Pflugers Arch - Eur J Physiol DOI 10.1007/s00424-014-1523-1

ION CHANNELS, RECEPTORS AND TRANSPORTERS

Neuronal expression of the intermediate conductance calcium-activated potassium channel KCa3.1 in the mammalian central nervous system Ray W. Turner & Mirna Kruskic & Michelle Teves & Teresa Scheidl-Yee & Shahid Hameed & Gerald W. Zamponi

Received: 23 November 2013 / Revised: 14 April 2014 / Accepted: 15 April 2014 # Springer-Verlag Berlin Heidelberg 2014

Abstract The expression pattern and functional roles for calcium-activated potassium channels of the KCa2.x family and KCa1.1 have been extensively examined in central neurons. Recent work indicates that intermediate conductance calcium-activated potassium channels (KCa3.1) are also expressed in central neurons of the cerebellum and spinal cord. The current study used immunocytochemistry and GFP linked to KCNN4 promoter activity in a transgenic mouse to determine the expression pattern of KCa3.1 channels in rat or mouse neocortex, hippocampus, thalamus, and cerebellum. KCa3.1 immunolabel and GFP expression were closely matched and detected in both excitatory and inhibitory cells of all regions examined. KCa3.1 immunolabel was localized primarily to the somatic region of excitatory cells in cortical structures but at the soma and over longer segments of dendrites of cells in deep cerebellar nuclei. More extensive labeling was apparent for inhibitory cells at the somatic and dendritic level with no detectable label associated with axon tracts or regions of intense synaptic innervation. The data indicate that KCa3.1 channels are expressed in the CNS with a differential pattern of distribution between cells, suggesting

R. W. Turner : M. Kruskic : M. Teves Department of Cell Biology and Anatomy, Hotchkiss Brain Institute, University of Calgary, 3330 Hospital Dr. N.W., Calgary, Alberta, Canada T2N 4N1 R. W. Turner (*) : S. Hameed : G. W. Zamponi Department of Physiology and Pharmacology, Hotchkiss Brain Institute, University of Calgary, 3330 Hospital Dr. N.W., Calgary, Alberta, Canada T2N 4N1 e-mail: [email protected] URL: http://www.acs.ucalgary.ca/~rwturner T. Scheidl-Yee Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, Alberta, Canada T2N 4N1

important functional roles for these calcium-activated potassium channels in regulating the excitability of central neurons. Keywords KCa3.1 . IKCa . KCNN4 . SK4 . Potassium channel

Introduction The excitability of neurons is strongly regulated by the activity of voltage- or calcium-gated potassium channels that mediate spike repolarization and the generation of afterhyperpolarizations (AHPs). Compared to a wide diversity of voltage-gated potassium channels, only two subtypes of calcium-activated potassium channels were believed to exist in central neurons: a “big conductance” channel (BK, mslo, KCa1.1, KCNMA1) and three isoforms of small conductance channels (SK1–3, KCa2.1– 2.3, KCNN1–3) [72]. The properties of KCa1.1 and KCa2.x channels differ in key respects that define their expression patterns and functional roles in neurons. KCa1.1 channels are both voltage and calcium dependent and are closely associated with voltage-dependent calcium channels to ensure activation by a relatively large voltage response [11, 54]. KCa1.1 channels thus typically contribute to spike repolarization and the generation of a fast AHP (fAHP) of ~10 ms [11]. KCa2.x channels are only calcium dependent but have a higher sensitivity to internal calcium due to a constitutive association with calmodulin, allowing these channels to typically contribute to a medium AHP (mAHP) of ~50 ms that summates during depolarizations in the sub- or suprathreshold range [1, 60]. Indeed, the roles for KCa1.1 and KCa2.2 channels in controlling membrane excitability are so important as to support an

Pflugers Arch - Eur J Physiol

almost ubiquitous expression pattern in central neurons [55, 56, 61, 63]. However, the subcellular distribution of either channel type varies depending on cell type, with KCa1.1 channels expressed at the soma, dendrites, or presynaptic terminals [10, 27, 42]. Similarly, KCa2.x channels can be localized in different cells to one or more regions of the soma-dendritic axis and axon terminals and often with a complementary expression pattern between channel isoforms [5, 48, 49, 55, 56, 61]. We thus understand a great deal about the expression pattern and localization of KCa1.1 and KCa2.x channels in central neurons. Nevertheless, there are other calciumdependent hyperpolarizing responses in neurons that exert substantial control over membrane excitability but which have defied molecular identification to date [4]. In this regard, a third group of calcium-activated potassium channel exists that is expressed as an “intermediate conductance” channel (KCa3.1, SK4, IKCa1, KCNN4) [28, 31, 40, 52]. KCa3.1 channels are similar to KCa2.x channels in being drawn from the same gene family but share only ~45 % sequence homology [28, 31, 40, 72]. KCa3.1 channels also associate with calmodulin to sense internal calcium [19, 52] and are typically reported as being only calcium dependent [19, 40, 62]. However, KCa3.1 channels are different in exhibiting an intermediate conductance of ~20–90 pS and a pharmacological profile that is entirely distinct from that of KCa1.1 and KCa2.x channels [14, 64, 72, 74]. The KCa3.1 channel was first encountered in red blood cells as the Gardos channel [23] and, since then, in numerous cells of the immune system, endothelial and epithelial cells, activated microglia and astrocytes, and in neurons of the enteric and myenteric nervous systems [7, 8, 14, 29, 33, 74]. However, unlike KCa1.1 and KCa2.x channels, KCa3.1 channels were only considered to be expressed in the CNS in endothelial cells and activated glia [14, 15, 29, 73]. Nevertheless, the existence of either calcium-activated potassium channels of intermediate conductance or KCa3.1 immunolabel has been reported in primary sensory neurons of the autonomic and peripheral nervous systems [12, 22, 43, 46, 70], some spinal cord motoneurons [14, 43], and salamander rod photoreceptors [53]. A series of protein biochemical and physiological tests also recently established that KCa3.1 channels are expressed in rat cerebellar Purkinje cells, where they control temporal summation of synaptic responses [17]. Obtaining evidence for KCa3.1 expression in Purkinje cells leads to the question of how widespread KCa3.1 channel expression might be in other central neurons. The current study used KCa3.1 immunocytochemistry and KCNN4 promoter activity to establish that KCa3.1 potassium channels are expressed in numerous cell types of the rat and mouse CNS, revealing a potentially prominent role in controlling cell excitability.

Materials and methods Animal care Male Sprague–Dawley rats (P18–P30) and C57BL6 mice (P60) were obtained from Charles River, Canada. All animals were maintained according to the guidelines established by the Canadian Council for Animal Care (CCAC) and experimental procedures approved by the University of Calgary Animal Care Committee. All chemicals were obtained from Sigma (St. Louis, MO) unless otherwise indicated. Tissue fixation Tissue destined for immunocytochemistry was obtained from male rats (P25–35) and male GAD67-GFP knock-in mice (P28) deeply anesthetized with isofluoren VSP by inhalation until unresponsive to ear pinch. Animals were perfused intracardially with 250 ml of 0.1 M phosphate buffer (PB, pH 7.4) followed by 100 ml of 4 % paraformaldehyde (PARA, pH 7.4) at room temperature (RT). Brains were placed into 4 % PARA at RT for 1 h and left overnight at 4 °C. GAD67-GFP knock-in mice (P26) were provided courtesy of I. Laplante and J-C. Lacaille (University of Montreal, Canada) and Y. Yanagawa (Gunma University, Japan) [65] and perfused intracardially with 4 % PARA. Sections of 45 μm thickness were cut by vibratome (Leica VT1000 S, Germany) in the coronal or sagittal planes in PB. Hippocampal cultures were fixed after 9 days in vitro in 4 % PARA at RT for 1 h, washed in PB, and reacted in the same working solutions as free floating tissue sections. Immunocytochemistry KCa3.1 immunolabel was detected using a monoclonal IK-1 (D-5) antibody (Santa Cruz, sc-365265; 1:75; http://www. scbt.com/datasheet-365265-ik1-d-5-antibody.html), which provides only a single band on Western blots of brain lysates at the predicted molecular weight of 47 kDa compared to all other polyclonal antibodies to KCa2.x channel isoforms tested here (see Fig. 1a). The D-5 antibody was developed against amino acids 308–427 of human KCa3.1 protein, corresponding to a region derived from exons 5 to 8 of the KCNN4 gene. Commercially available KCa3.1 knockout animals are based on deletions in exon 1 (JAX) [8] or exon 4 (UC Davis KOMP Repository) [58]. Tests with tissue from these knockouts revealed a band on Western blots from tissue lysates (data not shown). In addition, RT-PCR using primers spanning the regions of exons 5 to 8 revealed 454 base pair bands in both wt and knockout animals, with DNA sequencing of gel-purified bands confirming the KCNN4 messenger RNA (mRNA) sequence. These data indicate that mRNA for KCa3.1 channels continues to be transcribed in these knockout animals even though channel function is lost, potentially accounting

Pflugers Arch - Eur J Physiol

a

M

R

M

R

M

R

M

R

100 75 63 48 35 25 20 17

kDa

KCa3.1

KCa2.1

KCa2.2 KCa2.3

b

KCa3.1

Control

c KCa3.1

MAP-2

d KCa3.1

Iba-1

Fig. 1 KCa3.1 antibody specificity in central regions. a Western blot analyses of the specificity of a monoclonal KCa3.1 antibody in lysate from mouse (M) or rat (R) brain. The KCa3.1 antibody labels one band at ~47 kDa MW compared to entirely different MW bands revealed by antibodies to KCa2.1, KCa2.2, or KCa2.3 proteins. b–d Dual images of KCa3.1 immunolabel (red) compared to the indicated counterlabels. c KCa3.1 immunolabel in hippocampal CA4 pyramidal cell bodies is absent upon omission of the primary antibody (b, control). c Endothelial cells of a longitudinally sectioned blood vessel are positive for KCa3.1 immunolabel but negative for MAP-2 in the hippocampal CA3 stratum oriens. d Microglia in 9-day-old hippocampal cell cultures exhibit KCa3.1 immunolabel detected with an Iba-1 antibody. Scale bars = 20 μm

for translation of the C-terminal region representing the antiIK-1 (D-5) antigen on Western blots, preventing us from using these for immunocytochemical controls. Complementary primary antibodies used for tissue sections were monoclonal rat microtubule-associated protein-2

(MAP2a, b) (Sigma M9942; 1:500), or rabbit polyclonal antibodies against KCa2.1 (Alomone, APC-039; 1:200), KCa2.2 (Alomone, APC-028; 1:250), KCa2.3 (Santa Cruz, sc-28621; 1:200), bovine brain microtubule-associated protein (MAP2a, b) (Sigma, AB24640; 1:500), γ-aminobuteric acid (GABA) (Sigma, A2052; 1:7,000), or Iba-1 (WAKO Chemicals, 019–19741; 1:250). Endothelial cells and microglia were labeled using AlexaFluor 488-conjugated isolectin GS-IB4 (5 μg/ml; Molecular Probes) applied in working solution along with primary antibodies [18, 24]. Tissue sections were reacted in a working solution consisting of 3 % normal donkey serum, 0.2 % dimethylsulfoxide (DMSO), and 0.1 % Tween-20. Primary antibodies were included in the working solution for 24–72 h with gentle agitation on a rocker at 4 °C. After thorough washing in working solution, sections were exposed for 2– 3 h (RT) to AlexaFluor 488-conjugated goat anti-rabbit IgG (1:1,000; Molecular Probes, OR) or AlexaFluor 594conjugated donkey anti-mouse IgG (1:1,000). Sections were washed 3 times for 20 min in PB, mounted in anti-fade medium (Fluoromount), and stored at −20 °C. Cell regions were identified according to rat and mouse brain stereotaxic atlas [20, 51]. Controls consisted of omitting the primary antibodies and were included in all experimental tests to compare the relative labeling intensity. Fluorescent labeling was imaged on a Zeiss Axioimager equipped with Colibri LED illumination and optical sections obtained via Apotome grid illumination using a 0.27-μm section thickness. Control images in which primary antibodies were omitted were obtained from the same animal as test images and processed side-by-side during immunocytochemical staining. Control and test images were then compared using matched digital camera settings and display parameters in Axiovision software and identical light levels in Photoshop. Extended images were prepared from optical stacks of images in Axiovision software and transferred to Adobe Photoshop for adjustment of levels or brightness/contrast only before assembly in Abode Illustrator software. Western blots Fresh mouse or rat whole brain was homogenized in lysis buffer (10 % wt/vol, 150 mM NaCl, 50 mM Tris pH 7.5, and 1 % Nonidet P-40 including protease inhibitors). The homogenate was centrifuged at ∼16,000 × g for 10 min at 4 °C and the supernatant was collected. Protein concentration was estimated using the Bradford assay (Bio-Rad). Forty micrograms of total protein from lysate was separated on SDS/PAGE gels. The primary antibodies used for Western blotting were from rabbit polyclonal anti-KCNN1 (Alomone, APC-039; 1:500 dilution), rabbit polyclonal anti-KCNN2 (Alomone, APC-028; 1:400 dilution), anti-KCNN3 (Santa Cruz Biotechnology, sc-2862; 1:1,000 dilution), and monoclonal anti-KCNN4 (Santa Cruz,

Pflugers Arch - Eur J Physiol

sc-365265; 1:1,000 dilution). The immunoreactive bands were detected using the Odyssey Imaging System (LICOR, Lincoln, Nebraska) using appropriate fluorescent conjugated secondary antibodies (Mandel Scientific Company Inc). Transgenic KCNN4 knock-in mouse A transgenic mouse was created to enable visualization of cells exhibiting KCNN4 promoter activity via GFP expression (see Fig. 8a). For this purpose, a BAC transgenic clone was constructed using recombineering technology [71]. We synthesized a recombineering cassette (Celtek) containing 150 bp of homology arms which included GFP fused to the KCNN4 ATG site, a self cleaving p2A peptide and CreERT2PpolyA to allow tamoxifen-induced gene alterations in KCNN4 expressing cells, and finally a FRT flanked EM7-Kan prokaryotic selectable marker to select for BAC clones containing the recombination event. The mouse BAC clone RP23-4169P (TCAG Genome Resource Facility, Hospital for Sick Kids, Toronto, ON) was used as the target for the homologous recombineering reaction with the pSC101-BAD-gbaA vector (personal gift, A. F. Stewart, Univ. Technology, Dresden, Germany) [71] and the GFPp2A-CreERT2-EM7Neo/Kan cassette. Kanamycin-positive clones were screened at both 3′ and 5′ ends of the recombineering reaction by PCR for cassette completeness. The resulting positive clone was grown and purified with Nucleobond BAC-100 (MJS Biolynx Cat# MCN740579), ethanol-precipitated, and rehydrated with injection buffer supplemented with 20 mM spermine and 70 mM spermidine (polyamines). Transgenic mice were produced by pronuclear injection of the BAC construct into C57BL/6 X DBA F1 or CD-1 single-cell embryos using standard techniques [45]. Transgenic lines were produced at the University of Calgary by the Clara Christie Centre for Mouse Genomics and transgenic mice identified through genotyping using two sets of primers, one set at the 5′ end GTCTCCGGTCTGTCATAG GGT, CTTCAGCTCGATGCGGTTCAC and one set at the 3′ end CGCCTTCTATCGCCTTCTT, GCTTTGCTCTCTAA CACTCAG to ensure that the full length transgene was still intact. This transgenic mouse also permits the future amplification of GFP or the induction of other fluorescent proteins via KCNN4-CRE expression.

Results Specificity of KCa3.1 immunolabel KCa3.1 immunolabel was localized using a mouse monoclonal antibody (IK-1(D-5)) targeted against the KCa3.1 Cterminus and imaged using fluorophore-conjugated secondary antibodies in tissue sections of rat brain, CD57BL/6 mice, or

GAD-67-GFP knock-in mice. The D-5 antibody detected a single band on Western blots prepared from lysates of rat or mouse brain at ~47 kDa. Since the D-5 antibody was originally generated against the C-terminus, it was necessary to determine if only the KCa3.1 channel was being localized given considerable homology of this region with that of KCa2.x channels. Specificity was established by finding that Western blots of rat or mouse brain lysate probed with antibodies to KCa2.1 or KCa2.3 channels reported bands of substantially different MW from that identified by the D-5 KCa3.1 antibody (Fig. 1a). We also established that the D-5 KCa3.1 antibody did not detect KCa2.2 protein on Western blots from brain lysate (Fig. 1a). This was important given an earlier report of a short KCa2.2 isoform that presented a band at ~47 kDa [44]. We note that the KCa2.2 antibody used here (Alomone Labs, APC-028) was developed against sequence 542–559 of the KCa2.2 C-terminus (ETQMENYDKHVTYNAERS). This sequence is nearly identical to the sequence of 542–561 (ETQMENYDKHVTYNAE) previously used by Bond et al. [13] and Strassmeir et al. [63] to develop a “pan α-KCa2.2-C” antibody designed to recognize multiple isoforms of KCa2.2, including the truncated variant of KCa2.2 that lacks the S3–S5 regions [44], and another KCa2.2 variant with an extended Nterminus [63]. The specificity of the pan α-KCa2.2-C antibody was previously established by detecting bands on Western blots from brain lysates of wild-type but not KCa2.2 knockout mice [63] and by a lack of immunolabel in knockout mice [3]. Previous authors using this antibody detected bands on Western blots from rat or mouse brain lysates at ~49, ~65, and/or 78 kDa [13, 35, 55, 56, 63]. In our hands, the KCa2.2 antibody detected bands from rat brain lysate at ~18, 28, 40, and 64 kDa (Fig. 1a). In any case, the banding pattern of all KCa2.x channels on Western blots was distinctly different from that of the D-5 KCa3.1 antibody. Since KCa3.1 channels are also expressed in endothelial cells and activated glia [14, 15, 33], the protein detected on Western blots does not necessarily reflect neuronal expression. To distinguish between neuronal and nonneuronal structures in tissue sections, we used a dual labeling procedure to first compare KCa3.1 immunolabel to that of microtubuleassociated protein (MAP-2) present in neuronal dendrites and somata. The specificity of all labeling was checked in every immunocytochemical experiment against control sections in which the primary antibody was omitted (Fig. 1b). Positive controls were obtained in the form of KCa3.1 immunolabeling of endothelial cells lining the interior of blood vessels that were negative for MAP-2 immunolabel (Fig. 1c). Microglia were identified in intact tissue sections by exposure to 488-conjugated isolectin-GS-IB4 [18] or a polyclonal Iba-1 antibody [32]. Microglia could be detected as small diameter cells with short and extensively branched processes interspersed at relatively low density in all brain

Pflugers Arch - Eur J Physiol

regions, but consistently failed to exhibit any KCa3.1 immunolabel in normal tissue sections (data not shown). It has been shown that activated glia upregulate KCa3.1 channels [14, 15, 33]. Accordingly, Iba-1-positive microglia colabeled for KCa3.1 protein were readily detected in 9-dayold cultures of rat hippocampal neurons (Fig. 1d), presumably reflecting activation of microglia in the process of preparing or maintaining cell cultures. Given these controls, we concluded that the immunolabel identified by the D-5 antibody represents KCa3.1 protein. However, we cannot distinguish at this time the extent to which this label might include alternate isoforms of KCa3.1 channels. With these restrictions in mind, we conducted a series of immunocytochemical tests in five key regions of rat and mouse brain to examine the potential for expression of KCa3.1 immunolabel in central neurons. KCa3.1 immunolabel expression pattern In general, KCa3.1 label was distributed in a similar fashion in rat and mouse brain sections and was restricted to MAP-2positive neurons and not glial structures. GABAergic cells were identified using a transgenic GAD-67-GFP knock-in mouse [65] or an anti-GABA polyclonal antibody [2]. KCa3.1 immunolabel presented in MAP-2-positive neurons as a diffuse label in the cytoplasm localized primarily to the soma but in some cases over extended regions of dendrites. No labeling was detected in nuclear regions (Fig. 1b). KCa3.1 immunolabel was nonuniform in being detected in specific cell populations and at different relative levels of immunofluorescent intensity in photomicrographs over multiple immunocytochemical experiments. While these apparent differences in fluorescent labeling intensity are noted below, they are not interpreted to directly reflect a quantitative difference in protein expression levels or subcellular localization of KCa3.1 protein. As often found in light level microscopic analyses of ion channels in intact tissue, distinguishing a labeling pattern suggestive of plasma membrane insertion of KCa3.1 channels was less frequent, but was obtained in several cases. Olfactory bulb KCa3.1 immunolabel was detected in all major neuronal cell types of the olfactory bulbs but at relatively different levels of fluorescent intensity. KCa3.1 immunolabel was detected in the somata of mitral cells, granule cells, and periglomerular cells, all identified according to relative position in the layered olfactory bulb structure and using MAP-2 as a counterlabel. Periglomerular and granule cells exhibited the most prominent punctate label suggestive of a plasma membrane label (Fig. 2a–d), while mitral cells exhibited

only a light cytoplasmic label that could make identification more difficult (Fig. 2e, f). By comparison, very few dendrites of mitral or granule cells exhibited KCa3.1 immunolabel. KCa3.1 immunolabel was also detected in neurons of the anterior olfactory nucleus, but in only a portion of the GABAergic cells in GAD-67 expressing mouse sections (Fig. 2g, h). Cortical regions KCa3.1 immunolabel was widely detected in MAP-2-positive cells in all layers of cortex (Fig. 3). Some regional variations in labeling intensity were apparent, with relatively higher intensity of immunofluorescence in cells positioned in layers 3–5 than in layers 1–2 or layer 6. There were also regional differences in the relative intensity of fluorescent label between cortical regions, with the most prominent pyramidal cell somatic label in the cingulate cortex, detectable label in the motor cortex, less in the frontal cortex, and minimal labeling of pyramidal cells in the medial orbital cortex. The pattern of KCa3.1 immunolabel was distinct in cortical neurons in being largely restricted to the somatic region of pyramidal cells (Fig. 3a). However, in isolated cases a diffuse or punctate labeling of MAP-2-positive dendrites could be detected at high magnification (Fig. 3b). Cortical inhibitory cells were identified in GAD-67-GFP-labeled sections, revealing interneurons that were either positive or negative for KCa3.1 immunolabel (Fig. 3c, d). No diffuse label for KCa3.1 was apparent in layers 1–2 or layer 4, suggesting a lack of prominent label in the axon tracts or presynaptic zones expected in these regions of axon termination. A distinctly different pattern of KCa3.1 immunolabel was found in the more primitive cortical subicular region. Pyramidal cells in the subicular region exhibited some of the most prominent and extended KCa3.1 label among cells in the associated hippocampal formation. Thus, in the subiculum, KCa3.1 immunolabel was apparent as a somatic cytoplasmic label, with punctate labeling of restricted segments of MAP-2counterlabeled apical dendrites in the stratum radiatum (Fig. 3e, f). Short segments of MAP-2-positive processes of unknown origin were also demarcated by KCa3.1 labeling across the full width of the stratum lacunosum-moleculare (Fig. 3e). By comparison, no labeling was apparent in basilar dendrites of subicular pyramidal cells within the stratum oriens (Fig. 3e). Comparatively large diameter presumed interneurons positioned within or adjacent to stratum pyramidale were the most intensely labeled cells at the level of the soma and at least proximal dendritic extensions (Fig. 3e). This identification was further supported by KCa3.1 immunolabel in GAD-67-GFP-positive neurons within the stratum pyramidale of mouse tissue sections (Fig. 3g, h).

Pflugers Arch - Eur J Physiol Fig. 2 KCa3.1 immunolabel in olfactory bulb neurons. Shown are dual immunolabeled images for MAP-2 and KCa3.1 (a–f) and for GAD-67 and KCa3.1 (g, h). KCa3.1 immunolabel is found in rat periglomerular cells (a, b, arrows), granule cells (c, d, arrows), and mitral cells (e, f, arrows) of the olfactory bulb. g, h In the mouse anterior olfactory nucleus, GAD-67positive neurons are either KCa3.1 positive (solid arrow) or KCa3.1 negative (open arrows). Two non-GABAergic cells that are KCa3.1 positive are indicated by asterisks. Scale bars = 20 μm

Hippocampus KCa3.1 immunolabel was expressed in specific cell types within all regions of the hippocampus, with a consistent pattern and relative differences in intensity levels between cell populations. KCa3.1 immunolabel in pyramidal cells was most often restricted to the somatic region or very proximal

extent of apical dendrites in the stratum radiatum (Fig. 4a–c). No label was detected in pyramidal cell basilar dendrites in the stratum oriens in any of the CA1 to CA3 regions, or in the alveus containing the axonal projections of pyramidal cells. CA1 pyramidal cells exhibited KCa3.1 immunolabel but at relatively low intensity in the vicinity of the soma (Fig. 4a). A lighter degree of labeling if not a lack of KCa3.1

Pflugers Arch - Eur J Physiol

Fig. 3 KCa3.1 immunolabel in cortical neurons. Shown are dual immunolabel images for MAP-2 and KCa3.1 in cells of layer 3 of M2 neocortex (a–d) and the hippocampal subicular region (e–g). a, b KCa3.1 label is detected in the somatic region of neocortical pyramidal cells (a) and in some cases as a diffuse label in apical dendrites at high magnification (b, arrows). c, d GAD-67-GFP expressing interneurons in M2 cerebral cortex are either positive (c) or negative (d, arrow) for KCa3.1

immunolabel. e, f Subicular pyramidal cells exhibit KCa3.1 immunolabel at the soma and over extended regions of apical dendrites in SR but not in basilar dendrites in the SO. Image bounded by dashed lines in e is expanded in f. g GAD-67-GFP expressing interneurons in the subicular pyramidal cell layer positive for KCa3.1 immunolabel. Scale bars = a–d, f, 20 μm; e, 50 μm; g, 10 μm. SO stratum oriens, SP stratum pyramidale, SR stratum radiatum, SL-M stratum lacunosum-moleculare

Pflugers Arch - Eur J Physiol

immunostaining often characterized pyramidal cell bodies and stratum radiatum in CA2 (Fig. 4b), with an increase in relative fluorescent signal intensity in CA3 pyramidal cells (Fig. 4c) and higher relative signal intensity in CA4 pyramidal cells (Fig. 4d). One of the highest levels of KCa3.1 immunolabel was consistently found in the somatic region of MAP-2positive presumed interneurons positioned at intervals near the dorsal or ventral boundary of the pyramidal cell body layers in each of the CA1–CA4 regions (Fig. 4a, b). Presumed interneurons also exhibited intense KCa3.1 immunolabel over extended regions of dendrites that could be tracked over the course of either stratum radiatum or stratum oriens. In the dentate gyrus, granule cells exhibited a light level of KCa3.1 immunolabel within at least the thin shell

of cytoplasm inherent to these cells, with a diffuse or punctate label in the region of the small diameter MAP2-counterlabeled dendrites (Fig. 4e). The most intense KCa3.1 immunolabel in this region and potentially all of the hippocampus were found in hilar interneurons ventral to the granule cell layer. Some multipolar neurons in the hilar region exhibited intense label at the soma as well as in thick diameter dendrites that could be visualized as they projected through the granule cell layer and into the overlying dendritic regions (Fig. 4e). KCa3.1 labeling was also found in interneurons immediately ventral to the granule cell layer with dendrites projecting parallel to the granule cell layer and identified as inhibitory according to a GABA counterlabel (Fig. 4f).

Fig. 4 KCa3.1 immunolabel is differentially expressed in the hippocampus. a–d Shown is dual immunolabel for MAP-2 to identify neuronal cell structure (left column) and KCa3.1 (right column) in the region of stratum pyramidale of each CA region. KCa3.1 immunolabel is detected at a light level in the somatic region of CA1 pyramidal cells (a) but is virtually absent from CA2 pyramidal cells (b). KCa3.1 immunolabel in both regions is expressed at higher immunofluorescent intensity in cell bodies and proximal dendrites of select (putative interneurons) positioned within or adjacent to stratum pyramidale (arrows). c, d KCa3.1 immunolabel is detected at higher levels in the cell bodies and proximal apical dendrites

of CA3 pyramidal cells (c) and at the highest relative level in CA4 pyramidal cells (d). e Cell bodies of granule cell bodies in the dentate gyrus (DG) exhibit KCa3.1 immunolabel at detectable levels, along with a diffuse or punctate KCa3.1 label in the dentate molecular layer. KCa3.1 immunolabel is highly expressed in hilar interneurons and dendrites projecting into the molecular layer of dentate gyrus (arrows). f Dual labeling indicates KCa3.1 protein expression in GABAergic hilar interneurons. b, e, f Dashed lines identify boundaries of cell layers. Scale bars = 20 μm

Pflugers Arch - Eur J Physiol

We previously reported the expression of KCa3.1 potassium channels in cerebellar Purkinje cells [17]. An example of a Purkinje cell and proximal dendrites revealed through a calbindin counterlabel is shown in Fig. 6a–c. KCa3.1 label was detected at the level of the soma and over restricted segments of the thick proximal shaft of Purkinje cell dendrites. A punctate pattern of label was apparent over sections of secondary dendritic trunks, although any association of label with tertiary dendritic branches or dendritic spines was not

confirmed (Fig. 6b, c). Molecular layer interneurons were also positive for KCa3.1 immunolabel, with strong label in the cell bodies and at least proximal processes of basket cells immediately adjacent to the Purkinje cell layer (Fig. 6b, c). Stellate cells in the outer third of the molecular layer were KCa3.1 immunopositive, but with only a light label detected in the somatic region (Fig. 6d). A light level of KCa3.1 expression demarked the outer perimeter of granule cell somata (Fig. 6e). Weak to strong labeling was detected in individual Golgi cells within the granule cell layer identified in GAD-67-GFP mice, with label apparently restricted to the somatic region and not the large dendritic tree that can extend into the molecular layer. Some of the most distinct KCa3.1 immunolabel was found in large diameter presumed excitatory cells of deep cerebellar nuclei, one of the principal output cells of the cerebellum. Here KCa3.1 immunolabel could be detected as a distinct plasma membrane-like signal around the perimeter of the soma and over extended lengths of individual dendrites (Fig. 6f). KCa3.1 immunolabel could also be detected on at least some number of smaller diameter GABAergic cells in tissue sections from GAD-67 mice (Fig. 6h). The ability to use the GAD-67-GFP mouse line to counterlabel the entire Purkinje cell structure of soma, dendrites, and axons allowed for closer inspection of any KCa3.1 immunolabel on axon tracts or terminal boutons. Here the GFP signal associated with GAD-67 expression clearly distinguished Purkinje cell axons coursing through the granule cell layer before coalescing in the white matter bundles that

Fig. 5 KCa3.1 immunolabel in thalamic neurons. Shown are dual immunolabel images for the indicated cellular markers (left) and KCa3.1 (right). a–c KCa3.1 immunolabel is detected in MAP-2-positive relay neurons (a; mediodorsal nucleus) and GABAergic neurons in both the relay nuclei (b) and nRT (c). d, e MAP-2-positive neurons exhibit

immunolabel for KCa3.1 in both the medial habenula (MHb) (d) and lateral habenula (LHb) (e). f Consistent labeling of MAP-2-positive neurons in the paraventricular nucleus (PVP). Scale bars = 20 μm. nRT nucleus reticularis, MHb medial habenula, LHb lateral habenula, PVP paraventricular nucleus

Thalamus KCa3.1 immunolabel was detected in all major classes of neurons in thalamic nuclei. The cell bodies and at least proximal extensions of dendrites of relay cells could be distinguished (Fig. 5a), with particularly prominent label in cells of the medial geniculate nucleus. Counterlabeling for GABAergic neurons revealed KCa3.1 label in inhibitory cells within the relay nuclei (Fig. 5b) and in nuclear reticularis neurons (Fig. 5c). Epithalamic neurons exhibited immunolabel, with some of the most intense fluorescent signal in medial habenular neurons (Fig. 5d) that extended into the more sparsely distributed cell population of the lateral habenula (Fig. 5e). KCa3.1 label was further evident in neurons of the paraventricular nuclei (Fig. 5f). Cerebellum

Pflugers Arch - Eur J Physiol

Fig. 6 KCa3.1 immunolabel is selectively distributed in cerebellar cell classes. a–c Dual immunocytochemistry for calbindin (a) and KCa3.1 (b) reveals IKCa immunolabel on rat Purkinje cell somata (b, asterisk) and restricted segments of primary and secondary dendritic branches (b, arrows). Regions delineated by dashed boxes in a and b are expanded in c. d MAP-2-labeled stellate cells (green, arrows) exhibit KCa3.1 immunolabel (red). e–h KCa3.1 immunolabel (red) in tissue sections from GAD-67-GFP mice. e KCa3.1 label is detected on granule cell somata (small arrows) and as a diffuse label in a Golgi cell (open arrows). GAD-67-positive axons of Purkinje cells in the granule cell layer and adjacent white matter (wm, dashed line) are negative for

KCa3.1. f KCa3.1 (red) and GAD-67 (green) expressing Purkinje cell axons in the DCN. KCa3.1 label is detected as a punctate expression pattern around the cell body perimeter and along an extended length of dendrite (arrows), but not with GAD-67-labeled axons. g Magnified view of the somata of two large diameter DCN cells and GAD-67-positive Purkinje cell axon boutons. KCa3.1 label (red) appears as a distinct punctate label associated with the plasma membrane of DCN cells (filled arrows) but not with GFP-labeled axon boutons (open arrows). h KCa3.1 immunolabel (red) is associated with some GAD-67-GFP-labeled small diameter cells in the DCN. Scale bars = a, b, f, 20 μm; c–e, g, h 10 μm. wm white matter

Pflugers Arch - Eur J Physiol

project to the deep nuclei positioned at the base of the cerebellum. Counterlabeling with KCa3.1 antibody revealed the somata of granule and Golgi cells, but no labeling of Purkinje cell axons within the granule cell layer or white matter bundles (Fig. 6e). In the deep cerebellar nuclei, the axons and large diameter terminal boutons of Purkinje cells were also readily distinguished in GAD-67-GFP mice and were KCa3.1 negative. The lack of KCa3.1 immunolabel in Purkinje cell axon boutons could at times be entirely resolved when aligned adjacent to punctate KCa3.1 label present on the membranes of large diameter cells (Fig. 6g). Finally, clusters of smaller diameter GAD-67-GFP-labeled inhibitory neurons in the DCN exhibited variable levels of KCa3.1 immunolabel ranging from presumed negative to intensely positive (Fig. 6h). KCa3.1 vs KCa2.x immunolabel localization The distribution of immunolabel for each of the three isoforms of KCa2.x channels has been well characterized [13, 35, 55,

Fig. 7 KCa3.1 immunolabel distributes independently of the pattern for KCa2.x channels. a–c Shown are sets of dual immunolabel images for each of the KCa2.x channel isoforms in comparison to that of KCa3.1 in different brain regions. a KCa2.1 immunolabel shows a more extensive distribution in the hippocampal CA1 pyramidal cell body region compared to KCa3.1, with detectable overlap only apparent in a presumed interneuron (arrow). b KCa2.2 immunolabel is extensively distributed

56, 63]. Given that KCa3.1 channels are drawn from the same gene family (KCNN4) as KCa2.x (KCNN1-3) and share a calcium- and calmodulin-dependent activation process, we were interested in comparing their distribution patterns. In general, we found an equivalent pattern of expression and subcellular localization of KCa2.x channel immunolabel as previously reported. Direct comparisons of the distribution for each KCa2.x isoform with KCa3.1 consistently revealed an overlapping expression in many cell types but distinctly different subcellular localizations (Fig. 7). Thus, in the CA1 hippocampal region, KCa2.1 immunolabel can be detected at P20 in most cell bodies and many apical dendritic extensions of cells in the stratum radiatum. Dual immunolabeling for KCa3.1 instead shows a much more restricted pattern at the somatic level (Fig. 7a). In the neocortex, KCa2.2 immunolabel is found in cell somata and both apical and basilar dendritic extensions of the majority of cells in layer V (Fig. 7b). This labeling contrasts again with a restricted localization of KCa3.1 immunolabel to the cell body region.

over the soma and both apical and basilar dendritic processes of cortical neurons, while KCa3.1 immunolabel is restricted primarily to the cell body region. c KCa2.3 immunolabel in dentate gyrus granule cells distributes in a manner distinct from KCa3.1 immunolabel, with a putative interneuron positioned at the border of the hilar region indicated by the arrow. Scale bars = 20 μm

Pflugers Arch - Eur J Physiol

Similarly, KCa2.3 and KCa3.1 immunolabel exhibit little evidence of colocalization in dual immunolabel images (Fig. 7c). Together these data confirm the specificity of the KCa3.1 antibody as shown in control tests (Fig. 1) and indicate different patterns of localization of respective immunolabel and presumably protein at the subcellular level. Identifying KCNN4 promoter activity To obtain a second measure of KCa3.1 expression, we created a transgenic mouse that enabled GFP expression tied to the promoter of KCa3.1 (KCNN4-GFP), allowing GFP expression to be used to identify cells with recent KCNN4 promoter activity (see “Materials and methods”) (Fig. 8a). The transgenic line was constructed using a BAC transgene with the synthesized reporter element GFP inserted immediately downstream of the translation initiation site of the KCNN4 gene to enable KCNN4 promoter-dependent expression of GFP (Fig. 8a). Since GFP was linked to the KCNN4 promoter and not the KCa3.1 channel per se, we expect no effect on channel distribution patterns. Tissue sections were prepared from P20-30 KCNN4-GFP mice to compare the distribution of GFP label to that of KCa3.1 and MAP-2-labeled structures. We found that all brain regions in the KCNN4-GFP mouse exhibited normal Fig. 8 The distribution of KCNN4 promoter activity in a transgenic mouse line correlates with KCa3.1 immunolabel. a Map of a BAC transgene under the control of the KCNN4 gene promoter to identify cells by GFP fluorescence. b Dual label images of MAP-2 immunolabel (red) and KCNN4-GFP (green) in the CA1 hippocampal cell body layer in the KCNN4-GFP mouse. c Dual label images of IKCa immunolabel (red) in relation to cells labeled for GFP-KCNN4 promoter activity (green) in the CA1 region. Arrows indicate a blood vessel positive for both KCa3.1 immunolabel and GFP expression, confirming KCa3.1 expression in endothelial cells. Scale bars = b 20 μM, c 50 μm

structure, with GFP expression appearing in most cells as a punctate or granular label within the nucleus or somatic region (Fig. 8b). A comparison of KCNN4-GFP and MAP-2 immunolabel revealed a close correspondence of GFP expression in neurons, with no visible labeling of nonneuronal (i.e., microglial) cell types (Fig. 8b). MAP-2 immunolabel also emphasized the relative restriction of GFP label to the somatic compared to dendritic regions of most neurons, as predicted for a fluorescent indicator of KCNN4 promoter activity as compared to KCa3.1 protein distribution. A comparison between KCNN4-GFP and KCa3.1 immunolabel further revealed a close correspondence of GFP expression to neuronal cell types previously identified as KCa3.1 positive, with additional confirmation of KCa3.1 expression in endothelial cells of blood vessels (Fig. 8c). While KCNN4-GFP expression and both KCa3.1 and MAP-2 labeling suggested almost one-to-one correspondence, we note that individual cells in a population could exhibit different intensities of GFP fluorescent signal, potentially indicating a variable degree of KCNN4 promoter activity in a cell population (Fig. 8b, c). KCNN4-GFP expression pattern In the hippocampus, KCNN4-GFP expression closely reproduced KCa3.1 labeling in identifying pyramidal cells

Pflugers Arch - Eur J Physiol

and putative interneurons as determined using dual label for MAP-2 (Fig. 8b) or KCa3.1 (Fig. 8c), with detectable GFP expression in all CA1–CA4 pyramidal cell populations. KCNN4-GFP expression was also detected in dentate gyrus granule cells and interneurons, with punctate GFP fluorescence in the cell body region. In the neocortex, GFP labeling was detected in the cells of all layers, with punctate labeling of presumed Betz cells in layer V that corresponded well with that of a KCa3.1 counter immunolabel (Fig. 9a). KCNN4GFP expression was readily detected in thalamic relay cells as confirmed with MAP-2 labeling (Fig. 9b). Labeling for

KCNN4-GFP expression was more pronounced in cerebellar neurons, where GFP expression labeled the nuclear and somatic cytoplasmic regions and in some Purkinje cells extended as a fluorescent label detectable in at least proximal dendritic regions (Fig. 9c). GFP expression could also be reliably detected in granule, basket, and stellate cells (not shown). The reason for a more extended distribution of KCNN4-GFP label in Purkinje cells is unknown but cannot be taken as a direct indicator of the degree of KCa3.1 translation or protein distribution since the GFP signal is not linked to KCa3.1 protein. Finally, GFP expression indicating KCNN4 promoter activity

Fig. 9 The distribution of KCNN4 promoter activity in cortical and cerebellar structures matches KCa3.1 immunolabel. Shown are dual images of the indicated labels in the cortex (a), thalamic relay nucleus (b), cerebellar cortex (c), and deep cerebellar nuclei (d) in relation to GFP expression tied to KCNN4 promoter activity. a KCa3.1 immunolabel of cortical cell bodies are associated with KCNN4 promoter activity. b Numerous thalamic relay cells revealed by MAP-2 immunolabel are

GFP-KCNN4 positive. c Calbindin immunolabel in cerebellar Purkinje cells indicates somatic GFP-KCNN4 promoter activity and presumed diffusion of GFP to proximal dendritic regions (small arrows). d MAP2-labeled small diameter DCN cells (open arrows) and large diameter DCN cells are GFP positive for KCNN4 promoter activity. Scale bars = 20 μm

Pflugers Arch - Eur J Physiol

was detected in both small and large diameter DCN cells (Fig. 9d).

Discussion The expression pattern and function of KCa3.1 channels have been extensively examined in nonneuronal cells, but support for neuronal expression of KCa3.1 channels has been growing, with one or more molecular, immunocytochemical, or electrophysiological lines of evidence obtained in sensory cells of the peripheral and autonomic nervous systems [21, 43, 46, 47, 69], retina [43], and some motoneurons [14, 43]. KCa3.1 expression and insertion in the plasma membrane of rat cerebellar Purkinje cells was also recently established through a series of molecular and electrophysiological measures [17]. The current study now reports that KCa3.1 immunolabel and KCNN4 promoter activity indicative of mRNA transcription are in fact expressed in a wide range of central neurons and differentially expressed across cellular and subcellular regions. These results are important in identifying the expression of a new class of calcium-gated potassium channel that is available to control the excitability of central neurons.

no apparent evidence for KCa3.1 expression in brain tissue [28, 30, 31, 40]. The validity of KC3.1 immunolabel determined in the present study was supported by detecting KCNN4 promoter activity and, thus, mRNA transcription by the expression pattern of GFP tied to KCNN4 promoter activity in a transgenic mouse line. These results are also in line with at least a scattered mRNA signal for KCa3.1 in the cell body layers of the cortex, hippocampus, and cerebellum reported through in situ hybridization in the Allen Brain Atlas (http://mouse.brain-map.org/gene/show/16307) [38]. However, our detected expression pattern for KCNN4 promoter activity and KCa3.1 protein expression was much more extensive than suggested in the atlas, presumably reflecting the relative specificity of the probes used against different potential isoforms of KCa3.1 channels. In this regard, different isoforms of KCa3.1 have been reported in various body tissues (i.e., rat colon vs spleen) [6, 50]. Since the full sequence of KCa3.1 expressed in central neurons has not yet been determined, it is not possible to specifically identify which isoform(s) the D-5 antibody serves to localize or if additional patterns of distribution will become apparent with further development of antibodies to specific isoforms. KCa3.1 subcellular expression pattern

Localizing KCa3.1 expression The relevance of any reported immunocytochemical distribution pattern depends on the specificity of antibody used to detect immunolabel. Here the distribution and expression patterns of KCa3.1 immunolabel were determined using a monoclonal antibody developed against amino acids 308– 427 of the C-terminus of human KCa3.1 (Santa Cruz). A key positive control was the consistent labeling of endothelial cells lining cerebral blood vessels for KCa3.1 immunolabel [57]. KCa3.1 immunolabel was also readily observed in Iba-1labeled microglia of hippocampal cultures even though it could not be detected in intact tissue. These results are consistent with an upregulation of KCa3.1 channels in microglia or astrocytes in response to numerous forms of stress or cell damage [14, 15, 33, 34, 59, 64]. Conversely, the lack of KCa3.1 immunolabel in microglia in intact tissue sections suggests that the neuronal KCa3.1 labeling detected here reflects a normal baseline expression in the absence of any damage imposed by histological preparation. The D-5 KCa3.1 monoclonal antibody detected a band on Western blots from brain lysate at ~47 kDa, a molecular weight consistent with KCa3.1 protein. A series of controls established that this did not correspond to rat or mouse KCa2.x potassium channel isoforms, including a short variant of KCa2.2 channels that reportedly appeared in one study in the ~49-kDa range on Western blots [44]. Initial cloning studies identified one sequence for KCa3.1 in T lymphocytes, human pancreas, and human placenta, with

The data presented here provide evidence that KCa3.1 channels are expressed in CNS neurons, but differentially in excitatory and inhibitory neurons, and according to distinct regional, celltype specific, and subcellular distribution patterns. In general, KCa3.1 immunolabel presented as a diffuse cytoplasmic label at the somatic level of neurons, but with a plasma membranelike label suggestive of membrane insertion of KCa3.1 channels in some cases (i.e., large diameter deep cerebellar nuclear cells). The functional roles of KCa3.1 channels continue to be elucidated, with reports that KCa3.1 channels can also be associated with at least inner mitochondrial membranes in colon cells [16]. Thus, the cytoplasmic-like KCa3.1 immunolabel found here could correspond to KCa3.1 protein targeted to regions other than the plasma membrane. The expression of KCa3.1 channels in both excitatory and inhibitory neurons was supported by immunolabel in both GAD-GFP-negative and GAD-GFP-positive cell types in principal output cells and inhibitory interneurons in the neocortex, stratum pyramidale of the hippocampus, and the nRT. KCa3.1 immunolabel was found primarily at the somatic level in most excitatory neurons with differences in the relative intensity of immunofluorescent label for cells around the CA regions of the hippocampus or between cortical regions. A comparatively intense label was detected in the epithalamic MHb and LHb nuclei as compared to dorsal and ventral regions of thalamic relay nuclei and in the medial geniculate nuclei. Little if any label was detected on either apical or basilar dendrites of cortical neurons, with the exception of

Pflugers Arch - Eur J Physiol

presumed excitatory cells in the subiculum, where segments of MAP-2-labeled processes were positive for KCa3.1 immunolabel throughout the stratum radiatum and stratum lacunosum-moleculare. In contrast, a prominent and even continuous plasma membrane-like label was apparent on extended segments of dendrites of large diameter presumed excitatory cells in the cerebellar nuclei. KCa3.1 immunolabel could often be detected at the soma and over more extended lengths of dendrites of several inhibitory cell types, as determined by close inspection of labeling for GABA or GAD-GFP. KCa3.1 immunolabel was detected on presumed interneurons at especially high intensity in each of the hippocampal CA regions and dentate gyrus. Here immunolabel served to highlight relatively large diameter cells within or adjacent to the stratum pyramidale and, at times, portions of dendrites over some distance from the cell body region. Dentate gyrus hilar interneurons were especially prominent, with intensely labeled dendrites projecting up through the granule cell layer. In neocortical regions, KCa3.1 immunolabel on inhibitory cells was more variable, with GAD-67-GFP-positive cells that were either positive or negative for KCa3.1 (Fig. 3c, d). In the cerebellar cortex, KCa3.1 immunolabel was reliably detected in GABAergic Purkinje cells at the soma and over discrete regions of the primary and secondary branches and was particularly clear at the soma and proximal dendrites of basket cells near the Purkinje cell layer. Less prominent or detectable KCa3.1 label characterized stellate cells in the molecular layer, indicating regional differences in the extent of KCa3.1 immunolabel among similar classes of GABAergic interneurons. A consistent finding was the lack of KCa3.1 immunolabel in axon tracts in any of the regions examined here, including the alveus, the mossy fiber projection of the hippocampus, or in other regions of dense axonal termination (i.e., layers I–II or IV of the neocortex). A particularly clear distinction was gained in the cerebellum where individual axons of Purkinje cells could be resolved within the prominent white matter tracts in a GAD-GFP mouse line that were all KCa3.1 negative. Similarly, no KCa3.1 label was found in Purkinje cell axon boutons which could be visualized in the GAD-GFP knock-in mouse adjacent to deep cerebellar nuclear neurons. KCa3.1 and KCa2.x expression patterns Similar molecular structure and calcium sensing mechanisms of KCa3.1 and KCa2.2 channels warrant a comparison between the relative expression patterns of these calciumsensitive potassium channels. In some cases, the pattern of KCa3.1 immunolabel in somatic or dendritic regions was similar to that of KCav2.x isoforms, including labeling of somatic membranes of neocortical pyramidal cells by KCa3.1 or KCa2.2 [56]. However, in general, there were significant differences in the distribution of KCa3.1 vs

KCa2.x immunolabel even within the same cell population. For instance, the near lack of KCa3.1 labeling of neocortical cell dendrites differs from KCa2.1 labeling of dendritic processes in the neocortex [55] and a prominent band of KCa2.2 immunolabel of pyramidal cell bodies and proximal dendrites in layer V [55, 63]. In the hippocampus, KCa3.1 immunolabel was virtually absent in the stratum oriens and only detected as a sparsely distributed label on dendrites in the stratum radiatum. This pattern contrasts with KCa2 channel distribution where KCa2.1 label is reportedly lacking in the CA1–CA3 pyramidal cell body layers, with KCa2.2 labeling shifting with age from pyramidal cell somata to dendrites in both the stratum oriens and stratum radiatum [5]. Similarly, a restricted pattern of KCa3.1 immunolabel on short segments of Purkinje cell dendrites in the proximal molecular layer differs from KCa2.2 channel immunolabel reported to occur at the soma and throughout the dendritic tree of Purkinje cells [9, 55]. Finally, KCa2.3 labeling is reportedly high in hippocampal mossy fibers but is lacking in the CA3 pyramidal cell layer [55], while KCa3.1 immunolabel exhibits the opposite pattern of being detected in CA3 pyramidal cell somata but not mossy fibers. These comparisons are important in revealing that the pattern of KCa3.1 immunolabel contrasts in almost every case with that reported for KCa2.x channel proteins, indicating an independent if not complementary localization between these four isoforms of calcium-dependent potassium channel. KCa3.1 functional roles The functional roles for KCa3.1 channels have been thoroughly examined in numerous nonexcitable cells in the process of promoting secretion, cell motility, proliferation, and calcium influx (reviewed in [7, 8, 29, 74]). The role for KCa3.1 in excitable cells has been explored in the vascular and autonomic systems. In endothelial cells, KCa3.1 channels communicate a membrane hyperpolarization to smooth muscle cells through endothelial extensions in the internal elastic lamina [37]. In enteric and myenteric neurons, the expression of KCa3.1 channels has been verified through a battery of molecular, electrophysiological, and pharmacological tests that indicate a key role for KCa3.1 channels in generating an apamininsensitive slow AHP that regulates spike output [46, 47, 70]. Another recent study established that a calciumdependent AHP of ~250 ms duration evoked by parallel fiber synaptic input in cerebellar Purkinje cells is driven by KCa3.1 channels [17]. In Purkinje cells, KCa3.1 channels serve the important role of suppressing temporal summation of parallel fiber EPSPs during repetitive input, functionally establishing a filter for background synaptic activity. Another role for KCa3.1 channels was reported for parotid acinar cells, where the N-terminal region of

Pflugers Arch - Eur J Physiol

KCa3.1 channels was shown to functionally block KCa1.1 channels, allowing cholinergic input to trigger a reciprocal oscillatory relationship between KCa3.1 and KCa1.1 activation [66]. The potential role for KCa3.1 channels in controlling the excitability of other central neurons has not yet been determined. Of interest is the fact that many central neurons also exhibit a long duration and apamin-insensitive slow AHP, the molecular identity of which has not been fully established [4] and that could incorporate KCa3.1 channel activation. The specific properties and ionic basis for this response can vary between cells [25, 26, 67, 68, 75] and, in some cases, exhibit a lack of sensitivity to the traditional KCa3.1 channel blocker ChTx [36, 76]. Most of the cell types identified here for KCa3.1 immunolabel exhibit a slow AHP, although the ability to draw a direct comparison is difficult in the absence of physiological tests. In fact, a low threshold spike-evoked slow AHP can be recorded in thalamic relay cells but not nRT cells [76] even though both cell types exhibit KCa3.1 immunolabel. The extent to which KCa3.1 channels might modify transmitter release is unknown, particularly given the apparent lack of KCa3.1 immunolabel on axons and terminal regions. However, a role for KCa3.1 channels in hormone release was shown in cultured mouse pituitary corticotrophs where KCa3.1 can regulate membrane excitability and ACTH secretion [39]. Identifying the functional roles for KCa3.1 channels may also need to address a remarkable capacity for KCa3.1 channels to exhibit up- or downregulation in response to stimuli that range from the induction of cell motility or proliferation to physical insults and biochemical cascades inherent to disease states [29, 41, 73]. Indeed, the upregulation of KCa3.1 has often been tied to further disruption of neuronal function, such that treatment with KCa3.1 blockers can provide substantial therapeutic benefit [14, 15, 33, 41, 73]. The full range of potential roles for KCa3.1 channels in central neurons awaits further investigation. Acknowledgments We gratefully acknowledge L. Chen for expert technical assistance, the generous preparation and donation of fixed GAD67-GFP knock-in mouse brains by J-C. Lacaille and I. Laplante (Université de Montréal, Canada) originally supplied by Y. Yanagawa (Gunma University, Japan), and D.E. Rancourt and F.R. Jirik for advice in the design of a BAC construct. This work was supported by operating grants from the Canadian Institute of Health Research (R.W.T., G.W.Z.) and a studentship through Alberta Innovates—Health Solutions (AI-HS) (M.T.). R.W.T. and G.W.Z. are AI-HS Scientists and G.W.Z. holds a Canada Research Chair.

References 1. Adelman JP, Maylie J, Sah P (2012) Small-conductance Ca2+ −activated K+ channels: form and function. Annu Rev Physiol 74: 245–269. doi:10.1146/annurev-physiol-020911-153336

2. Akakin D, Sirvanci S, Gurbanova A, Aker R, Onat F, San T (2011) Ultrastructural GABA immunocytochemistry in the mossy fiber terminals of Wistar and genetic absence epileptic rats receiving amygdaloid kindling stimulations. Brain Res 1377:101–108. doi:10.1016/ j.brainres.2010.12.066 3. Allen D et al (2011) The SK2-long isoform directs synaptic localization and function of SK2-containing channels. Nat Neurosci 14: 744–749. doi:10.1038/nn.2832 4. Andrade R, Foehring RC, Tzingounis AV (2012) The calciumactivated slow AHP: cutting through the Gordian knot. Front Cell Neurosci 6:47. doi:10.3389/fncel.2012.00047 5. Ballesteros-Merino C et al (2012) Developmental profile of SK2 channel expression and function in CA1 neurons. Hippocampus 22: 1467–1480. doi:10.1002/hipo.20986 6. Barmeyer C, Rahner C, Yang Y, Sigworth FJ, Binder HJ, Rajendran VM (2010) Cloning and identification of tissue-specific expression of KCNN4 splice variants in rat colon. Am J Physiol Cell Physiol 299:C251–C263. doi:10.1152/ajpcell.00091.2009 7. Bednarczyk P (2009) Potassium channels in brain mitochondria. Acta Biochim Pol 56:385–392 8. Begenisich T et al (2004) Physiological roles of the intermediate conductance, Ca2+−activated potassium channel Kcnn4. J Biol Chem 279:47681–47687. doi:10.1074/jbc.M409627200 9. Belmeguenai A et al (2010) Intrinsic plasticity complements longterm potentiation in parallel fiber input gain control in cerebellar Purkinje cells. J Neurosci 30:13630–13643. doi:10.1523/ JNEUROSCI.3226-10.2010 10. Benhassine N, Berger T (2005) Homogeneous distribution of large-conductance calcium-dependent potassium channels on soma and apical dendrite of rat neocortical layer 5 pyramidal neurons. Eur J Neurosci 21:914–926. doi:10.1111/j.1460-9568. 2005.03934.x 11. Berkefeld H, Fakler B, Schulte U (2010) Ca2+−activated K+ channels: from protein complexes to function. Physiol Rev 90:1437– 1459. doi:10.1152/physrev.00049.2009 12. Boettger MK et al (2002) Calcium-activated potassium channel SK1and IK1-like immunoreactivity in injured human sensory neurones and its regulation by neurotrophic factors. Brain 125:252–263 13. Bond CT et al (2004) Small conductance Ca2+−activated K+ channel knock-out mice reveal the identity of calcium-dependent afterhyperpolarization currents. J Neurosci 24:5301–5306. doi:10. 1523/JNEUROSCI.0182-04.2004 14. Bouhy D et al (2011) Inhibition of the Ca(2)(+)-dependent K(+) channel, KCNN4/KCa3.1, improves tissue protection and locomotor recovery after spinal cord injury. J Neurosci 31:16298–16308. doi: 10.1523/JNEUROSCI.0047-11.2011 15. Chen YJ, Raman G, Bodendiek S, O’Donnell ME, Wulff H (2011) The KCa3.1 blocker TRAM-34 reduces infarction and neurological deficit in a rat model of ischemia/reperfusion stroke. J Cereb Blood Flow Metab 31:2363–2374. doi:10.1038/jcbfm.2011.101 16. De Marchi U et al (2009) Intermediate conductance Ca2+−activated potassium channel (KCa3.1) in the inner mitochondrial membrane of human colon cancer cells. Cell Calcium 45:509–516. doi:10.1016/j. ceca.2009.03.014 17. Engbers JDT et al (2012) Intermediate conductance calciumactivated potassium channels modulate summation of parallel fiber input in cerebellar Purkinje cells. Proc Natl Acad Sci U S A 109: 2601–2606. doi:10.1073/pnas.1115024109 18. Ernst C, Christie BR (2006) Isolectin-IB 4 as a vascular stain for the study of adult neurogenesis. J Neurosci Methods 150:138–142. doi: 10.1016/j.jneumeth.2005.06.018 19. Fanger CM et al (1999) Calmodulin mediates calcium-dependent activation of the intermediate conductance KCa channel, IKCa1. J Biol Chem 274:5746–5754 20. Franklin KBJ, Paxinos G (2008) The mouse brain in stereotaxic coordinates. Elsevier, Amsterdam

Pflugers Arch - Eur J Physiol 21. Furness JB et al (2003) Expression of intermediate conductance potassium channel immunoreactivity in neurons and epithelial cells of the rat gastrointestinal tract. Cell Tissue Res 314:179–189. doi:10. 1007/s00441-003-0808-z 22. Furness JB et al (2004) Intermediate conductance potassium (IK) channels occur in human enteric neurons. Auton Neurosci 112:93– 97. doi:10.1016/j.autneu.2004.02.003 23. Gardos G (1958) The function of calcium in the potassium permeability of human erythrocytes. Biochim Biophys Acta 30:653– 654 24. Grossmann R, Stence N, Carr J, Fuller L, Waite M, Dailey ME (2002) Juxtavascular microglia migrate along brain microvessels following activation during early postnatal development. Glia 37:229–240. doi: 10.1002/glia.10031 25. Gulledge AT, Dasari S, Onoue K, Stephens EK, Hasse JM, Avesar D (2013) A sodium-pump-mediated afterhyperpolarization in pyramidal neurons. J Neurosci 33:13025–13041. doi:10.1523/ JNEUROSCI.0220-13.2013 26. Hu H, Vervaeke K, Storm JF (2007) M-channels (Kv7/KCNQ channels) that regulate synaptic integration, excitability, and spike pattern of CA1 pyramidal cells are located in the perisomatic region. J Neurosci 27:1853–1867. doi:10.1523/JNEUROSCI.4463-06.2007 27. Hu H et al (2001) Presynaptic Ca2+−activated K+ channels in glutamatergic hippocampal terminals and their role in spike repolarization and regulation of transmitter release. J Neurosci 21:9585– 9597 28. Ishii TM, Silvia C, Hirschberg B, Bond CT, Adelman JP, Maylie J (1997) A human intermediate conductance calciumactivated potassium channel. Proc Natl Acad Sci U S A 94: 11651–11656 29. Jensen BS, Strobaek D, Olesen SP, Christophersen P (2001) The Ca2+−activated K+ channel of intermediate conductance: a molecular target for novel treatments? Curr Drug Targets 2:401–422 30. Jensen BS et al (1998) Characterization of the cloned human intermediate-conductance Ca2+−activated K+ channel. Am J Physiol 275:C848–C856 31. Joiner WJ, Wang LY, Tang MD, Kaczmarek LK (1997) hSK4, a member of a novel subfamily of calcium-activated potassium channels. Proc Natl Acad Sci U S A 94:11013–11018 32. Kanazawa H, Ohsawa K, Sasaki Y, Kohsaka S, Imai Y (2002) Macrophage/microglia-specific protein Iba1 enhances membrane ruffling and Rac activation via phospholipase C-gamma-dependent pathway. J Biol Chem 277:20026–20032. doi:10.1074/jbc. M109218200 33. Kaushal V, Koeberle PD, Wang Y, Schlichter LC (2007) The Ca2+ −activated K+ channel KCNN4/KCa3.1 contributes to microglia activation and nitric oxide-dependent neurodegeneration. J Neurosci 27:234–244. doi:10.1523/JNEUROSCI.3593-06.2007 34. Khanna R, Roy L, Zhu X, Schlichter LC (2001) K+ channels and the microglial respiratory burst. Am J Physiol Cell Physiol 280:C796– C806 35. Klocker N, Oliver D, Ruppersberg JP, Knaus HG, Fakler B (2001) Developmental expression of the small-conductance Ca(2+)-activated potassium channel SK2 in the rat retina. Mol Cell Neurosci 17: 514–520. doi:10.1006/mcne.2000.0956 36. Lancaster B, Nicoll RA (1987) Properties of two calcium-activated hyperpolarizations in rat hippocampal neurones. J Physiol 389:187– 203 37. Ledoux J et al (2008) Functional architecture of inositol 1,4,5-trisphosphate signaling in restricted spaces of myoendothelial projections. Proc Natl Acad Sci U S A 105:9627–9632. doi:10.1073/pnas. 0801963105 38. Lein ES et al (2007) Genome-wide atlas of gene expression in the adult mouse brain. Nature 445:168–176. doi:10.1038/nature05453 39. Liang Z et al (2011) Control of hypothalamic-pituitary-adrenal stress axis activity by the intermediate conductance calcium-activated

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

51. 52.

53.

54.

55.

56.

potassium channel, SK4. J Physiol 589:5965–5986. doi:10.1113/ jphysiol.2011.219378 Logsdon NJ, Kang J, Togo JA, Christian EP, Aiyar J (1997) A novel gene, hKCa4, encodes the calcium-activated potassium channel in human T lymphocytes. J Biol Chem 272:32723–32726 Maezawa I, Zimin PI, Wulff H, Jin LW (2011) Amyloid-beta protein oligomer at low nanomolar concentrations activates microglia and induces microglial neurotoxicity. J Biol Chem 286:3693–3706. doi: 10.1074/jbc.M110.135244 Misonou H et al (2006) Immunolocalization of the Ca2+−activated K+ channel Slo1 in axons and nerve terminals of mammalian brain and cultured neurons. J Comp Neurol 496:289–302. doi:10.1002/ cne.20931 Mongan LC et al (2005) The distribution of small and intermediate conductance calcium-activated potassium channels in the rat sensory nervous system. Neuroscience 131:161–175. doi:10.1016/j. neuroscience.2004.09.062 Murthy SR et al (2008) Identification and characterization of a novel, shorter isoform of the small conductance Ca2+−activated K+ channel SK2. J Neurochem 106:2312–2321. doi:10.1111/j.1471-4159.2008. 05557.x Nagy A, Gertsenstein M, Vintersten K, Behringer RR (2003) Manipulating the mouse embryo: a laboratory manual, 3rd edn. Cold Spring Harbor Press, NY Neylon CB et al (2004) Intermediate-conductance calcium-activated potassium channels in enteric neurones of the mouse: pharmacological, molecular and immunochemical evidence for their role in mediating the slow afterhyperpolarization. J Neurochem 90:1414–1422. doi:10.1111/j.1471-4159.2004.02593.x Nguyen TV et al (2007) Effects of compounds that influence IK (KCNN4) channels on afterhyperpolarizing potentials, and determination of IK channel sequence, in guinea pig enteric neurons. J Neurophysiol 97:2024–2031. doi:10.1152/jn.00935.2006 Obermair GJ, Kaufmann WA, Knaus HG, Flucher BE (2003) The small conductance Ca2+−activated K+ channel SK3 is localized in nerve terminals of excitatory synapses of cultured mouse hippocampal neurons. Eur J Neurosci 17:721–731 Ohtsuki G, Piochon C, Adelman JP, Hansel C (2012) SK2 channel modulation contributes to compartment-specific dendritic plasticity in cerebellar Purkinje cells. Neuron 75:108–120. doi:10.1016/j. neuron.2012.05.025 Ohya S, Niwa S, Yanagi A, Fukuyo Y, Yamamura H, Imaizumi Y (2011) Involvement of dominant-negative spliced variants of the intermediate conductance Ca2+−activated K+ channel, K(Ca)3.1, in immune function of lymphoid cells. J Biol Chem 286:16940–16952. doi:10.1074/jbc.M110.184192 Paxinos G, Watson C (2007) The rat brain in stereotaxic coordinates. Elsevier, Amsterdam Pedarzani P, Stocker M (2008) Molecular and cellular basis of smalland intermediate-conductance, calcium-activated potassium channel function in the brain. Cell Mol Life Sci 65:3196–3217. doi:10.1007/ s00018-008-8216-x Pelucchi B, Grimaldi A, Moriondo A (2008) Vertebrate rod photoreceptors express both BK and IK calcium-activated potassium channels, but only BK channels are involved in receptor potential regulation. J Neurosci Res 86:194–201. doi:10.1002/jnr.21467 Rehak R, Bartoletti TM, Engbers JDT, Berecki G, Turner RW, Zamponi GW (2013) Low voltage activation of KCa1.1 current by Cav3-KCa1.1 complexes. PLoS One 8:e61844 Sailer CA, Kaufmann WA, Marksteiner J, Knaus HG (2004) Comparative immunohistochemical distribution of three smallconductance Ca2+−activated potassium channel subunits, SK1, SK2, and SK3 in mouse brain. Mol Cell Neurosci 26:458–469 Sailer CA et al (2002) Regional differences in distribution and functional expression of small-conductance Ca2+−activated K+ channels in rat brain. J Neurosci 22:9698–9707

Pflugers Arch - Eur J Physiol 57. Sandow SL, Neylon CB, Chen MX, Garland CJ (2006) Spatial separation of endothelial small- and intermediate-conductance calcium-activated potassium channels (K(Ca)) and connexins: possible relationship to vasodilator function? J Anat 209:689–698. doi:10. 1111/j.1469-7580.2006.00647.x 58. Si H et al (2006) Impaired endothelium-derived hyperpolarizing factor-mediated dilations and increased blood pressure in mice deficient of the intermediate-conductance Ca2+−activated K+ channel. Circ Res 99:537–544. doi:10.1161/01.RES.0000238377.08219.0c 59. Singh SK, O’Hara B, Talukder JR, Rajendran VM (2012) Aldosterone induces active K(+) secretion by enhancing mucosal expression of Kcnn4c and Kcnma1 channels in rat distal colon. Am J Physiol Cell Physiol 302:C1353–C1360. doi:10.1152/ajpcell.00216.2011 60. Stocker M (2004) Ca(2+)-activated K+ channels: molecular determinants and function of the SK family. Nat Rev Neurosci 5:758–770. doi:10.1038/nrn1516 61. Stocker M, Pedarzani P (2000) Differential distribution of three Ca(2+)-activated K(+) channel subunits, SK1, SK2, and SK3, in the adult rat central nervous system. Mol Cell Neurosci 15:476– 493. doi:10.1006/mcne.2000.0842 62. Stoneking CJ, Shivikumar O, Nicholson Thomas D, Colledge WH, Mason MJ (2013) Voltage dependence of the Ca2+−activated K+ channel KCa3.1 in human erythroleukemia cells. Am J Physiol Cell Physiol. doi:10.1152/ajpcell.00368.2012 63. Strassmaier T, Bond CT, Sailer CA, Knaus HG, Maylie J, Adelman JP (2005) A novel isoform of SK2 assembles with other SK subunits in mouse brain. J Biol Chem 280:21231–21236. doi:10.1074/jbc. M413125200 64. Strobaek D et al (2013) NS6180, a new K(Ca) 3.1 channel inhibitor prevents T-cell activation and inflammation in a rat model of inflammatory bowel disease. Br J Pharmacol 168:432–444. doi:10.1111/j. 1476-5381.2012.02143.x 65. Tamamaki N, Yanagawa Y, Tomioka R, Miyazaki J, Obata K, Kaneko T (2003) Green fluorescent protein expression and colocalization with calretinin, parvalbumin, and somatostatin in the GAD67-GFP knock-in mouse. J Comp Neurol 467:60–79. doi:10. 1002/cne.10905 66. Thompson J, Begenisich T (2006) Membrane-delimited inhibition of maxi-K channel activity by the intermediate conductance Ca2+ −activated K channel. J Gen Physiol 127:159–169. doi:10.1085/ jgp.200509457

67. Tzingounis AV, Nicoll RA (2008) Contribution of KCNQ2 and KCNQ3 to the medium and slow afterhyperpolarization currents. Proc Natl Acad Sci U S A 105:19974–19979. doi:10.1073/pnas. 0810535105 68. Tzingounis AVet al (2010) The KCNQ5 potassium channel mediates a component of the afterhyperpolarization current in mouse hippocampus. Proc Natl Acad Sci U S A 107:10232–10237. doi:10.1073/ pnas.1004644107 69. Vogalis F, Harvey JR, Furness JB (2002) TEA- and apamin-resistant K(Ca) channels in guinea-pig myenteric neurons: slow AHP channels. J Physiol 538:421–433 70. Vogalis F, Harvey JR, Neylon CB, Furness JB (2002) Regulation of K+ channels underlying the slow afterhyperpolarization in enteric afterhyperpolarization-generating myenteric neurons: role of calcium and phosphorylation. Clin Exp Pharmacol Physiol 29: 935–943 71. Wang J et al (2006) An improved recombineering approach by adding RecA to lambda Red recombination. Mol Biotechnol 32: 43–53 72. Wei AD, Gutman GA, Aldrich R, Chandy KG, Grissmer S, Wulff H (2005) International Union of Pharmacology. LII. Nomenclature and molecular relationships of calciumactivated potassium channels. Pharmacol Rev 57:463–472. doi:10.1124/pr.57.4.9 73. Wulff H, Castle NA (2010) Therapeutic potential of KCa3.1 blockers: recent advances and promising trends. Expert Rev Clin Pharmacol 3:385–396. doi:10.1586/ecp.10.11 74. Wulff H, Kolski-Andreaco A, Sankaranarayanan A, Sabatier JM, Shakkottai V (2007) Modulators of small- and intermediate-conductance calcium-activated potassium channels and their therapeutic indications. Curr Med Chem 14:1437– 1457 75. Zhang L, Kolaj M, Renaud LP (2010) Ca2+−dependent and Na+−dependent K+ conductances contribute to a slow AHP in thalamic paraventricular nucleus neurons: a novel target for orexin receptors. J Neurophysiol 104:2052–2062. doi:10.1152/ jn.00320.2010 76. Zhang L, Renaud LP, Kolaj M (2009) Properties of a T-type Ca2+ channel-activated slow afterhyperpolarization in thalamic paraventricular nucleus and other thalamic midline neurons. J Neurophysiol 101:2741–2750