Neuropathologic features of pontocerebellar hypoplasia type 6.

J Neuropathol Exp Neurol Copyright Ó 2014 by the American Association of Neuropathologists, Inc.

Vol. 73, No. 11 November 2014 pp. 1009Y1025

ORIGINAL ARTICLE

Neuropathologic Features of Pontocerebellar Hypoplasia Type 6 Jeffrey T. Joseph, MD, PhD, A. Micheil Innes, MD, Amanda C. Smith, PhD, Megan R. Vanstone, MSc, Jeremy A. Schwartzentruber, MSc, FORGE Canada Consortium, Dennis E. Bulman, PhD, Jacek Majewski, PhD, Ray A. Daza, PhD, Robert F. Hevner, MD, PhD, Jean Michaud, MD, and Kym M. Boycott, PhD, MD

Abstract Pontocerebellar hypoplasia is a group of severe developmental disorders with prenatal onset affecting the growth and function of the brainstem and cerebellum. The rarity and genetic heterogeneity of this group of disorders can make molecular diagnosis challenging. We report 3 siblings who were born to nonconsanguineous parents, were hypotonic at birth, developed seizures, had repeated apneic spells, and died within 2 months of life. Neuroimaging showed that all had profound cerebellar hypoplasia and simplified cortical gyration. Genetic analysis by whole-exome sequencing demonstrated compound heterozygous mutations in the mitochondrial arginyl transfer RNA synthetase gene RARS2, indicating that the children had pontocerebellar hypoplasia type 6. Autopsies on the younger twin siblings revealed small and immature cerebella at an approximate developmental age of less than 18 weeks. The basis pontis showed regressive changes, and the medulla had marked inferior olivary hypoplasia. The brains of both twins were microencephalic and had simplified gyri; cortices were immature, and deep white matter had extensive astrocytosis. The findings suggest a near-normal embryologic period followed by midgestation developmental slowing or cessation and later regression in select anatomic regions. This is the first detailed description of neuropathologic findings associated with pontocerebellar hypoplasia type 6 and demonstrates the profound effects of RARS2 disruption during early neurodevelopment.

From the Calgary Laboratory Services (JTJ) and Alberta Children’s Hospital Foundation Research Institute for Child and Maternal Health, Department of Medical Genetics (AMI), University of Calgary, Calgary, Alberta; Children’s Hospital of Eastern Ontario Research Institute, University of Ottawa, Ottawa, Ontario (ACS, MRV, FCC, DEB, JMichaud, KMB); and McGill University and Genome Quebec Innovation Center, Montreal, Quebec (JAS, JMajewski), Canada; Center for Integrative Brain Research, Seattle Children’s Research Institute, Seattle, Washington (RFH, RAD); and Department of Neurological Surgery, University of Washington, Seattle, Washington (RFH). Send correspondence and reprint requests to: Jeffrey T. Joseph, MD, PhD, Calgary Laboratory Services, Foothills Medical Center, 1403-29 St NW, Calgary, Alberta, Canada T2N2T9; E-mail: [email protected] This work was supported by funding to the FORGE Canada Consortium from the Government of Canada through Genome Canada, the Canadian Institutes of Health Research, and the Ontario Genomics Institute (Grant No. OGI-049) (to Kym M. Boycott). Additional funding was provided by Genome Quebec and Genome British Columbia (to Kym M. Boycott). Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the journal’s Web site (http://www.jneuropath.com).

Key Words: PCH6, Pontocerebellar hypoplasia, RARS2, Wholeexome sequencing.

INTRODUCTION Pontocerebellar hypoplasia (PCH) is a group of congenital brain malformations characterized by variable hypoplasia or atrophy of the cerebellar cortex, deep nuclei, accessory brainstem nuclei, pons, and cerebral cortex (1, 2). At least 10 forms of PCH are recognized (Table, Supplemental Digital Content 1, http://links.lww.com/NEN/A645); collectively, they are very rare. Most of the descriptions of PCH have been based on neuroradiologic findings; only a few detailed neuropathologic descriptions are available for a few subtypes of PCH (3) (Table, Supplemental Digital Content 1, http://links.lww.com/NEN/A645). The genetic basis of most subtypes has been identified, making possible prenatal testing for families with known mutations. More than half of patients with PCH have a common homozygous mutation in TSEN54 (p.A307S), and a further 8% of patients have other mutations in this gene. However, mutations in the other genes associated with PCH are rare contributors to the phenotype, with each accounting for approximately 1% of patients (3). The genetic heterogeneity and distribution of mutations for PCH make it challenging to arrive at a molecular diagnosis for a family because of the difficulty in identifying the most likely gene to test, the costly cascade of molecular investigations, and clinical access to funding for such testing. This paradigm is shifting dramatically with the advent of next-generation sequencing. At present, it is possible to sequence the complete genome of an individual in a matter of weeks and at a cost equivalent to sequencing almost equal to 10 average-sized genes by Sanger sequencing. A variation of this next-generation sequencing strategy is to sequence 1% to 2% of the genome that encodes proteins, termed whole-exome sequencing (WES), at substantially less cost (almost equal to 2Y3 average-sized genes by Sanger sequencing). Currently, WES has a well-established role in novel gene discovery (4), and its role in providing timely and cost-effective diagnoses of known rare disease genes is rapidly emerging. In this report, we describe a family in which 3 children, including female dizygotic twins, were born with significant neurodevelopmental malformations of both the cerebrum and posterior fossa structures, using magnetic resonance imaging.

J Neuropathol Exp Neurol Volume 73, Number 11, November 2014

Copyright © 2014 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.

1009


Joseph et al

Whole-exome sequencing identified compound heterozygous mutations in the RARS2 gene, which encodes mitochondrial arginyl transfer RNA (tRNA) synthetase, consistent with a diagnosis of PCH type 6 (PCH6) in this family (5). Here, we report the first detailed descriptions of the pathologic findings in PCH6 and highlight the utility of WES for the diagnosis of a rare disease.

MATERIALS AND METHODS Patients Three children (a boy and female dizygotic twins) born to healthy nonconsanguineous parents died of severe neurodevelopmental anomalies in the first 2 months of life. Despite diagnostic investigations, a molecular etiology for this presumed autosomal recessive disease was not forthcoming. Therefore, they were enrolled in the FORGE (Finding of Rare Disease Genes) Canada project, a nationwide effort using WES for molecular diagnosis and discovery of novel rare disease genes. Institutional Research Ethics Board approval for the FORGE Canada project was granted by the Children’s Hospital of Eastern Ontario, and informed consent was obtained from the parents. Total genomic DNA was extracted from blood following standard procedures. The first child was a male infant born at 41 weeks to a 32-year-old gravida 1 mother. The pregnancy was conceived via in vitro fertilization for male factor infertility. Ultrasounds at 18 and 20 weeks of gestational age both yielded normal results. Apgar scores were 4, 7, and 7; birth weight was 3,441 g; and occipitofrontal circumference (OFC) was 33.5 cm. On examination at delivery, he was not particularly dysmorphic but had a high arched palate and micrognathia. He was hypotonic and had a weak cry. He had adducted thumbs and was jittery. His clinical course was complicated by frequent cyanosis and seizures from an early age; in view of multiple CNS anomalies, a decision to involve palliative care was made. At 1 month of age, he had an apneic spell in the hospital and died. No autopsy was performed. A subsequent pregnancy was conceived via in vitro fertilization and resulted in female dizygous twins. Ultrasound examination at 18 weeks yielded normal results. A repeated ultrasound at 21 weeks was within the reference range; however, in light of the family history and on close inspection, the cerebella had undergone less-than-expected interval growth. At 25 weeks, both twins had clear cerebellar hypoplasia, which strongly supported recurrence of a familial neurogenetic disorder. The female twins were delivered vaginally at 37 weeks of gestational age with normal vertex presentation. Twin A had a birth weight of 2,550 g, an OFC of 31 cm, and Apgar scores of 4 and 9. She had a sloped forehead, micrognathia, adducted thumbs, and contractures of the knees. She developed seizures and apneic spells. A palliative care approach was adopted; she died at 2 months of age. Twin B had a birth weight of 2,281 g, an OFC of 30 cm, and Apgar scores of 4 and 9. She had micrognathia and adducted thumbs. Apneas began at 6 hours of life, and she also developed seizures. She was intubated on Day 2 of life for increasing apnea; she died at 5 weeks of age.

Investigations and Neuroimaging Investigations of the infants were undertaken in an attempt to arrive at a diagnosis for this family. Electroencephalographs

1010

for all 3 infants yielded very abnormal results and were consistent with diffuse encephalopathy. In one or more of the infants, karyotype, array CGH (60K), and transferrin isoelectric focusing yielded normal results; very-long-chain fatty acids, urine and plasma amino acids, and urine organic acids were within reference range. Given the cortical and pontocerebellar anomalies, a wide variety of single-gene disorders were considered. Sanger sequencing of CASK, TSEN54 (PCH2A/PCH4), TSEN2 (PCH2B), and TSEN34 (PCH3C) yielded normal results. Magnetic resonance images indicated a relatively uniform phenotype among these siblings. All of the infants were microcephalic and had coarse or simple cortical gyri, enlarged ventricles, and small cerebella on axial T1-weighted images (data not shown). The bright abundant subarachnoid cerebrospinal fluid (CSF) on coronal T2-weighted images indicated that the infants’ brains were small within the context of reduced OFCs, suggesting that they had undergone atrophy after an initial more-normal developmental period (Figs. 1AYC). On sagittal T1-weighted images, all 3 infants had very small vermes and abundant posterior fossa CSF (Figs. 1DYF). The pontine bases were small, more flattened caudally, and displaced anteriorly. The cingulate gyri appeared relatively normal, but the superior frontal gyri lacked tertiary folds. The corpus callosum was very thin and lacked a splenium.

Exome Sequencing Exome capture and high-throughput sequencing of DNA samples from the twins and their parents were performed at the McGill University and Genome Quebec Innovation Center (Montreal, Canada). Exome target enrichment was performed using the Agilent SureSelect 50 Mb All Exon Kit (V3), and sequencing (Illumina HiSeq) generated an average of 13.6 Gbp of 100-bp paired-end reads. The mean coverage of consensus coding sequence regions after removal of duplicate reads was 100 to 130 per sample. Eighty-six percent to 90% of consensus coding sequence region bases had higher than 20 coverage, and 94% to 96% had higher than 5 coverage in the patients and parents. Reads were quality trimmed from the 3¶ end, and sequences with fewer than 30 bases remaining were discarded. Remaining reads were aligned to hg19 using Burrows-Wheeler Aligner (6). Duplicate reads were marked using Picard (http://picard.sourceforge.net) and excluded. Single nucleotide variants and short insertions and deletions (indels) were called using SAMtools mpileup (7) and bcftools and qualityfiltered to require a minimal 20% of reads supporting the variant call. Variants were annotated using ANNOVAR (8) and custom scripts to select coding and splice-site variants and to exclude common (Q5% minor allele frequency) polymorphisms represented in the National Heart, Lung, and Blood Institute exome server (http://evs.gs.washington.edu/EVS), in the 1,000 genomes (http://www.1000genomes.org/), or in approximately 600 control exomes sequenced at our center. Given the presumed autosomal recessive mode of inheritance, only genes with homozygous or multiple heterozygous variants predicted to affect protein sequence were considered. The pathogenicity of candidate missense single nucleotide variants was predicted using SIFT (Sorting Intolerant From Tolerant; http://sift.bii.a-star.edu.sg/) and PolyPhen-2 (Polymorphism Phenotyping; http://genetics.bwh.harvard.edu/pph2/). Ó 2014 American Association of Neuropathologists, Inc.



Pontocerebellar Hypoplasia Type 6

FIGURE 1. Radiologic features of children affected with PCH6. T2-weighed coronal magnetic resonance images (AYC); T1-weighted sagittal magnetic resonance images (DYF). Each triple panel has the brother (A, D), Twin A (B, E), and Twin B (C, F). Each affected sibling had simplified gyri that lack significant secondary or tertiary gyration, although the cingulate gyri were distinct (AYC). The cerebella (CB) had a ‘‘butterfly’’ configuration characteristic of PCH. Each brain was separated from the skull by an abundant amount of CSF, which suggests atrophy after the skull had formed. In sagittal sections, each sibling had a diminutive cerebellar vermis surrounded by abundant CSF (DYF). The pons had a small dorsoventral width and bulged more superiorly than inferiorly. The cingulate gyrus (cc) had formed, but the corpus callosum (cc) was very thin and lacked a well-formed splenium.

Variant Validation Sanger sequencing was used to validate identified variants and to evaluate segregation in the family. Polymerase chain reaction and sequencing of the variants within the RARS2 gene were performed with the following intronic primers flanking exons 12 and 17, respectively: forward-5¶GG GTGGAATTCCTCAGGC3¶ reverse-5¶AGAAGTTGCCCACT TTAAACATAC3¶ and forward-5¶CCTCCACTGTGTATGGA TATTAAGG3¶ reverse-5¶TTTGGGAAAAGTCTAGAGGCAG3¶.

Neuropathologic Evaluation Twin A was aged at an equivalent of 45 weeks of gestational age at death; the postmortem interval was 2 days, and her brain was examined after 3 weeks of fixation. Twin B was aged at an equivalent of 42 weeks of gestational age at death; the postmortem interval was 24 hours, and her brain was examined after 1 week of fixation. Because of autopsy restrictions, neither spinal cord was removed or examined. Histochemical staining with hematoxylin and eosin (H&E), Luxol fast blue (LFB), and Nissl stains was performed using routine protocols. Immunostaining was performed on formalin-fixed paraffin-embedded tissue using the Leica Bond Polymer Refine Detection kit on a Leica Bond III platform. Antibodies used were as follows: synaptophysin (1:1000, NCL-SYNAP-299 mouse monoclonal antibody; Novocastra, Newcastle, United Kingdom), glial fibrillary acidic protein (GFAP; 1:2000, Z0334 rabbit polyclonal antibody; Dako, Carpinteria, CA), NeuN (1:200, MAB377 clone A60 mouse monoclonal antibody; Millipore, Billerica, MA), calretinin (1:200, 18-0211 rabbit polyclonal antibody; Invitrogen, Carlsbad, CA), PGP9.5 (1:250, mouse monoclonal antibody 10A1;

Novocastra), and vimentin (1:1600, clone V9 mouse monoclonal antibody; Dako).

Immunofluorescence Sections on slides were deparaffinized in xylene overnight and rehydrated in a series of alcohol. The rehydrated tissue sections were treated for antigen retrieval via boiling in 0.01 mol/L sodium citrate (pH 6.0) for 5 to 15 minutes. After being cooled on ice and rinsed in PBS, the sections were incubated in blocking solution (10% normal goat serum, 2% bovine serum albumin, and 0.1% Triton X-100 in PBS) for 30 minutes. The sections were then incubated with primary antibodies diluted in blocking solution for 1 or 2 days at 4-C. The primary antibodies were antiYcalbindin D28K (1:1000, rabbit polyclonal; Chemicon, Temecula, CA), anti-Map2 (1:500, rabbit polyclonal; Chemicon), anti-NeuN (1:1500, mouse monoclonal; Chemicon), and anti-GFAP clone GF2 (1:100, mouse monoclonal; Dako). The slides were rinsed and incubated with secondary antibodies diluted in blocking solution for 2 hours at room temperature. Alexa Fluor secondary IgG and IgG1 antibodies conjugated to various dyes were used (Molecular Probes, Eugene, OR). The slides were again rinsed and then treated with 0.1% Sudan Black in 70% ethanol for 30 minutes to block autofluorescence. After a brief destaining in 75% ethanol, sections were rinsed in PBS, counterstained with DAPI (Sigma, St Louis, MO) to label DNA with blue fluorescence, and coverslipped in Fluoromount-G (SouthernBiotech, Birmingham, AL). After overnight curing, fluorescence images were acquired using a Carl Zeiss Axio Imager Z1 microscope equipped with a motorized stage and MosaiX software (Zeiss). Confocal images were obtained using a Zeiss LSM710. Images were photographed digitally and processed using Photoshop

Ó 2014 American Association of Neuropathologists, Inc.


1011


Joseph et al

(Adobe, San Jose, CA) to optimize brightness, contrast, and resolution. NeuN expression correlates with a reduced mitotic index of neoplastic cells in central neurocytomas (9).

RESULTS Molecular Diagnosis DNA from the twins and both parents were analyzed using WES. Given the presumed recessive mode of inheritance in this family, all variants identified by WES were filtered to include only those that were homozygous or compound heterozygous (Table, Supplemental Digital Content 2, http://links.lww.com/NEN/A646). These recessive variants were then filtered for rarity (i.e. maintaining only those occurring at a frequency of G1%). The only remaining candidate variants shared by the dizygotic twins were identified in the RARS2 gene (NM_020320.3): c.997CYG and c.1432GYA, resulting in p.Arg333Gly and p.Gly478Arg, respectively. These variants were confirmed in the twins by Sanger sequencing. Each parent carried one of the variants, confirming that the children were compound heterozygotes (Fig. 2). The 2 variants identified in this family alter highly conserved residues and are predicted by SIFT (10) and PolyPhen (11) to be damaging. The molecular data, combined with the concordance between clinical presentation and factors reported to be associated with RARS2 mutations, confirmed PCH6 as the rare disease in this family (3, 5, 12Y14).

Neuropathologic Features of PCH6 External Cerebrum Both Twin A and Twin B were microencephalic (Twin A, 202 g [reference, 434 T 55 g]; Twin B, 151 g [reference, 395 T 55 g]). Cerebral cortices were simplified: They lacked tertiary and many secondary gyri, although most primary gyri had formed (superior, middle, and inferior frontal gyri; superior and middle temporal gyri) (Fig. 3). The occipital gyri were less distinct (Figs. 3A, B, D, F). The parietal lobes were the least developed; they were flattened rather than convex (Figs. 3B, F), compared with control (Fig. 3C), and lacked normal parietal divisions (e.g. superior and inferior lobules). Leptomeninges over the parietal lobe had increased vessels. Gyri were coarse; they were more rounded and had greater sulcal spaces compared with normal term-gestation brains (compare the superior and middle frontal gyri in Figs. 3B, E, F with Fig. 3C). The middle temporal sulcus was incomplete, and the middle and inferior temporal lobes remained partially fused. The presumed precentral and postcentral gyri were prominent in Twin B (Fig. 3E). The incomplete inferior temporal sulcus is a gyral pattern typical of a 30-week-gestation fetus, although the gyri were more mature than in a midgestation fetus (larger and more rounded, with deeper sulci) (15).

External Brainstem and Cerebellum The brainstem and especially the cerebellum manifested the most severe macroscopic changes (Fig. 4). The

FIGURE 2. Sanger sequencing of the RARS2 gene. Electropherograms showing the position of mutations in the father, in the mother, and in each of the twins (arrows). Nomenclature of all mutations was based on NM_020320.3. Mutation 1 (c.997CYG:p.Arg 333Gly) was found in the twins and in Parent 1. Mutation 2 (c.1432GYA:p.Gly478Arg) was also present in both twins and in Parent 2.

1012





FIGURE 3. External cerebral structure. The superior surfaces of Twin A (A) and Twin B (D) both showed a simplified gyral pattern. Gyri were more rounded than in a control brain from a 39-week-gestation newborn (C), and sulci were wider. In Twin B, these changes imparted a knobby appearance to the cortex. The major frontal gyri (superior, middle, and inferior) had formed in both twins, but the superior parietal lobe was concave and had a dense overlying plexus of leptomeningeal vessels. The right cortical superior lateral surface from Twin A (B) showed the sunken, poorly developed superior parietal lobule. The left superior lateral cortical surface from Twin B demonstrated the prominent precentral and postcentral gyri and the poorly developed superior parietal lobule (E). The right lateral cerebrum from Twin B (F) illustrated thinning of the superior temporal gyrus, incomplete separation of the middle temporal gyrus and inferior temporal gyrus, and considerable simplification of the frontal operculum (fop). ag, angular gyrus; ifg, inferior frontal gyrus; ipl, inferior parietal lobule; itg, inferior temporal gyrus; mfg, middle frontal gyrus; mtg, middle temporal gyrus; ol, occipital lobe; pocg, postcentral gyrus; prcg, precentral gyrus; sfg, superior frontal gyrus; smg, supramarginal gyrus; spl, superior parietal lobule; stg, superior temporal gyrus. Scale bar = 2 cm in all images.

brainstem and cerebellum were similar in Twins A and B (Figs. 4A, B). Cerebellar hemispheres were flattened stubs of tissue protruding off the brainstem (Figs. 4A, B, D, E; compare with the size of the age-matched control cerebellum in Fig. 4C). They lacked any foliation and showed only a slight indentation at the location of the primordial primary fissure (fpr in Fig. 4E; compare with a normal age-matched fpr control in Fig. 4F). There was a vermis (Fig. 4E); in the sagittal section of Twin B, it had developed rudimentary lobules with minimal foliation (compare the diminutive vermis with its simple folia in Fig. 4G with the fine arborization of the folia in the control brain in Fig. 4H). In correlation with the diminutive cerebellum, the pons was flattened rather than bulbous, especially caudally (Figs. 4A, B, D, G), but still retained its indentations at the medulla (pmj) and midbrain (ipc; best illustrated in Fig. 4G). The middle cerebellar peduncles connecting the pons and cerebellum were also shrunken (Fig. 4D), and no myelin was demonstrable in the region of the normal superior cerebellar peduncle decussation (midline in midbrain to the

right of Fig. 4G). The external cranial nerves (II, III, V, VII, and VIII) were extant and myelinated (Figs. 4A, B, D). In the sagittal section, faint myelin was present in the posterior columns (Fig. 4G). The ventral medullary surface had a longitudinal pyramid but lacked an inferior olivary bulge (Fig. 4D). The aqueduct was patent, and choroid plexus had formed (Fig. 4G). No inferior olivary nucleus (ION) bulge was identified in its normal position lateral to the pyramids.

Cerebellar Vermis The sagittal view of the cerebellar vermis provided detailed developmental information about Twin B (Fig. 5A). Although very simplified, comparison of this vermis with lobular designations by Larsell (16) and with the development sequence by Rakic and Sidman (17) indicated that all of the major lobules and their fissures had formed (Fig. 5A). Based on Figure 1 in Rakic and Sidman (17), the developmental age of this vermis was estimated to be between 16 and 20 weeks’ gestation. Of the 10 lobules, the nodulus was most mature



1013

Joseph et al


(enlarged in Figs. 5D, E); it had several folia that had an external granular layer (EGL), a molecular layer, a Purkinje cell layer (PC), and an internal granular layer (IGL). The Purkinje neurons were cytologically relatively normal, although the cell bodies were sometimes displaced from the

1014

normal single line (PC). In the nodulus, some calretininimmunoreactive neurons were present in the PC and also deeper in the IGL (brown staining in Fig. 5E). These deeper cells likely represent immature and incompletely migrated Purkinje neurons, although other neuron subtypes cannot be




excluded. Immunofluorescence with antibodies to calbindin confirmed the presence of Purkinje neurons (green fluorescence in Fig. 5F) and showed them to be in the correct position but slightly out of line, compared with a term-gestation vermis (Fig. 5G). Glial fibrillary acidic protein immunofluorescence staining revealed relatively normal Bergmann radial glial fibers (red fluorescence in Fig. 5F) compared with a control (Fig. 5G), and DAPI stains identified both external and internal granular neurons (blue nuclei in Figs. 5F, G above and below the green Purkinje neurons). Calbindin reactivity in Purkinje neuron dendritic trees was simplified, compared with the control (compare green arbors in Figs. 5F, G). Histologic development in fissure depths lagged behind that on the outer lobules (compare the fissures fpr, fppd, fsec, and fpl with the outer aspects of lobules fol, dec, and cul in Fig. 5A). For example, in the prepyramidal fissure, the cortex lacked any lamination, except for a single cell layer of external granular neurons (Fig. 5B). No cells had cytologic features of Purkinje neurons, although a few calretinin-positive neurons were scattered in deeper areas (Fig. 5C) (18). Despite its somewhat advanced development, the vermis histology lagged far behind that of normal term infants.

Cerebellar Hemispheres In contrast to the vermis, the cerebellar hemispheres lacked lobule formation or foliation (Figs. 4E, 6A, B). The hemispheres had a thin EGL (Figs. 6A, B, E) but lacked other definite layers in most stains. Synaptophysin immunostain demonstrated a thin molecular layer in the hemispheres (Fig. 6H, upper figure), whereas anti-NeuN antibody immuno reacted with sparse cells in the region of the IGL (Fig. 6C). The poorly developed hemispheric cortex contrasted with the much more advanced vermis, which had all 4 surface layers (EGL, M, PC, and IGL on synaptophysin immunostains in Fig. 6H). At higher magnification, H&E stain and antiGFAP immunoperoxidase identified an extensive gliotic reaction in the hemispheres (Figs. 6E, F). Only rare cells that were not in any definite layer were immunoreactive to calretinin 3 (red circle in Fig. 6G). Calbindin immunofluorescence confirmed the poor development of the hemisphere (contrast Fig. 6I from Twin B with Fig. 6J from a term-gestation control). A few Purkinje neurons had migrated to the surface (green calbindin-positive cells in Fig. 6I); nuclei of granular


neurons were present in the EGL (blue DAPI-stained nuclei). Bergmann radial glial fibers (red GFAP immunofluorescence in Fig. 6I) were disorganized, and few granular neurons had reached the IGL (blue DAPI staining below Purkinje neurons; compare with the control in Fig. 6J). In addition, the few Purkinje neurons were shrunken and had stubby proximal dendrites (Fig. 6I) compared with the fine dendritic arbor in the control (Fig. 6J). Transverse sections through the brainstem and cerebellum at the level of the abducens nucleus typically demonstrated a well-developed dentate nucleus in the deep cerebellar white matter (24-week-gestation control in Fig. 6D). In no section of the cerebellum from either twinVincluding transverse sections at the abducens nucleus level (Figs. 6A, B), other levels (Fig. 6C), and parasagittal sections from Twin B (data not shown)Vwere any dentate nuclei or other cerebellar nuclei demonstrable. A few NeuN-positive neurons were present in the deeper white matter (red circle in Fig. 6C); these likely represent the trigeminal mesencephalic nucleus.

Medulla Caudal medulla transverse microscopic sections in both twins revealed intact major nuclei (Figs. 7A, B; gracilis, cuneatus, spinal trigeminal [spV], and hypoglossal [xii]) and confirmed the presence of the pyramids (py). Similar to the gross sections, no surface olivary bulge (ion) was present lateral to the pyramids in either twin at any level (compare the region lateral to the pyramids of Twin A in Figs. 7A, E and of Twin B in Figs. 7C, D, F, G with the control medulla from a 24-week-gestation fetus in Fig. 7H); neither twin had formed an ION, with its normally prominent indentations and neuropil (e.g. in Fig. 7H). At higher magnification lateral to the pyramids, there were a few scattered neurons in Twin A (encircled red in Fig. 7E), which in Twin B were immunoreactive to calretinin (neurons circled red in Fig. 7G). In the region of the normal arcuate nucleus, ventral to the pyramids, no histologic area (large neuron clusters embedded in neuropil; Figs. 7A, C) or calretinin immunoreactivity (Fig. 7G) indicating the presence of this nucleus was demonstrable, although given the degeneration in the pontine base (Fig. 8), arcuate remnants cannot be excluded. The hypoglossal nerve (XII) exited through the pyramids (py) in both twins (Figs. 7A, C, F), rather than its usual exit lateral to the pyramids. No myelin

FIGURE 4. Posterior fossa structures. Inferior brain views of both Twin A (A) and Twin B (B) show similar minute cerebellar hemispheres in both twins as compared with a normal 39-week-gestation control (C). The brainstems were less affected and had visible cranial nerves II, III, V, VII, and VIII. This view also shows the simplified inferior temporal gyrus (itg), temporal-occipital gyrus (tog), and orbitofrontal cortex (ofc) in Twin B compared with the control. Closer view of the ventral (D) surface of Twin B demonstrated a small and more caudally narrowed pons, which nevertheless had myelinated cranial nerves (V, VII, and VIII). Cerebellar hemispheres were thin wings of tissue (cb-hem), and the middle cerebellar peduncle connecting the pons and cerebellum was sunken. The medulla had pyramids (py) but lacked demonstrable inferior olives. The dorsal view of Twin B (E) revealed the greatly simplified cerebellar hemispheres, with only a weak indentation of the primary fissure (fpr), especially when compared with the many distinct folia in the control cerebellum (F). Nevertheless, Twin B had a distinct cerebellar vermis (E). The sagittal section through the brainstem and cerebellum of Twin B demonstrated a greatly simplified cerebellar vermis with only rudimentary lobules (G) compared with the 39-week control (H). The hemisphere was diminutive and completely lacked folia. The pontine base was flattened, although indentations at the pontomedullary junction (pmj) and interpeduncular cistern (ipc) were present. Myelin was present in the posterior columns of the spinal cord (white band). cb-hem, cerebral hemispheres; cen, central lobule; cul, culmen; dec, declive; fol, folium; fpl, posterolateral fissure; fppd, prepyramidal fissure; gr, gyrus rectus; II, optic nerve; III, oculomotor nerve; IX, glossopharyngeal nerve; lin, lingula; med, medulla; nod, nodulus; pyr, pyramis; tub, tuber; uv, uvula; V, trigeminal nerve; VII, facial nerve; VIII, vestibulocochlear nerve; X, vagus nerve. Scale bars = (B, C) 2 cm. Ó 2014 American Association of Neuropathologists, Inc.


1015

Joseph et al

1016





had formed in the medial lemniscus (?ml in Fig. 7F) or in the inferior cerebellar peduncle (icp in Fig. 7D). Although myelinated axons were in the reticular formation (rf in Fig. 7F), they did not form the arcuate bundles connecting the posterior column nuclei to the medial lemniscus.

Pons In histologic sections, the basic structure of the pons had formed, but some specific structures were either nearly absent or greatly reduced (middle region of Twin A in Fig. 8A and 3 levels from Twin B in Figs. 8BYD). The flattened pontine base retained its layers of pontine nuclei (Fig. 8G, pontine) and interspersed corticopontine and corticospinal columns (Fig. 8G, CBT CST). Under higher magnification in both twins, however, few neurons remained in the pontine nuclear zones, either by basic histology (isolated neuron circled in Fig. 8H) or in calretinin immunoperoxidase stains (Fig. 8I, red circles), and the entire base displayed extensive gliosis (GFAP immunoreactivity in Fig. 8G and black arrows in Fig. 8H). Pontine-penetrating vessels in the sagittal view of the pontine base had greatly expanded Virchow-Robin spaces (VRS in Fig. 8F). At term, most major white matter tracts are normally myelinated, except for the descending cortical fibers and pontocerebellar fibers (19). In both postterm infants, the pattern of myelination was similar to that in fetuses in the second trimester. The major myelinated tracts included all of the cranial nerves (V in Figs. 8A, C; VI and VII in Fig. 8B), the medial longitudinal fasciculus (mlf in Figs. 8A, DYF), and both the spinal trigeminal tract (spV in Fig. 8B) and the trigeminal mesencephalic tract (mesV in Figs. 8D, E). AntiY myelin basic protein (MBP) immunoperoxidase staining in Twin B revealed sparse myelin in a greatly reduced superior cerebellar peduncle, medial lemniscus, lateral lemniscus, and central tegmental tract (scp, ml, ll, and ctt, respectively, in Fig. 8E). Major nuclei contributing to the cranial nerves and diffuse system (e.g. locus ceruleus, raphe nuclei, and dorsal tegmental nucleus) were identified (data not shown).

Midbrain The midbrain also retained its basic structure (Fig. 9). It had a patent aqueduct (aq in Figs. 9B, E), cerebral peduncles


(cp in Figs. 9A, B), tectal nuclei (inferior colliculus [ic] in Figs. 9A, B; superior colliculus [sc] in Fig. 9E), and several tegmental nuclei. The superior cerebellar peduncle normally begins to myelinate by 30 weeks’ gestation (19) and is a prominent medial white matter tract at term (scp in control; Fig. 9D). However, caudal sections from the affected twins had no superior cerebellar peduncle or its decussation (Figs. 9A, B). Gross sections had no large central ascending medial white matter tract (insets to Figs. 9A, E), and neither neurofilament immunostains (Twin A in Fig. 9C) nor MBP immunostains (Fig. 9F) revealed the superior cerebellar peduncle in the midbrain. The superior cerebellar peduncle normally has decussated and then separated at the level of the oculomotor nucleus (iii) and nerve (III) (control in Fig. 9D). In Twin B, the oculomotor nucleus was present (iii in Figs. 9E, G), and myelinated axons from the nerve swept over the top of the substantia nigra (sn) and exited ventrally (Figs. 9E, G). In this region, either the ascending superior cerebellar peduncle or the caudal red nucleus normally lies within the course of the oculomotor nerve (Fig. 9D). However, in Twin B, the distance between the nucleus (iii) and the substantia nigra (pbp/sn) was reduced, and neither superior cerebellar peduncle fibers nor red nucleus neurons were identified (Fig. 9G). No distinct red nucleus was identified in coronal sections through the thalamus, which included the rostral midbrain (data not shown).The midbrain had well-myelinated cranial nerves (III in Figs. 9E, F; IV in Figs. 9A, B) and their intact nuclei (iv in Fig. 9B; iii in Figs. 9E, G). The oculomotor nuclei were not well-separated compared with the normal (compare iii in Fig. 9E with normal in Fig. 9D). Myelin basic protein immunostain outlined the periaqueductal gray by its paucity of myelinated axons (pag in Fig. 9F). Clusters of substantia nigra neurons were extant in both twins at several levels (sn in Figs. 9B, C, E; pbp/sn in Fig. 9G); some medial raphe neurons were present at caudal levels (ra in Fig. 9C; caudal linear nucleus and median raphe not separated by scp). No well-formed ascending somatosensory tracts were identified in either LFB stains (Figs. 9A, E) or anti-MBP immunostains (Fig. 9F), although the presence of some axons was likely based on staining of the pons (ml in Fig. 8E). As in the pons, Virchow-Robin spaces in the midbrain were dilated (Fig. 9B).

FIGURE 5. Cerebellar vermis histology from Twin B. (A) The sagittal view of the entire cerebellar vermis has architectural designations that are based on Larsell (16). Although all of the primary fissures (fpr) and lobules had developed, the vermian foliation was very immature (compare with the age-matched control in Fig. 4H). The EGL (dark line of cells) was present around some folia surfaces (e.g. nodulus [nod], folium [fol], and declive [dec]), was minimal around others (e.g. lingula [lin] and tuber [tub]), and tended to be more prominent around the gyri than in the sulci (compare nod with the adjacent posterolateral fissure [fpl]). The rectangles indicated the magnified regions in (B), (D), and (E). (B, C) Close-up images of the fppd. This fissure had no internal granular neurons or cells with cytologic features of Purkinje neurons (B). Its pial surface had only a slight increase in cellularity in the EGL. The surrounding tissue was gliotic. No calretinin-positive cells form a coherent PC, although scattered deeper cells expressed this antigen in their cytoplasm (brown dots in red circles) (C). (D, E) Close-up images from a fol in the nod. In contrast to the fppd, the nod (D) had an EGL, a PC containing cytologic Purkinje neurons, and an IGL. Immunohistochemistry for calretinin showed weak labeling of the surface of mature Purkinje cells and strong labeling of the cytoplasm of deeper, presumably migrating neurons (brown dots in the IGL) (E). (F, G) The vermis from Twin B (F) contained misaligned but near-normal Purkinje cells expressing calbindin (green immunofluorescence), compared with the control vermis (G). Bergmann glia expressing GFAP (red immunofluorescence) were similar in Twin B and the control, and the EGL was visible in both (nuclei counterstained with DAPI [blue]). Stains: (A, B, D) H&E; (C, E) calretinin; (F, G) immunofluorescence with calbindin (green), GFAP (red), and DAPI (blue). cen, central lobule; cul, culmen; fh, horizontal fissure; fpc, preculminate fissure; fprc, precentral fissure; fps, posterior superior fissure; fsec, secondary fissure; ML, molecular layer; pyr, pyramis; uv, uvula. Ó 2014 American Association of Neuropathologists, Inc.


1017

Joseph et al


FIGURE 6. Cerebellar hemisphere histology. (AYC, EYI) Transverse sections through the cerebellar hemispheres from Twin A (A) and Twin B (B, C, EYI). (D) A control cerebellar hemisphere at a similar level from a 24-week-gestation fetus. (J) A control cerebellar cortex from a 40-week-gestation infant. The insets to (A) and (B) are field views from each hemisphere demonstrating that the sections were at the level of the abducens nucleus (vi) or abducens nerve (VI). Neither Twin A (A; Nissl/LFB stain) nor Twin B (B; H&E/LFB stain) showed any evidence of a dentate nucleus at this level (compare with the control fetal brain at the same level in D). (C) A more rostral NeuN-immunostained section of the deep hemisphere from Twin B at the level of the trigeminal motor nucleus. The red circle encloses scattered positive neurons; those closest to the ventricle are from the mesencephalic nucleus of the trigeminal, whereas the cells farther from the ventricle are of uncertain histogenesis. Sparse internal granular neurons also immunoreact with NeuN (IGL). The superficial region of the cerebellar hemisphere in Twin B (small box in B) had some surface external granular neurons (top of figures EYH) but lacked other features of cerebellar folia. The parenchyma was extensively gliotic (E, H&E stain; F, GFAP immunoperoxidase stain) and had no cytologic Purkinje neuron layer (E). Rare deeper neurons immunoreact with calretinin (G; circled). Synaptophysin immunoperoxidase from the hemisphere (H; upper figure) revealed mainly a thin molecular layer (M), which contrasted with the much thicker one and more advanced layering in the vermis (H; lower figure). Cerebellar cortical immunofluorescence from Twin B (I) revealed only occasional atrophic Purkinje neurons (calbindin [green]) that lacked well-developed dendrites, had poorly developed Bergmann glia (GFAP stained red above the Purkinje neurons), and few internal granular neurons (DAPI-stained blue nuclei below the Purkinje neurons). In comparison, the cerebellar hemisphere of a control 40-week-gestation infant (J) contained highly branched Purkinje cells expressing calbindin (green), abundant radially oriented Bergmann glia expressing GFAP (red), and a dense IGL (DAPI-stained blue nuclei below Purkinje neurons). Stains: (A) Nissl/LFB; (B, E) H&E/LFB; (C) NeuN; (D) H&E; (F) GFAP; (G) calretinin; (H) Synaptophysin; (I, J) immunofluorescence for calbindin (green) and GFAP (red), with nuclei stained blue with DAPI. dn, dentate nucleus; e/g, emboliform-globus nuclei; spV, spinal trigeminal nucleus; VII, facial nerve.

Diencephalon and Telencephalon Similar to the brainstem, the basic structure of the diencephalon and telencephalon was intact in both twins, although some specific structures either retained an immature

1018

state or showed regressive changes (Fig. 10). The thalami (th) and hypothalami were extensively fused in the midline in both twins (Twin A in Fig. 10B and Twin B in Fig. 10E), which reduced the third ventricle (v3) to a slit (compare with the Ó 2014 American Association of Neuropathologists, Inc.




FIGURE 7. Medulla histology. (A, E) The caudal medulla of Twin A. (BYD, F, G) The caudal, middle, and rostral medulla of Twin B. (H) From a 24-week-gestation fetal control at a level similar to (A), (C), (E), (F), and (G). Boxes in (A) and (C) are regions enlarged in (E) to (G). In Twin A, the medulla had a hypoglossal nerve (XII) that traversed the pyramidal tract (py). There was no demonstrable inferior olivary bulge in this section, although a few neurons were scattered lateral to the pyramid, which were of uncertain origin (E; ?ion). Three different levels of the medulla from Twin B had basic structures from the medulla, including several cranial nerve nuclei (spinal trigeminal tract [spV], solitary tract [sol], dorsal motor nucleus of vagus [dmnX], and hypoglossal nucleus [xii]) and some major white matter tracts (cuneate tract [ct], sol, and spV). The ion was a prominent structure that normally resides just lateral to the pyramids throughout most of the medulla, and XII normally exits between these 2 structures (H). No ion bulge or nucleus was present at any level from Twin B (B, C, D, F, G), although a few calretinin-immunoreactive neurons were present in the region normally occupied by the ion (circled red in G). The calretinin stain (G) showed a region devoid of staining just dorsal to the pyramids, in an area normally occupied by the medial lemniscus. No discernable LFB-stainable myelinated axons were present in this region (C), although some faint myelin immunoreacted with MBP antibodies in the approximate region (F). The XII normally exits lateral to the pyramids; in both Twin A (A) and Twin B (C, F), this nerve exited instead directly through the pyramids. Two large myelinated structures marked (?) in (A) and (D) were of uncertain origin. Stains: (A) Nissl/LFB; (BYD, H) H&E/LFB; (E) H&E; (F) MBP; (G) calretinin. (?) Unidentified white matter tract; cn, cuneate nucleus; ct&cn, cuneate tract and cuneate nucleus; gn, gracilis nucleus; icp, inferior cerebellar peduncle; ion, inferior olivary nucleus; IVth ven, fourth ventricle; lrn, lateral reticular nucleus; ml, medial lemniscus; pyX, decussation of pyramids; rf, reticular formation.

control in Fig. 10C). Cortical gyral separation was incomplete in the inferior temporal area (middle temporal and inferior temporal gyri and temporal-occipital gyrus; compare stg, mtg, itg, and to in Figs. 10B, E with Fig. 10C). Although the gyral separation was similar to a 30-week fetus, sulci were deeper, which imparted a rounded, knobby, or mushroom shape to the gyri (compare gyri in twins in Figs. 10A, B, DYF with the control in Fig. 10C). Regressive changes included the paucity or collapse of the deep white matter (centrum semiovale [cso]), its brownish hue, the thin corpora callosa (cc), and dilation of the lateral ventricles (vl) (compare volume and color of cso, thickness of cc, and ventricular size in the twins with the control in Fig. 10C). The caudate nuclear bulge, fornix (f), and anterior commissure (ac) had a relatively normal configuration (Fig. 10F). Normal myelination of

the posterior limb of the internal capsule at term (icpl in Fig. 10C) was not demonstrable in either twin at the same level (Figs. 10B, E).

Deep Telencephalic White Matter Telencephalic white matter from both twins displayed extensive gliosis. Hematoxylin and eosin stained many reactive astrocytes (Figs. 11A, B), some of which were binucleated or multinucleated (arrowheads in Fig. 11A). These astrocytes reacted strongly with GFAP (arrowheads in Fig. 11C). Twin B (at 42 weeks of postconception age) had islands of primitive cells in the deep white matter (arrows in Fig. 11A), which were not present in Twin A (Fig. 11B) (45 weeks of postconception age). These primitive cells were immunoreactive to the neuronal marker PGP9.5 (Fig. 11D)



1019

Joseph et al


FIGURE 8. Pons histology. (A, G, H) Micrographs from the pons of Twin A; the remaining are from Twin B. Few myelinated tracts were demonstrable in LFB-stained sections from the rostral pons from Twin A (A; medial longitudinal fasciculus [mlf], vestibulomesencephalic tract [vmtr]) or Twin B (B; spinal trigeminal tract [spV]). Pontine cranial nerves had myelinated axons (trigeminal nerve [V] in A, C; abducens nerve [VI] and facial nerve [VII] in B; trochlear nerve [IV] in D). Immunoperoxidase staining for MBP in (E) showed sparse myelinated axons in the mlf, mesencephalic trigeminal tract, lateral lemniscus (ll), medial lemniscus (ml), and central tegmental tract (ctt). The medial aspect of the pontine base had greatly dilated Virchow-Robin spaces (sagittal section from Twin B in F). As best demonstrated in GFAP immunostains (G), the basic structure of the pontine base was intact, including its descending corticobulbar and corticospinal tracts (CBT CST) and horizontal pontine nuclear regionsVpontocerebellar fiber tracts (pontine). However, at higher magnification, most of the cells in the pontine base were reactive astrocytes, with only rare pontine neurons remaining in H&E stains (black circle in H) or calretinin immunoperoxidase stains (red circles in I). Stains: (A) Nissl/LFB; (BYD, F) H&E/LFB; (E) MBP; (G) GFAP; (H) H&E; (I) calretinin. dmtg, dorsal medial tegmental area; lc, locus ceruleus; mesV, trigeminal mesencephalic tract; ml/tl, medial lemniscus/trigeminal lemniscus; pontine, pontine neuron region; ra, raphe nuclei; scp, superior cerebellar peduncle; spv, spinal trigeminal nucleus; svn, superior vestibular nucleus; vii, facial nucleus; vm, trigeminal motor nucleus; VRS, dilated Virchow-Robin spaces.

but did not react with the astrocytic marker GFAP (Fig. 11C) or with the mature neuron marker NeuN (data not shown).

Cerebral Cortex In both twins, the neocortex had 6 demonstrable layers (Fig. 12C), and the hippocampus had a typical ‘‘C within a C’’ configuration of the dentate and hippocampal gyri (Fig. 12A). However, in Twin B, multiple areas of the cortex, including the hippocampus (Figs. 12A, B) and neocortex (Figs. 12C, D), had several or multiple tangential chains of small and larger cells (arrows in Figs. 12B, C), most of which did not express NeuN (Fig. 12D). These chains encompassed small cells in layers II and IV and larger cells in layer III. They were not associated with vimentin-immunoreactive radial glial fibers (data not shown). These chains of cells were not apparent in either neocortex or hippocampus from the 3-week older Twin A (compare hippocampi in Figs. 12B, F with neocortex in Figs. 12C, E). NeuN also marked a significant number of white matter neurons (data not shown). Although the neocortex had 6 layers in most areas, these were less distinct than those in normal newborn infants.

1020

DISCUSSION Whole-exome sequencing of this family identified compound heterozygous mutations in the RARS2 gene as the explanation for the severe neurodevelopmental disorder that affected the 3 siblings. The radiologic features shared by the affected infants and the similar pathologic findings in the twins suggest that the effect of the RARS2 mutations was relatively homogeneous. The most profound consequences were found in the cerebellum and in cerebellum-associated nuclei (ION, pontine base, and dentate nucleus). The central hypothesis generated by pathologic analysis is that RARS2 mutations i) have only a small adverse effect on early development, ii) have increasing effect during midgestation, and iii) eventually lead to regressive changes in already developed brain structures. The basic embryonic brain configuration was largely developed in both twins, except for the incomplete thalamichypothalamic separation (Figs.10B, E), which left only a slit for the third ventricle. The 3 divisions of the brainstem (Figs. 4, 7, 8, 9), cranial nerve nuclei, and diffuse system nuclei had Ó 2014 American Association of Neuropathologists, Inc.




FIGURE 9. Midbrain histology. Midbrain sections from Twin A (B, C), Twin B (A, E, F, G), and a control term-gestation infant (D). The LFB-stained sections of Twin B (A, E, G) and Twin A (B) showed myelin in the trochlear nerve (IV), oculomotor nerve (III), and medial longitudinal fasciculus (mlf). At term, the superior cerebellar peduncle (scp) normally is a prominent medial myelinated bundle (scp in D), and both the medial lemniscus (ml) and the lateral lemniscus (ll) are myelinated (ml and ll in D); none of these is demonstrable in either Twin B (A, E, F) or Twin A (B). Neurofilament immunoperoxidase-stained sections from Twin A at higher magnification (C) had no demonstrable scp axons in the normal location of this structure (compare B, C, and * in D). In a more rostral section from Twin B (E, F), III swept over a region in which the scp or red nucleus would normally reside; neither of these structures is identified in these slides. At higher magnification from this region (G), the oculomotor nucleus (iii) and mlf are near the parabrachial pigmented nucleus/substantia nigra (pbp/sn), with no demonstrable red nucleus or scp (starred region). Gross sections of the term infant brain typically are white in the region of the scp or slightly colored in the region of the red nucleus; neither of these structures was extant in gross sections from Twin B (insets to A and E). Although not demonstrable in routine stains, the midbrain had distinct periaqueductal gray and scattered myelinated axons in ventrolateral regions (F). Stains: (A, D, E, G) H&E/ LFB; (B) Nissl/LFB; (C) neurofilament; (F) MBP. aq, aqueduct; cp, cerebral peduncle; ic, inferior colliculus; iv, trochlear nucleus; pag, periaqueductal gray; ra, raphe nuclei; red, red nucleus; sc, superior colliculus; sn, substantia nigra.

all formed. Nonuniform development arrest manifested during the second trimester. Comparisons of the cerebella vermes (Figs. 4Y6) with published stages of development (e.g. Fig. 1 in [17] ; Figs. 9, 11, 12 in [16]) indicate that development of the cerebella lagged or arrested between approximately 14 and 18 weeks’ gestation; all primary lobules had formed, and the primary fissure was a groove on the superior surface, but lobules displayed only minimal foliation. Purkinje neurons are born in the subventricular zone of the fourth ventricle around the fifth week of gestation and subsequently migrate radially to the vermis and later to the hemispheres. The external granular neurons derive from the rhombic lip, migrate tangentially over the cerebellar surface, and proliferate before tracking down the Bergmann glia and populating the IGL. As evident in Twin B, these histogenic sequences had occurred in parts of the vermis but had largely failed in vermian fissures and across the entire hemisphere; only a thin layer of external granular cells coated the hemispheres (Fig. 6E). Purkinje neurons had either failed to proliferate or more likely failed to fully migrate to their final target and subsequently degenerated in the deeper white matter. A few shrunken Purkinje neurons were identified in immunostains for calbindin (Figs. 5F, 6I), and a few calretininpositive cells remained in the hemispheric white matter. Inferior

olivary and dentate nuclear primordia normally develop around 15 weeks’ gestation (20). At autopsy, the inferior olivary (Fig. 7), dentate (Fig. 6), and red nuclei (Fig. 9), were not recognizable, although a few neurons remained in the former site (Fig. 7), and the presence of sparse myelinated axons in the central tegmental tract suggests that some parvocellular red nucleus neurons remained (these neurons normally make a major contribution to this tract; Fig. 8). The medial longitudinal fasciculus, posterior columns, and anterolateral funiculus normally display mature myelin in the rostral spinal cord by 21 to 25 weeks’ gestation (19); all of these had some myelin staining in Twin B (Fig. 7; data not shown), indicating that myelination had matured to about the beginning of the third trimester. The middle temporal sulcus and inferior temporal gyri normally appear between 28 and 31 weeks’ gestation (21); these were present but incomplete. However, other gyri were more advanced (e.g. the anterior and posterior orbitofrontal gyri, which normally develop later) (21). The parietal lobe was most affected; it was flat to concave, rather than convex (Fig. 3), and had only rudimentary gyri. Later regressive changes were greatest in the pontine base, cerebellum, and deep telencephalic white matter. The general pontine structures of the base and tegmentum had



1021

Joseph et al


FIGURE 10. Cerebrum. Coronal sections from the cerebrum from Twin A (A, B), Twin B (DYF), and a control term infant (C). (A, D) From approximately the same level (pulvinar [pul]) as are sections (B), (C), and (E) (thalami [th]). (F) From the level of the amygdala (am). Twins A and B had similar cortical structures (compare A with D and B with E). In comparison with the normal control (C), both twins had dilated lateral ventricles (vl; A and D), fused middle thalamic regions (th; B and E), fused hypothalami (hth; F), thin corpora callosa (cc; A, B, D, E), and shrunken, brownish centrum semiovale (cso; A, B, D, E). Gyri were rounded and simplified compared with the control (compare gyri in A and E with C). The basic structure of the basal ganglia (cuneate nucleus [cn] and put) in the twins had a normal anatomic arrangement (F). Gyration in the inferior temporal region and hippocampal formation (hf) was simplified compared with the control (compare hf in A, D, E with C). ac, anterior commissure; cg, cingulate gyrus; f, fornix; Hg, Heschl gyrus; icpl, internal capsule posterior limb; ifg, inferior frontal gyrus; itg, inferior temporal gyrus; ln, lentiform nucleus; mfg, middle frontal gyrus; mtg, middle temporal gyrus; sfg, superior frontal gyrus; stg, superior temporal gyrus; to, temporal-occipital gyrus; v3, third ventricle. Scale bar = 2 cm.

formed (Figs. 8A, G, I), but the pontine base had subsequently regressed, as demonstrated by i) the extensive loss of neurons in the pontine base gray matter, ii) extensive gliosis, and iii) the ex vacuo dilation of the Virchow-Robin spaces around the penetrating arteries (Fig. 8F). The location of the normal dentate nucleus also had few demonstrable neurons (Fig. 6); this region had undergone extensive astrocytosis. Other major regressive changes were found in the deep cerebral white matter, which displayed a subtle brown discoloration in gross sections (Fig. 10), had extensive gliosis histologically (Fig. 11), and had few axons in neurofilament immunostains (data not shown). Additional evidence of development followed by regression was suggested in radiologic images, which showed both reduced OFCs (slowed development) and even smaller brains within those skulls (regression or atrophy of previously developed brains) (Fig. 1). Although some of the reactive astrocytic changes in the white matter might have been caused by neuronal and axonal damage, a primary effect on myelin is also possible, as suggested by the disease ‘‘leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation’’ (MIM 611105), which is caused by a similar mitochondrial aspartyl-tRNA synthetase deficiency (DARS2) (22). At 42 weeks’ equivalent gestation, the cerebrum from Twin B retained some islands of immature cells inthe intermediate zone (Fig. 11) and the cortices displayed tangential chains of neurons (Fig. 12). These findings indicate that development proceeded heterogeneously, with some areas more advanced than others. These deep white matter immature islands and cortical tangential chains were not demonstrable in the 3-week older Twin A (Fig. 11). The significance of the tangential cellular chains in layers II to IV in Twin B remains uncertain (Figs. 12B, C). Tangential migration is important

1022

in positioning GABAergic interneurons from the ganglionic eminence to the cerebral cortex (23). This process is complex and includes bidirectional movements that can be influenced by radial glia (15). In Twin B, these tangential chains were not associated with vimentin-immunoreactive radial processes (data not shown). Tangential migration is thought to direct interneurons to the marginal zone and subplate, after which they migrate radially to their final position in the cortical plate (24). In Twin B at 42 weeks, the chains included both small cells in layers II and IV but also larger neurons in layer III. Hence, it is unlikely that they represent only interneuron migration. We hypothesize that the immature islands of cells and the tangential chains represent an immature stage of development because they had largely disappeared by 45 weeks in Twin A. Production of mature tRNA involves multiple steps, including removal of introns by tRNA splicing endonuclease (TSENs) (25) and charging of tRNA with amino acids by specific aminoacyl-tRNA synthetases (26). Mutations in the 4 genes of the TSEN complex are responsible for the majority of types of PCH (3). In addition to a role in tRNA splicing, the TSEN complex is involved in messenger RNA 3¶ end formation. The RARS2 gene, which causes the PCH6 phenotype in this family, is 1 of 19 different nucleus-encoded mitochondrial aminoacyl-tRNA synthetases; RARS2 mediates the transfer of arginine to its tRNA. The precise mechanism of how RARS2 disruption causes PCH may be more complicated, as some tRNA synthetases participate in alternate functions, including splicing and apoptosis (2). Comparison with other forms of PCH reveals diverse pathologic changes; the changes illustrated for TSEN54 mutations are most similar to those found in the twins with PCH6 Ó 2014 American Association of Neuropathologists, Inc.




FIGURE 11. Deep cerebral white matter. Small islands of primitive cells were present in the deep white matter in Twin B (A) (arrows); these were not present in the 3-week older Twin A (B). The region was gliotic in both twins; Twin B had frequent reactive astrocytes, some of which are multinucleated (arrowheads in A); Twin A had prominent gemistocytes (arrowheads in B). The primitive islands in Twin B (arrows) did not immunoreact to GFAP (C) but reacted with the neuronal marker PGP9.5 (D). Anti-GFAP antibody also identified many white matter astrocytes (arrowheads in C).

described in this article. PCH type 1, which has 2 genetic loci, is notable for a loss of lower motor neurons and neurogenic atrophy. PCH type 1A, caused by mutations in the VRK1 (vaccinia-related kinase 1) gene, leads to neurogenic atrophy (27); no autopsy neuropathology has been detailed for this genetic mutation. An autopsy on a patient with PCH type 1B (caused by mutations in EXOSC3 [RNA exosome component 3]) showed loss of spinal lower motor neurons and extensive cerebellar atrophy with severe loss of cerebellar neurons (12). In that patient, the cerebellar vermis (illustrated in their Fig. 1l) had fully formed folia, unlike the poorly formed vermes from the twins. PCH2 is associated with mutations in 4 different genes. Similar to PCH6 described here, the overall pathologic changes in this form include the following: subtotal loss of pontine neurons; cerebellar hypoplasia greater in the hemispheres than in the vermis or floccule; and variable loss of Purkinje neurons and internal granular neurons (28). Unlike the more extreme changes demonstrated here for PCH6, PCH2 has some remaining cerebellar dentate neurons grouped in islands, and although inferior olivary neurons are lost, their ‘‘winding pattern’’ is spared. Supratentorial findings were less specific, and myelination was unaffected. The more specific neuropathology in PCH2A and PCH4, both caused by mutations in the TSEN54 (tRNA splicing endonuclease 54) gene, have a spectrum of neuropathologic changes that are similar to that shown here for PCH6 (29). Similar to the twins described here, Purkinje neurons had a ‘‘loose’’ distribution, the pontine base showed ‘‘severe hypoplasia,’’ and no dentate nucleus was identified (Fig. 5, this article). However, those patients had simplified, noncrenated ION, unlike the absent ION described

here, and the illustrated cerebellar vermis (their Fig. 2D) was much better developed than in the twins (Fig. 5, this article); the cerebellar hemispheres were not separately discussed. The neuropathology in PCH5, which is also caused by mutations in TSEN54, has been illustrated and discussed in 3 siblings (30). These fetuses were all at different gestational ages, which complicates comparison but provides additional useful information. The dentate nucleus in their 20-week-gestation fetus was ‘‘immature’’ but could not be identified in the 27- and 37-week-gestation siblings. Under the hypothesis that the underlying pathology was similar, this finding, like those in this article, suggests that the dentate nucleus had formed and then regressed. Across the 3 gestational ages, the cerebella progressively diminished in size, relative to the remainder of the brains. Similar to PCH2A and PCH4, the ION was present but not convoluted and showed increasing neuron loss and gliosis across the 3 different gestational ages; similar to PCH6, the findings again suggest incomplete formation followed by regression. In PCH7 (molecular etiology unknown), the brain reportedly showed cerebral atrophy with rudimentary cerebral white matter (31). Although the telencephalic white matter in the twins described here was gliotic, the cerebral cortices were simplified but not atrophic. Similar to the twins, the cerebellum was ‘‘represented only in the midline by the vermis,’’ whereas the cerebellar hemispheres ‘‘were virtually absent and represented only by a few very rudimentary folia,’’ which lacked neurons. Also similar to the twins, the pontine base lacked descending corticobulbar and corticospinal tracts and pontine neurons, and the ION was absent,



1023

Joseph et al


whereas the pontine tegmentum was relatively normal. This report did not illustrate the pathologic changes; thus, detailed comparison with the current description is not possi-

ble. No CNS pathology has yet been illustrated specifically for PCH2B, PCH2C, PCH2D, PCH3, PCH6, PCH8, PCH9, or PCH10.

FIGURE 12. Cerebral cortex. The hippocampus from Twin B (A) had a normal ‘‘C’’-shaped dentate gyrus and an appropriate inverted ‘‘C’’ in the Ammon horn fields. At higher magnification (B), the CA1 field had several rows of small neurons (arrows) and lacked the mature pyramidal neurons typically present at term. Similarly, the neocortex (frontal lobe) of Twin B (C) showed multiple tangential chains of neurons (arrows) in layers II to IV. (D) More mature neurons were immunolabeled with NeuN and were not arranged in rows. (E, F) In the 3-week older Twin A, these tangential cellular chains were not prominent in the neocortex (E) or in hippocampal field CA1 (F). DGy, dentate gyrus granular neurons; CA, cornu Ammon fields; Sub, subiculum.

1024




Although the pathogenesis of how perturbation of the TSEN complex leads to severe and specific anomalies of the pons and cerebellum remains incompletely understood, knockdown of tsen54 in zebrafish embryos recapitulates much of the human phenotype (32). Knockdown of rars2 in zebrafish leads to a phenotype comparable to that seen in tsen54 knockdown, further highlighting the likely shared pathogenesis (32). We now have within our diagnostic toolbox a comprehensive method (WES) for evaluating all possible disease genes in a timely and cost-effective manner. This is of particular value when there is relatively limited information with which to narrow the differential diagnosis or when, despite extensive phenotyping, the number of possible genes is still greater than a few. The role for WES also extends to ultrarare diseases where the disease is just so rare that clinical testing is not readily available. Families presented with the option of WES as a diagnostic tool must be counseled regarding the possibility of incidental findings and the discovery of mutation in a gene unrelated to the phenotype being investigated but nonetheless of medical importance. Achieving molecular diagnosis is of significant value to families, in this instance providing closure and options for prenatal or preimplantation genetic testing. It also allows us to advance our knowledge about a particular rare disease, as in this case, with the first detailed neuropathologic description of PCH6. ACKNOWLEDGMENTS We thank the family for their support to make this work possible. We also wish to thank Drs Roger Skinner, Chris Milroy, and Cynthia Trevenen, as well as Thomas Kryton, Vivian King, Kawal Deogun, Vanessa Lad, and Joanna Bartczak, for their expertise and contributions to neuropathologic examination. We also thank Mary Anderson for the care she provided to the family as a genetic counselor and Dr Kirsten Kutsche for research testing of the CASK gene. We acknowledge the contribution of the high-throughput sequencing platform at the McGill University and Genome Quebec Innovation Center. This work was selected for study by the FORGE Canada steering committee consisting of K. Boycott (University of Ottawa), J. Friedman (University of British Columbia), J. Michaud (University of Montreal), F. Bernier (University of Calgary), M. Brudno (University of Toronto), B. Fernandez (Memorial University), B. Knoppers (McGill University), M. Samuels (University of Montreal), and S. Scherer (University of Toronto). REFERENCES 1. Hevner RF. Progress on pontocerebellar hypoplasia. Acta Neuropathol 2007;114:401Y2 2. Namavar Y, Barth PG, Poll-The BT, et al. Classification, diagnosis and potential mechanisms in pontocerebellar hypoplasia. Orphanet J Rare Dis 2011;6:50 3. Namavar Y, Barth PG, Kasher PR, et al. Clinical, neuroradiological and genetic findings in pontocerebellar hypoplasia. Brain 2011;134:143Y56 4. Boycott KM, Vanstone MR, Bulman DE, et al. Rare-disease genetics in the era of next-generation sequencing: discovery to translation. Nat Rev Genet 2013;10:681Y91 5. Edvardson S, Shaag A, Kolesnikova O, et al. Deleterious mutation in the mitochondrial arginylYtransfer RNA synthetase gene is associated with pontocerebellar hypoplasia. Am J Hum Genet 2007;81:857Y62


6. Li H, Durbin R. Fast and accurate short read alignment with BurrowsWheeler transform. Bioinformatics 2009;25:1754Y60 7. Li H, Handsaker B, Wysoker A, et al. The sequence alignment/map format and SAMtools. Bioinformatics 2009;25:2078Y79 8. Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res 2010;38:e164 9. Englund C, Alvord EC Jr, Folkerth RD, et al. NeuN expression correlates with reduced mitotic index of neoplastic cells in central neurocytomas. Neuropathol Appl Neurobiol 2005;31:429Y38 10. Kumar P, Henikoff S, Ng PC. Predicting the effects of coding nonsynonymous variants on protein function using the SIFT algorithm. Nat Protoc 2009;4:1073Y81 11. Adzhubei IA, Schmidt S, Peshkin L, et al. A method and server for predicting damaging missense mutations. Nat Methods 2010;7:248Y49 12. Wan J, Yourshaw M, Mamsa H, et al. Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration. Nat Genet 2012;44:704Y8 13. Rankin J, Brown R, Dobyns WB, et al. Pontocerebellar hypoplasia type 6: a British case with PEHO-like features. Am J Med Genet A 2010;152: 2079Y84 14. Glamuzina E, Brown R, Hogarth K, et al. Further delineation of pontocerebellar hypoplasia type 6 due to mutations in the gene encoding mitochondrial arginyl-tRNA synthetase, RARS2. J Inherit Metab Dis 2012; 35:459Y67 15. Yokota Y, Ghashghaei H, Han C, et al. Radial glial dependent and independent dynamics of interneuronal migration in the developing cerebral cortex. PLoS One 2007;2:e794 16. Larsell O. The development of the cerebellum in man in relation to its comparative anatomy. J Comp Neurol 1947;87:85Y129 17. Rakic P, Sidman RL. Histogenesis of cortical layers in human cerebellum, particularly the lamina dissecans. J Comp Neurol 1970;139:473Y500 18. Andressen C, Blu¨mcke I, Celio MR. Calcium-binding proteins: selective markers of nerve cells. Cell Tissue Res 1993;271:181Y208 19. Gilles FH. Myelination in the neonatal brain. Hum Pathol 1976;7:244Y48 20. Murofushi K. Normal development and dysgenesias of the dentate nucleus and inferior olive. Acta Neuropathol 1974;27:317 21. Chi JG, Dooling EC, Gilles FH. Gyral development of the human brain. Ann Neurol 1977;1:86Y93 22. Scheper GC, van der Klok T, van Andel RJ, et al. Mitochondrial aspartyl-tRNA synthetase deficiency causes leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation. Nat Genet 2007;39:534Y39 23. Corbin JG, Nery S, Fishell G. Telencephalic cells take a tangent: non-radial migration in the mammalian forebrain. Nat Neurosci 2001;4:1177Y82 24. Me´tin C, Baudoin JP, Raki( S, et al. Cell and molecular mechanisms involved in the migration of cortical interneurons. Eur J Neurosci 2006; 23:894Y900 25. Calvin K, Li H. RNA-splicing endonuclease structure and function. Cellular and Molecular Life Sciences 2008;65:1176Y85 26. Antonellis A, Green ED. The role of aminoacyl-tRNA synthetases in genetic diseases. Annu Rev Genomics Hum Genet 2008:9:87Y107 27. Renbaum P, Kellerman E, Jaron R, et al. Spinal muscular atrophy with pontocerebellar hypoplasia is caused by a mutation in the VRK1 gene. Am J Hum Genet 2009;85:281Y89 28. Barth PG, Aronica E, de Vries L, et al. Pontocerebellar hypoplasia type 2: a neuropathological update. Acta Neuropathol 2007;114:373Y86 29. Cassandrini D, Biancheri R, Tessa A, et al. Pontocerebellar hypoplasia: clinical, pathologic, and genetic studies. Neurology 2010;75: 1459Y64 30. Patel MS, Becker LE, Toi A, et al. Severe, fetal-onset form of olivopontocerebellar hypoplasia in three sibs: PCH type 5? Am J Med Genet A 2006;140:594Y603 31. Anderson C, Davies JH, Lamont L, et al. Early pontocerebellar hypoplasia with vanishing testes: a new syndrome? Am J Med Genet A 2011; 155A:667Y72 32. Kasher PR, Namavar Y, van Tijn P, et al. Impairment of the tRNA-splicing endonuclease subunit 54 (tsen54) gene causes neurological abnormalities and larval death in zebrafish models of pontocerebellar hypoplasia. Hum Mol Genet 2011;20:1574Y84



1025

RARS2 Mutations: Is Pontocerebellar Hypoplasia Type 6 a Mitochondrial Encephalopathy?

Natural course of pontocerebellar hypoplasia type 2A.

Brain morphometry in Pontocerebellar Hypoplasia type 2.

Loss of PCLO function underlies pontocerebellar hypoplasia type III.

EXOSC3 mutations in pontocerebellar hypoplasia type 1: novel mutations and genotype-phenotype correlations.

Novel AMPD2 mutation in pontocerebellar hypoplasia, dysmorphisms, and teeth abnormalities.

Anterior horn cell disease associated with pontocerebellar hypoplasia in infants.

Neuropathologic features of anti-dipeptidyl-peptidase-like protein-6 antibody encephalitis.

TSEN54 gene-related pontocerebellar hypoplasia type 2 presenting with exaggerated startle response: report of two cases in a family.

A familial late‑onset hereditary ataxia mimicking pontocerebellar hypoplasia caused by a novel TSEN54 mutation.

Autosomal-Recessive Mutations in the tRNA Splicing Endonuclease Subunit TSEN15 Cause Pontocerebellar Hypoplasia and Progressive Microcephaly.

A novel mutation in the promoter of RARS2 causes pontocerebellar hypoplasia in two siblings.

Novel homozygous RARS2 mutation in two siblings without pontocerebellar hypoplasia - further expansion of the phenotypic spectrum.

Novel motor phenotypes in patients with VRK1 mutations without pontocerebellar hypoplasia.

Complete callosal agenesis, pontocerebellar hypoplasia, and axonal neuropathy due to AMPD2 loss.

Autosomal-Recessive Mutations in the tRNA Splicing Endonuclease Subunit TSEN15 Cause Pontocerebellar Hypoplasia and Progressive Microcephaly.

Brainstem tegmental necrosis and olivary hypoplasia: raising awareness of a rare neuropathologic correlate of congenital apnea.

The spinal muscular atrophy with pontocerebellar hypoplasia gene VRK1 regulates neuronal migration through an amyloid-β precursor protein-dependent mechanism.

Biallelic mutations in the 3' exonuclease TOE1 cause pontocerebellar hypoplasia and uncover a role in snRNA processing.

New Perspectives of Dyrk1A Role in Neurogenesis and Neuropathologic Features of Down Syndrome.

Lethal olivopontoneocerebellar hypoplasia with dysmorphic features in sibs.

Genome-wide association meta-analysis of neuropathologic features of Alzheimer's disease and related dementias.

Neuropathologic effects of intrathecal water.

Giant axonal neuropathy: clinical, electrophysiologic, and neuropathologic features in two siblings.