In Vitro Cell.Dev.Biol.—Animal DOI 10.1007/s11626-014-9743-4

Myostatin knockdown and its effect on myogenic gene expression program in stably transfected goat myoblasts Amrutlal K. Patel & Ajai K. Tripathi & Utsav A. Patel & Ravi K. Shah & Chaitanya G. Joshi

Received: 18 November 2013 / Accepted: 24 February 2014 / Editor: T. Okamoto # The Society for In Vitro Biology 2014

Abstract Myostatin, a negative regulator of skeletal muscle mass, is a proven candidate to modulate skeletal muscle mass through targeted gene knockdown approach. Here, we report myostatin (MSTN) knockdown in goat myoblasts stably expressing small hairpin RNA (shRNAs) against MSTN gene through lentivirus vector-mediated integration. We observed 72% (p = 0.003) and 54% (p = 0.022) downregulation of MSTN expression with sh2 shRNA compared to empty vector control and untransduced myoblasts, respectively. The knockdown of MSTN expression was accompanied with concomitant downregulation of myogenic regulatory factor MYOD (77%, p=0.001), MYOG (94%, p=0.000), and MYF5 (36%, p=0.000), cell cycle regulator p21 (62%, p=0.000), MSTN receptor ACVR2B (23%, p = 0.061), MSTN antagonist follistatin (81%, p=0.000), and downstream signaling mediators SMAD2 (20%, p=0.060) and SMAD3 (49%, p=0.006). However, the expression of MYF6 was upregulated by 14% compared to control lentivirus-transduced myoblasts (p=0.354) and 79% compared to untransduced myoblasts (p=0.018) in sh2 shRNA-transduced goat myoblasts cells. Although, MSTN knockdown led to sustained cell proliferation of myoblasts, the myoblasts fusion was suppressed in both MSTN knocked down and control lentivirus-transduced myoblasts. The expression of interferon response gene OAS1 was significantly upregulated in control lentivirus (10.86-fold; p=0.000)- and sh2 (1.71-fold; p=0.002)-integrated myoblasts compared to untransduced myoblasts. Our study demonstrates A. K. Patel : A. K. Tripathi : U. A. Patel : R. K. Shah : C. G. Joshi (*) Department of Animal Biotechnology, College of Veterinary Science and Animal Husbandry, Anand Agricultural University, Anand 388 001, Gujarat, India e-mail: [email protected] A. K. Tripathi Case Western Reserve University, Cleveland, OH, USA

stable knockdown of MSTN in goat myoblasts cells and its potential for use in generation of transgenic goat by somatic cell nuclear transfer. Keywords Goat myoblasts . Lentivirus vector . Myogenesis . Myostatin knockdown . shRNAs . Stable cell line

Introduction Skeletal myogenesis is a complex process regulated by series of steps from developing somites (embryonic myogenesis) or from activation of quiescent satellite cells (adult) to generate myoblasts, their proliferation, myogenic differentiation, and fusion of myocytes to form myofibers (Bentzinger et al. 2012). The muscle growth is determined both by increase in the cell size (termed as hypertrophy) and increase in the cell number (known as hyperplasia). A major breakthrough in understanding skeletal myogenesis has been achieved by delineating natural mutation in the myostatin (MSTN) gene, causing double muscling phenotype in livestock species namely Belgian Blue and Piemontese (Kambadur et al. 1997; McPherron and Lee 1997; Grobet et al. 1998; Marchitelli et al. 2003). Similar phenotype could also be observed in the MSTN knockout mice (McPherron et al. 1997; Lin et al. 2002), further supporting the key role of MSTN in the regulation of muscle growth. MSTN, a member of TGF beta superfamily, is expressed as 42 kDa polypeptide which is proteolytically processed to generate the c-terminal 26 kDa matured peptide. The MSTN mature peptide remains in a latent complex of MSTN dimer with its N-terminus propeptide, which upon activation initiates signaling through activin type II receptors (mainly IIb and IIa to a lesser extent) (Lee et al. 2005) resulting in activation of SMAD2/3 and further downstream signaling cascade leading to expression of genes involved in muscle atrophy (Sartori

PATEL ET AL.

et al. 2009; Han et al. 2013) and inhibition of myoblasts proliferation and differentiation (Thomas et al. 2000; Taylor et al. 2001; Langley et al. 2002). RNA interference is one of the promising methods of post transcriptional regulation of gene expression. Recently, number of studies reported successful knockdown of MSTN gene through RNA interference in vitro (Jain et al. 2010; Hu et al. 2011; Tripathi et al. 2012, 2013a, b) as well as in vivo (Hu et al. 2013) leading to enhancement of muscle growth. Goat meat is preferred over meat from other livestock species as it contains less fat (James and Berry 1997) and is accepted by most ethnic communities. The transgenic goat having myostatin knocked down offers the potential to enhance the meat production. To achieve this objective, earlier, we and other group reported successful knockdown of MSTN in in vitro culture system using small hairpin RNA (shRNA) against MSTN gene through transient transfection assay (Jain et al. 2010; Tripathi et al. 2013a, b). The myoblasts cells carrying stable integration of shRNA against MSTN gene provide a model to study the biological response of MSTN knockdown as well as potential source for the generation of transgenic goat by somatic cell nuclear transfer. Here, we report, MSTN knockdown in myoblasts stably integrated with shRNA against MSTN by lentivirus vector and assessed its effect on the expression of myogenic regulators as well as induction of possible undesired interferon response.

Materials and Methods Cell cultures. Caprine myoblasts culture was established from the rectus abdominis muscle of adult goat by adopting the procedures described by Tripathi et al. (2010) and BaqueroPerez et al. (2012). Briefly, muscle tissue, after mincing, was disaggregated by Pronase (Sigma, St. Louis, MO) for 1 h at 37°C, and cell suspension was passed through a 70 μM cell strainer (BD Biosciences, San Jose, CA). The cells were further pelleted by centrifugation at 800×g for 10 min and seeded in 1% collagen-coated flask in growth medium DMEM/F12 (Life technologies, Carlsbad, CA) with 20% fetal bovine serum (FBS) (Life technologies). Cells were allowed to adhere for 48 h, and attached cells were supplemented with fresh growth medium. Cells were sub-cultured at 70–80% confluency and used for further studies. Cells after attaining complete confluency were cultured in DMEM/F12 with 2% horse serum for 96 h to obtain the differentiated myotubes. Plasmids and production of lentiviruses. The plasmids pLKO.1 cmv-turbo GFP carrying sh2 shRNA (pLKO.sh2) (custom designed from Sigma) with the highest MSTN knockdown efficiency (Tripathi et al. 2013a, b) and pLKO.1 cmv-turbo GFP (pLKO-empty vector) without shRNA were used to generate the lentivirus particles following the protocol

described on the addgene website (http://www.addgene.org/ plko). Briefly, lentivirus particles were packaged in 293 T cells by co-transfecting the plasmids pLKO.sh2 or pLKO-empty vector, psPAX2 (addgene #12260), pMD2.G (addgene #12259). The culture supernatant containing lentivirus particles was harvested, and virus particles were concentrated by Lenti-X concentrator (Clontech, Heidelberg, Germany) as per the manufacturer’s instructions. Generation of stable cell lines. Goat myoblasts cells were seeded into 6 cm dishes. At 70–80% confluency, cells were transduced with lentivirus particles carrying sh2 shRNA or empty vector by infecting the cells with concentrated virus particles in the presence of protamine sulfate (8 μg/ml) (Sigma). The virus-transduced cells were selected with puromycin (200 ng/ml) (Sigma) for 2 wk. Analysis of shRNA integration. DNA isolation from stable myoblasts cells integrated with MSTN shRNA and empty vector along with untransduced myoblasts was performed using DNeasy tissue kit (Qiagen, Hilden, Germany) as per the manufacturer’s instructions. The integration analysis was performed by Polymerase Chain Reaction (PCR) from genomic DNA using lentiviral plasmid specific primers ( h U 6 I n t F w d : C G ATA C A A G G C T G T TA G A G a n d CMVIntRev: CTGCCAAGTGGGCAGTTTAC) using untransduced myoblasts genomic DNA as control using EmeraldAmp GT PCR Master Mix (Takara-Bio, Dalian, China). The PCR reactions were performed by initial denaturation of 98°C for 1 min followed by 35 cycles of 98°C for 10 s, 60°C for 10 s, and 72°C for 20 s with final extension of 72°C for 2 min. Amplified PCR products were separated on 1% agarose gel electrophoresis and visualized by UV transilluminator. RNA isolation and qPCR. RNA was isolated from the untransduced goat myoblasts and lentivirus with or without sh2 shRNA-transduced myoblasts, fused myotubes, and muscle tissue by RNeasy mini kit (Qiagen) following manufacturer’s instructions. The cDNA synthesis was performed from total RNA using Revertaid RT kit (Fermentas, Hanover, MD) using random hexamer. Real-time PCR was performed using the gene specific primers (Table 1) using Quantifast Sybr green master mix (Qiagen). All reactions were performed in triplicate, and expression values were normalized using GAPDH as endogenous reference gene. The reaction mixtures were subjected to initial denaturation of 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The melt curve analysis was performed by increasing the temperature from 60 to 95°C with increase of 1°C per 30 s followed by final hold at 25°C. The specificity of the amplification was confirmed by separating PCR product on agarose gel electrophoresis and melt curve analysis. The fold change in the messenger RNA (mRNA) expression of

STABLE MYOSTATIN KNOCKDOWN IN GOAT MYOBLASTS Table 1. Primers used for qPCR analysis

Target

Primer sequence Forward

Reverse

MSTN

GTGTTGCAAAACTGGCTCAA

TCATCACAATCAAGCCCAAA

MyoD Myogenin Myf5 Myf6 FST ACVR2B SMAD2 p21 SMAD3 OAS1 GAPDH

TGCAACAGCGGATGACTTC GAACTACCTGCCTGTCCAC GCAAGAGGAAGTCCACCAC CTTGAGGGTGCGGATTTCC GGGACTTCAAGGTTGGCAG AGAGTGACCTCACTGCTG ACCAGGTCTCTAGATGGTCG CAGAAGAGCCACAGGTGC GCAAGATTCCACCAGGGTGC GATGTCCTGCCCGCCTTTGAT ATGTTTGTGATGGGCGTGA

TTGCAGGCCCACAGTAAAC CGACTTCCTCTTGCACACC CAGCCTCTGGTTAGGGTTG TCTCCACTACCTCCTCCACG TTCACCTTCCTCCTCGTCC TCATCCACAGGTCCGTCG GGGCAGAACTGGTGTCTC CGTCTCGGTGACAAAGTCG CAGGTGCAGCTCAATCCAG TCTCGCTGCAGCTCCGTGAA AAGCAGGGATGAAGTTCTGG

target gene in sh2 shRNA-expressing cells compared to empty vector control was expressed using the formula 2-ddCt. Western blot analysis. The untransduced goat myoblasts and lentivirus with or without sh2 shRNA-transduced myoblasts were harvested in RIPA buffer. The equal amount of protein sample was separated by 10% SDS-PAGE, transferred to PVDF membrane, and probed by anti-MSTN (1:50 dilution, Pierce, Rockford, IL #PA5-11936) and anti-tubulin (1:1,000 dilution, Pierce #MA1-25052) primary antibodies and Horse Reddish Peroxidase (HRP-conjugated) goat anti-rabbit (1:400 dilution, Jackson immunoResearch, West Grove, PA #111035-003) and anti-mouse (1:400 dilution, Pierce #31430) secondary antibodies, respectively. The membranes were then developed by metal-enhanced DAB substrate kit (Pierce #34065). The quantitative analysis of band intensities was measured by ImageJ software. Cell proliferation assay. The proliferation rate of sh2 shRNAand control lentivirus-integrated myoblasts was analyzed by growth curve analysis up to 96 h. Equal number of cells (2.5× 104 cells/well) was seeded in 12-well plate and cell counting was performed after 24, 48, 72, and 96 h. The number of cells was plotted against each time point to generate the growth curve. Analysis of myoblasts fusion. The confluent monolayer of primary myoblasts, sh2, and control lentivirus-integrated myoblasts were induced to differentiate in DMEM-F12 medium containing 2% horse serum for 96 h and stained with anti-desmin (Sigma #D1033) and anti-myosin heavy chain (Developmental Studies and Hybridoma Bank-MF20, Iowa City, Iowa) mouse monoclonal antibodies followed by counterstaining by DAPI. The primary myoblasts were labeled with Alexa fluor 488-conjugated goat anti-mouse secondary antibody (Invitrogen, Carlsbad, CA #A11029), whereas sh2 shRNA and control lentivirus-

transduced myoblasts were labeled with HRP-conjugated goat anti-mouse secondary antibody (Pierce #31430) followed by development with metal-enhanced DAB substrate kit (Pierce #34065). Statistical analysis. Statistical analysis was performed by two-tailed, unpaired Student t test assuming equal variance. Difference in the expression value in test sample compared to control with p value