DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
DNA AND CELL BIOLOGY Volume 33, Number 5, 2014 ª Mary Ann Liebert, Inc. Pp. 311–319 DOI: 10.1089/dna.2013.2026
Mycobacterium Bovis Ornithine Carbamoyltransferase, MB1684, Induces Proinflammatory Cytokine Gene Expression by Activating NF-kB in Macrophages Wei Zhao,*,{ Xiangmei Zhou,* Yun Lu, Yun Peng, Zhu Lin, Jingjun Lin, Lifeng Yang, Xiaomin Yin, and Deming Zhao
Mycobacterium bovis is the etiological factor of bovine tuberculosis (BTB), posing a significant problem to domestic cattle. The bacterium is also zoonotic, affecting human health worldwide. Macrophage evasion of the bacterium involves mycobacterial molecules such as MB1684 (ornithine carbamoyltransferase). In this study, we confirmed a concentration-dependent decrease in proliferation of Ana-1 macrophages when treated with rMB1684 when compared with mycobacterium bovis purified protein derivative of tuberculosis (MbPPD) or phosphate buffer solution incubation groups. We examined the activation of nuclear factor-kappa B (NF-kB) upon exposure to MB1684, and its role in MB1684-induced upregulation of interferon (IFN)-g and proinflammatory cytokines (interleukin [IL]-1b, IL-6, and tumor necrosis factor-a) in Ana-1 macrophages. The levels of proinflammatory cytokines and IFN-g were significantly high in MB1684-treated Ana-1 macrophages. The treatment led to an increase in NF-kB activation and a high expression of the just mentioned proinflammatory cytokines. NF-kB inhibition significantly abrogated MB1684-induced upregulation of proinflammatory cytokine mRNA expression, which suggests that MB1684-induced activation of NF-kB in turn stimulates gene expression of IFN-g and proinflammatory cytokines in Ana-1 macrophages. The experiment was repeated in bone marrow macrophages, a more invivo-like model system, and similar results validated our conclusion. Further, we identified the possibility of the application of MB1684 antigen for the detection of BTB in cattle serum. Introduction
M
ycobacterium bovis is an important pathogenic bacterial species involved in most cases of tuberculosis in cattle. Bovine tuberculosis (BTB) affects domestic animals worldwide and has a significant impact on human health (Tiruviluamala and Reichman, 2002). M. bovis resides chiefly in macrophages, where the bacterium confronts a hostile nutrient and oxygen supply and prolonged oxidative and nitrosative stress (Heo et al., 2011). To survive, M. bovis presumably must enhance its antioxidant defenses and improve its metabolic network. MB1684(argF) is essential for metabolism and utilization of l-arginine, which is crucial for intracellular survival of M. bovis in macrophages (Gordhan et al., 2002). A previous study confirmed the role of MB1684(argF) as a mycobacterial ‘‘secreted’’ protein (Napolitano et al., 2008). Macrophages are the major host cell for M. bovis invasion, and they instigate the host immune response against
BTB through pathogen recognition and inflammation activation (Casadevall, 2008; Ahmad, 2011). Nuclear factorkappa B (NF-kB) is a transcription factor, which plays an important role in inflammatory reactions (Weil et al., 1997). NF-kB can be activated in response to numerous stimuli, including the inflammatory cytokine interleukin-1 (IL-1), tumor necrosis factor (TNF), hydrogen peroxide, ionizing radiation, viral infections, and bacterial lipopolysaccharide. Most of these stimuli represent pathogenic stresses (Baeuerle, 1991). In peripheral tissues, NF-kB is a main regulator of the production of inflammatory mediators and acute-phase proteins, and its binding sites in their promoters serve as inducible transcriptional regulatory elements (Baeuerle and Henkel, 1994). The function of MB1684 in inflammation activation and innate immune response against M. bovis infections is unknown. Investigating the interaction of MB1684 with macrophages is important for understanding the pathogenic mechanism of M. bovis.
State Key Laboratories for Agrobiotechnology, National Animal Transmissible Spongiform Encephalopathy Laboratory, College of Veterinary Medicine, China Agricultural University, Beijing, China. *These two authors contributed equally to this work. { Current affiliation: China Institute of Veterinary Drug Control (IVDC), Beijing, China.
311
312
In this study, we characterized the ability of MB1684 to activate NF-kB signaling pathways in murine macrophages (Ana-1 cell line). The results indicated that MB1684 can activate NF-kB, and this activation is involved in the gene expression of inflammatory cytokines in MB1684-induced Ana-1 cells.
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
Materials and Methods M. bovis antigens
We expressed recombinant MB1684 as an M. bovis antigen. We designed a pair of polymerase chain reaction (PCR) primers with a restriction site and a protective base pair (forward primer: CGCGGATCCGTGATCAGGCATTTCC; reverse primer: CCCAAGCTTTCATGAGCGCTCCAG CAG). A full-length open-reading frame was amplified from genomic DNA of M. bovis standard strain (kindly provided by China Institute of Veterinary Drug Control CVCC). The forward primer contained a BamHI restriction site preceding the GTG initiation codon. The reverse primer had a HindIII restriction site followed by a stop codon. Respective restriction enzymes were used to digest the resultant PCR products and pProEX HTb expression vector (Invitrogen Life Technologies). After directional cloning, ligated pProEX was subsequently used to transform Escherichia coli BL21(DE3)pLysS host cells (Transgen) for expression. Protein was purified from 1000 mL of isopropyl-b-d-thiogalactopyranoside (IPTG)–induced cultures through affinity chromatography by QIAexpress NTA agarose matrix (Qiagen) and finally collected by elution buffer (20 mM Na3PO4, 500 mM NaCl, 30 mM imidazole, and carbamide 8 M). Recombinant protein contained His6-tagged amino-terminal residues. After dialysis via dialysis bag, the yield of recombinant protein was 0.7 mg per milliliter of phosphate buffer solution (PBS). The dialyzed recombinant protein was incubated with polymyxin B-agarose (Sigma-Aldrich) for 6 h at 4C to remove endotoxin contamination. Endotoxin concentration was examined using the LAL endotoxin assay kit and was shown to be undetectable ( £ 0.01 ng/mg). Purified endotoxin-free recombinant protein was filter sterilized and stored at - 80C. Western blot analysis was carried out with M. bovis-infected bovine serum (kindly provided by China Institute of Veterinary Drug Control CVCC) or anti-rMB1684 monoclonal antibody (MA) (manufactured by Institute of Microbiology Chinese Academy of Sciences) using the western blotting procedure. Western blot analysis of mycobacterium bovis (Mb) lysate was carried out with antirMB1684 MA as western blotting procedure. Western blot detection of MB1684 in 6 bovine serums (three M. bovisinfected: IB1, IB2, and IB3 and three healthy controls: HB1, HB2, and HB3 [all serums were kindly provided by China Institute of Veterinary Drug Control CVCC]) was carried out with anti-rMB1684 MA using the western blotting procedure. Reagents and antibodies
NF-kB inhibitor (BAY 11-7082) and antibodies against kBa were obtained from Beyotime Biotechnology, Inc. Cell line and culture
Ana-1 cells (a murine macrophage cell line) were cultivated in a 95% air/5% CO2 atmosphere in RPMI-1640
ZHAO ET AL.
medium supplemented with 10% fetal bovine serum (Gibco), 100 mg/mL streptomycin, 100 U/mL penicillin (Gibco), and 2 mM glutamine. Bone marrow from the tibiae and femurs of 6–8-week-old male C57BL/6 mice was depleted of RBCs using Red Blood Cell Lysing buffer (Sigma-Aldrich). Cells were plated in six-well culture plates (5 · 105 cells/mL; 2 mL/well) in complete RPMI-1640, as described earlier, and cell lines were supplemented with 20 ng/mL macrophage colony stimulation factor for 8 days. Nuclear extract and western blotting
Cells were treated with 2.5, 5, and 7.5 mg/mL of rMB1684; 2.5, 5, and 7.5 mg/mL of MbPPD; or PBS for 6 and 24 h. Then, the culture medium was discarded, and nuclei proteins were extracted using a Nuclear Extract kit (Beyotime Biotechnology). Equal amounts of protein were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis on 8% gels, and the separated proteins were transferred onto a nitrocellulose membrane. Nonspecific binding sites were blocked by incubating the membrane with 5% fat-free dried milk in Tris-Buffered Saline Tween-20 (TBST; 10 mM Tris HCl [pH 7.5], 0.15 M NaCl, and 0.05% Tween20). A rabbit anti-p65 polyclonal antibody (1:1000) was added and incubated for 1 h at 4C. Membranes were washed with TBST and then incubated with the secondary antibody, anti-rabbit horseradish peroxidase-conjugated goat antiserum (1:5000). Bands of immunoreactive protein were visualized after incubation of membrane with enhanced chemiluminescence reagent for 5 min on a Bio-Rad image system. The blot was stripped and reprobed with anti-actin antibody to estimate the total amount of protein loaded. A similar procedure was carried out for the NF-kB inhibition test. MTT test
Five hundred thousand cells per well in a 96-well microtiter plate reaching up to 100 mL level were inoculated. After 4 h of incubation at 37C, 10 mL of MB1684 and MbPPD at various concentrations were added, and incubated for 24 h as previously described. PBS was added to the control group. Cytotoxicity was determined by 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell viability/cytotoxicity assay kit (Beyotime Biotechnology) according to the manufacturer’s instructions. Absorbance was then measured with a microplate reader (VERSA) at 570 nm. For the bone marrow derivated monocyte (BMDM) MTT test, the same procedure was utilized on 2.5 · 105 cells. Cytokine release assessment
The levels of IL-1b, IL-6, and TNF-a were determined in culture supernatants of Ana-1 cells (0.2 · 106 cells/cm2) treated for 24 h with the peptides (2.5, 5, and 7.5 mg/mL) by using enzyme-linked immunosorbent assay (ELISA) kits specific for mouse IL-1b, IL-6, and TNF-a. The samples of culture supernatants, controls, and standards were first treated with a Fast Protein Precipitation and Concentration KIT (Boster Biotech) to increase protein concentration before being used for ELISA analysis. Samples were then pipetted into microplates supplied in the ELISA kits, according to the manufacturer’s instructions (R&D Systems).
M. BOVIS PROTEIN MB1684 ACTIVATES MACROPHAGE NF-jB
313
Table 1. Primers Used for Real-Time Polymerase Chain Reaction and Cloning Gene
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
b-Actin IL-6 TNF-a IL-1b IFN-g
Primer sequences (5¢–3¢) TGCTGTCCCTGTATGCCTCTG TGCCTTCTTGGGACTGAT GGCGGTGCCTATGTCTCA GTTCCCATTAGACAACTGC CGGCTGACTGAACTCAGATT
TTGATGTACCGCACGATTTCC CTGGCTTTGTCTTTCTTGTT CACTTGGTGGTTTGCTACG TGCCGTCTTTCATTACAC GACACATTCGAGTGCTGTCT
Product size (bp)
Annealing temperature (C)
223 384 221 229 159
60 49 53 47 52
IFN, interferon; IL, interleukin; TNF, tumor necrosis factor.
The experiments were performed in duplicate, using four to six independent cell preparations. The absorbance was measured at 450 nm, with the correction wavelength at 540 nm, using a microplate reader. The values were read off the standard curve and expressed as nanograms per liter (IL1b, IL-6, TNF-a, and IFN-g). For the BMM ELISA, the same procedure was utilized on 0.1 · 106 cells/cm2. Total RNA isolation
Ana-1 cells were stimulated by rMB1684 using the same treatment conditions as earlier and RNA-Solve reagent (Aidlab) was added. The total RNA of macrophages was extracted according to the manufacturer’s instructions. The RNA extracts were treated with RNase-free DNase I to remove DNA, quantified on a spectrophotometer (BioPhotometerw Eppendorf), and then stored at - 80C.
Results Characterization of rMB1684 protein
To evaluate the structural and functional similarities between rMB1684 and the natural MB1684, an experiment was carried out to verify whether our rMB1684 is a useful artificial molecule in our research in vitro. For this purpose, we designed a test for recognition of this protein by serum antibody from a PPD-positive cow. A western blot test was applied. The IgG isotype was purified from cattle serum of both PPDpositive and healthy animals. Figure 1A demonstrates that
Quantitative real-time PCR of cytokines
The RNA from each sample was reverse transcribed with oligodT to cDNA using the Reverse Transcription System (Formantas). To determine the mRNA expression of cytokines, real-time PCR was carried out using DNA Engine OpticonTM 2 continuous fluorescence detection system and SYBR Green PCR Master Mix kit (Biorad Laboratories). Endogenous housekeeping gene b-actin was used as a cDNA template control. PCR primers were used for amplification of genes cloned for real-time PCR (see Table 1). Each PCR contained 500 nM of each primer, 2 mL cDNA, and 10 mL Power SYBR Green PCR Master Mix (2 · ) in a final volume of 20 mL. After an initial denaturation for 10 min at 95C, 40 cycles of amplification were carried out consisting of denaturation at 94C for 15 s, followed by an annealing step at 60C for 20 s, and extension at 72C for 20 s. A final elongation step at 72C for 8 min concluded the PCR. The reaction was then subjected to a melting protocol from 65C to 95C, with 0.2C/s increments and 1 s holding at each increment to examine the specificity of the amplified products. Data were collected using the PCR baseline deduction mode. After adjusting baseline cycles and calculating threshold value, the sample threshold cycle was obtained. All the data were analyzed by the software SPSS13.0. The same procedure was used for analysis of BMMs. Statistical analysis of quantitative PCR
An independent sample t-test was used to analyze differences in mRNA expression between different groups. Differences with **p < 0.01 were considered to be statistically significant. All samples were analyzed in triplicate.
FIG. 1. Immunological analysis of recombinant protein coded for by the gene MB1684. Recombinant protein containing His6-tagged amino-terminal residues was expressed in Escherichia coli BL21(DE3)/pLysS followed by purification by affinity chromatography using Ni-NTA agarose matrix. (A) Western blot analysis of rMB1684 immunoblotted with PPD-positive or PPD-negative bovine serum. (B) Western blot identification of native MB1684 and recombinant MB1684. Lane 1: rMB1684 recognized by rMB1684 monoclonal antibody. Lane 2: Whole M. bovis cell lysate recognized by rMB1684 monoclonal antibodies. (C) Western blot detection of natural MB1684 in infected or healthy bovine serums. Line 1: M. bovis-infected serum recognized by rMB1684 monoclonal antibodies. Line 2: Healthy animal control.
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
314
IgG antibodies purified from the serum of a PPD-positive animal distinctly recognized rMB1684. In contrast, the healthy control individual IgG could not recognize the rMB1684 protein (Fig. 1A). Using rMB1684, the MA was prepared. To identify whether the prepared MA for rMB1684 could combine with natural protein, western blot analysis was performed using MA with a crude preparation of M. bovis or the recombinant protein. Figure 1B indicates that the MA prepared using recombinant MB1684 recognized protein with a *39 kDa band in the crude mycobacterial lysate as well as the recombinant protein. rMB1684 protein is slightly higher (*41 kDa) than the native molecule, which is expected because of the addition of His tag sequence to facilitate purification. These results validated that the overexpressed recombinant protein is a genuine M. bovis protein. Further, the MA could recognize the natural MB1684 in all three infected bovine serums (Fig. 1C), which implicated the existence of MB1684 in the infected animal’s body fluid. Moreover, strong recognition by the infected animal’s serum suggested that MB1684 is an important molecule of Mb to induce a host immune response. rMB1684 influenced the survival of Ana-1 cells
To characterize the influence of rMB1684 protein on the Ana-1 cells, an MTT test was designed to evaluate proliferation of cells incubated with rMB1684, MbPPD, or PBS with different concentrations. The proliferation of Ana-1 cells exhibited a concentration-dependent decrease in the rMB1684 group when compared with the PBS incubation group (Fig. 2). Higher concentrations of MbPPD resulted in greater proliferation of cells (Fig. 2).
ZHAO ET AL. rMB1684 induced an increase in protein levels of proinflammatory cytokines in Ana-1 cells
rMB1684-treated Ana-1 cells showed a statistically significant increase in protective cytokine INF-g and proinflammatory cytokine (IL-1b, TNF-a, and IL-6) release ( p < 0.05). The protein levels of the four cytokines were higher in rMB1684-treated cells compared with MbPPD- or PBS- (control) treated cells ( p < 0.05; Fig. 3). There was a positive correlation between the concentration of rMB1684 and the protein level of the four cytokines (Fig. 3). rMB1684-induced NF-kB activation in Ana-1 cells
To study the relationship between NF-kB and rMB1684induced increase in cytokine release in Ana-1 macrophages, we first investigated the influence of rMB1684 treatment on NF-kB activation by detecting the nuclear translocation of p65 (a component of NF-kB) through western blot analysis. Ana-1 macrophages were treated with rMB1684, MbPPD, or PBS. Nuclear and cytoplasmic extracts were collected after 6 and 24 h. As shown in Figure 4A, a 6-h treatment with 2.5 mg/mL protein induced obvious translocation of NF-kB p65 subunit from cytoplasm to cytoblast (rMB1684), while also reducing the level of cytoplasmic p65. The relative density analysis showed that the translocated p65 band in the cytoblast was significantly higher in the rMB1684treated group than in those treated with MbPPD or PBS (control). Further, the 24-h-treatment cells showed the same results as the 6-h-treatment group (Fig. 4B). The 5- and 7.5mg/mL protein treatment groups demonstrated similar levels to the 2.5 mg/mL treatment group (figure not shown), which demonstrates that even a small amount of the protein can activate NF-kB. rMB1684 induced NF-kB-dependent increase in the mRNA levels of proinflammatory cytokines in Ana-1 cells
FIG. 2. Ana-1 cell viability/cytotoxicity assay with ascending concentration of rMB1684 and MbPPD. MTT can be deoxidized into insoluble formazan by succinodehydrogenase within mitochondria in viable cells. Dissolved formazan was read by a microplate reader at 570 nm. The tiny checkered pattern represents the rMB1684-challenge group. The larger checkered pattern represents the MbPPDchallenge group. The horizontal pattern represents the control group. All data are mean–SD of triplicate samples and are representative of three experiments. *p < 0.05, **p < 0.01. SD, standard deviation; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide.
To better understand the mechanism of NF-kB activation in rMB1684-induced release of increased proinflammatory cytokines, changes in mRNA levels of these cytokines were quantified in rMB1684-treated cells with and without preincubation of NF-kB inhibitor BAY 11-7082. Ana-1 cells were treated with 2.5 mg/mL of rMB1684, MbPPD, or PBS for 6, 12, and 24 h. IL-1b, IL-6, TNF-a, IFN-g, and b-actin DNA were amplified separately and confirmed by agarose gel electrophoresis (data not shown) and gene sequencing (data not shown). The mRNA expression of IFN-g and proinflammatory cytokines IL-1b, TNF-a, and IL-6 increased with protein treatment at 24 h (Fig. 5). NF-kB inhibitor pretreatment of the Ana-1 cells restrained the upregulation of IL-1b, IL-6, TNF-a, and IFN-g mRNA levels induced by rMB1684 at 24 h ( p < 0.01; Fig. 5). The mRNA expression of IL-1b, IL6, TNF-a, and IFN-g was significantly higher in rMB1684treated Ana-1 cells compared with groups pretreated with NF-kB inhibitor and MbPPD- or PBS-treated cells ( p < 0.05) at 24 h (Fig. 5). Different concentrations of rMB1684 and different time points revealed insignificant differences (6- and 12-h data not shown). To verify the effect of NF-kB inhibitor, western blot analysis of cells after 24 h in NF-kB nuclear translocation with and without BAY 11-7082 treatment was performed. The results indicated that NF-kB activated by
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
M. BOVIS PROTEIN MB1684 ACTIVATES MACROPHAGE NF-jB
315
FIG. 3. Cytokines produced by Ana-1 cells challenged with rMB1684. Cells were treated for 24 h with PBS, MbPPD (2.5, 5, and 7.5 mg/mL), or rMB1684 (2.5, 5, and 7.5 mg/mL). The levels of cytokines in culture supernatants were determined by ELISA. All data are mean–SD of triplicate samples and are representative of three experiments. *p < 0.05. ELISA, enzymelinked immunosorbent assay; PBS, phosphate buffer solution; IL, interleukin; TNF, tumor necrosis factor; IFN, interferon.
rMB1684 accompanied the translocation from cytoplasm to cytoblast. The relative density analysis of the 24-h, 0.75-mg/mL group showed that there was a significant difference between cells treated and untreated with NF-kB inhibitor (Fig. 5).
for the development of a specific and accurate diagnostic test for tuberculosis. So far, no report is available about ornithine carbamoyltransferase in M. bovis (argF, MB1684), and there is a need to better understand the function and pathogenesis of this protein in M. bovis infection. Tubercle bacilli are hardy
rMB1684 challenge in primary bone marrow macrophages
To confirm our results, we repeated MTT, western blot, and quantitative real time PCR tests in BMDMs. This primary cell line is more representative of in vivo conditions when compared with the Ana-1 cell line. The data show inconspicuous differences between BMM and Ana-1 cells (Fig. 6). Interestingly, BMMs resulted in a more moderate reaction with rMB1684 than Ana-1 cells, but the results of the MTT showed them to be more sensitive. Discussion
Mycobacterium tuberculosis protein Rv1656(argF, MT1694) was initially discovered by mass spectroscopy in the urine of patients with pulmonary tuberculosis (Napolitano et al., 2008). The protein is thought to be an anabolic synthetase of M. tuberculosis—ornithine carbamoyltransferase (Cole et al., 1998). Although the argF-encoded ornithine carbamoyltransferase has been purified from M. bovis Bacillus Calmette-Gue´rin (Timm et al., 1992), little is known about the protein. During M. tuberculosis infection, ornithine carbamoyltransferase is actively produced in vivo and is involved in the host–pathogen interaction. This indicates a new strategy
FIG. 4. Western blot analysis of p65 nuclear translocation of Ana-1 cells. Cells were challenged with 2.5 mg/mL rMB1684, 2.5 mg/mL MbPPD, or PBS. Cytoplasmic extracts and nuclear extracts were prepared and immunoblotted with anti-p65 antibody. (A) Cells were challenged for 6 h. (B) Cells were challenged for 24 h.
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
316
ZHAO ET AL.
FIG. 5. (A) The mRNA expression of IFN-g and proinflammatory cytokines in Ana-1 cells. Cells were or were not pretreated with NF-kB inhibitor BAY 11-7082, and then incubated with 2.5, 5, and 7.5 mg/mL rMB1684 or MbPPD for 24 h. The mRNA levels of four cytokines were measured by quantitative real time PCR. The expression level was interpreted as relative expression. MB1684: Cells were treated with rMB1684; i MB1684: cells were pretreated with NF-kB inhibitor (12 mM) for 1 h before MB1684 challenge; MbPPD: cells were challenged with MbPPD; iControl: cells were pretreated with NF-kB inhibitor for 1 h before PBS treatment; and Control: cells were treated with PBS. All data are mean–SD of triplicate. **p < 0.01. (B) NF-kB inhibition by BAY 11-7082 in Ana-1 Cells. Cells were or were not pretreated with NF-kB inhibitor BAY 11-7082, followed by rMB1684 challenge. Western blot analysis of p65 was used to confirm the inhibitory effect of BAY 11-7082. Nuclear extracts were electrophoresed and immunoblotted with p65 antibody as described in the ‘‘Materials and Methods’’ section. The blot was stripped and reprobed with anti-transcription factor (Max) antibody to estimate the total amount of nuclear protein loaded in the gel. Representative blots of p65 and Max are shown. (C) Bars represent the relative density of p65, compared with Max, and were expressed as arbitrary units. Data are the mean–SD of three independent experiments. NF-kB, nuclear factor-kappa B. facultative intracellular pathogens that live and multiply in nonactivated macrophages. Before tubercle bacilli can be destroyed by macrophages, these cells must be activated by various cytokines. Such activation is the essence of cellmediated immunity (Dannenberg, 1989). That is why, in this study, we emphasize the interaction between MB1684 and host macrophages.
In our initial study, we found a significant difference between M. bovis-infected and noninfected bovine serum. Even minute levels of anti-MB1684 IgG could not be detected in healthy bovine serum. In contrast, IgG in M. bovisinfected bovine serum was intensely recognized by rMB1684, which indicated that MB1684 has the potential to be a diagnostic mycobacterial antigen. More importantly,
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
M. BOVIS PROTEIN MB1684 ACTIVATES MACROPHAGE NF-jB
317
FIG. 6. (A) Bone marrow macrophage cell viability/cytotoxicity assay with ascending concentrations of rMB1684 and MbPPD. Specific interpreting refers legend of Figure 2. (B) Western blot analysis of p65 nuclear translocation of bone marrow macrophage cells. Specific interpreting refers legend of Figure 4. (C) The mRNA expression of IFN-g and proinflammatory cytokines in bone marrow macrophage cells. Specific interpreting refers legend of Figure 5A. (D) Western blot analysis of NF-kB inhibition by BAY 11-7082 and relative density analysis of bone marrow macrophage cells. Specific interpreting refers to legend of Figure 5B and C. the MA against MB1684 can detect the mycobacterial natural MB1684 protein in vivo at a high sensitivity, which gives us a new sight for BTB fast detection assay. It has been shown that MT1694, an intracellular metabolic enzyme, gets a half-secrete attribute in Myobacterium tuberculosis biotin (Mtb). We postulate that this enzyme serves a similar function to MB1684 in Mb. This is based on the fact that MB1684 can induce strong immune responses in vivo as an intracellular molecule. In future studies, we will examine the survival of Ana-1 cells exposed to rMB1684 protein. We strongly believe that this protein has a suppressive and even lethal effect on macrophages. Whether this is due to cytotoxicity or a physiological response (e.g., triggering of apoptosis or necrosis) could not be determined in the current study. Further examination is needed to elucidate this mechanism. In our study, we found that rMB1684 produced a stronger response than MbPPD. Surprisingly, it was found that tuberculosis bacilli can evade destruction by macrophages. The
activation of macrophages requires the collaboration of T cells in tuberculosis infection (Fenton and Vermeulen, 1996). Cytokines produced by activated T cells further modulate macrophage function (Fenton and Vermeulen, 1996). This is a major reason why purified protein derivatives exhibit low reactivity to macrophages compared with rMB1684 protein. The NF-kB system plays a major role in regulating innate and adaptive immunity and inflammatory responses (Baeuerle and Henkel, 1994; Doyle and O’Neill, 2006; Perkins, 2007). NF-kB activation results in gene regulation in cellular processes, such as inflammation, immune response, cell proliferation, and apoptosis (Chen et al., 2002). The NF-kB transcription factor primarily exists in the cytoplasm as an inactive complex bound to IkB-as. Upon extracellular stimulation, IkB-as are phosphorylated and subsequently degraded, which leads to the release of NF-kB and nuclear translocation of the p65 subunit of NF-kB. Target gene expression is activated after translocation
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
318
(Baeuerle and Baltimore, 1996; Bai et al., 2008). It is widely believed that inflammation is an absolutely necessary component in the pathogenesis of M. bovis. The major effects of inflammation are noticed not only in innate immunity against Mtb (Behar et al., 2010), but also in granulomas formation and development (Philips and Ernst, 2012). In this study, we reported that NF-kB signaling plays a central role in MB1684-induced IFN-g and proinflammatory cytokine gene upregulation at the mRNA level in Ana-1 cells. We demonstrated that NF-kB was activated in Ana-1 macrophages upon exposure to MB1684, and that NF-kB activation led to the increase of proinflammatory cytokine gene expression. Pretreatment with NF-kB inhibitor significantly abrogated protein-induced upregulation of proinflammatory cytokine gene expression. We conclude that MB1684 is a very important mycobacterial antigen, which is relevant to innate immunity, Th1 immune response, inflammation, and even granuloma formation. In this study, mycobacterial molecular MB1684 induced increased IL-1b release by the NFkB signaling pathway in murine macrophages. This pathway may play an important role in regulating and controlling protective cytokine IL-1b release; however, the upstream signaling pathway remains unclear. IL-1b is a major nonredundant cytokine in the function of acute bacterial control of M. bovis (Mayer-Barber et al., 2010). It has been shown that IL-1b release in mice infected with M. bovis can be triggered by mechanisms other than toll like receptor (TLR) or inflammasome activation (Mayer-Barber et al., 2010). In this study, we understood that MB1684 is one of the mycobacterial molecules that contribute to TNF release by the NF-kB signaling pathway. TNF is very important for the control of tuberculosis in humans and in mice (Solovic et al., 2010). This cytokine contributes to activation of macrophages for the killing of intracellular mycobacteria and regulates apoptosis of infected cells (Balcewicz-Sablinska et al., 1998; Clay et al., 2008). Macrophage-derived TNF and T-cell-derived TNF are secreted together to modulate mycobacteria killing and apoptosis of macrophages (Solovic et al., 2010). However, TNF also contributes to granulomagenic activities (Mulligan et al., 1993; Roach et al., 2002). It is well known that conventional CD4 + and CD8 + T cells are the primary source of IFN-g (Cooper et al., 2011). In the present study, induction of IFN-g with significant quantities of MB1684 may tremendously affect the control of mycobacterial infection in vivo. IFN-g is essential for the control of M. tuberculosis and M. bovis in human and mice through regulation of phagosome maturation and autophagy activation ( Jouanguy et al., 1999). IL-6 has a potent function in Mb control when it is induced by the bacteria (Cooper et al., 2011). However, its effect is dependent on the nature of the challenge. Its absence delays the expression of IFN-g and does not increase mortality in a low-dose model (Saunders et al., 2000). In a high-dose model, this cytokine is critical for the survival of animals (Ladel et al., 1997). Indeed, IL-6 is very important to the T-cell response during mycobacterial infections (Appelberg et al., 1994; Leal et al., 1999). IL-6 was significantly expressed in our present study, which indicated that MB1684 is a mycobacterial contributor to IL-6 release. Combined, these results indicate that MB1684-induced upregulation of inflammatory cytokine genes is NF-kB dependent, which indicates that MB1684 is a remarkable mycobacterial antigen for Th1 immune response and inflammatory activation.
ZHAO ET AL.
In our last study, we confirmed the similarity between passaged and primary macrophages. The sensitivity of primary macrophages was lower than Ana-1 cells, but the immune response activity was opposite. The results were similar in the present study, which affirmed our conclusion. The subtle difference in results between the two cells is due to the higher sensitivity and lower reactivity of the BMMs. It is widely believed that Mtb expresses multiple molecules as the agonists of TLRs (Philips and Ernst, 2012). Lipoproteins, Lipoarabinomannans, phosphatidylinositol mannans (PIMs), and Mtb genomic DNA have potential to be TLR agonists (Hertz et al., 2001; Sutcliffe and Harrington, 2004; Bafica et al., 2005; Banaiee et al., 2006). Effort should be made to confirm whether MB1684 has evolved to be another potent TLR agonist or whether it is involved in other signaling pathways. This does not exclude the possibility that other signaling pathways might be involved in the stimulation of proinflammatory cytokine gene expression during macrophage–MB1684 interactions. In addition, we cannot exclude contributions of other mycobacterial molecules to the pathogenesis. Although further studies are needed to investigate the role of other possible signaling pathways in the interaction between MB1684 and immune cells, our study contributes to the understanding of the molecular mechanism behind the interaction between MB1684 and macrophages. Acknowledgments
This work was supported by Natural Science Foundation of China (Project No. 30972164, No. 31001048, No. 31172293, and No. 31272532); the special scientific fund for nonprofit public industry (Agriculture), China (Project No. 200903027); the Beijing Science Foundation of China (Project No. 6101002); National ‘‘Twelfth Five-Year’’ Plan for Science & Technology Support (Project No. 2012AA101302); and Funding of State Key Lab of Agrobiotechnology (Project No. 2012SKLAB06-14). The authors also would like to thank China Agricultural University, who provided BSL-3 Laboratories for experiments using M. bovis culture and infection. Disclosure Statement
No competing financial interests exist. References
Ahmad, S. (2011). Pathogenesis, immunology, and diagnosis of latent Mycobacterium tuberculosis infection. Clin Dev Immunol 2011, 814943. Appelberg, R., Castro, A.G., Pedrosa, J., and Minoprio, P (1994). Role of interleukin-6 in the induction of protective T cells during mycobacterial infections in mice. Immunology 82, 361–364. Baeuerle, P.A. (1991). The inducible transcription activator NFkappa B: regulation by distinct protein subunits. Biochim Biophys Acta 1072, 63–80. Baeuerle, P.A., and Baltimore, D. (1996). NF-kappa B: ten years after. Cell 87, 13–20. Baeuerle, P.A., and Henkel, T. (1994). Function and activation of NF-kappa B in the immune system. Annu Rev Immunol 12, 141–179. Bafica, A., Scanga, C.A., Feng, C.G., Leifer, C., Cheever, A., and Sher, A. (2005). TLR9 regulates Th1 responses and co-
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
M. BOVIS PROTEIN MB1684 ACTIVATES MACROPHAGE NF-jB
operates with TLR2 in mediating optimal resistance to Mycobacterium tuberculosis. J Exp Med 202, 1715–1724. Bai, Y., Li, Q., Yang, J., Zhou, X., Yin, X., and Zhao, D. (2008). p75(NTR) activation of NF-kappaB is involved in PrP106–126-induced apoptosis in mouse neuroblastoma cells. Neurosci Res 62, 9–14. Balcewicz-Sablinska, M.K., Keane, J., Kornfeld, H., and Remold, H.G. (1998). Pathogenic Mycobacterium tuberculosis evades apoptosis of host macrophages by release of TNF-R2, resulting in inactivation of TNF-alpha. J Immunol 161, 2636–2641. Banaiee, N., Kincaid, E.Z., Buchwald, U., Jacobs, W.J., and Ernst, J.D. (2006). Potent inhibition of macrophage responses to IFN-gamma by live virulent Mycobacterium tuberculosis is independent of mature mycobacterial lipoproteins but dependent on TLR2. J Immunol 176, 3019–3027. Behar, S.M., Divangahi, M., and Remold, H.G. (2010). Evasion of innate immunity by Mycobacterium tuberculosis: is death an exit strategy? Nat Rev Microbiol 8, 668–674. Casadevall, A. (2008). Evolution of intracellular pathogens. Annu Rev Microbiol 62, 19–33. Chen, L.F., Mu, Y., and Greene, W.C. (2002). Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-kappaB. EMBO J 21, 6539–6548. Clay, H., Volkman, H.E., and Ramakrishnan, L. (2008). Tumor necrosis factor signaling mediates resistance to mycobacteria by inhibiting bacterial growth and macrophage death. Immunity 29, 283–294. Cole, S.T., Brosch, R., Parkhill, J., et al. (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393, 537–544. Cooper, A.M., Mayer-Barber, K.D., and Sher, A. (2011). Role of innate cytokines in mycobacterial infection. Mucosal Immunol 4, 252–260. Dannenberg, A.J. (1989). Immune mechanisms in the pathogenesis of pulmonary tuberculosis. Rev Infect Dis 11 Suppl 2, S369–S378. Doyle, S.L., and O’Neill, L.A. (2006). Toll-like receptors: from the discovery of NFkappaB to new insights into transcriptional regulations in innate immunity. Biochem Pharmacol 72, 1102–1113. Fenton, M.J., and Vermeulen, M.W. (1996). Immunopathology of tuberculosis: roles of macrophages and monocytes. Infect Immun 64, 683–690. Gordhan, B.G., Smith, D.A., Alderton, H., McAdam, R.A., Bancroft, G.J., and Mizrahi, V. (2002). Construction and phenotypic characterization of an auxotrophic mutant of Mycobacterium tuberculosis defective in L-arginine biosynthesis. Infect Immun 70, 3080–3084. Heo, D.R., Shin, S.J., Kim, W.S., et al. (2011). Mycobacterium tuberculosislpdC, Rv0462, induces dendritic cell maturation and Th1 polarization. Biochem Biophys Res Commun 411, 642–647. Hertz, C.J., Kiertscher, S.M., Godowski, P.J., Bouis, D.A., Norgard, M.V., Roth, M.D., and Modlin, R.L. (2001). Microbial lipopeptides stimulate dendritic cell maturation via Toll-like receptor 2. J Immunol 166, 2444–2450. Jouanguy, E., Lamhamedi-Cherradi, S., Lammas, D., et al. (1999). A human IFNGR1 small deletion hotspot associated with dominant susceptibility to mycobacterial infection. Nat Genet 21, 370–378. Ladel, C.H., Blum, C., Dreher, A., Reifenberg, K., Kopf, M., and Kaufmann, S.H. (1997). Lethal tuberculosis in interleukin-6-deficient mutant mice. Infect Immun 65, 4843–4849.
319
Leal, I.S., Smedegard, B., Andersen, P., and Appelberg, R. (1999). Interleukin-6 and interleukin-12 participate in induction of a type 1 protective T-cell response during vaccination with a tuberculosis subunit vaccine. Infect Immun 67, 5747–5754. Mayer-Barber, K.D., Barber, D.L., Shenderov, K., et al. (2010). Caspase-1 independent IL-1beta production is critical for host resistance to mycobacterium tuberculosis and does not require TLR signaling in vivo. J Immunol 184, 3326–3330. Mulligan, M.S., Vaporciyan, A.A., Miyasaka, M., Tamatani, T., and Ward, P.A. (1993). Tumor necrosis factor alpha regulates in vivo intrapulmonary expression of ICAM-1. Am J Pathol 142, 1739–1749. Napolitano, D.R., Pollock, N., Kashino, S.S., Rodrigues, V.J., and Campos-Neto, A. (2008). Identification of Mycobacterium tuberculosis ornithine carboamyltransferase in urine as a possible molecular marker of active pulmonary tuberculosis. Clin Vaccine Immunol 15, 638–643. Perkins, N.D. (2007). Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat Rev Mol Cell Biol 8, 49–62. Philips, J.A., and Ernst, J.D. (2012). Tuberculosis pathogenesis and immunity. Annu Rev Pathol 7, 353–384. Roach, D.R., Bean, A.G., Demangel, C., France, M.P., Briscoe, H., and Britton, W.J. (2002). TNF regulates chemokine induction essential for cell recruitment, granuloma formation, and clearance of mycobacterial infection. J Immunol 168, 4620–4627. Saunders, B.M., Frank, A.A., Orme, I.M., and Cooper, A.M. (2000). Interleukin-6 induces early gamma interferon production in the infected lung but is not required for generation of specific immunity to Mycobacterium tuberculosis infection. Infect Immun 68, 3322–3326. Solovic, I., Sester, M., Gomez-Reino, J.J., et al. (2010). The risk of tuberculosis related to tumour necrosis factor antagonist therapies: a TBNET consensus statement. Eur Respir J 36, 1185–1206. Sutcliffe, I.C., and Harrington, D.J. (2004). Lipoproteins of Mycobacterium tuberculosis: an abundant and functionally diverse class of cell envelope components. FEMS Microbiol Rev 28, 645–659. Timm, J., Rompaey, I., Tricot, C., et al. (1992). Molecular cloning, characterization and purification of ornithine carbamoyltransferase from Mycobacterium bovis BCG. Mol Gen Genet 234, 475–480. Tiruviluamala, P., and Reichman, L.B. (2002). Tuberculosis. Annu Rev Public Health 23, 403–426. Weil, R., Whiteside, S.T., and IsraE`l, A. (1997). Control of NFkB activity by the IkBb inhibitor. Immunobiology 198, 14–23.
Address correspondence to: Deming Zhao, PhD State Key Laboratories for Agrobiotechnology National Animal Transmissible Spongiform Encephalopathy Laboratory College of Veterinary Medicine China Agricultural University Beijing 100193 China E-mail: [email protected] Received for publication March 5, 2013; received in revised form December 24, 2013; accepted January 17, 2014.
DNA AND CELL BIOLOGY Volume 33, Number 5, 2014 ª Mary Ann Liebert, Inc. Pp. 311–319 DOI: 10.1089/dna.2013.2026
Mycobacterium Bovis Ornithine Carbamoyltransferase, MB1684, Induces Proinflammatory Cytokine Gene Expression by Activating NF-kB in Macrophages Wei Zhao,*,{ Xiangmei Zhou,* Yun Lu, Yun Peng, Zhu Lin, Jingjun Lin, Lifeng Yang, Xiaomin Yin, and Deming Zhao
Mycobacterium bovis is the etiological factor of bovine tuberculosis (BTB), posing a significant problem to domestic cattle. The bacterium is also zoonotic, affecting human health worldwide. Macrophage evasion of the bacterium involves mycobacterial molecules such as MB1684 (ornithine carbamoyltransferase). In this study, we confirmed a concentration-dependent decrease in proliferation of Ana-1 macrophages when treated with rMB1684 when compared with mycobacterium bovis purified protein derivative of tuberculosis (MbPPD) or phosphate buffer solution incubation groups. We examined the activation of nuclear factor-kappa B (NF-kB) upon exposure to MB1684, and its role in MB1684-induced upregulation of interferon (IFN)-g and proinflammatory cytokines (interleukin [IL]-1b, IL-6, and tumor necrosis factor-a) in Ana-1 macrophages. The levels of proinflammatory cytokines and IFN-g were significantly high in MB1684-treated Ana-1 macrophages. The treatment led to an increase in NF-kB activation and a high expression of the just mentioned proinflammatory cytokines. NF-kB inhibition significantly abrogated MB1684-induced upregulation of proinflammatory cytokine mRNA expression, which suggests that MB1684-induced activation of NF-kB in turn stimulates gene expression of IFN-g and proinflammatory cytokines in Ana-1 macrophages. The experiment was repeated in bone marrow macrophages, a more invivo-like model system, and similar results validated our conclusion. Further, we identified the possibility of the application of MB1684 antigen for the detection of BTB in cattle serum. Introduction
M
ycobacterium bovis is an important pathogenic bacterial species involved in most cases of tuberculosis in cattle. Bovine tuberculosis (BTB) affects domestic animals worldwide and has a significant impact on human health (Tiruviluamala and Reichman, 2002). M. bovis resides chiefly in macrophages, where the bacterium confronts a hostile nutrient and oxygen supply and prolonged oxidative and nitrosative stress (Heo et al., 2011). To survive, M. bovis presumably must enhance its antioxidant defenses and improve its metabolic network. MB1684(argF) is essential for metabolism and utilization of l-arginine, which is crucial for intracellular survival of M. bovis in macrophages (Gordhan et al., 2002). A previous study confirmed the role of MB1684(argF) as a mycobacterial ‘‘secreted’’ protein (Napolitano et al., 2008). Macrophages are the major host cell for M. bovis invasion, and they instigate the host immune response against
BTB through pathogen recognition and inflammation activation (Casadevall, 2008; Ahmad, 2011). Nuclear factorkappa B (NF-kB) is a transcription factor, which plays an important role in inflammatory reactions (Weil et al., 1997). NF-kB can be activated in response to numerous stimuli, including the inflammatory cytokine interleukin-1 (IL-1), tumor necrosis factor (TNF), hydrogen peroxide, ionizing radiation, viral infections, and bacterial lipopolysaccharide. Most of these stimuli represent pathogenic stresses (Baeuerle, 1991). In peripheral tissues, NF-kB is a main regulator of the production of inflammatory mediators and acute-phase proteins, and its binding sites in their promoters serve as inducible transcriptional regulatory elements (Baeuerle and Henkel, 1994). The function of MB1684 in inflammation activation and innate immune response against M. bovis infections is unknown. Investigating the interaction of MB1684 with macrophages is important for understanding the pathogenic mechanism of M. bovis.
State Key Laboratories for Agrobiotechnology, National Animal Transmissible Spongiform Encephalopathy Laboratory, College of Veterinary Medicine, China Agricultural University, Beijing, China. *These two authors contributed equally to this work. { Current affiliation: China Institute of Veterinary Drug Control (IVDC), Beijing, China.
311
312
In this study, we characterized the ability of MB1684 to activate NF-kB signaling pathways in murine macrophages (Ana-1 cell line). The results indicated that MB1684 can activate NF-kB, and this activation is involved in the gene expression of inflammatory cytokines in MB1684-induced Ana-1 cells.
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
Materials and Methods M. bovis antigens
We expressed recombinant MB1684 as an M. bovis antigen. We designed a pair of polymerase chain reaction (PCR) primers with a restriction site and a protective base pair (forward primer: CGCGGATCCGTGATCAGGCATTTCC; reverse primer: CCCAAGCTTTCATGAGCGCTCCAG CAG). A full-length open-reading frame was amplified from genomic DNA of M. bovis standard strain (kindly provided by China Institute of Veterinary Drug Control CVCC). The forward primer contained a BamHI restriction site preceding the GTG initiation codon. The reverse primer had a HindIII restriction site followed by a stop codon. Respective restriction enzymes were used to digest the resultant PCR products and pProEX HTb expression vector (Invitrogen Life Technologies). After directional cloning, ligated pProEX was subsequently used to transform Escherichia coli BL21(DE3)pLysS host cells (Transgen) for expression. Protein was purified from 1000 mL of isopropyl-b-d-thiogalactopyranoside (IPTG)–induced cultures through affinity chromatography by QIAexpress NTA agarose matrix (Qiagen) and finally collected by elution buffer (20 mM Na3PO4, 500 mM NaCl, 30 mM imidazole, and carbamide 8 M). Recombinant protein contained His6-tagged amino-terminal residues. After dialysis via dialysis bag, the yield of recombinant protein was 0.7 mg per milliliter of phosphate buffer solution (PBS). The dialyzed recombinant protein was incubated with polymyxin B-agarose (Sigma-Aldrich) for 6 h at 4C to remove endotoxin contamination. Endotoxin concentration was examined using the LAL endotoxin assay kit and was shown to be undetectable ( £ 0.01 ng/mg). Purified endotoxin-free recombinant protein was filter sterilized and stored at - 80C. Western blot analysis was carried out with M. bovis-infected bovine serum (kindly provided by China Institute of Veterinary Drug Control CVCC) or anti-rMB1684 monoclonal antibody (MA) (manufactured by Institute of Microbiology Chinese Academy of Sciences) using the western blotting procedure. Western blot analysis of mycobacterium bovis (Mb) lysate was carried out with antirMB1684 MA as western blotting procedure. Western blot detection of MB1684 in 6 bovine serums (three M. bovisinfected: IB1, IB2, and IB3 and three healthy controls: HB1, HB2, and HB3 [all serums were kindly provided by China Institute of Veterinary Drug Control CVCC]) was carried out with anti-rMB1684 MA using the western blotting procedure. Reagents and antibodies
NF-kB inhibitor (BAY 11-7082) and antibodies against kBa were obtained from Beyotime Biotechnology, Inc. Cell line and culture
Ana-1 cells (a murine macrophage cell line) were cultivated in a 95% air/5% CO2 atmosphere in RPMI-1640
ZHAO ET AL.
medium supplemented with 10% fetal bovine serum (Gibco), 100 mg/mL streptomycin, 100 U/mL penicillin (Gibco), and 2 mM glutamine. Bone marrow from the tibiae and femurs of 6–8-week-old male C57BL/6 mice was depleted of RBCs using Red Blood Cell Lysing buffer (Sigma-Aldrich). Cells were plated in six-well culture plates (5 · 105 cells/mL; 2 mL/well) in complete RPMI-1640, as described earlier, and cell lines were supplemented with 20 ng/mL macrophage colony stimulation factor for 8 days. Nuclear extract and western blotting
Cells were treated with 2.5, 5, and 7.5 mg/mL of rMB1684; 2.5, 5, and 7.5 mg/mL of MbPPD; or PBS for 6 and 24 h. Then, the culture medium was discarded, and nuclei proteins were extracted using a Nuclear Extract kit (Beyotime Biotechnology). Equal amounts of protein were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis on 8% gels, and the separated proteins were transferred onto a nitrocellulose membrane. Nonspecific binding sites were blocked by incubating the membrane with 5% fat-free dried milk in Tris-Buffered Saline Tween-20 (TBST; 10 mM Tris HCl [pH 7.5], 0.15 M NaCl, and 0.05% Tween20). A rabbit anti-p65 polyclonal antibody (1:1000) was added and incubated for 1 h at 4C. Membranes were washed with TBST and then incubated with the secondary antibody, anti-rabbit horseradish peroxidase-conjugated goat antiserum (1:5000). Bands of immunoreactive protein were visualized after incubation of membrane with enhanced chemiluminescence reagent for 5 min on a Bio-Rad image system. The blot was stripped and reprobed with anti-actin antibody to estimate the total amount of protein loaded. A similar procedure was carried out for the NF-kB inhibition test. MTT test
Five hundred thousand cells per well in a 96-well microtiter plate reaching up to 100 mL level were inoculated. After 4 h of incubation at 37C, 10 mL of MB1684 and MbPPD at various concentrations were added, and incubated for 24 h as previously described. PBS was added to the control group. Cytotoxicity was determined by 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell viability/cytotoxicity assay kit (Beyotime Biotechnology) according to the manufacturer’s instructions. Absorbance was then measured with a microplate reader (VERSA) at 570 nm. For the bone marrow derivated monocyte (BMDM) MTT test, the same procedure was utilized on 2.5 · 105 cells. Cytokine release assessment
The levels of IL-1b, IL-6, and TNF-a were determined in culture supernatants of Ana-1 cells (0.2 · 106 cells/cm2) treated for 24 h with the peptides (2.5, 5, and 7.5 mg/mL) by using enzyme-linked immunosorbent assay (ELISA) kits specific for mouse IL-1b, IL-6, and TNF-a. The samples of culture supernatants, controls, and standards were first treated with a Fast Protein Precipitation and Concentration KIT (Boster Biotech) to increase protein concentration before being used for ELISA analysis. Samples were then pipetted into microplates supplied in the ELISA kits, according to the manufacturer’s instructions (R&D Systems).
M. BOVIS PROTEIN MB1684 ACTIVATES MACROPHAGE NF-jB
313
Table 1. Primers Used for Real-Time Polymerase Chain Reaction and Cloning Gene
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
b-Actin IL-6 TNF-a IL-1b IFN-g
Primer sequences (5¢–3¢) TGCTGTCCCTGTATGCCTCTG TGCCTTCTTGGGACTGAT GGCGGTGCCTATGTCTCA GTTCCCATTAGACAACTGC CGGCTGACTGAACTCAGATT
TTGATGTACCGCACGATTTCC CTGGCTTTGTCTTTCTTGTT CACTTGGTGGTTTGCTACG TGCCGTCTTTCATTACAC GACACATTCGAGTGCTGTCT
Product size (bp)
Annealing temperature (C)
223 384 221 229 159
60 49 53 47 52
IFN, interferon; IL, interleukin; TNF, tumor necrosis factor.
The experiments were performed in duplicate, using four to six independent cell preparations. The absorbance was measured at 450 nm, with the correction wavelength at 540 nm, using a microplate reader. The values were read off the standard curve and expressed as nanograms per liter (IL1b, IL-6, TNF-a, and IFN-g). For the BMM ELISA, the same procedure was utilized on 0.1 · 106 cells/cm2. Total RNA isolation
Ana-1 cells were stimulated by rMB1684 using the same treatment conditions as earlier and RNA-Solve reagent (Aidlab) was added. The total RNA of macrophages was extracted according to the manufacturer’s instructions. The RNA extracts were treated with RNase-free DNase I to remove DNA, quantified on a spectrophotometer (BioPhotometerw Eppendorf), and then stored at - 80C.
Results Characterization of rMB1684 protein
To evaluate the structural and functional similarities between rMB1684 and the natural MB1684, an experiment was carried out to verify whether our rMB1684 is a useful artificial molecule in our research in vitro. For this purpose, we designed a test for recognition of this protein by serum antibody from a PPD-positive cow. A western blot test was applied. The IgG isotype was purified from cattle serum of both PPDpositive and healthy animals. Figure 1A demonstrates that
Quantitative real-time PCR of cytokines
The RNA from each sample was reverse transcribed with oligodT to cDNA using the Reverse Transcription System (Formantas). To determine the mRNA expression of cytokines, real-time PCR was carried out using DNA Engine OpticonTM 2 continuous fluorescence detection system and SYBR Green PCR Master Mix kit (Biorad Laboratories). Endogenous housekeeping gene b-actin was used as a cDNA template control. PCR primers were used for amplification of genes cloned for real-time PCR (see Table 1). Each PCR contained 500 nM of each primer, 2 mL cDNA, and 10 mL Power SYBR Green PCR Master Mix (2 · ) in a final volume of 20 mL. After an initial denaturation for 10 min at 95C, 40 cycles of amplification were carried out consisting of denaturation at 94C for 15 s, followed by an annealing step at 60C for 20 s, and extension at 72C for 20 s. A final elongation step at 72C for 8 min concluded the PCR. The reaction was then subjected to a melting protocol from 65C to 95C, with 0.2C/s increments and 1 s holding at each increment to examine the specificity of the amplified products. Data were collected using the PCR baseline deduction mode. After adjusting baseline cycles and calculating threshold value, the sample threshold cycle was obtained. All the data were analyzed by the software SPSS13.0. The same procedure was used for analysis of BMMs. Statistical analysis of quantitative PCR
An independent sample t-test was used to analyze differences in mRNA expression between different groups. Differences with **p < 0.01 were considered to be statistically significant. All samples were analyzed in triplicate.
FIG. 1. Immunological analysis of recombinant protein coded for by the gene MB1684. Recombinant protein containing His6-tagged amino-terminal residues was expressed in Escherichia coli BL21(DE3)/pLysS followed by purification by affinity chromatography using Ni-NTA agarose matrix. (A) Western blot analysis of rMB1684 immunoblotted with PPD-positive or PPD-negative bovine serum. (B) Western blot identification of native MB1684 and recombinant MB1684. Lane 1: rMB1684 recognized by rMB1684 monoclonal antibody. Lane 2: Whole M. bovis cell lysate recognized by rMB1684 monoclonal antibodies. (C) Western blot detection of natural MB1684 in infected or healthy bovine serums. Line 1: M. bovis-infected serum recognized by rMB1684 monoclonal antibodies. Line 2: Healthy animal control.
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
314
IgG antibodies purified from the serum of a PPD-positive animal distinctly recognized rMB1684. In contrast, the healthy control individual IgG could not recognize the rMB1684 protein (Fig. 1A). Using rMB1684, the MA was prepared. To identify whether the prepared MA for rMB1684 could combine with natural protein, western blot analysis was performed using MA with a crude preparation of M. bovis or the recombinant protein. Figure 1B indicates that the MA prepared using recombinant MB1684 recognized protein with a *39 kDa band in the crude mycobacterial lysate as well as the recombinant protein. rMB1684 protein is slightly higher (*41 kDa) than the native molecule, which is expected because of the addition of His tag sequence to facilitate purification. These results validated that the overexpressed recombinant protein is a genuine M. bovis protein. Further, the MA could recognize the natural MB1684 in all three infected bovine serums (Fig. 1C), which implicated the existence of MB1684 in the infected animal’s body fluid. Moreover, strong recognition by the infected animal’s serum suggested that MB1684 is an important molecule of Mb to induce a host immune response. rMB1684 influenced the survival of Ana-1 cells
To characterize the influence of rMB1684 protein on the Ana-1 cells, an MTT test was designed to evaluate proliferation of cells incubated with rMB1684, MbPPD, or PBS with different concentrations. The proliferation of Ana-1 cells exhibited a concentration-dependent decrease in the rMB1684 group when compared with the PBS incubation group (Fig. 2). Higher concentrations of MbPPD resulted in greater proliferation of cells (Fig. 2).
ZHAO ET AL. rMB1684 induced an increase in protein levels of proinflammatory cytokines in Ana-1 cells
rMB1684-treated Ana-1 cells showed a statistically significant increase in protective cytokine INF-g and proinflammatory cytokine (IL-1b, TNF-a, and IL-6) release ( p < 0.05). The protein levels of the four cytokines were higher in rMB1684-treated cells compared with MbPPD- or PBS- (control) treated cells ( p < 0.05; Fig. 3). There was a positive correlation between the concentration of rMB1684 and the protein level of the four cytokines (Fig. 3). rMB1684-induced NF-kB activation in Ana-1 cells
To study the relationship between NF-kB and rMB1684induced increase in cytokine release in Ana-1 macrophages, we first investigated the influence of rMB1684 treatment on NF-kB activation by detecting the nuclear translocation of p65 (a component of NF-kB) through western blot analysis. Ana-1 macrophages were treated with rMB1684, MbPPD, or PBS. Nuclear and cytoplasmic extracts were collected after 6 and 24 h. As shown in Figure 4A, a 6-h treatment with 2.5 mg/mL protein induced obvious translocation of NF-kB p65 subunit from cytoplasm to cytoblast (rMB1684), while also reducing the level of cytoplasmic p65. The relative density analysis showed that the translocated p65 band in the cytoblast was significantly higher in the rMB1684treated group than in those treated with MbPPD or PBS (control). Further, the 24-h-treatment cells showed the same results as the 6-h-treatment group (Fig. 4B). The 5- and 7.5mg/mL protein treatment groups demonstrated similar levels to the 2.5 mg/mL treatment group (figure not shown), which demonstrates that even a small amount of the protein can activate NF-kB. rMB1684 induced NF-kB-dependent increase in the mRNA levels of proinflammatory cytokines in Ana-1 cells
FIG. 2. Ana-1 cell viability/cytotoxicity assay with ascending concentration of rMB1684 and MbPPD. MTT can be deoxidized into insoluble formazan by succinodehydrogenase within mitochondria in viable cells. Dissolved formazan was read by a microplate reader at 570 nm. The tiny checkered pattern represents the rMB1684-challenge group. The larger checkered pattern represents the MbPPDchallenge group. The horizontal pattern represents the control group. All data are mean–SD of triplicate samples and are representative of three experiments. *p < 0.05, **p < 0.01. SD, standard deviation; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide.
To better understand the mechanism of NF-kB activation in rMB1684-induced release of increased proinflammatory cytokines, changes in mRNA levels of these cytokines were quantified in rMB1684-treated cells with and without preincubation of NF-kB inhibitor BAY 11-7082. Ana-1 cells were treated with 2.5 mg/mL of rMB1684, MbPPD, or PBS for 6, 12, and 24 h. IL-1b, IL-6, TNF-a, IFN-g, and b-actin DNA were amplified separately and confirmed by agarose gel electrophoresis (data not shown) and gene sequencing (data not shown). The mRNA expression of IFN-g and proinflammatory cytokines IL-1b, TNF-a, and IL-6 increased with protein treatment at 24 h (Fig. 5). NF-kB inhibitor pretreatment of the Ana-1 cells restrained the upregulation of IL-1b, IL-6, TNF-a, and IFN-g mRNA levels induced by rMB1684 at 24 h ( p < 0.01; Fig. 5). The mRNA expression of IL-1b, IL6, TNF-a, and IFN-g was significantly higher in rMB1684treated Ana-1 cells compared with groups pretreated with NF-kB inhibitor and MbPPD- or PBS-treated cells ( p < 0.05) at 24 h (Fig. 5). Different concentrations of rMB1684 and different time points revealed insignificant differences (6- and 12-h data not shown). To verify the effect of NF-kB inhibitor, western blot analysis of cells after 24 h in NF-kB nuclear translocation with and without BAY 11-7082 treatment was performed. The results indicated that NF-kB activated by
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
M. BOVIS PROTEIN MB1684 ACTIVATES MACROPHAGE NF-jB
315
FIG. 3. Cytokines produced by Ana-1 cells challenged with rMB1684. Cells were treated for 24 h with PBS, MbPPD (2.5, 5, and 7.5 mg/mL), or rMB1684 (2.5, 5, and 7.5 mg/mL). The levels of cytokines in culture supernatants were determined by ELISA. All data are mean–SD of triplicate samples and are representative of three experiments. *p < 0.05. ELISA, enzymelinked immunosorbent assay; PBS, phosphate buffer solution; IL, interleukin; TNF, tumor necrosis factor; IFN, interferon.
rMB1684 accompanied the translocation from cytoplasm to cytoblast. The relative density analysis of the 24-h, 0.75-mg/mL group showed that there was a significant difference between cells treated and untreated with NF-kB inhibitor (Fig. 5).
for the development of a specific and accurate diagnostic test for tuberculosis. So far, no report is available about ornithine carbamoyltransferase in M. bovis (argF, MB1684), and there is a need to better understand the function and pathogenesis of this protein in M. bovis infection. Tubercle bacilli are hardy
rMB1684 challenge in primary bone marrow macrophages
To confirm our results, we repeated MTT, western blot, and quantitative real time PCR tests in BMDMs. This primary cell line is more representative of in vivo conditions when compared with the Ana-1 cell line. The data show inconspicuous differences between BMM and Ana-1 cells (Fig. 6). Interestingly, BMMs resulted in a more moderate reaction with rMB1684 than Ana-1 cells, but the results of the MTT showed them to be more sensitive. Discussion
Mycobacterium tuberculosis protein Rv1656(argF, MT1694) was initially discovered by mass spectroscopy in the urine of patients with pulmonary tuberculosis (Napolitano et al., 2008). The protein is thought to be an anabolic synthetase of M. tuberculosis—ornithine carbamoyltransferase (Cole et al., 1998). Although the argF-encoded ornithine carbamoyltransferase has been purified from M. bovis Bacillus Calmette-Gue´rin (Timm et al., 1992), little is known about the protein. During M. tuberculosis infection, ornithine carbamoyltransferase is actively produced in vivo and is involved in the host–pathogen interaction. This indicates a new strategy
FIG. 4. Western blot analysis of p65 nuclear translocation of Ana-1 cells. Cells were challenged with 2.5 mg/mL rMB1684, 2.5 mg/mL MbPPD, or PBS. Cytoplasmic extracts and nuclear extracts were prepared and immunoblotted with anti-p65 antibody. (A) Cells were challenged for 6 h. (B) Cells were challenged for 24 h.
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
316
ZHAO ET AL.
FIG. 5. (A) The mRNA expression of IFN-g and proinflammatory cytokines in Ana-1 cells. Cells were or were not pretreated with NF-kB inhibitor BAY 11-7082, and then incubated with 2.5, 5, and 7.5 mg/mL rMB1684 or MbPPD for 24 h. The mRNA levels of four cytokines were measured by quantitative real time PCR. The expression level was interpreted as relative expression. MB1684: Cells were treated with rMB1684; i MB1684: cells were pretreated with NF-kB inhibitor (12 mM) for 1 h before MB1684 challenge; MbPPD: cells were challenged with MbPPD; iControl: cells were pretreated with NF-kB inhibitor for 1 h before PBS treatment; and Control: cells were treated with PBS. All data are mean–SD of triplicate. **p < 0.01. (B) NF-kB inhibition by BAY 11-7082 in Ana-1 Cells. Cells were or were not pretreated with NF-kB inhibitor BAY 11-7082, followed by rMB1684 challenge. Western blot analysis of p65 was used to confirm the inhibitory effect of BAY 11-7082. Nuclear extracts were electrophoresed and immunoblotted with p65 antibody as described in the ‘‘Materials and Methods’’ section. The blot was stripped and reprobed with anti-transcription factor (Max) antibody to estimate the total amount of nuclear protein loaded in the gel. Representative blots of p65 and Max are shown. (C) Bars represent the relative density of p65, compared with Max, and were expressed as arbitrary units. Data are the mean–SD of three independent experiments. NF-kB, nuclear factor-kappa B. facultative intracellular pathogens that live and multiply in nonactivated macrophages. Before tubercle bacilli can be destroyed by macrophages, these cells must be activated by various cytokines. Such activation is the essence of cellmediated immunity (Dannenberg, 1989). That is why, in this study, we emphasize the interaction between MB1684 and host macrophages.
In our initial study, we found a significant difference between M. bovis-infected and noninfected bovine serum. Even minute levels of anti-MB1684 IgG could not be detected in healthy bovine serum. In contrast, IgG in M. bovisinfected bovine serum was intensely recognized by rMB1684, which indicated that MB1684 has the potential to be a diagnostic mycobacterial antigen. More importantly,
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
M. BOVIS PROTEIN MB1684 ACTIVATES MACROPHAGE NF-jB
317
FIG. 6. (A) Bone marrow macrophage cell viability/cytotoxicity assay with ascending concentrations of rMB1684 and MbPPD. Specific interpreting refers legend of Figure 2. (B) Western blot analysis of p65 nuclear translocation of bone marrow macrophage cells. Specific interpreting refers legend of Figure 4. (C) The mRNA expression of IFN-g and proinflammatory cytokines in bone marrow macrophage cells. Specific interpreting refers legend of Figure 5A. (D) Western blot analysis of NF-kB inhibition by BAY 11-7082 and relative density analysis of bone marrow macrophage cells. Specific interpreting refers to legend of Figure 5B and C. the MA against MB1684 can detect the mycobacterial natural MB1684 protein in vivo at a high sensitivity, which gives us a new sight for BTB fast detection assay. It has been shown that MT1694, an intracellular metabolic enzyme, gets a half-secrete attribute in Myobacterium tuberculosis biotin (Mtb). We postulate that this enzyme serves a similar function to MB1684 in Mb. This is based on the fact that MB1684 can induce strong immune responses in vivo as an intracellular molecule. In future studies, we will examine the survival of Ana-1 cells exposed to rMB1684 protein. We strongly believe that this protein has a suppressive and even lethal effect on macrophages. Whether this is due to cytotoxicity or a physiological response (e.g., triggering of apoptosis or necrosis) could not be determined in the current study. Further examination is needed to elucidate this mechanism. In our study, we found that rMB1684 produced a stronger response than MbPPD. Surprisingly, it was found that tuberculosis bacilli can evade destruction by macrophages. The
activation of macrophages requires the collaboration of T cells in tuberculosis infection (Fenton and Vermeulen, 1996). Cytokines produced by activated T cells further modulate macrophage function (Fenton and Vermeulen, 1996). This is a major reason why purified protein derivatives exhibit low reactivity to macrophages compared with rMB1684 protein. The NF-kB system plays a major role in regulating innate and adaptive immunity and inflammatory responses (Baeuerle and Henkel, 1994; Doyle and O’Neill, 2006; Perkins, 2007). NF-kB activation results in gene regulation in cellular processes, such as inflammation, immune response, cell proliferation, and apoptosis (Chen et al., 2002). The NF-kB transcription factor primarily exists in the cytoplasm as an inactive complex bound to IkB-as. Upon extracellular stimulation, IkB-as are phosphorylated and subsequently degraded, which leads to the release of NF-kB and nuclear translocation of the p65 subunit of NF-kB. Target gene expression is activated after translocation
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
318
(Baeuerle and Baltimore, 1996; Bai et al., 2008). It is widely believed that inflammation is an absolutely necessary component in the pathogenesis of M. bovis. The major effects of inflammation are noticed not only in innate immunity against Mtb (Behar et al., 2010), but also in granulomas formation and development (Philips and Ernst, 2012). In this study, we reported that NF-kB signaling plays a central role in MB1684-induced IFN-g and proinflammatory cytokine gene upregulation at the mRNA level in Ana-1 cells. We demonstrated that NF-kB was activated in Ana-1 macrophages upon exposure to MB1684, and that NF-kB activation led to the increase of proinflammatory cytokine gene expression. Pretreatment with NF-kB inhibitor significantly abrogated protein-induced upregulation of proinflammatory cytokine gene expression. We conclude that MB1684 is a very important mycobacterial antigen, which is relevant to innate immunity, Th1 immune response, inflammation, and even granuloma formation. In this study, mycobacterial molecular MB1684 induced increased IL-1b release by the NFkB signaling pathway in murine macrophages. This pathway may play an important role in regulating and controlling protective cytokine IL-1b release; however, the upstream signaling pathway remains unclear. IL-1b is a major nonredundant cytokine in the function of acute bacterial control of M. bovis (Mayer-Barber et al., 2010). It has been shown that IL-1b release in mice infected with M. bovis can be triggered by mechanisms other than toll like receptor (TLR) or inflammasome activation (Mayer-Barber et al., 2010). In this study, we understood that MB1684 is one of the mycobacterial molecules that contribute to TNF release by the NF-kB signaling pathway. TNF is very important for the control of tuberculosis in humans and in mice (Solovic et al., 2010). This cytokine contributes to activation of macrophages for the killing of intracellular mycobacteria and regulates apoptosis of infected cells (Balcewicz-Sablinska et al., 1998; Clay et al., 2008). Macrophage-derived TNF and T-cell-derived TNF are secreted together to modulate mycobacteria killing and apoptosis of macrophages (Solovic et al., 2010). However, TNF also contributes to granulomagenic activities (Mulligan et al., 1993; Roach et al., 2002). It is well known that conventional CD4 + and CD8 + T cells are the primary source of IFN-g (Cooper et al., 2011). In the present study, induction of IFN-g with significant quantities of MB1684 may tremendously affect the control of mycobacterial infection in vivo. IFN-g is essential for the control of M. tuberculosis and M. bovis in human and mice through regulation of phagosome maturation and autophagy activation ( Jouanguy et al., 1999). IL-6 has a potent function in Mb control when it is induced by the bacteria (Cooper et al., 2011). However, its effect is dependent on the nature of the challenge. Its absence delays the expression of IFN-g and does not increase mortality in a low-dose model (Saunders et al., 2000). In a high-dose model, this cytokine is critical for the survival of animals (Ladel et al., 1997). Indeed, IL-6 is very important to the T-cell response during mycobacterial infections (Appelberg et al., 1994; Leal et al., 1999). IL-6 was significantly expressed in our present study, which indicated that MB1684 is a mycobacterial contributor to IL-6 release. Combined, these results indicate that MB1684-induced upregulation of inflammatory cytokine genes is NF-kB dependent, which indicates that MB1684 is a remarkable mycobacterial antigen for Th1 immune response and inflammatory activation.
ZHAO ET AL.
In our last study, we confirmed the similarity between passaged and primary macrophages. The sensitivity of primary macrophages was lower than Ana-1 cells, but the immune response activity was opposite. The results were similar in the present study, which affirmed our conclusion. The subtle difference in results between the two cells is due to the higher sensitivity and lower reactivity of the BMMs. It is widely believed that Mtb expresses multiple molecules as the agonists of TLRs (Philips and Ernst, 2012). Lipoproteins, Lipoarabinomannans, phosphatidylinositol mannans (PIMs), and Mtb genomic DNA have potential to be TLR agonists (Hertz et al., 2001; Sutcliffe and Harrington, 2004; Bafica et al., 2005; Banaiee et al., 2006). Effort should be made to confirm whether MB1684 has evolved to be another potent TLR agonist or whether it is involved in other signaling pathways. This does not exclude the possibility that other signaling pathways might be involved in the stimulation of proinflammatory cytokine gene expression during macrophage–MB1684 interactions. In addition, we cannot exclude contributions of other mycobacterial molecules to the pathogenesis. Although further studies are needed to investigate the role of other possible signaling pathways in the interaction between MB1684 and immune cells, our study contributes to the understanding of the molecular mechanism behind the interaction between MB1684 and macrophages. Acknowledgments
This work was supported by Natural Science Foundation of China (Project No. 30972164, No. 31001048, No. 31172293, and No. 31272532); the special scientific fund for nonprofit public industry (Agriculture), China (Project No. 200903027); the Beijing Science Foundation of China (Project No. 6101002); National ‘‘Twelfth Five-Year’’ Plan for Science & Technology Support (Project No. 2012AA101302); and Funding of State Key Lab of Agrobiotechnology (Project No. 2012SKLAB06-14). The authors also would like to thank China Agricultural University, who provided BSL-3 Laboratories for experiments using M. bovis culture and infection. Disclosure Statement
No competing financial interests exist. References
Ahmad, S. (2011). Pathogenesis, immunology, and diagnosis of latent Mycobacterium tuberculosis infection. Clin Dev Immunol 2011, 814943. Appelberg, R., Castro, A.G., Pedrosa, J., and Minoprio, P (1994). Role of interleukin-6 in the induction of protective T cells during mycobacterial infections in mice. Immunology 82, 361–364. Baeuerle, P.A. (1991). The inducible transcription activator NFkappa B: regulation by distinct protein subunits. Biochim Biophys Acta 1072, 63–80. Baeuerle, P.A., and Baltimore, D. (1996). NF-kappa B: ten years after. Cell 87, 13–20. Baeuerle, P.A., and Henkel, T. (1994). Function and activation of NF-kappa B in the immune system. Annu Rev Immunol 12, 141–179. Bafica, A., Scanga, C.A., Feng, C.G., Leifer, C., Cheever, A., and Sher, A. (2005). TLR9 regulates Th1 responses and co-
DNA and Cell Biology 2014.33:311-319. Downloaded from online.liebertpub.com by SUNY Stony Brook package(NERL) on 12/21/14. For personal use only.
M. BOVIS PROTEIN MB1684 ACTIVATES MACROPHAGE NF-jB
operates with TLR2 in mediating optimal resistance to Mycobacterium tuberculosis. J Exp Med 202, 1715–1724. Bai, Y., Li, Q., Yang, J., Zhou, X., Yin, X., and Zhao, D. (2008). p75(NTR) activation of NF-kappaB is involved in PrP106–126-induced apoptosis in mouse neuroblastoma cells. Neurosci Res 62, 9–14. Balcewicz-Sablinska, M.K., Keane, J., Kornfeld, H., and Remold, H.G. (1998). Pathogenic Mycobacterium tuberculosis evades apoptosis of host macrophages by release of TNF-R2, resulting in inactivation of TNF-alpha. J Immunol 161, 2636–2641. Banaiee, N., Kincaid, E.Z., Buchwald, U., Jacobs, W.J., and Ernst, J.D. (2006). Potent inhibition of macrophage responses to IFN-gamma by live virulent Mycobacterium tuberculosis is independent of mature mycobacterial lipoproteins but dependent on TLR2. J Immunol 176, 3019–3027. Behar, S.M., Divangahi, M., and Remold, H.G. (2010). Evasion of innate immunity by Mycobacterium tuberculosis: is death an exit strategy? Nat Rev Microbiol 8, 668–674. Casadevall, A. (2008). Evolution of intracellular pathogens. Annu Rev Microbiol 62, 19–33. Chen, L.F., Mu, Y., and Greene, W.C. (2002). Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-kappaB. EMBO J 21, 6539–6548. Clay, H., Volkman, H.E., and Ramakrishnan, L. (2008). Tumor necrosis factor signaling mediates resistance to mycobacteria by inhibiting bacterial growth and macrophage death. Immunity 29, 283–294. Cole, S.T., Brosch, R., Parkhill, J., et al. (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393, 537–544. Cooper, A.M., Mayer-Barber, K.D., and Sher, A. (2011). Role of innate cytokines in mycobacterial infection. Mucosal Immunol 4, 252–260. Dannenberg, A.J. (1989). Immune mechanisms in the pathogenesis of pulmonary tuberculosis. Rev Infect Dis 11 Suppl 2, S369–S378. Doyle, S.L., and O’Neill, L.A. (2006). Toll-like receptors: from the discovery of NFkappaB to new insights into transcriptional regulations in innate immunity. Biochem Pharmacol 72, 1102–1113. Fenton, M.J., and Vermeulen, M.W. (1996). Immunopathology of tuberculosis: roles of macrophages and monocytes. Infect Immun 64, 683–690. Gordhan, B.G., Smith, D.A., Alderton, H., McAdam, R.A., Bancroft, G.J., and Mizrahi, V. (2002). Construction and phenotypic characterization of an auxotrophic mutant of Mycobacterium tuberculosis defective in L-arginine biosynthesis. Infect Immun 70, 3080–3084. Heo, D.R., Shin, S.J., Kim, W.S., et al. (2011). Mycobacterium tuberculosislpdC, Rv0462, induces dendritic cell maturation and Th1 polarization. Biochem Biophys Res Commun 411, 642–647. Hertz, C.J., Kiertscher, S.M., Godowski, P.J., Bouis, D.A., Norgard, M.V., Roth, M.D., and Modlin, R.L. (2001). Microbial lipopeptides stimulate dendritic cell maturation via Toll-like receptor 2. J Immunol 166, 2444–2450. Jouanguy, E., Lamhamedi-Cherradi, S., Lammas, D., et al. (1999). A human IFNGR1 small deletion hotspot associated with dominant susceptibility to mycobacterial infection. Nat Genet 21, 370–378. Ladel, C.H., Blum, C., Dreher, A., Reifenberg, K., Kopf, M., and Kaufmann, S.H. (1997). Lethal tuberculosis in interleukin-6-deficient mutant mice. Infect Immun 65, 4843–4849.
319
Leal, I.S., Smedegard, B., Andersen, P., and Appelberg, R. (1999). Interleukin-6 and interleukin-12 participate in induction of a type 1 protective T-cell response during vaccination with a tuberculosis subunit vaccine. Infect Immun 67, 5747–5754. Mayer-Barber, K.D., Barber, D.L., Shenderov, K., et al. (2010). Caspase-1 independent IL-1beta production is critical for host resistance to mycobacterium tuberculosis and does not require TLR signaling in vivo. J Immunol 184, 3326–3330. Mulligan, M.S., Vaporciyan, A.A., Miyasaka, M., Tamatani, T., and Ward, P.A. (1993). Tumor necrosis factor alpha regulates in vivo intrapulmonary expression of ICAM-1. Am J Pathol 142, 1739–1749. Napolitano, D.R., Pollock, N., Kashino, S.S., Rodrigues, V.J., and Campos-Neto, A. (2008). Identification of Mycobacterium tuberculosis ornithine carboamyltransferase in urine as a possible molecular marker of active pulmonary tuberculosis. Clin Vaccine Immunol 15, 638–643. Perkins, N.D. (2007). Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat Rev Mol Cell Biol 8, 49–62. Philips, J.A., and Ernst, J.D. (2012). Tuberculosis pathogenesis and immunity. Annu Rev Pathol 7, 353–384. Roach, D.R., Bean, A.G., Demangel, C., France, M.P., Briscoe, H., and Britton, W.J. (2002). TNF regulates chemokine induction essential for cell recruitment, granuloma formation, and clearance of mycobacterial infection. J Immunol 168, 4620–4627. Saunders, B.M., Frank, A.A., Orme, I.M., and Cooper, A.M. (2000). Interleukin-6 induces early gamma interferon production in the infected lung but is not required for generation of specific immunity to Mycobacterium tuberculosis infection. Infect Immun 68, 3322–3326. Solovic, I., Sester, M., Gomez-Reino, J.J., et al. (2010). The risk of tuberculosis related to tumour necrosis factor antagonist therapies: a TBNET consensus statement. Eur Respir J 36, 1185–1206. Sutcliffe, I.C., and Harrington, D.J. (2004). Lipoproteins of Mycobacterium tuberculosis: an abundant and functionally diverse class of cell envelope components. FEMS Microbiol Rev 28, 645–659. Timm, J., Rompaey, I., Tricot, C., et al. (1992). Molecular cloning, characterization and purification of ornithine carbamoyltransferase from Mycobacterium bovis BCG. Mol Gen Genet 234, 475–480. Tiruviluamala, P., and Reichman, L.B. (2002). Tuberculosis. Annu Rev Public Health 23, 403–426. Weil, R., Whiteside, S.T., and IsraE`l, A. (1997). Control of NFkB activity by the IkBb inhibitor. Immunobiology 198, 14–23.
Address correspondence to: Deming Zhao, PhD State Key Laboratories for Agrobiotechnology National Animal Transmissible Spongiform Encephalopathy Laboratory College of Veterinary Medicine China Agricultural University Beijing 100193 China E-mail: [email protected] Received for publication March 5, 2013; received in revised form December 24, 2013; accepted January 17, 2014.
