIBCO) for 6 hr after serum starvation. The bars indicate mean (5SD) fold change relative to the wild-type (white bar). Experiments were performed in triplicate and repeated twice. *p < 0.05; **p < 0.01; ***p < 0.001 compared with wild-type. (C) Luciferase assays using p3TP-lux, which contains three repeats of TRE fused to a portion of the plasminogen activator inhibitor (PAI)-1 promoter.24 The cells were treated or untreated with 1 ng/ml human TGF-b1 (Roche Diagnostics) for 6 hr after serum starvation. The bars indicate mean (5SD) fold change relative to wild-type (white bar). Experiments were performed in triplicate and repeated twice. *p < 0.05; **p < 0.01; ***p < 0.001 compared with wild-type. Statistical analysis was performed with Dunnett’s test. Abbreviation is as follows: WT, wild-type.
An individual presenting with aplastic anemia and harboring a null allele28—a de novo 3q26 deletion encompassing MECOM—provides important clues to deciphering the effects of MECOM missense mutations. In a mouse model, heterozygous knockout of Mecom leads to a marked
impairment in the self-renewal capacity of long-term hematopoietic stem cells due to accelerated differentiation.29 This impairment might occur in the individual with the 3q26 deletion and possibly in individuals with RUSAT reported in this study. MECOM haploinsufficiency might be sufficient to cause bone marrow failure. However, no limb anomalies were described in the individual with the 3q26 deletion,28 which suggests that the missense mutations identified in this study might act as gain-of-function, partial loss-of-function as shown in Figure 3, or possibly dominant-negative rather than the complete loss-of-function mutations affecting the bone development of forearms and fingers. The MECOM mutations identified in this study in individuals with RUSAT were clustered in the 8th zinc finger motif in the C-terminal ZFD. The 8th zinc finger motif is the oligomerization domain involved in interactions with EVI1 itself and with RUNX1.30 Thus, these mutations might alter not only protein-DNA binding but also protein-protein interactions in transcriptional regulation. Functional interactions between EVI1 and other sequence-specific transcription factors, such as SPI1,31 GATA1,32 SMAD3,26 and FOS,19 have also been reported previously. In this context, the divergent effect of mutants observed in luciferase assays in this study might depend on altered interaction of mutant EVI1 with DNA and/or other transcriptional factors. Although knock-in mouse models harboring mutations in the 8th zinc finger motif of Evi1 have not been reported, Junbo mouse, which had a Evi1 mutation in the 9th zinc finger motif of the same C-terminal ZFD, had extra digits on the forelimbs,27 which suggests an important role for the C-terminal ZFD in digit development. In conclusion, we have identified MECOM mutations in individuals with RUSAT. We report missense mutations in MECOM as a cause of a Mendelian disorder, although overexpression of MECOM has been shown to induce myeloid malignancies. Our findings provide compelling evidence for the critical roles of EVI1 in normal hematopoiesis and in the development of forelimbs and fingers in humans. Further studies are required to elucidate the mechanisms underlying the development of RUSAT. Supplemental Data Supplemental Data include a Supplemental Note of one case report, two figures, and three tables and can be found with this article online at http://dx.doi.org/10.1016/j.ajhg.2015.10.010.
Acknowledgments The authors thank the patients who participated in this study and their families and doctors. We are grateful to Dr. Joan Massague and Dr. Jeff Wrana for p3TP-lux (Addgene plasmid #11767). We also thank Yoko Tateda, Kumi Kato, Miyuki Tsuda, Mami Kikuchi, and Kiyotaka Kuroda for their technical assistance. This work was supported by the Practical Research Project for Rare/Intractable
852 The American Journal of Human Genetics 97, 848–854, December 3, 2015
Diseases from Japan Agency for Medical Research and Development (AMED) to T. Niihori, Y.M., and Y.A. Received: July 29, 2015 Accepted: October 14, 2015 Published: November 12, 2015
Web Resources The URLs for data presented herein are as follows: 1000 Genomes, http://browser.1000genomes.org dbSNP, http://www.ncbi.nlm.nih.gov/projects/SNP/ ExAC Browser, http://exac.broadinstitute.org/ GenBank, http://www.ncbi.nlm.nih.gov/genbank/ Human Genetic Variation Database (HGVD), http://www.genome. med.kyoto-u.ac.jp/SnpDB/ OMIM, http://www.omim.org/ RCSB Protein Data Bank, http://www.rcsb.org/pdb/home/home.do SWISS-MODEL, http://swissmodel.expasy.org/
References 1. Thompson, A.A., Woodruff, K., Feig, S.A., Nguyen, L.T., and Schanen, N.C. (2001). Congenital thrombocytopenia and radio-ulnar synostosis: a new familial syndrome. Br. J. Haematol. 113, 866–870. 2. Thompson, A.A., and Nguyen, L.T. (2000). Amegakaryocytic thrombocytopenia and radio-ulnar synostosis are associated with HOXA11 mutation. Nat. Genet. 26, 397–398. 3. Castillo-Caro, P., Dhanraj, S., Haut, P., Robertson, K., Dror, Y., and Sharathkumar, A.A. (2010). Proximal radio-ulnar synostosis with bone marrow failure syndrome in an infant without a HOXA11 mutation. J. Pediatr. Hematol. Oncol. 32, 479–485. 4. Sugita, M., Yokokawa, Y., Yoneyama, H., and Kaneko, T. (2007). A case of amegakaryocytic thrombocytopenia with radio-ulnar synostosis syndrome, successfully treated with allogeneic bone marrow transplantation. Haematologica 92, 280. 5. Yoshida, H., Hashii, Y., Okuda, T., Kusuki, S., Sato, E., Inoue, A., Kawakami, C., Yabe, M., Ohta, H., and Ozono, K. (2010). A case of congenital bone marrow failure with radio-ulnar synostosis. Int. J. Hematol. 91, 331–332. 6. Imanishi, D., Miyazaki, Y., Yamasaki, R., Sawayama, Y., Taguchi, J., Tsushima, H., Fukushima, T., Yoshida, S., Sasaki, H., Hata, T., and Tomonaga, M. (2007). Donor-derived DNA in fingernails among recipients of allogeneic hematopoietic stemcell transplants. Blood 110, 2231–2234. 7. Thiede, C., Prange-Krex, G., Freiberg-Richter, J., Bornha¨user, M., and Ehninger, G. (2000). Buccal swabs but not mouthwash samples can be used to obtain pretransplant DNA fingerprints from recipients of allogeneic bone marrow transplants. Bone Marrow Transplant. 25, 575–577. 8. Niihori, T., Aoki, Y., Okamoto, N., Kurosawa, K., Ohashi, H., Mizuno, S., Kawame, H., Inazawa, J., Ohura, T., Arai, H., et al. (2011). HRAS mutants identified in Costello syndrome patients can induce cellular senescence: possible implications for the pathogenesis of Costello syndrome. J. Hum. Genet. 56, 707–715. 9. Acuna-Hidalgo, R., Bo, T., Kwint, M.P., van de Vorst, M., Pinelli, M., Veltman, J.A., Hoischen, A., Vissers, L.E., and Gilissen, C. (2015). Post-zygotic point mutations are an underrecognized source of de novo genomic variation. Am. J. Hum. Genet. 97, 67–74.
10. Morishita, K., Parker, D.S., Mucenski, M.L., Jenkins, N.A., Copeland, N.G., and Ihle, J.N. (1988). Retroviral activation of a novel gene encoding a zinc finger protein in IL-3-dependent myeloid leukemia cell lines. Cell 54, 831–840. 11. Stein, S., Ott, M.G., Schultze-Strasser, S., Jauch, A., Burwinkel, B., Kinner, A., Schmidt, M., Kra¨mer, A., Schwa¨ble, J., Glimm, H., et al. (2010). Genomic instability and myelodysplasia with monosomy 7 consequent to EVI1 activation after gene therapy for chronic granulomatous disease. Nat. Med. 16, 198–204. 12. Glass, C., Wilson, M., Gonzalez, R., Zhang, Y., and Perkins, A.S. (2014). The role of EVI1 in myeloid malignancies. Blood Cells Mol. Dis. 53, 67–76. 13. Wieser, R. (2007). The oncogene and developmental regulator EVI1: expression, biochemical properties, and biological functions. Gene 396, 346–357. 14. Kataoka, K., and Kurokawa, M. (2012). Ecotropic viral integration site 1, stem cell self-renewal and leukemogenesis. Cancer Sci. 103, 1371–1377. 15. Brooks, D.J., Woodward, S., Thompson, F.H., Dos Santos, B., Russell, M., Yang, J.M., Guan, X.Y., Trent, J., Alberts, D.S., and Taetle, R. (1996). Expression of the zinc finger gene EVI-1 in ovarian and other cancers. Br. J. Cancer 74, 1518–1525. 16. Liu, Y., Chen, L., Ko, T.C., Fields, A.P., and Thompson, E.A. (2006). Evi1 is a survival factor which conveys resistance to both TGFbeta- and taxol-mediated cell death via PI3K/AKT. Oncogene 25, 3565–3575. 17. Albers, C.A., Paul, D.S., Schulze, H., Freson, K., Stephens, J.C., Smethurst, P.A., Jolley, J.D., Cvejic, A., Kostadima, M., Bertone, P., et al. (2012). Compound inheritance of a low-frequency regulatory SNP and a rare null mutation in exon-junction complex subunit RBM8A causes TAR syndrome. Nat. Genet. 44, 435–439, S1–S2. 18. Perkins, A.S., Mercer, J.A., Jenkins, N.A., and Copeland, N.G. (1991). Patterns of Evi-1 expression in embryonic and adult tissues suggest that Evi-1 plays an important regulatory role in mouse development. Development 111, 479–487. 19. Bard-Chapeau, E.A., Jeyakani, J., Kok, C.H., Muller, J., Chua, B.Q., Gunaratne, J., Batagov, A., Jenjaroenpun, P., Kuznetsov, V.A., Wei, C.L., et al. (2012). Ecotopic viral integration site 1 (EVI1) regulates multiple cellular processes important for cancer and is a synergistic partner for FOS protein in invasive tumors. Proc. Natl. Acad. Sci. USA 109, 2168–2173. 20. Delwel, R., Funabiki, T., Kreider, B.L., Morishita, K., and Ihle, J.N. (1993). Four of the seven zinc fingers of the Evi-1 myeloid-transforming gene are required for sequence-specific binding to GA(C/T)AAGA(T/C)AAGATAA. Mol. Cell. Biol. 13, 4291–4300. 21. Funabiki, T., Kreider, B.L., and Ihle, J.N. (1994). The carboxyl domain of zinc fingers of the Evi-1 myeloid transforming gene binds a consensus sequence of GAAGATGAG. Oncogene 9, 1575–1581. 22. Wolfe, S.A., Nekludova, L., and Pabo, C.O. (2000). DNA recognition by Cys2His2 zinc finger proteins. Annu. Rev. Biophys. Biomol. Struct. 29, 183–212. 23. Tanaka, T., Nishida, J., Mitani, K., Ogawa, S., Yazaki, Y., and Hirai, H. (1994). Evi-1 raises AP-1 activity and stimulates cfos promoter transactivation with dependence on the second zinc finger domain. J. Biol. Chem. 269, 24020–24026. 24. Wrana, J.L., Attisano, L., Ca´rcamo, J., Zentella, A., Doody, J., Laiho, M., Wang, X.F., and Massague´, J. (1992). TGF beta signals through a heteromeric protein kinase receptor complex. Cell 71, 1003–1014.
The American Journal of Human Genetics 97, 848–854, December 3, 2015 853
25. Dutta, P., Bui, T., Bauckman, K.A., Keyomarsi, K., Mills, G.B., and Nanjundan, M. (2013). EVI1 splice variants modulate functional responses in ovarian cancer cells. Mol. Oncol. 7, 647–668. 26. Kurokawa, M., Mitani, K., Irie, K., Matsuyama, T., Takahashi, T., Chiba, S., Yazaki, Y., Matsumoto, K., and Hirai, H. (1998). The oncoprotein Evi-1 represses TGF-beta signalling by inhibiting Smad3. Nature 394, 92–96. 27. Parkinson, N., Hardisty-Hughes, R.E., Tateossian, H., Tsai, H.T., Brooker, D., Morse, S., Lalane, Z., MacKenzie, F., Fray, M., Glenister, P., et al. (2006). Mutation at the Evi1 locus in Junbo mice causes susceptibility to otitis media. PLoS Genet. 2, e149. 28. Nielsen, M., Vermont, C.L., Aten, E., Ruivenkamp, C.A., van Herrewegen, F., Santen, G.W., and Breuning, M.H. (2012). Deletion of the 3q26 region including the EVI1 and MDS1 genes in a neonate with congenital thrombocytopenia and subsequent aplastic anaemia. J. Med. Genet. 49, 598–600.
29. Kataoka, K., Sato, T., Yoshimi, A., Goyama, S., Tsuruta, T., Kobayashi, H., Shimabe, M., Arai, S., Nakagawa, M., Imai, Y., et al. (2011). Evi1 is essential for hematopoietic stem cell self-renewal, and its expression marks hematopoietic cells with long-term multilineage repopulating activity. J. Exp. Med. 208, 2403–2416. 30. Senyuk, V., Sinha, K.K., Li, D., Rinaldi, C.R., Yanamandra, S., and Nucifora, G. (2007). Repression of RUNX1 activity by EVI1: a new role of EVI1 in leukemogenesis. Cancer Res. 67, 5658–5666. 31. Laricchia-Robbio, L., Premanand, K., Rinaldi, C.R., and Nucifora, G. (2009). EVI1 impairs myelopoiesis by deregulation of PU.1 function. Cancer Res. 69, 1633–1642. 32. Laricchia-Robbio, L., Fazzina, R., Li, D., Rinaldi, C.R., Sinha, K.K., Chakraborty, S., and Nucifora, G. (2006). Point mutations in two EVI1 Zn fingers abolish EVI1-GATA1 interaction and allow erythroid differentiation of murine bone marrow cells. Mol. Cell. Biol. 26, 7658–7666.
854 The American Journal of Human Genetics 97, 848–854, December 3, 2015
Radioulnar synostosis with amegakaryocytic thrombocytopenia (RUSAT [MIM: 605432]) is an inherited bone marrow failure syndrome with skeletal anomalies.1 RUSAT is characterized by thrombocytopenia that progresses to pancytopenia and congenital proximal fusion of the radius and ulna that results in extremely limited pronation and supination of the forearm. A heterozygous HOXA11 (MIM: 142958) mutation has been identified by candidate gene analysis in two unrelated families as a cause of RUSAT.2 However, a number of individuals with RUSAT lacking HOXA11 mutations have been reported,3 which suggests that additional genetic loci are responsible for RUSAT. To discover a causative mutation, we performed whole exome sequencing on a girl with RUSAT (TRS1) who lacked a HOXA11 mutation (Table 1, Figure 1A, Supplemental Note) and whose parents lacked clinical symptoms of RUSAT. TRS1 underwent cord blood transplantation (CBT) at 4 months of age and complete donor-typed chimerism was confirmed by analysis of her peripheral blood at day þ35. Donor-derived DNA was sometimes observed in recipient fingernails and saliva after hematopoietic stem cell transplantation.6,7 Therefore, DNA from peripheral blood of TRS1, which was collected before
CBT, was used for whole exome sequencing. This study was approved by the Ethics Committee of the Tohoku University School of Medicine. All samples analyzed in this study were collected after written informed consent was obtained. We searched for de novo variants as pathogenic candidates by the filtering steps detailed in Table S1 and identified one heterozygous alteration, c.2266A>G in MECOM (EVI1) (GenBank: NM_001105078, MIM: 165215), which resulted in the amino acid substitution p.Thr756Ala. To confirm that this alteration was a germline variant, Sanger sequencing was performed on DNA from other tissues via a previously described protocol.8 The c.2266A>G variant was present in a buccal swab, fingernails, and hairs of the girl collected after cord blood transplantation, but it was absent in blood samples of her parents and her healthy brother (Figure 1B). We confirmed high levels of donor chimerism in the nail of TRS1 (data not shown); therefore, the small mutant allele fractions from the nails, and possibly the buccal swab, would be mainly due to her chimerism, rather than somatic mosaicism. Mutation analysis of all coding exons and neighboring introns of MECOM in two additional individuals with simplex RUSAT lacking a HOXA11 mutation identified two variants: c.2252A>G (p.His751Arg)
1 Department of Medical Genetics, 2Department of Pediatrics, Tohoku University School of Medicine, Sendai 980-8574, Japan; 3Department of Hematology and Oncology, Miyagi Children’s Hospital, Sendai 989-3126, Japan; 4Department of Hematology-Oncology, Tokyo Metropolitan Children’s Medical Center, Fuchu 183-8561, Japan; 5Department of Pediatrics, Osaka University Graduate School of Medicine, Suita 565-0871, Japan; 6Division of Cell Proliferation, United Centers for Advanced Research and Translational Medicine, Tohoku University Graduate School of Medicine, Sendai 980-8575, Japan; 7 National Research Institute for Child Health and Development, Tokyo 157-8535, Japan 8 These authors contributed equally to this work *Correspondence: [email protected] http://dx.doi.org/10.1016/j.ajhg.2015.10.010. Ó2015 by The American Society of Human Genetics. All rights reserved.
848 The American Journal of Human Genetics 97, 848–854, December 3, 2015
Table 1.
Clinical Manifestations in Individuals with Mutations in MECOM
Individual
TRS24
TRS1
TRS35
Clinical Information Family history
simplex
simplex
simplex
Gender
female
female
male
Age at last clinical examination
3 years 2 months
8 years 9 months
8 years 0 months
Height (SD)
90.3 cm (0.95)
113.7 cm (2.5)
112 cm (2.42)
Weight (SD)
11.8 kg (1.07)
16.6 kg (2.1)
17.8 kg (1.63)
Gestational age
35 weeks
37 weeks
31 weeks
Birth weight
2,160 g
2,058 g
2,180 g
Leukocyte count at birth
6,780/ml
17,100/ml
3,220/ml
Hemoglobin count at birth
4.0 g/dl
12.9 g/dl
2.7 g/dl
Platelet count at birth
5,000/ml
8,000/ml
89,000/ml
Initial clinical presentation
neonatal asphyxia
systemic petechiae
fetal hydrops
HSC transplantation
CBT, 4 months
uBMT, 18 months
uBMT, 8 months
Radioulnar synostosis
blt
blt
blt
Finger abnormality
blt bony defect of the intermediate phalanges of the fifth digits, blt brachymesophalangia of the fourth digits
blt clinodactyly of the fifth digits
overlapping fingers without abnormalities of bone
Hearing
normal
sensorineural hearing impairment: Rt 55 dB, Lt 33.75 dB
prelingual sensorineural hearing impairment: Rt 60 dB, Lt 25 dB
Psychomotor development
normal
normal
mild intellectual disability (IQ 67)
Other
none
cleft palate, dysarthria
hydrocele testicle
cDNA (GenBank: NM_001105078)
c.2266A>G
c.2252A>G
c.2248C>T
Protein (GenBank: NP_001098548)
p.Thr756Ala
p.His751Arg
p.Arg750Trp
Mutations in MECOM
Abbreviations are as follows: HSC, hematopoietic stem cell; CBT, cord blood transplantation; blt, bilateral; uBMT, unrelated bone marrow transplantation; Rt, right; Lt, left; IQ, intelligence quotient.
in individual TRS24 and c.2248C>T (p.Arg750Trp) in TRS35 (Table 1, Figures 1C and 1D). The c.2252A>G (p.His751Arg) variant was present in the DNA collected from a buccal swab and hairs of TRS2 but was absent from her fingernails and peripheral blood, nor was it present in her healthy parents. TRS3 presented the c.2248C>T (p.Arg750Trp) variant in his buccal swab, nails, and hairs. This variant was not detected in the DNA of his healthy mother, and the samples of his father were not available. All of the samples fromTRS2 and TRS3 that we could analyze were collected after hematopoietic stem cell transplantation. Therefore, these sequencing results indicate that the germline mutant allele in the buccal swab and nails might be diluted by donor-derived DNA. Alternatively, we could not exclude the possibility for post-zygotic mutations.9 In total, two of these three variants were considered to be de novo. All three variants affect residues in a highly conserved region of EVI1 (Figure 2A)
and were predicted in silico to be damaging (Table S2). None of the three variants was observed in 382 ethnicitymatched healthy controls or in public variant databases, such as dbSNP, 1000 Genomes, the Human Genetic Variation Database, and ExAC (see Web Resources). These results strongly suggest that these variants are disease-causing mutations. The Evi1 locus was initially identified as a common target of the retroviral integration site in murine myeloid leukemia.10 In humans, MECOM represents a frequent site of insertional mutagenesis after gene therapy for X-linked chronic granulomatous disease.11 MECOM encodes the transcriptional regulator proteins EVI1 and MDS1-EVI1, which are transcribed from alternative transcriptional start sites.12 EVI1 has been reported to be able to recruit either coactivators or corepressors.13 High MECOM expression, which is observed in 5%–10% of all cases of acute myeloid leukemia, is predictive of a poor
The American Journal of Human Genetics 97, 848–854, December 3, 2015 849
AGAACCCACACAGGAGAGCAG
AGAACCCACACAGGAGAGCAG
B
A
WT
WT
TRS1
WT
AGAACCCACACAGGAGAGCAG
c.2266A>G p.Thr756Ala A AGAACCCAC CAGGAGAGCAG G
Peripheral blood (Pre-CBT) A AGAACCCACGCAGGAGAGCAG
Hair (Post-CBT)
Figure 1. Individuals with RUSAT Attributed to MECOM Mutations (A) Radiographs of the forearms of TRS1 show bilateral radioulnar synostosis (arrows). Open arrowheads indicate a bilateral bony defect of the intermediate phalanges of the fifth digits. (B–D) Mutation analysis of TRS1 (B), TRS2 (C), and TRS3 (D) and their families. DNA extraction was performed with a BuccalAmp DNA Extraction Kit (Epicenter) for buccal swab and ISOHAIR (Nippon Gene) for fingernails and hairs. PCR primers are listed in Table S3. Abbreviations are as follows: WT, wild-type; BMT, bone marrow transplantation; CBT, cord blood transplantation; NA, not available.
A AGAACCCACGCAGGAGAGCAG
Buccal swab (Post-CBT)
C and three such motifs in its C-terminal domain that recognize an ETSNail like motif19–21 (Figure 2A). In each (Post-CBT) TRS2 c.2252A>G zinc finger motif, a zinc ion is tetrap.His751Arg hedrally coordinated between two CTAACACGGCA GCTTGAGAACC D cysteines at one end of the b sheet NA WT AACCTAACACGGCACTTGAG and two histidines in the a helix, Hair which stabilizes protein folding22 (Post-BMT) TRS3 A (Figure 2B). All three mutations idenCTAACACGGCGCTTGAGAACC c.2248C>T p.Arg750Trp tified in individuals with RUSAT Buccal swab AACCTAACA C TGGCACTTGAG (Post-BMT) affected the histidine essential for Hair folding stability (Figures S1A and CTAACACGGC ACTTGAGAACC (Post-BMT) S1B) or the neighboring residues, Nail and p.Arg750Trp was located at the C (Post-BMT) AACCTAACATGGCACTTGAG position predicted to contact DNA CTAACACGGCACTTGAGAACC Buccal swab directly22 (Figure S1C). These find(Post-BMT) Peripheral blood ings suggest that the identified muta(Post-BMT) tions might alter the folding stability AACCTAACACGGCACTTGAG T of the 8th zinc finger motif and Nail (Post-BMT) the DNA-binding ability of the C-terminal zinc finger domain (ZFD) of EVI1. To test the DNA binding ability of mutant EVI1 in vivo, outcome.14 The aberrant expression of MECOM has also been found in solid tumors, such as ovarian and colon can- we performed chromatin immunoprecipitation (ChIP)cers.15,16 In inherited bone marrow failure syndromes, qPCR assays on regions known to be EVI1 binding EVI1 is thought to repress RBM8A gene expression by sites.19 Compared with wild-type EVI1, we observed binding to a site created by a pathogenic variant in the significantly reduced levels of RUNX1 exon 1 DNA precip50 untranslated region of RBM8A in individuals with itated with p.Arg750Trp and p.His751Arg mutants as well thrombocytopenia with absent radii syndrome.17 In as reduced levels of CD109 promoter DNA precipitated normal human cells, MECOM is expressed in hematopoiet- with p.Arg750Trp mutants, albeit with large error bars ic stem cells and plays an important function in hemato- (Figure S2). These two regions harbor ETS-like motifs poiesis and stem cell self-renewal.14 In mice, Mecom is and 12-O-Tetradecanoylphorbol-13-acetate (TPA)-responexpressed at high levels in the urinary system, the lung, sive element (TRE) motifs. The TRE motif is commonly the heart, and the limb bud in embryo,18 which suggests recognized by activator protein-1 (AP-1, formed by JUN that this gene plays an important role in limb develop- and FOS), and a physical association between EVI1 and ment. These observations support the evidence that FOS has been reported.19 Our results suggest that the direct and/or indirect DNA binding ability of two EVI1 MECOM mutations cause RUSAT. EVI1 contains seven Cys2His2 zinc finger motifs in its mutants to one or more genomic regions might be N-terminal domain that recognize a GATA-like motif decreased. WT
CTAACACGGCACTTGAGAACC
WT
A AGAACCCAC CAGGAGAGCAG G
CTAACACGGCACTTGAGAACC
850 The American Journal of Human Genetics 97, 848–854, December 3, 2015
A
B
Figure 2. Mutations in MECOM Identified in Individuals with RUSAT (A) MECOM mutations were clustered in the 8th zinc finger motif. All affected residues are completely conserved throughout evolution. Blue dots indicate the cysteines and histidines essential for the folding stability of the zinc finger domain. A cylinder and open arrows indicate a helix and b sheets, respectively. (B) Homology modeling of the 8th zinc finger motif. Homology models of the C-terminal ZFD of EVI1 were generated using SWISSMODEL (RRID: nif-0000-03522) on the crystal structure of a designed zinc finger protein bound to DNA (PDB: 1MEY). This protein and the C-terminal ZFD of the human EVI1 protein share 50% sequence identity.
To examine whether EVI1 variants alter transcriptional regulation, we performed luciferase assays using two reporter systems, focusing on activator protein-1 (AP-1) and transforming growth factor b (TGF-b) signaling. First, we measured luciferase activity upon binding of transcription factors to the AP-1 enhancer elements, which is one of the targets of regulation by EVI1 with dependence on the C-terminal ZFD.23 Renilla luciferase encoded by phRLnull-luc was used to normalize the transfection efficiency. We observed a suppression of relative luciferase activity (RLA) in cells transfected with wild-type EVI1 compared with cells transfected with empty vector after treatment with 10% serum, whereas EVI1 mutants displayed enhanced suppression—that is, a gain-of-function effect (Figure 3B). We obtained similar results with HEK293 cells (data not shown). These results showed that effects of wild-type EVI1 were different from those observed in NIH 3T3 cells using a luciferase reporter plasmid harboring three repeats of TRE followed by the herpes simplex virus thymidine kinase promoter23 but were similar to the observations made in an immortalized normal ovarian epithelial cell line transfected with the same luciferase reporter plasmid as that used in this study.25 This discordance might be explained by the difference of the backbone of each luciferase construct. Next, we used a p3TP-lux reporter vector, which also contains TRE and a portion of the plasminogen activator inhibitor (PAI)-1 promoter24 and has been used to demonstrate the suppression of TGF-b-mediated transcriptional responses by EVI1.26 RLA in cells transfected with wildtype EVI1 was suppressed, unlike cells transfected with empty vector after treatment with 1 ng/ml TGF-b1, whereas EVI1 mutants showed an attenuated suppression effect (Figure 3C). Kurokawa et al. showed that the
C-terminal ZFD deletion had a similar effect on TGFb-mediated transcriptional response to that of the wildtype construct.26 Our results raise the possibility that missense mutations affecting the C-terminal ZFD are also associated with aberrant TGF-b signaling. These results indicate that mutations might be gain of function for AP1 and partial loss of function for TGF-b signaling. Further studies are needed to elucidate transcriptional dysregulation in the mutant EVI1 background. All individuals with mutations in MECOM identified in this study were simplex cases and required hematopoietic stem cell transplantation to counter bone marrow failure (Table 1). By contrast, the individuals with a HOXA11 mutation reported by Thompson et al.1,2 were familial cases with a broad hematologic spectrum that ranged from early-onset bone marrow failure to a lack of clinical problems. Furthermore, TRS1 and TRS3 exhibited severe anemia at birth (hemoglobin 4.0 and 2.7 g/dl, respectively), whereas the individuals harboring a HOXA11 mutation did not experience this issue. Mutations in MECOM might therefore be associated with a severe hematologic phenotype among individuals with RUSAT. Thompson et al.1 reported an individual with a HOXA11 mutation who had sensorineural deafness. The two individuals with MECOM mutations, TRS2 and TRS3, also had sensorineural hearing impairments. A mouse model, called Junbo, expressing a mutation corresponding to human EVI1 p.Asn782Ile, had susceptibility to otitis media and hearing loss.27 As for our individuals with RUSAT, TRS3 did not have chronic otitis media, and a past history of chronic otitis media was uncertain in TRS2. These observations suggest that individuals with MECOM mutations would be associated with hearing impairment not due to chronic otitis media.
The American Journal of Human Genetics 97, 848–854, December 3, 2015 851
A
B
C
Figure 3. EVI1 Mutants Alter Transcriptional Regulation (A) Immunoblot of exogenous EVI1 in NIH 3T3 whole-cell lysates. The protein levels were comparable for FLAG-tagged wild-type and mutant EVI1. (B) Luciferase assay for AP-1 enhancer element. Empty or EVI1 expression constructs, pAP-1-luc (Agilent Technologies; contains seven tandem repeats of TRE-like TGACTAA motif, which is consensus AP-1 binding site), and phRL null luc (transfection control) were co-transfected into NIH 3T3 cells using lipofectamine 2000 (Life Technologies). At 18 hr after transfection, the cells were serum starved in DMEM for 24 hr and were either treated or untreated with 10% newborn calf serum (GIBCO) for 6 hr after serum starvation. The bars indicate mean (5SD) fold change relative to the wild-type (white bar). Experiments were performed in triplicate and repeated twice. *p < 0.05; **p < 0.01; ***p < 0.001 compared with wild-type. (C) Luciferase assays using p3TP-lux, which contains three repeats of TRE fused to a portion of the plasminogen activator inhibitor (PAI)-1 promoter.24 The cells were treated or untreated with 1 ng/ml human TGF-b1 (Roche Diagnostics) for 6 hr after serum starvation. The bars indicate mean (5SD) fold change relative to wild-type (white bar). Experiments were performed in triplicate and repeated twice. *p < 0.05; **p < 0.01; ***p < 0.001 compared with wild-type. Statistical analysis was performed with Dunnett’s test. Abbreviation is as follows: WT, wild-type.
An individual presenting with aplastic anemia and harboring a null allele28—a de novo 3q26 deletion encompassing MECOM—provides important clues to deciphering the effects of MECOM missense mutations. In a mouse model, heterozygous knockout of Mecom leads to a marked
impairment in the self-renewal capacity of long-term hematopoietic stem cells due to accelerated differentiation.29 This impairment might occur in the individual with the 3q26 deletion and possibly in individuals with RUSAT reported in this study. MECOM haploinsufficiency might be sufficient to cause bone marrow failure. However, no limb anomalies were described in the individual with the 3q26 deletion,28 which suggests that the missense mutations identified in this study might act as gain-of-function, partial loss-of-function as shown in Figure 3, or possibly dominant-negative rather than the complete loss-of-function mutations affecting the bone development of forearms and fingers. The MECOM mutations identified in this study in individuals with RUSAT were clustered in the 8th zinc finger motif in the C-terminal ZFD. The 8th zinc finger motif is the oligomerization domain involved in interactions with EVI1 itself and with RUNX1.30 Thus, these mutations might alter not only protein-DNA binding but also protein-protein interactions in transcriptional regulation. Functional interactions between EVI1 and other sequence-specific transcription factors, such as SPI1,31 GATA1,32 SMAD3,26 and FOS,19 have also been reported previously. In this context, the divergent effect of mutants observed in luciferase assays in this study might depend on altered interaction of mutant EVI1 with DNA and/or other transcriptional factors. Although knock-in mouse models harboring mutations in the 8th zinc finger motif of Evi1 have not been reported, Junbo mouse, which had a Evi1 mutation in the 9th zinc finger motif of the same C-terminal ZFD, had extra digits on the forelimbs,27 which suggests an important role for the C-terminal ZFD in digit development. In conclusion, we have identified MECOM mutations in individuals with RUSAT. We report missense mutations in MECOM as a cause of a Mendelian disorder, although overexpression of MECOM has been shown to induce myeloid malignancies. Our findings provide compelling evidence for the critical roles of EVI1 in normal hematopoiesis and in the development of forelimbs and fingers in humans. Further studies are required to elucidate the mechanisms underlying the development of RUSAT. Supplemental Data Supplemental Data include a Supplemental Note of one case report, two figures, and three tables and can be found with this article online at http://dx.doi.org/10.1016/j.ajhg.2015.10.010.
Acknowledgments The authors thank the patients who participated in this study and their families and doctors. We are grateful to Dr. Joan Massague and Dr. Jeff Wrana for p3TP-lux (Addgene plasmid #11767). We also thank Yoko Tateda, Kumi Kato, Miyuki Tsuda, Mami Kikuchi, and Kiyotaka Kuroda for their technical assistance. This work was supported by the Practical Research Project for Rare/Intractable
852 The American Journal of Human Genetics 97, 848–854, December 3, 2015
Diseases from Japan Agency for Medical Research and Development (AMED) to T. Niihori, Y.M., and Y.A. Received: July 29, 2015 Accepted: October 14, 2015 Published: November 12, 2015
Web Resources The URLs for data presented herein are as follows: 1000 Genomes, http://browser.1000genomes.org dbSNP, http://www.ncbi.nlm.nih.gov/projects/SNP/ ExAC Browser, http://exac.broadinstitute.org/ GenBank, http://www.ncbi.nlm.nih.gov/genbank/ Human Genetic Variation Database (HGVD), http://www.genome. med.kyoto-u.ac.jp/SnpDB/ OMIM, http://www.omim.org/ RCSB Protein Data Bank, http://www.rcsb.org/pdb/home/home.do SWISS-MODEL, http://swissmodel.expasy.org/
References 1. Thompson, A.A., Woodruff, K., Feig, S.A., Nguyen, L.T., and Schanen, N.C. (2001). Congenital thrombocytopenia and radio-ulnar synostosis: a new familial syndrome. Br. J. Haematol. 113, 866–870. 2. Thompson, A.A., and Nguyen, L.T. (2000). Amegakaryocytic thrombocytopenia and radio-ulnar synostosis are associated with HOXA11 mutation. Nat. Genet. 26, 397–398. 3. Castillo-Caro, P., Dhanraj, S., Haut, P., Robertson, K., Dror, Y., and Sharathkumar, A.A. (2010). Proximal radio-ulnar synostosis with bone marrow failure syndrome in an infant without a HOXA11 mutation. J. Pediatr. Hematol. Oncol. 32, 479–485. 4. Sugita, M., Yokokawa, Y., Yoneyama, H., and Kaneko, T. (2007). A case of amegakaryocytic thrombocytopenia with radio-ulnar synostosis syndrome, successfully treated with allogeneic bone marrow transplantation. Haematologica 92, 280. 5. Yoshida, H., Hashii, Y., Okuda, T., Kusuki, S., Sato, E., Inoue, A., Kawakami, C., Yabe, M., Ohta, H., and Ozono, K. (2010). A case of congenital bone marrow failure with radio-ulnar synostosis. Int. J. Hematol. 91, 331–332. 6. Imanishi, D., Miyazaki, Y., Yamasaki, R., Sawayama, Y., Taguchi, J., Tsushima, H., Fukushima, T., Yoshida, S., Sasaki, H., Hata, T., and Tomonaga, M. (2007). Donor-derived DNA in fingernails among recipients of allogeneic hematopoietic stemcell transplants. Blood 110, 2231–2234. 7. Thiede, C., Prange-Krex, G., Freiberg-Richter, J., Bornha¨user, M., and Ehninger, G. (2000). Buccal swabs but not mouthwash samples can be used to obtain pretransplant DNA fingerprints from recipients of allogeneic bone marrow transplants. Bone Marrow Transplant. 25, 575–577. 8. Niihori, T., Aoki, Y., Okamoto, N., Kurosawa, K., Ohashi, H., Mizuno, S., Kawame, H., Inazawa, J., Ohura, T., Arai, H., et al. (2011). HRAS mutants identified in Costello syndrome patients can induce cellular senescence: possible implications for the pathogenesis of Costello syndrome. J. Hum. Genet. 56, 707–715. 9. Acuna-Hidalgo, R., Bo, T., Kwint, M.P., van de Vorst, M., Pinelli, M., Veltman, J.A., Hoischen, A., Vissers, L.E., and Gilissen, C. (2015). Post-zygotic point mutations are an underrecognized source of de novo genomic variation. Am. J. Hum. Genet. 97, 67–74.
10. Morishita, K., Parker, D.S., Mucenski, M.L., Jenkins, N.A., Copeland, N.G., and Ihle, J.N. (1988). Retroviral activation of a novel gene encoding a zinc finger protein in IL-3-dependent myeloid leukemia cell lines. Cell 54, 831–840. 11. Stein, S., Ott, M.G., Schultze-Strasser, S., Jauch, A., Burwinkel, B., Kinner, A., Schmidt, M., Kra¨mer, A., Schwa¨ble, J., Glimm, H., et al. (2010). Genomic instability and myelodysplasia with monosomy 7 consequent to EVI1 activation after gene therapy for chronic granulomatous disease. Nat. Med. 16, 198–204. 12. Glass, C., Wilson, M., Gonzalez, R., Zhang, Y., and Perkins, A.S. (2014). The role of EVI1 in myeloid malignancies. Blood Cells Mol. Dis. 53, 67–76. 13. Wieser, R. (2007). The oncogene and developmental regulator EVI1: expression, biochemical properties, and biological functions. Gene 396, 346–357. 14. Kataoka, K., and Kurokawa, M. (2012). Ecotropic viral integration site 1, stem cell self-renewal and leukemogenesis. Cancer Sci. 103, 1371–1377. 15. Brooks, D.J., Woodward, S., Thompson, F.H., Dos Santos, B., Russell, M., Yang, J.M., Guan, X.Y., Trent, J., Alberts, D.S., and Taetle, R. (1996). Expression of the zinc finger gene EVI-1 in ovarian and other cancers. Br. J. Cancer 74, 1518–1525. 16. Liu, Y., Chen, L., Ko, T.C., Fields, A.P., and Thompson, E.A. (2006). Evi1 is a survival factor which conveys resistance to both TGFbeta- and taxol-mediated cell death via PI3K/AKT. Oncogene 25, 3565–3575. 17. Albers, C.A., Paul, D.S., Schulze, H., Freson, K., Stephens, J.C., Smethurst, P.A., Jolley, J.D., Cvejic, A., Kostadima, M., Bertone, P., et al. (2012). Compound inheritance of a low-frequency regulatory SNP and a rare null mutation in exon-junction complex subunit RBM8A causes TAR syndrome. Nat. Genet. 44, 435–439, S1–S2. 18. Perkins, A.S., Mercer, J.A., Jenkins, N.A., and Copeland, N.G. (1991). Patterns of Evi-1 expression in embryonic and adult tissues suggest that Evi-1 plays an important regulatory role in mouse development. Development 111, 479–487. 19. Bard-Chapeau, E.A., Jeyakani, J., Kok, C.H., Muller, J., Chua, B.Q., Gunaratne, J., Batagov, A., Jenjaroenpun, P., Kuznetsov, V.A., Wei, C.L., et al. (2012). Ecotopic viral integration site 1 (EVI1) regulates multiple cellular processes important for cancer and is a synergistic partner for FOS protein in invasive tumors. Proc. Natl. Acad. Sci. USA 109, 2168–2173. 20. Delwel, R., Funabiki, T., Kreider, B.L., Morishita, K., and Ihle, J.N. (1993). Four of the seven zinc fingers of the Evi-1 myeloid-transforming gene are required for sequence-specific binding to GA(C/T)AAGA(T/C)AAGATAA. Mol. Cell. Biol. 13, 4291–4300. 21. Funabiki, T., Kreider, B.L., and Ihle, J.N. (1994). The carboxyl domain of zinc fingers of the Evi-1 myeloid transforming gene binds a consensus sequence of GAAGATGAG. Oncogene 9, 1575–1581. 22. Wolfe, S.A., Nekludova, L., and Pabo, C.O. (2000). DNA recognition by Cys2His2 zinc finger proteins. Annu. Rev. Biophys. Biomol. Struct. 29, 183–212. 23. Tanaka, T., Nishida, J., Mitani, K., Ogawa, S., Yazaki, Y., and Hirai, H. (1994). Evi-1 raises AP-1 activity and stimulates cfos promoter transactivation with dependence on the second zinc finger domain. J. Biol. Chem. 269, 24020–24026. 24. Wrana, J.L., Attisano, L., Ca´rcamo, J., Zentella, A., Doody, J., Laiho, M., Wang, X.F., and Massague´, J. (1992). TGF beta signals through a heteromeric protein kinase receptor complex. Cell 71, 1003–1014.
The American Journal of Human Genetics 97, 848–854, December 3, 2015 853
25. Dutta, P., Bui, T., Bauckman, K.A., Keyomarsi, K., Mills, G.B., and Nanjundan, M. (2013). EVI1 splice variants modulate functional responses in ovarian cancer cells. Mol. Oncol. 7, 647–668. 26. Kurokawa, M., Mitani, K., Irie, K., Matsuyama, T., Takahashi, T., Chiba, S., Yazaki, Y., Matsumoto, K., and Hirai, H. (1998). The oncoprotein Evi-1 represses TGF-beta signalling by inhibiting Smad3. Nature 394, 92–96. 27. Parkinson, N., Hardisty-Hughes, R.E., Tateossian, H., Tsai, H.T., Brooker, D., Morse, S., Lalane, Z., MacKenzie, F., Fray, M., Glenister, P., et al. (2006). Mutation at the Evi1 locus in Junbo mice causes susceptibility to otitis media. PLoS Genet. 2, e149. 28. Nielsen, M., Vermont, C.L., Aten, E., Ruivenkamp, C.A., van Herrewegen, F., Santen, G.W., and Breuning, M.H. (2012). Deletion of the 3q26 region including the EVI1 and MDS1 genes in a neonate with congenital thrombocytopenia and subsequent aplastic anaemia. J. Med. Genet. 49, 598–600.
29. Kataoka, K., Sato, T., Yoshimi, A., Goyama, S., Tsuruta, T., Kobayashi, H., Shimabe, M., Arai, S., Nakagawa, M., Imai, Y., et al. (2011). Evi1 is essential for hematopoietic stem cell self-renewal, and its expression marks hematopoietic cells with long-term multilineage repopulating activity. J. Exp. Med. 208, 2403–2416. 30. Senyuk, V., Sinha, K.K., Li, D., Rinaldi, C.R., Yanamandra, S., and Nucifora, G. (2007). Repression of RUNX1 activity by EVI1: a new role of EVI1 in leukemogenesis. Cancer Res. 67, 5658–5666. 31. Laricchia-Robbio, L., Premanand, K., Rinaldi, C.R., and Nucifora, G. (2009). EVI1 impairs myelopoiesis by deregulation of PU.1 function. Cancer Res. 69, 1633–1642. 32. Laricchia-Robbio, L., Fazzina, R., Li, D., Rinaldi, C.R., Sinha, K.K., Chakraborty, S., and Nucifora, G. (2006). Point mutations in two EVI1 Zn fingers abolish EVI1-GATA1 interaction and allow erythroid differentiation of murine bone marrow cells. Mol. Cell. Biol. 26, 7658–7666.
854 The American Journal of Human Genetics 97, 848–854, December 3, 2015
