Journal of Medical Virology
New Amino Acid Changes in Drug Resistance Sites and HBsAg in Hepatitis B Virus Genotype H ´ vila,2 L. Bobadilla-Morales,3 P. Go D. A. Ferna´ndez-Galindo,1 F. Sa´nchez-A mez-Quiro z,4 1 1 1 M. Bueno-Topete, J. Armenda´riz-Borunda, and L. V. Sa´nchez-Orozco * 1
Institute of Molecular Biology in Medicine and Gene Therapy, CUCS, University of Guadalajara, Guadalajara, Jalisco, Mexico 2 Gastroenterology Department, National Institute of Medical Sciences and Nutrition, Salvador Zubira´n, DF, Mexico 3 Human Genetic Institute “Dr. Enrique Corona Rivera”, CUCS, University of Guadalajara, Guadalajara, Jalisco, Mexico 4 Infectology Service, Civil Hospital of Guadalajara, Guadalajara, Jalisco, Mexico
Long-term treatment with retrotranscriptase (RT) inhibitors eventually leads to the development of drug resistance. Drug-related mutations occur naturally and these can be found in hepatitis B virus (HBV) carriers who have never received antiviral therapy. HBsAg are overlapped with RT domain, thus nucleot(s)ide analogues (NAs) resistance mutations and naturally-occurring mutations can cause amino acid changes in the HBsAg. Twenty-two patients with chronic hepatitis B were enrolled; three of them were previously treated with NAs and 19 were NAs-naı¨ve treated. HBV reverse transcriptase region was sequenced; genotyping and analysis of missense mutations were performed in both RT domain and HBsAg. There was predominance of genotype H. Drug mutations were present in 18.2% of patients. Classical lamivudine resistance mutations (rtM204V/ rtL180M) were present in one naı¨ve-treatment patient infected with genotype G. New amino acid changes were identified in drug resistance sites in HBV strains from patients infected with genotype H; rtQ215E was present in two naı¨veNAs treatment patients and rtI169M was identified in a patient previously treated with lamivudine. Mutations at sites rt169, rt204, and rt215 resulted in the Y161C, I195M, and C206W mutations at HBsAg. Also, new amino acid changes were identified in B-cell and T-cell epitopes and were more frequent in HBsAg compared to RT domain. In conclusion, new amino acid changes at antiviral resistance sites, B-cell and T-cell epitopes in HBV genotype H were identified in Mexican patients. J. Med. Virol. 2015. # 2015 Wiley Periodicals, Inc.
KEY WORDS:
nucleot(s)ide analogues; RT domain; B-cell epitopes; T-cell epitopes
C 2015 WILEY PERIODICALS, INC.
INTRODUCTION Hepatitis B virus (HBV) belongs to the hepadnaviridae family of enveloped viruses with doublestranded DNA genome of 3200 bp. Infection with HBV is still one of the major global health problems caused by an infectious disease. Worldwide, more than 240 million people are currently chronic HBV carriers [Ott et al., 2012]; these patients are at risk of developing progressive liver diseases including fibrosis, cirrhosis or hepatocellular carcinoma (HCC) [Szmuness, 1978; Song et al., 2013]. Treatment for chronic HBV infection is based on two groups of drugs: interferons, drugs with immunomodulatory and antiviral effects; and nucleos(t)ide analogues (NAs), drugs that block viral polymerase activity. The ultimate therapeutic goal when treating chronic HBV infection is to prevent cirrhosis development and HCC, by eliminating or producing sustained suppression of HBV replication [Hoofnagle and di Bisceglie, 1997; Lok, 2007]. Long-term treatment with RT inhibitors can develop drug resistance. Although the initial effect of NAs in suppressing HBV replication is promising, emergence of drugresistant variants reduces the benefit of therapy [Marcellin and Asselah, 2005; Hongthanakorn et al., 2011]. Percentage of resistance varies from 0–24% in Conflicts of interest: None. Grant sponsor: CONCACyT; Grant number: CB-2011-01 169824.; Grant sponsor: COECYTJAL; Grant number: 5-2010-11005. Correspondence to: Laura Vero nica Sa´nchez-Orozco, PhD, Instituto de Biologı´a Molecular en Medicina, Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara Sierra Mojada 950, Puerta 7, Edificio Q, Tercer Nivel, Col. Independencia, Guadalajara, Jalisco, Me´xico, CP 44340. E-mail: [email protected] Accepted 9 September 2014 DOI 10.1002/jmv.24098 Published online in Wiley Online Library (wileyonlinelibrary.com).
Ferna´ndez-Galindo et al.
2
the first year of treatment to 2–80% at 5 years of treatment, coupled with this, if this occurs before lamivudine (LMV) resistance the percentage of treatment-failure increases with the use of second line drugs [Ghany and Liang, 2007]. Drug resistance has been associated with emergence of gene mutations within the RT region in NAs treated patients or can occur naturally in HBV carriers who have never received antiviral therapy; the reported incidence of prevalence of YMDD mutations in treatment-naı¨ve patients varies, ranging from less than 1–18% in patients with chronic hepatitis B [Fung et al., 2006; Feeney et al., 2007; Margeridon-Thermet et al., 2009; Nguyen et al., 2009; Tan et al., 2012]. Antiviral resistance is by itself a major problem for the treatment of these patients, together with crossresistance further complicates the problem [Das et al., 2001]. HBsAg, a main serological marker for diagnosis of HBV infection, comprises 226 amino acids (aa), and contains a highly conformational epitope cluster in the major hydrophilic region extending from aa 99 to aa 169 [Stirk et al., 1992]. The DNA coding for the “a determinant” located from aa 124 to aa 147 and other important epitopes [Chiou et al., 1997; Cooreman et al., 2001] in the HBsAg are overlapped with the DNA coding for the RT domain. Thus, NAs resistance or/and naturally-occurring mutations can cause mutations in the HBsAg, originating vaccine escape mutant strains [Ashton-Rickardt and Murray, 1989; Carman et al., 1990; Chiou et al., 1997; Chen et al., 2000], failure to diagnosis with available commercial methods and immune escape [Oon et al., 1995; Weinberger et al., 2000]. Ten genotypes (genotypes A–J) have been identified by a sequence divergence [Schaefer, 2007; Tatematsu et al., 2009]. HBV genotypes have distinct geographical distributions, are associated with different rates of progression of liver disease and different rates of response to interferon therapy [Fung and Lok, 2004; Schaefer, 2007]. Genotype H is prevalent in Mexico [Sa´nchez et al., 2007], and little is known about mutations present in the RT domain in this genotype and the corresponding overlapping surface gene. Therefore, this study was carried out in order to identify mutations, in the RT domain of the RNA/ DNA polymerase gene and in the overlapping surface gene, of HBV isolated from Mexican patients with chronic hepatitis B either previously treated or not with NAs, and compare the pattern of mutations with different genotypes. MATERIAL AND METHODS Patients and Sera This study included a total of 22 patients with or without treatment; 15 samples were obtained from HBV mono-infected subjects and 7 from co-infected HBV/HIV patients. Sera were collected from peripheral blood and stored at 70˚C until use. J. Med. Virol. DOI 10.1002/jmv
TABLE I. PCR and Sequencing Primer Primer HBpol1S HBpol1R HBP1 DS7 DS7R J K M2
Sequence
Site
5 TCAAGCCTCCAAGCTGTGCCT 50 AGGTGAAGCGAAGTGCACACG 50 GAGTGTGGATTCGCACTCC-3’ 50 TCCTGCTGGTGGCTCCAGTT 50 AGGCCTTGTAAGTTGGCG 50 TTCGCAGTCCCCAACCTC 50 CCAATACCACATCATCCA 50 CAGGATGAAGAGGAA(T/G)ATGA
1864–1884 1596–1576 2268–2286 55–74 1117–1100 310–327 757–740 415–396
0
DNA Extraction, PCR Amplification, and Sequencing HBV DNA was purified 1from 200 ml of patient sera 1 using QIAamp MinElute Virus Spin kit (QIAGEN, Hilden, Germany). PCR amplification of a 2953 bp of the polymerase region was performed using primers HBpol1S and HBpol1R, followed by semi-nested PCR using the primers HBP1 and HBpol1R obtaining a PCR product of 2549 bp (Table I). Briefly, 10 ml of HBV DNA were added to 40 ml of reaction mixture, containing 1 PCR buffer, 0.5 mM of each primer, 75mM dNTP’s (dATP, dGTP, dCTP, and dGTP), 1.5 mM MgCl2, and 1 U Taq polymerase (Invitrogen, Carlsbad, CA). The annealing and elongation for both primer pairs were for 30 sec at 60˚C and 2 min at 72˚ C, respectively. The first PCR was carried out for 40 cycles and semi-nested PCR for 25 cycles, using an initial denaturing step of 94˚C for 5 min and a final amplification step of 72˚C for 5 min. Negative controls were included to discard cross-contamination. Specificity of the PCR assay was ensured by the inclusion of a positive control consisted of the cloned complete HBV-DNA genome in TOPO vector (Invitrogen). Positive samples were considered only after at least two positive independent assays were observed. Polymerase sequences could not be amplified from samples with low HBV DNA, in these cases we used alternate primers to amplify the HBV surface gene: primers DS7 and DS7R, with the same specifications and conditions previously described [Sa´nchez et al., 2002, 2007], only the extension time was modified to 1 min to obtain a fragment of 1,062 bp. Following PCR amplification, HBV DNA was puri1 fied using QIAquick PCR Purification Kit (QIAGEN). Cycle sequencing was done by the chain 1 termination method using BigDye Terminator v3.1 1 Cycle sequencing kit (Applied Biosystems , Foster city CA) with the sequencing primers listed in the Table I. The extension products were purified by filtration chromatography using DNA sequencing Clean-up (Zymo Research, Irvine, CA) and separated in an automated DNA genetic analyzer ABI 3100 (Applied Biosystems). HBV Genotyping and Sequence Analysis The genotypes of 22 HBV strains were determined using the nucleotide sequence of the RT polymerase
RT and HBsAg Mutations in HBV Genotype H
3
region using the NCBI Viral Genotyping Tool (http:// www.ncbi.nlm.nih.gov/projects/genotyping/formpage.cgi). The amino acid sequence of the RT domain and surface gene of HBV was deduced from the nucleotide sequence using the program ExPASy-Translate tool (http://web.expasy.org/translate/) and annealing by CLC DNA Workbench 5.6 (CLC bio A/S). The amino acid differences identified according to the corresponding genotype were analyzed with the multiple alignment performed by Shin-I et al. [2008] in a hepatitis virus database which include approximately 3,050 and 6,800 HBV strains for the polymerase region and HBsAg respectively. Also, an additional alignment was performed including 30 HBV strains of genotype H not considered in the alignment constructed by Shin-I, in order to check if the amino acid changes identified were polymorphic of genotype H or were mutants. Thus, if the amino acid difference was present in the consensus sequences of the identified genotype without a polymorphic change from the rest of genotypes; then, it was considered a mutant. Consequently, if the amino acid change was different from the consensus
sequences of the genotype but was present predominantly with the same amino acid in other genotypes, then it was defined as a polymorphic site. Ethical Considerations The study was performed in accordance with the principles of the declaration of Helsinki, and was approved by the ethics committee of University Center of Health Sciences, University of Guadalajara and Civil Hospital of Guadalajara. The blood samples were obtained with previous informed consent from all patients. The patients received the corresponding results of the molecular diagnosis tests. RESULTS Genotyping and Drug Resistance Mutations Samples from 22 patients were sequenced (Table II). Genotyping of samples showed predominance of genotype H, 81.8% (18/22) followed by F 9.1% (2/22) and G 9.1% (2/22). The latter genotype was found in the co-infected HIV group only. Drug mutations were present in 4/22 (18.2%) samples
TABLE II. Characteristics of HBV-Infected Patients
IDa
Origin
Age
Diagnosis
ALT (U/L)
AST (U/L)
FA (U/L)
BT (mg/dl)
ALB (g/dl)
Viral load (copies/ml)
Genotype
M M M M F F M M F F F F M
CH CH CH CH CH CH CH CH CH CH CH CH CH
12 26 74 36 ND 16 17 83 16 15 130 29 21.6
40 68 92 27 ND 26 26 176 16 27 167 34 22
84 ND 55 69 ND 51 146 193 64 125 127 106 ND
0.4 ND 0.8 0.54 ND 0.45 0.4 3.7 0.7 1.33 1.4 0.5 ND
ND ND 4.5 4.2 ND 4.6 2.9 1.6 2.2 4.3 3.2 ND ND
2.36 2.69 5.07 2.43 5.55 4.79 3.85 9.77 5.15 2.46 8.39 2.69 5.10
F H H H F H H H H H H H H
F F
CH CH
45 42
36 29
147 74
0.4 0.87
4.1 4.9
3.86 9.0
H H
M M M M M
CARRIER CIRRHOSIS CARRIER CARRIER CARRIER
32 30 19 23 42
22 31 92 87 41
ND 58 59 512 95
0.94 1.89 0.3 0.6 0.6
ND 2.9 ND ND 4.3
2.68 8.15 3.70 8.70 3.3
H G H H H
M M
AIDS C3 AIDS C3
57 ND
81 ND
204 ND
1.18 ND
3.8 ND
4.77 4.75
H G
Gender
Monoinfected treated-naı¨ve H12 WEST 51 H15 WEST 43 H17 CENTER 39 H18 CENTER 47 H21 CENTER 35 b H22 CENTER 63 H23b CENTER 27 H26b CENTER 56 H28b CENTER 32 b H32 CENTER 74 H34 CENTER 28 H182 WEST 37 H184 WEST 24 Monoinfected treated H14 WEST 66 H16b CENTER 58 HIV-coinfected treatment-naı¨ve b H29 CENTER 49 H31 CENTER 47 H94 WEST 28 H95 WEST 27 H181 WEST 46 HIV-coinfected treated H19 CENTER 52 H33 CENTER 33
ID, subject identification; M, male; F, female; CH, chronic hepatitis; ALT, alanine amino transferase; AST, aspartate amino-transferase; FA, alcaline phosphatase; BT, total bilirrubin; ALB, Albumin. Patient H14 was previously treated two times with PEG-IFN, first during 18 months and 11 year after was treated 1 more year with PEG-IFN. Patient H16 was previously treated with Lamivudine (LVM) during 2 years. Patient 19, was treated during 1 year with LVM þ Zidovudine (AZT) þ indinavir (IDV); then the treatment was modified to Saquinavir (SQV) þ didanosine (DDI) þ ritonavir (RTV) þ stavudine (d4T) 5 years later, d4T was changed by abacavir (ABC), 6 months later the blood sample was obtained. Patient H33 was previously treated with efivarenz (EFV) þ d4T þ LVM, 3 months later d4T was changed by tenofovir (TDF), this combination was prescribed during 18 months, then TDF was changed with d4T, 6 months later a blood sample was collected for HBV diagnosis. a All patients were previously serologically diagnosed using HBsAg. b HBsAg, HBeAg, anti HBs, and anti HBe, in all these samples both antigens were positive and both antibodies were negative, except H26 which only was HBsAg positive.
J. Med. Virol. DOI 10.1002/jmv
Ferna´ndez-Galindo et al.
4 TABLE III. Drug Mutantsin Hepatitis B Virus (HBV) Identified in Rt Domain and the Corresponding in HBsAg Subject
Treatment
RT Domain
Mutants in drug resistance sites H16 LVM I169M H17 naive Q215E H22 naive Q215E H31 Naive L180M, M204V
HBsAg Y161C C206W C206W I195M
DNA sequence of the RT domain and S the overlapping S region were determined by direct sequencing. Amino acid sequence was obtaining by translation of DNA sequence. LVM, lamivudine.
(Table III). rtI169M mutation was identified in a patient infected with HBV genotype H previously treated with LMV during 2 years. In 3 NAs-treatment naı¨ve patients, drug mutations were found: one HIV co-infected patient infected with HBV genotype G was affected by LMVr mutations; and, in two HBV patients mono-infected with genotype H, the amino acid change, rtQ215E was identified. Due to viral genome overlap, mutations in the RT can be translated into mutations on the surface gene. Thus, analysis of amino acid sequence of HBsAg was performed. Results showed that mutation at rt180
site did not result in any mutations in the surface gene; though, mutations at sites rt169, rt204 and rt215 resulted in amino acid changes on the HBsAg domain (Table III , Figs. 1 and 2). Amino Acid Changes Within B-cell and T-cell Epitopes in the HBsAg and Rt Domain The analysis on B and T cell epitopes in the HBsAg displayed amino acid changes in 12/22 samples; twelve different residues were present within T-cell epitopes (aa 11–33 and 28–51) and B-cell epitope (aa 160–207); only one amino acid change was identified within “a-determinant” (Table IV, Fig. 2). No amino acid changes were identified within B-cell epitope (aa 44–49), neither T-cell epitope (aa 136–155). Three additional amino acid changes were observed outside B-Cell and T-cell epitopes (Table IV, Fig. 1). Also, nine polymorphic changes were identified in the HBsAg domain; L8H, C19S/F, L21W, Q30R, S31N, S34L, C76Y, I208T, and Y221C; and four in the RT domain; H13Y, N139H, I163V, and I253R (Figs. 1 and 2). In the RT domain, only the amino acid change I169M also considered a drug mutation site, was identified in a T-cell epitope localized from amino
Fig. 1. Partial amino acid sequence corresponding to RT domain of viral polymerase.
J. Med. Virol. DOI 10.1002/jmv
RT and HBsAg Mutations in HBV Genotype H
5
Fig. 2. Amino acid sequence corresponding to HBsAg
acid 157–172 (Table IV, Fig. 1). No amino acid changes were identified in the others T-cell epitopes identified in this domain (aa 68–83, 83–91, and 111– 119). The identified missense mutations identified in this population affected more the open reading frame of the HBsAg compared to RT domain of the viral polymerase. DISCUSSION In this study, as reported previously by other studies in Mexican population, genotype H was the most prevalent (80%), followed by genotypes F and G [Sa´nchez et al., 2002, 2007]. Genotype F was reported previously in Mexico [Sa´nchez et al., 2002], but after the identification of genotype H these HBV strains were reclassified as genotype H. Drug mutants were identified in 18.2% of samples. This frequency is similar to previous studies [Margeridon-Thermet et al., 2009; Tan et al., 2012]. Three of the HBV strains affected with drug mutants corresponded to genotype H (two from naı¨ve NAs-treatment patients and one from a patient previously treated with LMV).
Noteworthy, in this study, several amino acids changes identified were different to previously reported in other populations. In one strain of genotype G isolated from a naı¨ve-treatment patient, we identified the classical mutations reported for LMV, these mutations have been reported in patients with genotype G and co-infection with HIV/HBV [Silva et al., 2010; Mata et al., 2012]. At this moment, remains to be elucidated if the mutants found in the RT domain of the viral polymerase in genotype H HBV (rtI169M and rtQ215E) affect the replicative capacity of the virus or really interfere with NAs treatment, due to the fact that amino acids identified are different from the previously reported (rtI169T/K and rtQ215S/H/P) [Delaney et al., 2003; Tenney et al., 2004; AminiBavil-Olyaee et al., 2009; Pastor et al., 2009]. An interesting approach will be to find out the implications of this finding in the treatment management. rt169 mutation has been recognized as a site of primary resistance to ETV and secondary resistance to LMV, however, some studies indicate that this mutation must be associated with other mutations, J. Med. Virol. DOI 10.1002/jmv
Ferna´ndez-Galindo et al.
6
TABLE IV. Amino Acid Changes on B and T Cells Epitopes in the HBsAg and the RT Region Domain HBsAg B-cell epitope (aa122-148) “a determinant” Subject H14 H15 H16 H17 H18 H19 H22 H26 H28 H31 H33 H34 H95 H181 H182
(aa160-207)
RT domain
T-cell epitope (aa11-33)
(aa28-51)
Outside T-B cells epitopes
T-cell epitope (aa157-172)
I25T P11L, L26R, T27Ka
Q129H Y161C C206Wa V180A C206Wa V180A
I169M Q16P, A17V T23I
Outside T-B cells Epitopes I/V253R H35Ka R110G Q215Ea T38K, Q215Ea
L26R
R18W L180M, M204Va
I195Ma Q101H L26R T23I L26R, T27Ka
V30G L293H F41S
P62Q, R79H
H35Qa
DNA sequence of the RT domain and the overlapping S region were determined by direct sequencing. Amino acid sequence was obtaining by translation of DNA sequence. Missense mutations were identified after analysis of the alignment of approximately 3,050 and 6,800 HBV strains for the polymerase region and HBsAg respectively performed by Shin-I et al., 2008 (27) plus an additional alignment of 30 HBV strains of genotype H, in order to check if the amino acid changes identified were polymorphic sites or were mutants. a Mutations affecting both HBsAg and RT domain.
especially the rtM204V, rtM204V/rtL180M, rtM250V, rtM204V/rtV173L, rtM204V/rtL180M/rtV173L to be involved in the resistance to ETV treatment and functions as compensatory change to LMV [Delaney et al., 2003; Tenney et al., 2004]. Contradictory data are in the effect of the rtQ215S/H/P mutation, this site has been linked with secondary resistance to LMV and ADV, with an intermediate degree of crossresistance to these NAs, also has been posted that on this site can often produce amino acid substitutions in the course of chronic infection, without altering the efficiency of viral replication or the susceptibility to LMV or ADV in vitro [Amini-Bavil-Olyaee et al., 2009]; and probably represent polymorphic sites instead of resistance mutations without clinical implications, although the substitutions rtQ215H/P/S occur as compensatory mutations and the mutations rtQ215S/rtV214A confer partial cross-resistance to LMV [Amini-Bavil-Olyaee et al., 2009; Pastor et al., 2009]. In this study, in both sites rt169 and rt215, different amino acid changes were found, in vitro studies with these sequences are needed to assess the effect that could have over the course of treatment with the different NAs. The mutations found in the RT domain in this study, resulted in sI195M, sY161C, and sC206W in the surface protein. sI195M, has been reported as a change produced by immune pressure [Shen et al., 2012]. The analysis of the surface protein in this study identified other important missense mutations; one resulting in the amino acid change sQ129H has been related with immune evasion. Substitutions within epitopes for T and B cells were more common J. Med. Virol. DOI 10.1002/jmv
in the HBsAg compared to the RT domain of the viral polymerase and mainly affected the B-cell epitope from amino acids 160 to 207 and the T-cell epitope from amino acids 11 to 33. Changes in this B-cell epitope are associated with conformational changes [Stirk et al., 1992; Paulij et al., 1999; Bauer et al., 2002; Lin et al., 2013], so their appearance in these epitopes may lead to vaccine escape mutants, diagnosis failure and perhaps immune tolerance resulting chronic infection. Related to changes within T-cell epitope (aa 11–33) could be responsible of the chronic state of the patients. In this study, a higher number of mutations in the HBV strains were detected within B-cell and T-cell epitopes on the surface antigen compared to the RT domain. HBV is a DNA virus, its replication is by reverse transcription through a pgRNA and a RT RNA/DNA polymerase unable to correct miss-incorporations during the DNA synthesis, conducing changes in the open reading frames (ORF) that can affect the amino acid sequence. In spite that the RT domain of the viral polymerase overlaps completely with the surface antigen, the ORF of the latter was most affected in the number of amino acid changes, since more mutants and polymorphic sites were identified in the HBsAg compared to the number of amino acid changes in the RT domain. Nevertheless, maintenance of the replicative capacity of the virus is a primordial event for the viral life cycle; this could be one explanation why the number in amino acid changes is lesser in the RT domain compared to the HBsAg. All patients were chronic carriers, twelve of them had mutants preferentially on B-cell and T-cell
RT and HBsAg Mutations in HBV Genotype H
epitopes from the HBsAg; probably, these mutants emerged in response to the immune pressure directed by the host. Scarce amino acid changes were observed on T-cell epitopes in the RT region, future in vitro studies are important to analyze these mutants and the biological effect in patients preferentially infected with genotype H. HBV polymerase is the largest protein of HBV and immunogenicity has been demonstrated at the level of T-cells in patients with selflimited hepatitis B [Rehermann et al., 1995; Maini et al., 1999], the polymerase is a target for the cellular immune response in acute infection due to the high content of T-cell epitopes and it is important for viral clearance [Mizukoshi et al., 2004], perhaps mutations into T and B-cell epitopes of viral polymerase may cause immune tolerance and escape from immune surveillance. Because of the cross sectional nature of this study, there is no information of either the initial or subsequent response to NAs, or the evolution of mutations in epitopes on HBsAg and polymerase. This variability issue must be studied using in vitro systems to rule out all possible implications from the theoretical point of view that the amino acid changes identified imply. In some areas from Mexico it seems that the HBV endemicity is decreasing, probably that is the reason of the scarce number of HBV-positive samples collected; also, the lack of health insurances in the majority of Mexican population complicates clinical protocols carry out to study the evolution of the most prevalent genotype in our country (genotype H) in treated patients. Following of many HBV-infected people is complicated and therefore, lost, by absence of opportunity to be appropriately treated. Another reason accounting for the scarce number of samples collected is that HBV genotype H and the genetic factors from Mexican population favor clearance of the virus in most of them, reducing virus transmission and appearance of new cases. Regardless, it is very important to increase the number of studies searching for infected people with HBV in high-risk groups where usually people do not attend hospitals in a regular fashion. ACKNOWLEDGMENTS We acknowledge Citlali Ortega for her kind help with the technical assistance in the sequencing running of the samples. The assistance of Dr. Miguel Angel Jime´nez Lue´vano, Dr. Rau´l Pe´rez-Gomez, and Dr. Arturo Rodrı´guez-Toledo is greatly appreciated. In the same way, help from Dr. Daniel Ruı´z-Romero, to obtain clinical information and Dr. Sara Sixtos is recognized. REFERENCES Amini-Bavil-Olyaee S, Herbers U, Mohebbi SR, Sabahi F, Zali MR, Luedde T, Trautwein C, Tacke F. 2009. Prevalence, viral replication efficiency and antiviral drug susceptibility of rtQ215
7 polymerase mutations within the hepatitis B virus genome. J Hepatol 51:647–654. Ashton-Rickardt PG, Murray K. 1989. Mutants of the Hepatitis B virus surface antigen that define some antigenically essential residues in the immunodominant ’a’ region. J Med Virol 29: 196–203. Bauer T, Weinberger K, Jilg W. 2002. Variants of two major T cell epitopes within the hepatitis B surface antigen are not recognized by specific T helper cells of vaccinated individuals. Hepatology 35:455–465. Carman W, Zanetti AR, Karayiannis P, Waters JA, Manzillo G, Tanzi E, Zuckerman AJ, Thomas HC. 1990. Vaccine-induced escape mutant of hepatitis B virus. Lancet 336:325–329. Chen WN, Oon CHJ, Toh I. 2000. Altered antigenicities of Hepatitis B virus surface antigen carrying mutations outside the common “a” determinant. Am J Gastroenterol 95:1098–1099. Chiou HL, Lee TH, Kao J, Mau YC, Ho MS. 1997. Altered antigenicity of “a” determinant variants of hepatitis B virus. J Genl Virol 78:2639–2645. Cooreman MP, Leroux-Roles G, Paulij WP. 2001. Vaccine-and hepatitis B immune globulin-induced escape mutations of hepatitis B virus surface antigen. J Biomed Sci 8:237–247. Das K, Xiong X, Yang H, Westland CE, Gibbs CS, Sarafianos SG, Arnold E. 2001. Molecular modeling and biochemical characterization reveal the mechanism of hepatitis B virus polymerase resistance to lamivudine (3TC) and emtricitabine (FTC). J Virol 75:4771–4779. Delaney WE, Yang H, Westland CE, Das K, Arnold E, Gibbs CS, Miller MD, Xiong S. 2003. The hepatitis B virus polymerase mutation rtV173L is selected during lamivudine therapy and enhances viral replication in vitro. J Virol 77:11833–11841. Feeney E, Fanning LJ, Horgan M. 2007. Baseline genotypic resistance in untreated hepatitis B virus infection. Gastroenterology 132:35A. Fung SK, Chae HB, Fontana RJ, Conjeevaram H, Marrero J, Oberhelman K, Hussain M, Lok AS. 2006. Virologic response and resistance to adefovir in patients with chronic hepatitis B. J Hepatol 44:283–290. Fung SK, Lok AS. 2004. Hepatitis B virus genotypes: do they play a role in the outcome of HBV infection. Hepatology 40:790–792. Ghany M, Liang TJ. 2007. Drug targets and molecular mechanisms of drug resistance in Chronic Hepatitis B. Gastroenterology 132:1574–1585. Hongthanakorn C, Chotiyaputta W, Oberhelman K, Fontana RJ, Marrero JA, Licari T, Lok AS. 2011. Virological breakthrough and resistance in patients with chronic hepatitis B receiving nucleos(t) ide analogues in clinical practice. Hepatology 53:1854–1863. Hoofnagle JH, di Bisceglie AM. 1997. The treatment of chronic viral hepatitis. N Engl Med 336:347–356. Lin YM, Jow GM, Mu SC, Chen BF. 2013. Naturally occurring hepatitis B virus B-Cell and T-Cell epitope mutants in hepatitis B vaccinated children. ScientificWorldJournal 2013:571875. Lok AS-F. 2007. Navigating the maze of hepatitis B treatments. Gastroenterology 132:1586–1594. Maini MK, Boni C, Ogg GS, King As, Reignat S, Lee CK, Larrubia JR, Webster GJ, McMichael AJ, Ferrari C, Williams R, Vergani D, Bertoletti A. 1999. Direct ex vivo analysis of hepatitis B virus-specific CD8-T cells associated with the control of infection. Gastroenterology 117:1386–1396. Marcellin P, Asselah T. 2005. Resistance to adefovir: A new challenge in the treatment of chronic hepatitis B. J Hepatol 43:920–923. Margeridon-Thermet S, Shulman NS, Ahmed A, Shahriar R, Liu T, Wang C, Holmes SP, Babrzadeh F, Gharizadeh B, Hanczaruk B, Simen BB, Egholm M, Shafer RW. 2009. Ultra-deep pyrosequencing of hepatitis B virus quasispecies from nucleoside and nucleotide reverse-transcriptase inhibitor (NRTI)-treated patients and NRTI-naive patients. J Infect Dis 199:1275–1285. Mata Marı´n, Arroyo JA, Anduiza CI, Caldero n GM, Cazares Rodrı´guez, Fuentes Allen, Arias Flores, Gayta´n Martı´nez. 2012. Prevalence and resistance pattern of genotype G and H in chronic hepatitis B and HIV co-infected patients in Mexico. Annals of Hepatology 11:47–51. Mizukoshi E, Sidney J, Livingston B, Ghany M, Hoofnagle JH, Sette A, Rehermann B. 2004. Cellular immune responses to the hepatitis B virus polymerase. J Immunol 173:5863–5871.
J. Med. Virol. DOI 10.1002/jmv
8 Nguyen MH, Garcia RT, Trinh HN, Nguyen HA, Nguyen KK, Nguyen LH, Levitt B. 2009. Prevalence of hepatitis B virus DNA polymerase mutations in treatment-naı¨ve patients with chronic hepatitis B. Aliment Pharmacol Ther 30:1150–1158. Oon CJ, Lim GK, Ye Z, Goh KT, Tan KL, Yo SL, Hopes E, Harrison TJ, Suckerman AJ. 1995. Molecular epidemiology of hepatitis B virus vaccine variants in Singapore. Vaccine 13: 699–702. Ott JJ, Stevens GA, Groeger J, Wiersma ST. 2012. Global epidemiology of hepatitis B virus infection: new estimates of age-specific HBsAg seroprevalence and endemicity. Vaccine 30:2212–2219. Pastor R, Habersetzer F, Fafi-Kremer S, Doffoel M, Baumert TF, Gut JP, Stoll-Keller F, Schvoerer E. 2009. Hepatitis B virus mutations potentially conferring adefovir/tenofovir resistance in treatment-naive patients. World J Gastroenterol 15:753–755. Paulij WP, DeWit PL, Su¨nnen CM, van Roosmalen MH, Petersenvan Ettekoven, Cooreman A, Heijtink MP. 1999. Localization of a unique hepatitis B virus epitope sheds new light on the structure of hepatitis B virus surface antigen. J Gen Virol 80:2121–2126. Rehermann B, Fowler P, Sidney J, Person J, Redeker A, Brown M, Moss B, Sette A, Chisari FV. 1995. The cytotoxic T lymphocyte response to multiple hepatitis B virus polymerase epitopes during and after acute viral hepatitis. J Exp Med 181: 1047–1058. Sa´nchez LV, Maldonado M, Bastidas-Ramı´rez BE, Norder H, Panduro A. 2002. Genotypes and S-gene variability of Mexican hepatitis B virus strains. J Med Virol 68:24–32. Sa´nchez LV, Tanaka Y, Maldonado M, Mizokami M, Panduro A. 2007. Difference of hepatitis B virus genotype distribution in two groups of Mexican patients with different risk factors. High prevalence of genotype H and G. Intervirology 50:9–15. Schaefer S. 2007. Hepatitis B virus taxonomy and hepatitis B virus genotypes. World J Gastroenterol 13:14–21. Shen ZY, Wei-Ping Z, Yong-Lin D, Hong-Li S. 2012. Variations in the S and P regions of the hepatitis B virus genome under immunosuppression in vitro and in vivo. Viral Immunol 25: 368–378.
J. Med. Virol. DOI 10.1002/jmv
Ferna´ndez-Galindo et al. Shin-I T, Tanaka Y, Tateno Y, Mizokami M. 2008. Development and public release of a comprehensive hepatitis virus database. Hepatol Res 38:234–243. Silva AC, Spina AM, Lemos MF, Oba IT, guastini CdeF, GomesGouvea MS, Pinho JR, Mendes-Correa MC. 2010. Hepatitis B genotype G and high frequency of lamivudine-resistance mutations among human immunodeficiency virus/hepatitis B virus coinfected patients in Brazil. Mem Inst Oswaldo Cruz 105:770–778. Song IH, Kim SM, Choo YK. 2013. Risk prediction of hepatitis B virus-related hepatocellular carcinoma in the era of antiviral therapy. W J Gastroenterol 19:8867–8872. Stirk HJ, Thornton JM, Howard CR. 1992. A topological model for hepatitis B surface antigen. Intervirology 33:148–158. Szmuness W. 1978. Prog Med Virol Hepatocellular carcinoma and the hepatitis B virus: Evidence for a causal association. 24:40–69. Tan Y, Ding K, Su J, Trinh X, Peng Z, Gong Y, Chen L, Cui Q, Lei N, Chen X, Yu R. 2012. The naturally occurring YMDD mutation among patients chronically infected HBV and untreated with Lamivudine: A systematic review and meta-analysis. PLoS One 7:32789e. Tatematsu K, Tanaka Y, Kurbanov F, Sugauchi F, Mano S, Maeshiro T, Nakayoshi T, Wakuta M, Miyakawa Y, Mizokami M. 2009. A genetic variant of hepatitis B virus divergent from known human and ape genotypes isolated from a Japanese patient and provisionally assigned to new genotype J. J Virol 83:10538–10547. Tenney DJ, Levine SM, Rose RE, Walsh AW, Weinheimer SP, Discotto L, Plym M, Pokomowwski K, Yu CF, Angus P, Ayres A, Bartholomeusz A, Sievert W, Thompson G, Warmer N, Locarnini S, Colonno RJ. 2004. Clinical emergence of entecavirresistant hepatitis B virus requires additional substitutions in virus already resistant to lamivudine. Antimicrob Agents Chemother 48:3498–3507. Weinberger KM, Bauer T, Bo¨hm S, Jilg W. 2000. High genetic variability of the group-specific a-determinant of hepatitis B virus surface antigen (HBsAg) and the corresponding fragment of the viral polymerase in chronic virus carriers lacking detectable HBsAg in serum. J Gen Virol 81:1165–1174.
New Amino Acid Changes in Drug Resistance Sites and HBsAg in Hepatitis B Virus Genotype H ´ vila,2 L. Bobadilla-Morales,3 P. Go D. A. Ferna´ndez-Galindo,1 F. Sa´nchez-A mez-Quiro z,4 1 1 1 M. Bueno-Topete, J. Armenda´riz-Borunda, and L. V. Sa´nchez-Orozco * 1
Institute of Molecular Biology in Medicine and Gene Therapy, CUCS, University of Guadalajara, Guadalajara, Jalisco, Mexico 2 Gastroenterology Department, National Institute of Medical Sciences and Nutrition, Salvador Zubira´n, DF, Mexico 3 Human Genetic Institute “Dr. Enrique Corona Rivera”, CUCS, University of Guadalajara, Guadalajara, Jalisco, Mexico 4 Infectology Service, Civil Hospital of Guadalajara, Guadalajara, Jalisco, Mexico
Long-term treatment with retrotranscriptase (RT) inhibitors eventually leads to the development of drug resistance. Drug-related mutations occur naturally and these can be found in hepatitis B virus (HBV) carriers who have never received antiviral therapy. HBsAg are overlapped with RT domain, thus nucleot(s)ide analogues (NAs) resistance mutations and naturally-occurring mutations can cause amino acid changes in the HBsAg. Twenty-two patients with chronic hepatitis B were enrolled; three of them were previously treated with NAs and 19 were NAs-naı¨ve treated. HBV reverse transcriptase region was sequenced; genotyping and analysis of missense mutations were performed in both RT domain and HBsAg. There was predominance of genotype H. Drug mutations were present in 18.2% of patients. Classical lamivudine resistance mutations (rtM204V/ rtL180M) were present in one naı¨ve-treatment patient infected with genotype G. New amino acid changes were identified in drug resistance sites in HBV strains from patients infected with genotype H; rtQ215E was present in two naı¨veNAs treatment patients and rtI169M was identified in a patient previously treated with lamivudine. Mutations at sites rt169, rt204, and rt215 resulted in the Y161C, I195M, and C206W mutations at HBsAg. Also, new amino acid changes were identified in B-cell and T-cell epitopes and were more frequent in HBsAg compared to RT domain. In conclusion, new amino acid changes at antiviral resistance sites, B-cell and T-cell epitopes in HBV genotype H were identified in Mexican patients. J. Med. Virol. 2015. # 2015 Wiley Periodicals, Inc.
KEY WORDS:
nucleot(s)ide analogues; RT domain; B-cell epitopes; T-cell epitopes
C 2015 WILEY PERIODICALS, INC.
INTRODUCTION Hepatitis B virus (HBV) belongs to the hepadnaviridae family of enveloped viruses with doublestranded DNA genome of 3200 bp. Infection with HBV is still one of the major global health problems caused by an infectious disease. Worldwide, more than 240 million people are currently chronic HBV carriers [Ott et al., 2012]; these patients are at risk of developing progressive liver diseases including fibrosis, cirrhosis or hepatocellular carcinoma (HCC) [Szmuness, 1978; Song et al., 2013]. Treatment for chronic HBV infection is based on two groups of drugs: interferons, drugs with immunomodulatory and antiviral effects; and nucleos(t)ide analogues (NAs), drugs that block viral polymerase activity. The ultimate therapeutic goal when treating chronic HBV infection is to prevent cirrhosis development and HCC, by eliminating or producing sustained suppression of HBV replication [Hoofnagle and di Bisceglie, 1997; Lok, 2007]. Long-term treatment with RT inhibitors can develop drug resistance. Although the initial effect of NAs in suppressing HBV replication is promising, emergence of drugresistant variants reduces the benefit of therapy [Marcellin and Asselah, 2005; Hongthanakorn et al., 2011]. Percentage of resistance varies from 0–24% in Conflicts of interest: None. Grant sponsor: CONCACyT; Grant number: CB-2011-01 169824.; Grant sponsor: COECYTJAL; Grant number: 5-2010-11005. Correspondence to: Laura Vero nica Sa´nchez-Orozco, PhD, Instituto de Biologı´a Molecular en Medicina, Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara Sierra Mojada 950, Puerta 7, Edificio Q, Tercer Nivel, Col. Independencia, Guadalajara, Jalisco, Me´xico, CP 44340. E-mail: [email protected] Accepted 9 September 2014 DOI 10.1002/jmv.24098 Published online in Wiley Online Library (wileyonlinelibrary.com).
Ferna´ndez-Galindo et al.
2
the first year of treatment to 2–80% at 5 years of treatment, coupled with this, if this occurs before lamivudine (LMV) resistance the percentage of treatment-failure increases with the use of second line drugs [Ghany and Liang, 2007]. Drug resistance has been associated with emergence of gene mutations within the RT region in NAs treated patients or can occur naturally in HBV carriers who have never received antiviral therapy; the reported incidence of prevalence of YMDD mutations in treatment-naı¨ve patients varies, ranging from less than 1–18% in patients with chronic hepatitis B [Fung et al., 2006; Feeney et al., 2007; Margeridon-Thermet et al., 2009; Nguyen et al., 2009; Tan et al., 2012]. Antiviral resistance is by itself a major problem for the treatment of these patients, together with crossresistance further complicates the problem [Das et al., 2001]. HBsAg, a main serological marker for diagnosis of HBV infection, comprises 226 amino acids (aa), and contains a highly conformational epitope cluster in the major hydrophilic region extending from aa 99 to aa 169 [Stirk et al., 1992]. The DNA coding for the “a determinant” located from aa 124 to aa 147 and other important epitopes [Chiou et al., 1997; Cooreman et al., 2001] in the HBsAg are overlapped with the DNA coding for the RT domain. Thus, NAs resistance or/and naturally-occurring mutations can cause mutations in the HBsAg, originating vaccine escape mutant strains [Ashton-Rickardt and Murray, 1989; Carman et al., 1990; Chiou et al., 1997; Chen et al., 2000], failure to diagnosis with available commercial methods and immune escape [Oon et al., 1995; Weinberger et al., 2000]. Ten genotypes (genotypes A–J) have been identified by a sequence divergence [Schaefer, 2007; Tatematsu et al., 2009]. HBV genotypes have distinct geographical distributions, are associated with different rates of progression of liver disease and different rates of response to interferon therapy [Fung and Lok, 2004; Schaefer, 2007]. Genotype H is prevalent in Mexico [Sa´nchez et al., 2007], and little is known about mutations present in the RT domain in this genotype and the corresponding overlapping surface gene. Therefore, this study was carried out in order to identify mutations, in the RT domain of the RNA/ DNA polymerase gene and in the overlapping surface gene, of HBV isolated from Mexican patients with chronic hepatitis B either previously treated or not with NAs, and compare the pattern of mutations with different genotypes. MATERIAL AND METHODS Patients and Sera This study included a total of 22 patients with or without treatment; 15 samples were obtained from HBV mono-infected subjects and 7 from co-infected HBV/HIV patients. Sera were collected from peripheral blood and stored at 70˚C until use. J. Med. Virol. DOI 10.1002/jmv
TABLE I. PCR and Sequencing Primer Primer HBpol1S HBpol1R HBP1 DS7 DS7R J K M2
Sequence
Site
5 TCAAGCCTCCAAGCTGTGCCT 50 AGGTGAAGCGAAGTGCACACG 50 GAGTGTGGATTCGCACTCC-3’ 50 TCCTGCTGGTGGCTCCAGTT 50 AGGCCTTGTAAGTTGGCG 50 TTCGCAGTCCCCAACCTC 50 CCAATACCACATCATCCA 50 CAGGATGAAGAGGAA(T/G)ATGA
1864–1884 1596–1576 2268–2286 55–74 1117–1100 310–327 757–740 415–396
0
DNA Extraction, PCR Amplification, and Sequencing HBV DNA was purified 1from 200 ml of patient sera 1 using QIAamp MinElute Virus Spin kit (QIAGEN, Hilden, Germany). PCR amplification of a 2953 bp of the polymerase region was performed using primers HBpol1S and HBpol1R, followed by semi-nested PCR using the primers HBP1 and HBpol1R obtaining a PCR product of 2549 bp (Table I). Briefly, 10 ml of HBV DNA were added to 40 ml of reaction mixture, containing 1 PCR buffer, 0.5 mM of each primer, 75mM dNTP’s (dATP, dGTP, dCTP, and dGTP), 1.5 mM MgCl2, and 1 U Taq polymerase (Invitrogen, Carlsbad, CA). The annealing and elongation for both primer pairs were for 30 sec at 60˚C and 2 min at 72˚ C, respectively. The first PCR was carried out for 40 cycles and semi-nested PCR for 25 cycles, using an initial denaturing step of 94˚C for 5 min and a final amplification step of 72˚C for 5 min. Negative controls were included to discard cross-contamination. Specificity of the PCR assay was ensured by the inclusion of a positive control consisted of the cloned complete HBV-DNA genome in TOPO vector (Invitrogen). Positive samples were considered only after at least two positive independent assays were observed. Polymerase sequences could not be amplified from samples with low HBV DNA, in these cases we used alternate primers to amplify the HBV surface gene: primers DS7 and DS7R, with the same specifications and conditions previously described [Sa´nchez et al., 2002, 2007], only the extension time was modified to 1 min to obtain a fragment of 1,062 bp. Following PCR amplification, HBV DNA was puri1 fied using QIAquick PCR Purification Kit (QIAGEN). Cycle sequencing was done by the chain 1 termination method using BigDye Terminator v3.1 1 Cycle sequencing kit (Applied Biosystems , Foster city CA) with the sequencing primers listed in the Table I. The extension products were purified by filtration chromatography using DNA sequencing Clean-up (Zymo Research, Irvine, CA) and separated in an automated DNA genetic analyzer ABI 3100 (Applied Biosystems). HBV Genotyping and Sequence Analysis The genotypes of 22 HBV strains were determined using the nucleotide sequence of the RT polymerase
RT and HBsAg Mutations in HBV Genotype H
3
region using the NCBI Viral Genotyping Tool (http:// www.ncbi.nlm.nih.gov/projects/genotyping/formpage.cgi). The amino acid sequence of the RT domain and surface gene of HBV was deduced from the nucleotide sequence using the program ExPASy-Translate tool (http://web.expasy.org/translate/) and annealing by CLC DNA Workbench 5.6 (CLC bio A/S). The amino acid differences identified according to the corresponding genotype were analyzed with the multiple alignment performed by Shin-I et al. [2008] in a hepatitis virus database which include approximately 3,050 and 6,800 HBV strains for the polymerase region and HBsAg respectively. Also, an additional alignment was performed including 30 HBV strains of genotype H not considered in the alignment constructed by Shin-I, in order to check if the amino acid changes identified were polymorphic of genotype H or were mutants. Thus, if the amino acid difference was present in the consensus sequences of the identified genotype without a polymorphic change from the rest of genotypes; then, it was considered a mutant. Consequently, if the amino acid change was different from the consensus
sequences of the genotype but was present predominantly with the same amino acid in other genotypes, then it was defined as a polymorphic site. Ethical Considerations The study was performed in accordance with the principles of the declaration of Helsinki, and was approved by the ethics committee of University Center of Health Sciences, University of Guadalajara and Civil Hospital of Guadalajara. The blood samples were obtained with previous informed consent from all patients. The patients received the corresponding results of the molecular diagnosis tests. RESULTS Genotyping and Drug Resistance Mutations Samples from 22 patients were sequenced (Table II). Genotyping of samples showed predominance of genotype H, 81.8% (18/22) followed by F 9.1% (2/22) and G 9.1% (2/22). The latter genotype was found in the co-infected HIV group only. Drug mutations were present in 4/22 (18.2%) samples
TABLE II. Characteristics of HBV-Infected Patients
IDa
Origin
Age
Diagnosis
ALT (U/L)
AST (U/L)
FA (U/L)
BT (mg/dl)
ALB (g/dl)
Viral load (copies/ml)
Genotype
M M M M F F M M F F F F M
CH CH CH CH CH CH CH CH CH CH CH CH CH
12 26 74 36 ND 16 17 83 16 15 130 29 21.6
40 68 92 27 ND 26 26 176 16 27 167 34 22
84 ND 55 69 ND 51 146 193 64 125 127 106 ND
0.4 ND 0.8 0.54 ND 0.45 0.4 3.7 0.7 1.33 1.4 0.5 ND
ND ND 4.5 4.2 ND 4.6 2.9 1.6 2.2 4.3 3.2 ND ND
2.36 2.69 5.07 2.43 5.55 4.79 3.85 9.77 5.15 2.46 8.39 2.69 5.10
F H H H F H H H H H H H H
F F
CH CH
45 42
36 29
147 74
0.4 0.87
4.1 4.9
3.86 9.0
H H
M M M M M
CARRIER CIRRHOSIS CARRIER CARRIER CARRIER
32 30 19 23 42
22 31 92 87 41
ND 58 59 512 95
0.94 1.89 0.3 0.6 0.6
ND 2.9 ND ND 4.3
2.68 8.15 3.70 8.70 3.3
H G H H H
M M
AIDS C3 AIDS C3
57 ND
81 ND
204 ND
1.18 ND
3.8 ND
4.77 4.75
H G
Gender
Monoinfected treated-naı¨ve H12 WEST 51 H15 WEST 43 H17 CENTER 39 H18 CENTER 47 H21 CENTER 35 b H22 CENTER 63 H23b CENTER 27 H26b CENTER 56 H28b CENTER 32 b H32 CENTER 74 H34 CENTER 28 H182 WEST 37 H184 WEST 24 Monoinfected treated H14 WEST 66 H16b CENTER 58 HIV-coinfected treatment-naı¨ve b H29 CENTER 49 H31 CENTER 47 H94 WEST 28 H95 WEST 27 H181 WEST 46 HIV-coinfected treated H19 CENTER 52 H33 CENTER 33
ID, subject identification; M, male; F, female; CH, chronic hepatitis; ALT, alanine amino transferase; AST, aspartate amino-transferase; FA, alcaline phosphatase; BT, total bilirrubin; ALB, Albumin. Patient H14 was previously treated two times with PEG-IFN, first during 18 months and 11 year after was treated 1 more year with PEG-IFN. Patient H16 was previously treated with Lamivudine (LVM) during 2 years. Patient 19, was treated during 1 year with LVM þ Zidovudine (AZT) þ indinavir (IDV); then the treatment was modified to Saquinavir (SQV) þ didanosine (DDI) þ ritonavir (RTV) þ stavudine (d4T) 5 years later, d4T was changed by abacavir (ABC), 6 months later the blood sample was obtained. Patient H33 was previously treated with efivarenz (EFV) þ d4T þ LVM, 3 months later d4T was changed by tenofovir (TDF), this combination was prescribed during 18 months, then TDF was changed with d4T, 6 months later a blood sample was collected for HBV diagnosis. a All patients were previously serologically diagnosed using HBsAg. b HBsAg, HBeAg, anti HBs, and anti HBe, in all these samples both antigens were positive and both antibodies were negative, except H26 which only was HBsAg positive.
J. Med. Virol. DOI 10.1002/jmv
Ferna´ndez-Galindo et al.
4 TABLE III. Drug Mutantsin Hepatitis B Virus (HBV) Identified in Rt Domain and the Corresponding in HBsAg Subject
Treatment
RT Domain
Mutants in drug resistance sites H16 LVM I169M H17 naive Q215E H22 naive Q215E H31 Naive L180M, M204V
HBsAg Y161C C206W C206W I195M
DNA sequence of the RT domain and S the overlapping S region were determined by direct sequencing. Amino acid sequence was obtaining by translation of DNA sequence. LVM, lamivudine.
(Table III). rtI169M mutation was identified in a patient infected with HBV genotype H previously treated with LMV during 2 years. In 3 NAs-treatment naı¨ve patients, drug mutations were found: one HIV co-infected patient infected with HBV genotype G was affected by LMVr mutations; and, in two HBV patients mono-infected with genotype H, the amino acid change, rtQ215E was identified. Due to viral genome overlap, mutations in the RT can be translated into mutations on the surface gene. Thus, analysis of amino acid sequence of HBsAg was performed. Results showed that mutation at rt180
site did not result in any mutations in the surface gene; though, mutations at sites rt169, rt204 and rt215 resulted in amino acid changes on the HBsAg domain (Table III , Figs. 1 and 2). Amino Acid Changes Within B-cell and T-cell Epitopes in the HBsAg and Rt Domain The analysis on B and T cell epitopes in the HBsAg displayed amino acid changes in 12/22 samples; twelve different residues were present within T-cell epitopes (aa 11–33 and 28–51) and B-cell epitope (aa 160–207); only one amino acid change was identified within “a-determinant” (Table IV, Fig. 2). No amino acid changes were identified within B-cell epitope (aa 44–49), neither T-cell epitope (aa 136–155). Three additional amino acid changes were observed outside B-Cell and T-cell epitopes (Table IV, Fig. 1). Also, nine polymorphic changes were identified in the HBsAg domain; L8H, C19S/F, L21W, Q30R, S31N, S34L, C76Y, I208T, and Y221C; and four in the RT domain; H13Y, N139H, I163V, and I253R (Figs. 1 and 2). In the RT domain, only the amino acid change I169M also considered a drug mutation site, was identified in a T-cell epitope localized from amino
Fig. 1. Partial amino acid sequence corresponding to RT domain of viral polymerase.
J. Med. Virol. DOI 10.1002/jmv
RT and HBsAg Mutations in HBV Genotype H
5
Fig. 2. Amino acid sequence corresponding to HBsAg
acid 157–172 (Table IV, Fig. 1). No amino acid changes were identified in the others T-cell epitopes identified in this domain (aa 68–83, 83–91, and 111– 119). The identified missense mutations identified in this population affected more the open reading frame of the HBsAg compared to RT domain of the viral polymerase. DISCUSSION In this study, as reported previously by other studies in Mexican population, genotype H was the most prevalent (80%), followed by genotypes F and G [Sa´nchez et al., 2002, 2007]. Genotype F was reported previously in Mexico [Sa´nchez et al., 2002], but after the identification of genotype H these HBV strains were reclassified as genotype H. Drug mutants were identified in 18.2% of samples. This frequency is similar to previous studies [Margeridon-Thermet et al., 2009; Tan et al., 2012]. Three of the HBV strains affected with drug mutants corresponded to genotype H (two from naı¨ve NAs-treatment patients and one from a patient previously treated with LMV).
Noteworthy, in this study, several amino acids changes identified were different to previously reported in other populations. In one strain of genotype G isolated from a naı¨ve-treatment patient, we identified the classical mutations reported for LMV, these mutations have been reported in patients with genotype G and co-infection with HIV/HBV [Silva et al., 2010; Mata et al., 2012]. At this moment, remains to be elucidated if the mutants found in the RT domain of the viral polymerase in genotype H HBV (rtI169M and rtQ215E) affect the replicative capacity of the virus or really interfere with NAs treatment, due to the fact that amino acids identified are different from the previously reported (rtI169T/K and rtQ215S/H/P) [Delaney et al., 2003; Tenney et al., 2004; AminiBavil-Olyaee et al., 2009; Pastor et al., 2009]. An interesting approach will be to find out the implications of this finding in the treatment management. rt169 mutation has been recognized as a site of primary resistance to ETV and secondary resistance to LMV, however, some studies indicate that this mutation must be associated with other mutations, J. Med. Virol. DOI 10.1002/jmv
Ferna´ndez-Galindo et al.
6
TABLE IV. Amino Acid Changes on B and T Cells Epitopes in the HBsAg and the RT Region Domain HBsAg B-cell epitope (aa122-148) “a determinant” Subject H14 H15 H16 H17 H18 H19 H22 H26 H28 H31 H33 H34 H95 H181 H182
(aa160-207)
RT domain
T-cell epitope (aa11-33)
(aa28-51)
Outside T-B cells epitopes
T-cell epitope (aa157-172)
I25T P11L, L26R, T27Ka
Q129H Y161C C206Wa V180A C206Wa V180A
I169M Q16P, A17V T23I
Outside T-B cells Epitopes I/V253R H35Ka R110G Q215Ea T38K, Q215Ea
L26R
R18W L180M, M204Va
I195Ma Q101H L26R T23I L26R, T27Ka
V30G L293H F41S
P62Q, R79H
H35Qa
DNA sequence of the RT domain and the overlapping S region were determined by direct sequencing. Amino acid sequence was obtaining by translation of DNA sequence. Missense mutations were identified after analysis of the alignment of approximately 3,050 and 6,800 HBV strains for the polymerase region and HBsAg respectively performed by Shin-I et al., 2008 (27) plus an additional alignment of 30 HBV strains of genotype H, in order to check if the amino acid changes identified were polymorphic sites or were mutants. a Mutations affecting both HBsAg and RT domain.
especially the rtM204V, rtM204V/rtL180M, rtM250V, rtM204V/rtV173L, rtM204V/rtL180M/rtV173L to be involved in the resistance to ETV treatment and functions as compensatory change to LMV [Delaney et al., 2003; Tenney et al., 2004]. Contradictory data are in the effect of the rtQ215S/H/P mutation, this site has been linked with secondary resistance to LMV and ADV, with an intermediate degree of crossresistance to these NAs, also has been posted that on this site can often produce amino acid substitutions in the course of chronic infection, without altering the efficiency of viral replication or the susceptibility to LMV or ADV in vitro [Amini-Bavil-Olyaee et al., 2009]; and probably represent polymorphic sites instead of resistance mutations without clinical implications, although the substitutions rtQ215H/P/S occur as compensatory mutations and the mutations rtQ215S/rtV214A confer partial cross-resistance to LMV [Amini-Bavil-Olyaee et al., 2009; Pastor et al., 2009]. In this study, in both sites rt169 and rt215, different amino acid changes were found, in vitro studies with these sequences are needed to assess the effect that could have over the course of treatment with the different NAs. The mutations found in the RT domain in this study, resulted in sI195M, sY161C, and sC206W in the surface protein. sI195M, has been reported as a change produced by immune pressure [Shen et al., 2012]. The analysis of the surface protein in this study identified other important missense mutations; one resulting in the amino acid change sQ129H has been related with immune evasion. Substitutions within epitopes for T and B cells were more common J. Med. Virol. DOI 10.1002/jmv
in the HBsAg compared to the RT domain of the viral polymerase and mainly affected the B-cell epitope from amino acids 160 to 207 and the T-cell epitope from amino acids 11 to 33. Changes in this B-cell epitope are associated with conformational changes [Stirk et al., 1992; Paulij et al., 1999; Bauer et al., 2002; Lin et al., 2013], so their appearance in these epitopes may lead to vaccine escape mutants, diagnosis failure and perhaps immune tolerance resulting chronic infection. Related to changes within T-cell epitope (aa 11–33) could be responsible of the chronic state of the patients. In this study, a higher number of mutations in the HBV strains were detected within B-cell and T-cell epitopes on the surface antigen compared to the RT domain. HBV is a DNA virus, its replication is by reverse transcription through a pgRNA and a RT RNA/DNA polymerase unable to correct miss-incorporations during the DNA synthesis, conducing changes in the open reading frames (ORF) that can affect the amino acid sequence. In spite that the RT domain of the viral polymerase overlaps completely with the surface antigen, the ORF of the latter was most affected in the number of amino acid changes, since more mutants and polymorphic sites were identified in the HBsAg compared to the number of amino acid changes in the RT domain. Nevertheless, maintenance of the replicative capacity of the virus is a primordial event for the viral life cycle; this could be one explanation why the number in amino acid changes is lesser in the RT domain compared to the HBsAg. All patients were chronic carriers, twelve of them had mutants preferentially on B-cell and T-cell
RT and HBsAg Mutations in HBV Genotype H
epitopes from the HBsAg; probably, these mutants emerged in response to the immune pressure directed by the host. Scarce amino acid changes were observed on T-cell epitopes in the RT region, future in vitro studies are important to analyze these mutants and the biological effect in patients preferentially infected with genotype H. HBV polymerase is the largest protein of HBV and immunogenicity has been demonstrated at the level of T-cells in patients with selflimited hepatitis B [Rehermann et al., 1995; Maini et al., 1999], the polymerase is a target for the cellular immune response in acute infection due to the high content of T-cell epitopes and it is important for viral clearance [Mizukoshi et al., 2004], perhaps mutations into T and B-cell epitopes of viral polymerase may cause immune tolerance and escape from immune surveillance. Because of the cross sectional nature of this study, there is no information of either the initial or subsequent response to NAs, or the evolution of mutations in epitopes on HBsAg and polymerase. This variability issue must be studied using in vitro systems to rule out all possible implications from the theoretical point of view that the amino acid changes identified imply. In some areas from Mexico it seems that the HBV endemicity is decreasing, probably that is the reason of the scarce number of HBV-positive samples collected; also, the lack of health insurances in the majority of Mexican population complicates clinical protocols carry out to study the evolution of the most prevalent genotype in our country (genotype H) in treated patients. Following of many HBV-infected people is complicated and therefore, lost, by absence of opportunity to be appropriately treated. Another reason accounting for the scarce number of samples collected is that HBV genotype H and the genetic factors from Mexican population favor clearance of the virus in most of them, reducing virus transmission and appearance of new cases. Regardless, it is very important to increase the number of studies searching for infected people with HBV in high-risk groups where usually people do not attend hospitals in a regular fashion. ACKNOWLEDGMENTS We acknowledge Citlali Ortega for her kind help with the technical assistance in the sequencing running of the samples. The assistance of Dr. Miguel Angel Jime´nez Lue´vano, Dr. Rau´l Pe´rez-Gomez, and Dr. Arturo Rodrı´guez-Toledo is greatly appreciated. In the same way, help from Dr. Daniel Ruı´z-Romero, to obtain clinical information and Dr. Sara Sixtos is recognized. REFERENCES Amini-Bavil-Olyaee S, Herbers U, Mohebbi SR, Sabahi F, Zali MR, Luedde T, Trautwein C, Tacke F. 2009. Prevalence, viral replication efficiency and antiviral drug susceptibility of rtQ215
7 polymerase mutations within the hepatitis B virus genome. J Hepatol 51:647–654. Ashton-Rickardt PG, Murray K. 1989. Mutants of the Hepatitis B virus surface antigen that define some antigenically essential residues in the immunodominant ’a’ region. J Med Virol 29: 196–203. Bauer T, Weinberger K, Jilg W. 2002. Variants of two major T cell epitopes within the hepatitis B surface antigen are not recognized by specific T helper cells of vaccinated individuals. Hepatology 35:455–465. Carman W, Zanetti AR, Karayiannis P, Waters JA, Manzillo G, Tanzi E, Zuckerman AJ, Thomas HC. 1990. Vaccine-induced escape mutant of hepatitis B virus. Lancet 336:325–329. Chen WN, Oon CHJ, Toh I. 2000. Altered antigenicities of Hepatitis B virus surface antigen carrying mutations outside the common “a” determinant. Am J Gastroenterol 95:1098–1099. Chiou HL, Lee TH, Kao J, Mau YC, Ho MS. 1997. Altered antigenicity of “a” determinant variants of hepatitis B virus. J Genl Virol 78:2639–2645. Cooreman MP, Leroux-Roles G, Paulij WP. 2001. Vaccine-and hepatitis B immune globulin-induced escape mutations of hepatitis B virus surface antigen. J Biomed Sci 8:237–247. Das K, Xiong X, Yang H, Westland CE, Gibbs CS, Sarafianos SG, Arnold E. 2001. Molecular modeling and biochemical characterization reveal the mechanism of hepatitis B virus polymerase resistance to lamivudine (3TC) and emtricitabine (FTC). J Virol 75:4771–4779. Delaney WE, Yang H, Westland CE, Das K, Arnold E, Gibbs CS, Miller MD, Xiong S. 2003. The hepatitis B virus polymerase mutation rtV173L is selected during lamivudine therapy and enhances viral replication in vitro. J Virol 77:11833–11841. Feeney E, Fanning LJ, Horgan M. 2007. Baseline genotypic resistance in untreated hepatitis B virus infection. Gastroenterology 132:35A. Fung SK, Chae HB, Fontana RJ, Conjeevaram H, Marrero J, Oberhelman K, Hussain M, Lok AS. 2006. Virologic response and resistance to adefovir in patients with chronic hepatitis B. J Hepatol 44:283–290. Fung SK, Lok AS. 2004. Hepatitis B virus genotypes: do they play a role in the outcome of HBV infection. Hepatology 40:790–792. Ghany M, Liang TJ. 2007. Drug targets and molecular mechanisms of drug resistance in Chronic Hepatitis B. Gastroenterology 132:1574–1585. Hongthanakorn C, Chotiyaputta W, Oberhelman K, Fontana RJ, Marrero JA, Licari T, Lok AS. 2011. Virological breakthrough and resistance in patients with chronic hepatitis B receiving nucleos(t) ide analogues in clinical practice. Hepatology 53:1854–1863. Hoofnagle JH, di Bisceglie AM. 1997. The treatment of chronic viral hepatitis. N Engl Med 336:347–356. Lin YM, Jow GM, Mu SC, Chen BF. 2013. Naturally occurring hepatitis B virus B-Cell and T-Cell epitope mutants in hepatitis B vaccinated children. ScientificWorldJournal 2013:571875. Lok AS-F. 2007. Navigating the maze of hepatitis B treatments. Gastroenterology 132:1586–1594. Maini MK, Boni C, Ogg GS, King As, Reignat S, Lee CK, Larrubia JR, Webster GJ, McMichael AJ, Ferrari C, Williams R, Vergani D, Bertoletti A. 1999. Direct ex vivo analysis of hepatitis B virus-specific CD8-T cells associated with the control of infection. Gastroenterology 117:1386–1396. Marcellin P, Asselah T. 2005. Resistance to adefovir: A new challenge in the treatment of chronic hepatitis B. J Hepatol 43:920–923. Margeridon-Thermet S, Shulman NS, Ahmed A, Shahriar R, Liu T, Wang C, Holmes SP, Babrzadeh F, Gharizadeh B, Hanczaruk B, Simen BB, Egholm M, Shafer RW. 2009. Ultra-deep pyrosequencing of hepatitis B virus quasispecies from nucleoside and nucleotide reverse-transcriptase inhibitor (NRTI)-treated patients and NRTI-naive patients. J Infect Dis 199:1275–1285. Mata Marı´n, Arroyo JA, Anduiza CI, Caldero n GM, Cazares Rodrı´guez, Fuentes Allen, Arias Flores, Gayta´n Martı´nez. 2012. Prevalence and resistance pattern of genotype G and H in chronic hepatitis B and HIV co-infected patients in Mexico. Annals of Hepatology 11:47–51. Mizukoshi E, Sidney J, Livingston B, Ghany M, Hoofnagle JH, Sette A, Rehermann B. 2004. Cellular immune responses to the hepatitis B virus polymerase. J Immunol 173:5863–5871.
J. Med. Virol. DOI 10.1002/jmv
8 Nguyen MH, Garcia RT, Trinh HN, Nguyen HA, Nguyen KK, Nguyen LH, Levitt B. 2009. Prevalence of hepatitis B virus DNA polymerase mutations in treatment-naı¨ve patients with chronic hepatitis B. Aliment Pharmacol Ther 30:1150–1158. Oon CJ, Lim GK, Ye Z, Goh KT, Tan KL, Yo SL, Hopes E, Harrison TJ, Suckerman AJ. 1995. Molecular epidemiology of hepatitis B virus vaccine variants in Singapore. Vaccine 13: 699–702. Ott JJ, Stevens GA, Groeger J, Wiersma ST. 2012. Global epidemiology of hepatitis B virus infection: new estimates of age-specific HBsAg seroprevalence and endemicity. Vaccine 30:2212–2219. Pastor R, Habersetzer F, Fafi-Kremer S, Doffoel M, Baumert TF, Gut JP, Stoll-Keller F, Schvoerer E. 2009. Hepatitis B virus mutations potentially conferring adefovir/tenofovir resistance in treatment-naive patients. World J Gastroenterol 15:753–755. Paulij WP, DeWit PL, Su¨nnen CM, van Roosmalen MH, Petersenvan Ettekoven, Cooreman A, Heijtink MP. 1999. Localization of a unique hepatitis B virus epitope sheds new light on the structure of hepatitis B virus surface antigen. J Gen Virol 80:2121–2126. Rehermann B, Fowler P, Sidney J, Person J, Redeker A, Brown M, Moss B, Sette A, Chisari FV. 1995. The cytotoxic T lymphocyte response to multiple hepatitis B virus polymerase epitopes during and after acute viral hepatitis. J Exp Med 181: 1047–1058. Sa´nchez LV, Maldonado M, Bastidas-Ramı´rez BE, Norder H, Panduro A. 2002. Genotypes and S-gene variability of Mexican hepatitis B virus strains. J Med Virol 68:24–32. Sa´nchez LV, Tanaka Y, Maldonado M, Mizokami M, Panduro A. 2007. Difference of hepatitis B virus genotype distribution in two groups of Mexican patients with different risk factors. High prevalence of genotype H and G. Intervirology 50:9–15. Schaefer S. 2007. Hepatitis B virus taxonomy and hepatitis B virus genotypes. World J Gastroenterol 13:14–21. Shen ZY, Wei-Ping Z, Yong-Lin D, Hong-Li S. 2012. Variations in the S and P regions of the hepatitis B virus genome under immunosuppression in vitro and in vivo. Viral Immunol 25: 368–378.
J. Med. Virol. DOI 10.1002/jmv
Ferna´ndez-Galindo et al. Shin-I T, Tanaka Y, Tateno Y, Mizokami M. 2008. Development and public release of a comprehensive hepatitis virus database. Hepatol Res 38:234–243. Silva AC, Spina AM, Lemos MF, Oba IT, guastini CdeF, GomesGouvea MS, Pinho JR, Mendes-Correa MC. 2010. Hepatitis B genotype G and high frequency of lamivudine-resistance mutations among human immunodeficiency virus/hepatitis B virus coinfected patients in Brazil. Mem Inst Oswaldo Cruz 105:770–778. Song IH, Kim SM, Choo YK. 2013. Risk prediction of hepatitis B virus-related hepatocellular carcinoma in the era of antiviral therapy. W J Gastroenterol 19:8867–8872. Stirk HJ, Thornton JM, Howard CR. 1992. A topological model for hepatitis B surface antigen. Intervirology 33:148–158. Szmuness W. 1978. Prog Med Virol Hepatocellular carcinoma and the hepatitis B virus: Evidence for a causal association. 24:40–69. Tan Y, Ding K, Su J, Trinh X, Peng Z, Gong Y, Chen L, Cui Q, Lei N, Chen X, Yu R. 2012. The naturally occurring YMDD mutation among patients chronically infected HBV and untreated with Lamivudine: A systematic review and meta-analysis. PLoS One 7:32789e. Tatematsu K, Tanaka Y, Kurbanov F, Sugauchi F, Mano S, Maeshiro T, Nakayoshi T, Wakuta M, Miyakawa Y, Mizokami M. 2009. A genetic variant of hepatitis B virus divergent from known human and ape genotypes isolated from a Japanese patient and provisionally assigned to new genotype J. J Virol 83:10538–10547. Tenney DJ, Levine SM, Rose RE, Walsh AW, Weinheimer SP, Discotto L, Plym M, Pokomowwski K, Yu CF, Angus P, Ayres A, Bartholomeusz A, Sievert W, Thompson G, Warmer N, Locarnini S, Colonno RJ. 2004. Clinical emergence of entecavirresistant hepatitis B virus requires additional substitutions in virus already resistant to lamivudine. Antimicrob Agents Chemother 48:3498–3507. Weinberger KM, Bauer T, Bo¨hm S, Jilg W. 2000. High genetic variability of the group-specific a-determinant of hepatitis B virus surface antigen (HBsAg) and the corresponding fragment of the viral polymerase in chronic virus carriers lacking detectable HBsAg in serum. J Gen Virol 81:1165–1174.
